Compositions and methods for modulating stem cells and uses thereof
10828346 ยท 2020-11-10
Assignee
Inventors
Cpc classification
C12N5/0658
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C12N15/111
CHEMISTRY; METALLURGY
A61P21/00
HUMAN NECESSITIES
A61K35/34
HUMAN NECESSITIES
A61K35/545
HUMAN NECESSITIES
International classification
C12N5/00
CHEMISTRY; METALLURGY
A61K35/545
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
G01N33/50
PHYSICS
C12N15/113
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
Abstract
There are provided compositions and methods for modulating stem cell division decisions, in particular, division symmetry. It has been demonstrated that wnt7a acts through frizzled-7 receptor expressed on the surface of adult stem cells, e.g. satellite stem cells, to activate the planar cell polarity (PCP) pathway, thereby promoting symmetrical expansion of stem cells. The compositions and methods of the invention are useful, for example, in modulating stem cell division symmetry in vitro and in vivo, in replenishing and expanding the stem cell pool, and in promoting the formation, maintenance, repair and regeneration of tissue.
Claims
1. A method for stimulating division symmetry of isolated satellite stem cells comprising contacting isolated satellite stem cells with a composition comprising as an active agent a polynucleotide encoding a Wnt7a polypeptide or an active variant thereof having at least 95% identity to SEQ ID NO:2 or SEQ ID NO:4 and capable of binding to and activating Fzd7.
2. A method for expanding a population of satellite stem cells comprising isolating satellite stem cells and contacting the stem cells with an effective amount of a composition comprising a polynucleotide encoding a Wnt7a polypeptide or an active variant thereof having at least 95% identity to SEQ ID NO:2 or SEQ ID NO:4 and capable of binding to and activating Fzd7.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) Embodiments of the present invention will now be described, by way of example only, with reference to the attached Figures, wherein:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11) (A) Representative histology of regenerated TA muscles of 3-month old mice, 8 days following electrotransfer-induced injury. Regenerated myofibers show centrally-located nuclei. Bar is 25 m. (B) Representative cryosections of TA muscles 3 weeks following electroporation with CMV-Wnt7a plasmid exhibit accelerated regeneration as evidenced by increased mass, and number and caliber of fibers. Electroporation with CMV-Wnt3a resulted in malformed muscle with abnormal accumulation of matrix. The basal lamina of myofibers was detected by Laminin 2 chain immunostaining. Bars are 200 m. (C) Quantification of muscle fiber caliber in TA muscles electroporated with either saline or a Wnt7a/Wnt3a expression plasmids, as compared to contralateral leg, 3 weeks after electroporation (n=4, *p0.008). Wnt7a and Wnt3a have divergent effects on myofiber caliber. (D) Quantification of muscle fiber number in TA muscles electroporated with either saline or a Wnt7a/Wnt3a expression plasmids, as compared to contralateral leg, 3 weeks after electroporation (n=4, *p0.03). Errors bars represent SEM.
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
DETAILED DESCRIPTION
(35) Generally, the present invention provides compositions and methods for modulating stem cells, in particular, adult stem cells. More particularly, the present invention provides compositions and methods for modulating stem cell division decisions.
(36) Various uses of the compositions and methods described herein are also provided, including therapeutic uses, for example, for promoting tissue formation, regeneration, repair or maintenance.
(37) The following description details various aspects and embodiments of the invention as contemplated by the inventors. It is understood that the scope of the invention is not limited to the exemplary embodiments described herein.
(38) It has now been demonstrated that activation of the planar cell polarity (PCP) pathway in stem cells, e.g. adult stem cells, promotes symmetrical stem cell division. Symmetrical division gives rise to two daughter cells and results in expansion of the stem cell pool. Conversely, inhibition of PCP signaling in stem cells inhibits symmetrical division, resulting in an increase in asymmetrical (apical-basal) cell division, which does not expand the stem cell pool. Interestingly, promotion of symmetrical stem cell division via activation the PCP pathway had no effect on the rate of cell division.
(39) It has now been demonstrated that Wnt7a, acting via the Frizzled7 (Fzd7) receptor, activates of PCP signaling in adult stem cells, e.g. satellite stem cells. Satellite stem cells are adult stem cells that give rise to muscle cells. It has further been demonstrated that inhibition of receptor or effector molecules in the PCP pathway, e.g. Fzd7 or Vangl2, abrogated the effects of Wnt7a. It has further been demonstrated administration of Wnt7a polypeptide, or a polynucleotide encoding a Wnt7a polypeptide, significantly increased satellite stem cell numbers in vitro and in vivo, and promoted tissue formation in vivo, leading to enhanced repair and regeneration in injured and diseased muscle tissue.
(40) Thus, Wnt7a, Fzd7 and other components of the PCP signaling pathway are novel targets for modulation of stem cell division decisions, and promotion of tissue formation, regeneration, maintenance and repair.
Definitions
(41) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
(42) The term stem cell, as used herein, refers to an undifferentiated cell that is capable of differentiating into a number of final, differentiated cell types. Different stem cells may have different potency. While the definitions below reflect current understanding, our knowledge and understanding of stem cells is constantly evolving. Totipotent stem cells typically have the capacity to develop into any cell type and are usually embryonic in origin. Pluripotent stem cells are typically cells in a stem cell line capable of differentiating into several differentiated cell types. Multipotent stem cells can differentiate into a number of cells, but only those of a closely related family. Unipotent stem cells can produce only one cell type, their own, but have the property of self-renewal which distinguishes them from non-stem cells. A muscle stem cell is an example of stem cell that is traditionally thought to be unipotent, giving rise to muscle cells only.
(43) An adult stem cell is a stem cell found in a developed organism. Adult stem cells include, but are not limited to, hematopoietic stem cells, mesenchymal stem cells, neural stem cells, endothelial stem cells and muscle stem cells.
(44) A satellite stem cell is an example of an adult stem cell that gives rise to muscle cells.
(45) The term progenitor cell, as used herein, refers to a cell that is committed to a particular cell lineage and which gives rise to cells of this lineage by a limited series of cell divisions. A myoblast is an example of a progenitor cell, which is capable of differentiation to only one type of cell, but is itself not fully mature or fully differentiated.
(46) The term symmetrical division, as used herein in reference to stem cells, refers to a cell division that increases the number of cells of the same type. The term planar division may also be used. Symmetrical stem cell division gives rise to two daughter stem cells, thereby expanding the stem cell pool. The term expansion therefore refers to an increase in the number of a cells of a particular type as a result of symmetrical division.
(47) The term asymmetrical division, as used herein in reference to stem cells, refers to a cell division that gives rise to one daughter stem cell and one progenitor cell, with no increase in stem cell number. The term apical-basal division may also be used.
(48) By promoting, enhancing or increasing symmetrical stem cell division, it is meant that the ratio of symmetrical to asymmetrical cell division is increased compared to normal or control, e.g. the ratio in the absence of a particular active agent, composition or treatment method. For example, the ratio of symmetrical to asymmetrical cell division may be increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, or even greater.
(49) The term differentiation, as used herein, refers to a developmental process whereby cells become specialized for a particular function, for example, where cells acquire one or more morphological characteristics and/or functions different from that of the initial cell type. The term differentiation includes both lineage commitment and terminal differentiation processes. States of undifferentiation or differentiation may be assessed, for example, by assessing or monitoring the presence or absence of biomarkers using immunohistochemistry or other procedures known to a person skilled in the art.
(50) The term lineage commitment, as used herein, refers to the process in which a stem cell becomes committed to forming a particular limited range of differentiated cell types. Lineage commitment arises, for example, when a stem cell gives rise to a progenitor cell during apical-basal division. Committed progenitor cells are often capable of self-renewal or cell division.
(51) The term terminal differentiation, as used herein, refers to the final differentiation of a cell into a mature, fully differentiated cell. Usually, terminal differentiation is associated with withdrawal from the cell cycle and cessation of proliferation.
(52) The term Wnt refers to a family of related genes and proteins. The Wnt genes encode over twenty cysteine-rich, secreted, Wnt proteins (glycoproteins) that act by binding to Frizzled (Fzd) receptors on target cells. A number of Wnt polypeptides are known in the art, including the human Wnts: Wnt 1, Wnt 2, Wnt 3, Wnt 4, Wnt 5a, Wnt 5b, Wnt 7a and Wnt 7b, and the mouse Wnts: Wnt 1, Wnt 2, Wnt 3a, Wnt 3b, Wnt 4, Wnt 5a, Wnt 5b, Wnt 6, Wnt 7a, Wnt 7b, Wnt 8a, Wnt 8b, Wnt lea, Wnt 10b, Wnt 11 and Wnt 12. Homologues from other species are also known and accessible to a person skilled in the art. Members of the Wnt family demonstrate marked evolutionary conversation and thus a high degree of homology is observed between species.
(53) Frizzled (Fzd) receptors are a family of G-protein coupled receptor proteins to which Wnt molecules are known to bind. Sequences of various Fzd receptors are available to those skilled in the art. Fzd7 is shown herein to be expressed on satellite stem cells. Other stem cells that express Fzd7 include hESC and NSC.
(54) Binding of different members of the Wnt family to certain members of the Fzd family on specific cells can initiate signaling by one of several distinct pathways, including canonical and non-canonical Wnt signaling pathways.
(55) In the termed canonical pathway, activation of the signaling molecule, Disheveled leads to the inactivation of glycogen synthase kinase-3 (GSK-3), a cytoplasmic serine-threonine kinase. The GSK-3 target, -catenin, is thereby stabilized and translocates to the nucleus where it activates TCF (T-cell-factor)-dependant transcription of specific promoters. This pathway is also described as the Wnt/-catenin pathway herein. Canonical Wnt-signaling plays a well-documented role in regulating myogenic growth and differentiation.
(56) In the termed non-canonical Wnt signaling pathway, also referred to as the planar cell polarity (PCP) pathway, binding of Wnt to Fzd also activates Disheveled (Dvl), which in this case activates RhoA, a small g protein, triggering a cascade that is unique from the canonical pathway. For example, in contrast to the canonical pathway, activation or stimulation of the PCP pathway does not result in nuclear translocation of -catenin.
(57) As used herein, effector molecule refers to a post-receptor signaling molecule, also referred to as a downstream effector molecule. Effector molecules may include, for example, cytosolic signaling molecules or nuclear signaling molecules and transcription factors, or molecules in a cell membrane, such as receptors or co-receptors. Effectors may include, for example, proteins, polynucleotides and peptides. Exemplary effector molecules in the PCP pathway include Celsr1, Celsr2, Celsr3, Dvl1, Dvl2, Dvl3, Pk1, Pk2, Pk3, Pk4, Rac/RhoA, Vangl1, Vangl2, Syndecan 4 (Syn4) and 7-1-integrin.
(58) In the context of a signaling pathway, activation may include one or more of, e.g. changes in phosphorylation, conformation, polarization, localization or distribution of a molecule within the cell or cell membrane. Activation may occur directly via activation, stimulation or upregulation of an activating component of a signaling pathway, or may occur indirectly by inhibiting an inhibitory component. The converse is also true where inhibition may occur directly or indirectly.
(59) The term modulator, as used herein, refers to both activators and inhibitors of a signaling event or pathway, for example, modulators of the Wnt7a signaling pathway. A modulator of the Wnt7a signaling pathway may be a compound or molecule that stimulates or inhibits the activity or expression of a Wnt7a polypeptide, or an upstream (activator) or downstream (effector) molecule in the Wnt7a signaling pathway, including modulators of the Frizzled7 (Fzd7) receptor. Candidate modulators of the Wnt7a signaling pathway may stimulate or inhibit the activity of a Wnt7a polypeptide directly or indirectly. Direct modulators may act on a Wnt7a polypeptide, or a gene encoding a Wnt7a polypeptide, whereas indirect modulators may act on one or more proteins, or genes encoding proteins, that act upstream (activators) or downstream (effectors) of a Wnt7a polypeptide in the Wnt7a signaling pathway. A modulator can act at a genetic level, for example to upregulate or downregulate the expression of a gene encoding a Wnt7a polypeptide or an activator or effector of Wnt7a signaling, or at the protein level to interfere with the activity of a Wnt7a polypeptide or an activator or effector of Wnt7a signaling. Modulators may themselves be Wnt polypeptides, or active fragments, derivatives or variants thereof. A modulator can be, for example, a polypeptide, peptide, polynucleotide, oligonucleotide, antibody or antibody fragment, or a small molecule activator or inhibitor. Small molecule modulators can be organic or inorganic.
(60) A stem cell modulator is a modulator that activates or inhibits a function of a stem cell. For example, a stem cell modulator may modify stem cell division, proliferation, differentiation, or survival. For example, Wnt7a, is a modulator of stem cell division decisions.
(61) The term Wnt7a signaling pathway, as used herein in reference to stem cells, refers to the Wnt7a-Fzd7 signaling pathway in adult stem cells, e.g. satellite stem cells, which was shown to activate PCP signaling. Wnt7a signaling was shown to induce polarized distribution of Vangl2 and 7-integrin, two known effector molecules in the PCP pathway, thereby promoting symmetrical stem cell division. Thus, the Wnt7a signaling pathway referred to herein is the PCP signaling pathway. In certain other cell types, Wnt7a may activate other Wnt signaling pathway.
(62) Component members of the Wnt7a signaling pathway demonstrate marked evolutionary conservation, e.g. in vertebrates and mammals. Human and mouse Wnt7A proteins share about 98% sequence identity, while corresponding Fzd7 homologues are about 96% identical and Vangl2 homologues are about 99% identical. Such high degree of homology often results in cross-species activity. For instance, it has been demonstrated herein that human Wnt7a is active in the mouse system (Example 2). Therefore, experimental findings can often be extrapolated across species.
(63) The terms protein, polypeptide, and peptide, as used herein, refer to a sequence of amino acid residues linked together by peptide bonds or modified peptide bonds. Typically, a polypeptide is at least six amino acids long and a peptide is at least 3 amino acids long. The polypeptide or peptide can be naturally occurring, recombinant, synthetic, or a combination of these. The polypeptide or peptide can be a fragment of a naturally occurring protein or polypeptide. The terms polypeptide and peptide also encompass analogues, derivatives and peptidomimetic compounds. Such compounds are well known in the art and may have significant advantages over naturally occurring peptides, including, for example, greater chemical stability, increased resistance to proteolytic degradation, enhanced pharmacological properties (such as, half-life, absorption, potency and efficacy), altered specificity (for example, a broad-spectrum of biological activities) or reduced antigenicity.
(64) Specific proteins or polypeptides (e.g. Wnt7a, Fzd7 or Vangl2, etc.) referred to herein encompass proteins and polypeptides having amino acid sequences corresponding to naturally occurring sequences, as well as variant or homologous polypeptide sequences, fragments and derivatives having an activity at least substantially identical to a wild-type protein. Likewise, specific genes (e.g. Wnt7a, Fzd7 or Vangl2, etc.) encompass nucleic acid sequences or partial sequences encoding proteins having a polypeptide sequence corresponding to naturally occurring sequences as well as variant or homologous polypeptide sequences, fragments, analogies and derivatives having an activity at least substantially identical to a wild-type protein. Polypeptides, including variants, fragments, analogues and derivatives thereof, having an increased activity compared to wild-type polypeptides are also contemplated.
(65) A functional activity, as used herein in reference to a polypeptide or gene or portion thereof, refers to a polypeptide, gene or portion thereof that displays one or more activities associated with a naturally-occurring protein or gene. Functional activity in regard to a polypeptide or portion thereof may include, for example, the ability to specifically bind to and/or activate a receptor or ligand for the polypeptide.
(66) Naturally occurring, as used herein in reference to an object, indicates that the object can be found in nature. For example, a naturally occurring polypeptide or polynucleotide sequence would be one that is present in an organism, and can be isolated from the organism, and which has not been intentionally modified by man in the laboratory. The term wild-type is often used interchangeably with naturally occurring.
(67) In the context of the present invention, a polypeptide, or fragment, variant, analogue or derivative thereof, is considered to have at least substantially the same activity as the wild-type protein when it exhibits about 50% of the activity of the wild-type protein, preferably at least 60%, 75%, or 80% of the activity of the wild-type protein. In preferred embodiments, the polypeptide, variant, fragment analogue or derivative exhibits at least about 85% of the activity of the wild-type protein, e.g. 88%, 90%, 95%, 99%, 100%. In certain embodiments, an activity greater than wild-type activity may be achieved. Activity of a Wnt7a polypeptide, variant, fragment, analogue or derivative can, for example, be determined by measuring its ability to promote symmetrical stem cell expansion and comparing to a wild-type protein. Methods of measuring and characterizing stem cell division are known in the art.
(68) A fragment of a polypeptide includes, but is not limited to, an amino acid sequence wherein one or more amino acids are deleted in comparison to the wild-type sequence or another reference sequence. For example, but not to be considered limiting, a fragment exists when one or more amino acids from the amino terminal, carboxy terminal or both are removed. Further, one or more amino acids internal to the polypeptide may be deleted. Active fragments are fragments that retain functional characteristics, e.g. of the native sequence or other reference sequence. Typically, active fragments are fragments that retain substantially the same activity as the wild-type protein. A fragment may, for example, contain a functionally important domain, such as a domain that is important for receptor or ligand binding.
(69) A variant polypeptide or variant fragment is one in which one or more amino acid residues have been deleted, added, or substituted for those that appear in the amino acid sequence of a wild-type sequence or another reference sequence. In the context of the present invention, a variant preferably retains substantially the same activity as the wild-type sequence or other reference sequence, or has better activity than the wild type protein.
(70) A variant may contain one or more amino acid substitutions, which may be conservative or non-conservative substitutions. As is known in the art, the twenty naturally occurring amino acids can be grouped according to the physicochemical properties of their side chains. Suitable groupings include alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine and tryptophan (hydrophobic side chains); glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine (polar, uncharged side chains); aspartic acid and glutamic acid (acidic side chains) and lysine, arginine and histidine (basic side chains). Another grouping of amino acids is phenylalanine, tryptophan, and tyrosine (aromatic side chains). A conservative substitution involves the substitution of an amino acid with another amino acid from the same group, while a non-conservative substitution involves the substitution of an amino acid with another amino acid from a different group.
(71) Typically, variant amino acid sequences comprise greater than about 70%, more preferably greater than about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the wild-type or reference sequence. The degree of identity may also be represented by a range defined by any two of the values listed above or any value therein between. Variants include mutants, in which the reference sequence is the wild-type sequence.
(72) A derivative is a peptide or polynucleotide containing additional chemical or biochemical moieties not normally a part of a naturally occurring molecule. Peptide derivatives include peptides in which one or more amino acid side chain and/or the amino-terminus and/or the carboxy-terminus has been derivatized with a suitable chemical substituent group, as well as cyclic peptides, dual peptides, multimers of the peptides, peptides fused to other proteins or carriers glycosylated peptides, phosphorylated peptides, peptides conjugated to lipophilic moieties (for example, caproyl, lauryl, stearoyl moieties) and peptides conjugated to an antibody or other biological ligand. Examples of chemical substituent groups that may be used to derivatize a peptide include, but are not limited to, alkyl, cycloalkyl and aryl groups; acyl groups, including alkanoyl and aroyl groups; esters; amides; halogens; hydroxyls; carbamyls, and the like. The substituent group may also be a blocking group such as Fmoc (fluorenylmethyl-OCO), carbobenzoxy(benzyl-CO), monomethoxysuccinyl naphthyl-NHCO, acetylamino-caproyl and adamantyl-NHCO. Other derivatives include C-terminal hydroxymethyl derivatives, 0-modified derivatives (for example, C-terminal hydroxymethyl benzyl ether) and N-terminally modified derivatives including substituted amides such as alkylamides and hydrazides.
(73) An analogue is a polypeptide or peptide comprising one or more non-naturally occurring amino acids. As is known in the art, substitution of all D-amino acids for all L-amino acids within a peptide can result in an inverse peptide, or in a retro-inverso peptide (see Goodman et al. Perspectives in Peptide Chemistry pp. 283-294 (1981); U.S. Pat. No. 4,544,752), both of which are considered to be analogues in the context of the present invention. An inverse peptide is one in which all L-amino acids of a sequence have been replaced with D-amino acids, and a retro-inverso peptide is one in which the sequence of the amino acids has been reversed (retro) and all L-amino acids have been replaced with D-amino acids.
(74) Peptidomimetics are compounds that are structurally similar to peptides and contain chemical moieties that mimic the function of the polypeptide or peptide of the invention. For example, if a polypeptide contains two charged chemical moieties having functional activity, a mimetic places two charged chemical moieties in a spatial orientation and constrained structure so that the charged chemical function is maintained in three-dimensional space. The term peptidomimetic thus is intended to include isosteres. The term isostere refers to a chemical structure that can be substituted for a polypeptide or peptide because the steric conformation of the chemical structure is similar to that of the peptide or polypeptide, for example, the structure fits a binding site specific for the polypeptide or peptide.
(75) One skilled in the art will appreciate that not all amino acids in a peptide or polypeptide need be modified. Similarly not all amino acids need be modified in the same way. Peptide derivatives, analogues and peptidomimetics of the present invention include chimeric molecules which contain two or more chemically distinct regions, each region comprising at least one amino acid or modified version thereof.
(76) A Wnt7a polypeptide, as used herein, encompasses a Wnt 7a protein having a polypeptide sequence corresponding to a wild-type Wnt7a sequence, or having a sequence that is at least about as 70%, more preferably about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or about 100%, identical to a naturally occurring Wnt7a sequence. Identity may be assessed over at least about 50, 100, 200, 300, or more contiguous amino acids, or may be assessed over the full length of the sequence. Methods for determining % identity or % homology are known in the art and any suitable method may be employed for this purpose. Wnt7a polypeptides also include variants, fragments, analogues and derivatives having an activity substantially identical to a wild-type Wnt7a polypeptide, e.g. binding to Fzd7. U.S. Pat. No. 6,297,030 describes Wnt7a polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques. Exemplary Wnt7A polypeptides include polypeptides comprising the amino acid sequence shown in SEQ ID NO: 2 (mouse) or SEQ ID NO: 4 (human), as well as active fragments, variants or derivatives thereof.
(77) The polypeptides of the present invention can be prepared by methods known in the art, such as purification from cell extracts or the use of recombinant techniques. Polypeptides as described herein will preferably involve purified or isolated polypeptide preparations. In certain embodiments, purification of the polypeptide may utilize recombinant expression methods well known in the art, and may involve the incorporation of an affinity tag into the expression construct to allow for affinity purification of the target polypeptide.
(78) Shorter sequences can also be chemically synthesized by methods known in the art including, but not limited to, exclusive solid phase synthesis, partial solid phase synthesis, fragment condensation or classical solution synthesis (Merrifeld (1963) Am. Chem. Soc. 85:2149; Merrifeld (1986) Science 232:341). The polypeptides of the present invention can be purified using standard techniques such as chromatography (e.g ion exchange, affinity, and sizing column chromatography or high performance liquid chromatography), centrifugation, differential solubility, or by other techniques familiar to a worker skilled in the art. The polypeptides can also be produced by recombinant techniques. Typically this involves transformation (including transfection, transduction, or infection) of a suitable host cell with an expression vector comprising a polynucleotide encoding the protein or polypeptide. The nucleic acid sequences for human and mouse wnt7a gene and various other components of the PCP signaling pathway are known in the art (see, for example, GenBank Accession Nos O00755, P24383, NP_004616, G36470, PF6706, P28047, H36470, NM_004625, M89801) and may be used as a basis for the polynucleotides of the invention.
(79) The polypeptides and peptides of the present invention can also be produced as fusion proteins. One use of such fusion proteins is to improve the purification or detection of the polypeptide or peptide. For example, a polypeptide or peptide can be fused to an immunoglobulin Fc domain and the resultant fusion protein can be readily purified using a protein A column. Other examples of fusion proteins include polypeptides or peptides fused to histidine tags (allowing for purification on Nie+ resin columns), to glutathione-S-transferase (allowing purification on glutathione columns) or to biotin (allowing purification on streptavidin columns or with streptavidin labelled19 magnetic beads). Once the fusion protein has been purified, the tag may be removed by site-specific cleavage using chemical or enzymatic methods known in the art.
(80) The term gene encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5 and 3 ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5 of the coding region and which are present on the mRNA are referred to as 5 non-translated sequences. The sequences which are located 3 or downstream of the coding region and which are present on the mRNA are referred to as 3 non-translated sequences. The term gene encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region termed exon or expressed regions or expressed sequences interrupted with non-coding sequences termed introns or intervening regions or intervening sequences. Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or spliced out from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. In addition to containing introns, genomic forms of a gene may also include sequences located on both the 5 and 3 end of the sequences that are present on the RNA transcript. These sequences are referred to as flanking sequences or regions (these flanking sequences are located 5 or 3 to the non-translated sequences present on the mRNA transcript). The 5 flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene. The 3 flanking region may contain sequences that direct the termination of transcription, posttranscriptional cleavage and polyadenylation.
(81) As used herein, the term polynucleotide sequence or nucleic acid sequence, refers to any nucleotide sequence (e.g., RNA or DNA), the manipulation of which may be deemed desirable for any reason (e.g., modulate cell function, treat disease, etc.), by one of ordinary skill in the art. Such nucleotide sequences include, but are not limited to, coding sequences of genes (e.g., reporter genes, selection marker genes, oncogenes, disease resistance genes, growth factors, etc.), and non-coding regulatory sequences which may not encode an mRNA (e.g., promoter sequence, polyadenylation sequence, termination sequence, enhancer sequence, etc.).
(82) The term oligonucleotide refers to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which, in turn, depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof.
(83) By the terms regulatory sequence, regulatory region, regulatory element it is meant a portion of nucleic acid typically, but not always, upstream of the protein or polypeptide coding region of a nucleotide sequence, which may be comprised of either DNA or RNA, or both DNA and RNA. When a regulatory region is active, and in operative association with a nucleotide sequence of interest, this may result in expression of the nucleotide sequence of interest. A regulatory element may be capable of mediating organ specificity, or controlling developmental or temporal nucleotide sequence activation. A regulatory region includes promoter elements, core promoter elements exhibiting a basal promoter activity, elements that are inducible in response to a stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers. Regulatory region, as used herein, also includes elements that are active following transcription, for example, regulatory elements that modulate nucleotide sequence expression such as translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located proximal to the coding region.
(84) The terms complementary and complementarity refer to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence A-G-T- is complementary to the sequence T-C-A. Complementarity may be partial, in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be complete or total complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.
(85) The term recombinant when made in reference to a nucleic acid molecule refers to a nucleic acid molecule that is comprised of segments of nucleic acid joined together by means of molecular biological techniques. The term recombinant when made in reference to a protein or a polypeptide refers to a protein molecule that is expressed using a recombinant nucleic acid molecule.
(86) The term isolated when used in relation to a polynucleotide, refers to a nucleic acid sequence that is identified and separated from at least one contaminant nucleic acid with which it is ordinarily associated in its natural source. Isolated nucleic acid molecule is present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids, such as DNA and RNA, are found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins. However, isolated nucleic acid molecule encoding a particular protein includes, by way of example, such nucleic acid in cells ordinarily expressing the protein, where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid may be present in single-stranded or double-stranded form. When an isolated nucleic acid is to be utilized to express a protein, the polynucleotide will contain at a minimum the sense or coding strand (i.e., the polynucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the polynucleotide may be double-stranded).
(87) The term purified refers to molecules, including nucleic or amino acid sequences that are removed from their natural environment isolated or separated. An isolated nucleic acid sequence is therefore a purified nucleic acid sequence. Substantially purified molecules are at least 60% free, at least 75% free, or typically at least 90%, 95% or 99% free from other components with which they are naturally associated. As used herein, the terms purified and to purify also refer to the removal of contaminants from a sample. The removal of contaminating molecules, including proteins, results in an increase in the percent of polypeptide of interest in the sample. In another example, recombinant polypeptides are expressed in bacteria, yeast, or mammalian host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.
(88) Nucleic acid sequences corresponding to genes or encoding polypeptides relating to the present invention can be readily purchased or purified from a suitable source by standard techniques, or can be synthesized chemically. The nucleic acids can be genomic DNA, RNA, cDNA prepared from isolated mRNA, or DNA amplified from a naturally occurring nucleic acid sequence by standard techniques. Alternatively, the known sequences may be used to prepare probes to obtain other nucleic acid sequences encoding a Wnt7a polypeptide from various sources using standard techniques. Suitable sources for obtaining the nucleic acids are those cells or tissues which are known to express the proteins of interest, such as skeletal muscle tissue and other tissues with measurable Wnt7a transcripts. An example of suitable cells would be myoblasts which express Wnt7a.
(89) Polynucleotides encoding fragments or variants of the naturally occurring Wnt7a proteins can be constructed by deletion, addition, and/or substitution of one or more nucleotides within the coding sequence using standard techniques, such as site-directed mutagenesis techniques.
(90) Specific initiation signals may be required for efficient translation of cloned polynucleotide. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire wild-type gene or cDNA, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, additional translational control signals may not be needed. In other cases, exogenous translational control signals, including, perhaps, the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements and/or transcription terminators (Bittner et al. (1987) Methods in Enzymol. 153, 516).
(91) In some instances, it may be desirable to link the coding sequence of a particular gene to an amino- or carboxyl-terminal epitope tag to facilitate detection or purification of expressed protein. Suitable epitope tags may include, but are not limited to, haemagluttanin (HA), myc, FLAG, 6X His, V5, glutathione-S-transferase (GST), etc.
(92) An expression vector, also known as an expression construct, is used to introduce a specific gene into a target cell. Once the expression vector is inside the cell, the protein that is encoded by the gene is produced by the cellular-transcription and translation machinery. The vector is frequently engineered to contain regulatory sequences that act as enhancer and promoter regions and lead to efficient transcription of the gene carried on the expression vector. The goal of a well-designed expression vector is the production of large amounts of stable messenger RNA.
(93) Suitable expression vectors include, but are not limited to, plasmids, phagemids, viral particles and vectors, phages and the like. The entire expression vector, or a part thereof, can be integrated into the host cell genome. In some circumstances, it is desirable to employ an inducible expression vector as are known in the art, e.g. the LACSWITCH Inducible Expression System (Stratagene, LaJolla, Calif.). Suitable expression vectors may comprise promoters for driving expression in a particular host cell. Some expression vectors may comprise a CMV promoter. The expression vectors may be, for example, pCMV or pCMV-Sport6.
(94) Those skilled in the field of molecular biology will understand that a wide variety of expression systems can be used to provide the recombinant polypeptide or peptide. The polypeptide or peptide can be produced in a prokaryotic host (e.g., E. cold or B. subtilis) or in a eukaryotic host (e.g., Saccharomyces or Pichia; mammalian cells, such as COS, NIH 3T3, CHO, BHK, 293, or HeLa cells, insect cells, or plant cells). The methods of transformation or transfection and the choice of expression vector will depend on the host system selected and can be readily determined by one skilled in the art. Transformation and transfection methods are described, for example, in Ausubel et al. (1994) CurrentProtocols in Molecular Biology, John Wiley & Sons, New York; and various expression vectors may be chosen from those provided, e.g. in Cloning Vectors: A Laboratory Manual (Ponwels et al., 1985, Supp. 1987) and by various commercial suppliers.
(95) In addition, a host cell may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in a specific, desired fashion. Such modifications (e.g. glycosylation) and processing (e.g. cleavage) of protein products may be important for the activity of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen by one skilled in the art to ensure the correct modification and processing of the expressed heterologous protein. The host cells harbouring the expression vehicle can be cultured in conventional nutrient media adapted as needed for activation of a chosen gene, repression of a chosen gene, selection of transformants, or amplification of a chosen gene according to known procedures.
(96) In the context of the present invention, oligonucleotide modulators are oligonucleotide-based inhibitors or activators that are targeted to one or more components of the Wnt7a-PCP signaling pathway genes, or genes encoding activators or effectors of the PCP pathway. Oligonucleotide modulators may, for example, include antisense oligonucleotides, short interfering RNA (siRNA) molecules, ribozymes and triple helix-forming oligonucleotides. RNA interference mediated by siRNAs is known in the art to play an important role in post-transcriptional gene silencing [Zamore, Nature Struc. Biol., 8:746-750 (2001)]. In nature, siRNA molecules are typically 21-22 base pairs in length and are generated when long double-stranded RNA molecules are cleaved by the action of an endogenous ribonuclease. Recently, it has been demonstrated that transfection of mammalian cells with synthetic siRNA molecules having a sequence identical to a portion of a target gene leads to a reduction in the mRNA levels of the target gene. For example, Vangl2 expression is inhibited with siRNA, which thereby inhibits symmetric cell division and results in an increase in asymmetric divisions. Oligonucleotide modulators can be prepared by conventional techniques well-known to those skilled in the art. For example, the oligonucleotides can be prepared using solid-phase synthesis using commercially available equipment, such as the equipment available from Applied Biosystems Canada Inc. (Mississauga, Canada). Alternatively, the oligonucleotide modulators can be prepared by enzymatic digestion and/or amplification of the naturally occurring target gene or mRNA, or of cDNA synthesized from the mRNA, using standard techniques known in the art. When the oligonucleotide inhibitors comprise RNA, they can be prepared by in vitro transcription methods also known in the art. As indicated above, siRNA molecules can also be conveniently prepared using commercially available in vitro transcription kits. Oligonucleotides can also be prepared using recombinant DNA techniques.
(97) As used herein, primer refers to an oligonucleotide containing two or more deoxyribonucleotides or ribonucleotides, typically more than three, from which synthesis of a primer extension product can be initiated. Experimental conditions conducive to synthesis include the presence of nucleoside triphosphates and an agent for polymerization and extension, such as DNA polymerase, and a suitable buffer, temperature and pH.
(98) With reference to the polypeptide and polynucleotide sequences defined herein, the term substantially identical in reference to sequence identity means at least 70%, preferably at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity. By identity is meant the number of conserved amino acids or nucleotides as determined by standard alignment algorithms or programs known in the art, used with default parameters established by each supplier. It will be understood that the degree of identity may be represented by a range defined by any two of the values listed above or any value therebetween. Identity may be assessed, for example, over at least about 50, 100, 200, 300, or more contiguous amino acids, or at least about 50, 100, 200, 300, 500, 750, 1000 or more nucleotides, or may be assessed over the full length of the sequence. The terms homology and identity are often used interchangeably. Methods for determining % identity or % homology are known in the art and any suitable method may be employed for this purpose. In general, sequences are aligned so that an optimized match is obtained. Examples of an algorithm that is suitable for determining percent sequence identity is algorithms such as the BLAST algorithm, as is well known to those skilled in the art. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). Other commercially or publicly available programs include the DNAStar MegAlign program (Madison, Wis.) and the University of Wisconsin Genetics Computer Group (UWG) Gap program (Madison Wis.).
(99) As used herein, the term at least 90% identical would refer to percent identities from 90 to 99.99% relative to a reference polynucleotide or polypeptide. Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polynucleotide or polypeptide length of 100 nucleotides or amino acids are compared, no more than 10% of the respective nucleotides or amino acids in the test polypeptide would differ from corresponding aligned positions of the reference nucleotides/polypeptides. Differences may be represented as point mutations randomly distributed over the entire length of an polynucleotide or amino acid sequence or may be clustered in one or more locations of varying length up to the maximum allowable, e.g. 10 of 100 nucleotide/amino acid differences for the above at least 90% identity example. Differences may be defined as nucleic acid or amino acid substitutions or deletions.
(100) Substantially identical nucleic acid molecules would hybridize typically at moderate stringency or at high stringency conditions along the length of the nucleic acid or along at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the full length nucleic acid molecule of interest. In the case of coding sequences, also contemplated are nucleic acid molecules that contain degenerate codons in place of codons in the hybridizing nucleic acid molecule.
(101) As used herein, domain refers to a portion of a molecule, e.g., polypeptide or the encoding polynucleotide, that is structurally and/or functionally distinct from other portions of the molecule. For example, Fzd7 comprises a putative cysteine-rich Wnt-binding domain comprising residues 45 to 169 of the polypeptide shown as SEQ ID NO: 6 (mouse) and SEQ ID NO: 8 (human). Based on homology exhibited between human/mouse Fzd7 and mouse Fzd8 and Fzd3 (for which crystal structures of the respective WNT-binding domain have been reported), residues 56, 58-60, and 62-64 of human/mouse Fzd7 may be particularly important for interaction with Wnt7a. As another example, the final four residues of each of SEQ ID NOs: 6 and 8 encode a putative PDZ-binding motif (specifically residues 569-572 of SEQ ID NO: 6 and residues 571-574 of SEQ ID NO: 8) (see, for example, Dann et al. Nature, 412, Jul. 5, 2001, p. 86-90).
(102) As used herein, gene therapy includes both ex vivo and in vivo techniques. Thus host cells can be genetically engineered ex vivo with a polynucleotide, with the engineered cells then being provided to a patient to be treated. Delivery of the active agent in vivo may involve a process that effectively introduces a molecule of interest (e.g. Wnt-7A polypeptide or other activator of PCP-signaling) into the cells or tissue being treated. In the case of polypeptide-based active agents, this can be effected directly or, alternatively, by transfecting transcriptionally active DNA into living cells such that the active polypeptide coding sequence is expressed and the polypeptide is produced by cellular machinery. Transcriptionally active DNA may be delivered into the cells or tissue, e.g. muscle, being treated using transfection methods including, but not limited to, electroporation, microinjection, calcium phosphate coprecipitation, DEAE dextran facilitated transfection, cationic liposomes and retroviruses. In certain embodiments, the DNA to be transfected is cloned into a vector. Such vectors may include plasmids effective for delivery and expression of the DNA within a host cell. Such vectors may include but are not limited to plasmids derived from human cytomegalovirus (hCMV) or other suitable promotors such as hPGK-1 or hACT.
(103) Alternatively, cells can be engineered in vivo by administration of the polynucleotide using techniques known in the art. For example, by direct injection of a naked polynucleotide (Feigner and Rhodes, (1991) Nature 349:351-352; U.S. Pat. No. 5,679,647) or a polynucleotide formulated in a composition with one or more other agents which facilitate uptake of the polynucleotide by the cell, such as saponins (see, for example, U.S. Pat. No. 5,739,118) or cationic polyamides (see, for example, U.S. Pat. No. 5,837,533); by microparticle bombardment (for example, through use of a gene gun, Biolistic, Dupont); by coating the polynucleotide with lipids, cell-surface receptors or transfecting agents; by encapsulation of the polynucleotide in liposomes, microparticles, or microcapsules; by administration of the polynucleotide linked to a peptide which is known to enter the nucleus; or by administration of the polynucleotide linked to a ligand subject to receptor-mediated endocytosis (see, for example, Wu and Wu, (1987) J: Biol. Chem. 262:4429-4432), which can be used to target cell types specifically expressing the receptors.
(104) Alternatively, a polynucleotide-ligand complex can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the polynucleotide to avoid lysosomal degradation; or the polynucleotide can be targeted for cell specific uptake and expression in vivo by targeting a specific receptor (see, for example, International Patent Applications WO 92/06180, WO 92/22635, WO92/203167 WO93/14188 and WO 93/20221). The present invention also contemplates the intracellular introduction of the polynucleotide and subsequent incorporation within host cell DNA for expression by homologous recombination (see, for example, Koller and Smithies (1989) Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al. (1989) Nature 342:435-438).
(105) The polynucleotide can be incorporated into a suitable expression vector. A number of vectors suitable for gene therapy applications are known in the art (see, for example, Viral Vectors: Basic Science and Gene Therapy, Eaton Publishing Co. (2000)) and may be used. The expression vector may be a plasmid vector. Methods of generating and purifying plasmid DNA are rapid and straightforward. In addition, plasmid DNA typically does not integrate into the genome of the host cell, but is maintained in an episomal location as a discrete entity eliminating genotoxicity issues that chromosomal integration may raise. A variety of plasmids are now readily available commercially and include those derived from Escherichia cold and Bacillus szlbtilis, with many being designed particularly for use in mammalian systems. Examples of plasmids that may be used in the present invention include, but are not limited to, the expression vectors pRc/CMV (Invitrogen), pCR2. 1 (Invitrogen), pAd/CMV and pAd/TR5/GFPq (Massie et al., (1998) Cytotechnology 28:53-64). In an exemplary embodiment, the plasmid is pRc/CMV, pRc/CMV2 (Invitrogen), pAdCMV5 (IRB-NRC), pcDNA3 (Invitrogen), pAdMLP5 (IRB-NRC), or pVAX (Invitrogen).
(106) Alternatively, the expression vector can be a viral-based vector. Examples of viral-based vectors include, but are not limited to, those derived from replication deficient retrovirus, lentivirus, adenovirus and adeno-associated virus. Retrovirus vectors and adeno-associated virus vectors are currently the recombinant gene delivery system of choice for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and the transferred polynucleotides are stably integrated into the chromosomal DNA of the host. A major prerequisite for the use of retroviruses is to ensure the safety of their use, particularly with regard to the possibility of the spread of wild-type virus in the cell population. Retroviruses, from which retroviral vectors may be derived include, but are not limited to, Moloney Murine Leulcemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leulcosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumour virus. Specific retroviruses include pLJ, pZIP, pWE and pEM, which are well known to those skilled in the art.
(107) The polynucleotide is usually incorporated into the vector under the control of a suitable promoter that allows for expression of the encoded polypeptide in viva. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter, the E1A promoter, the major late promoter (MLP) and associated leader sequences or the E3 promoter; the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAl promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTR, the histone, pot III, and (pectin promoters; B 19 parvovirus promoter; the SV40 promoter; and human growth hormone promoters. The promoter also may be the native promoter for the gene of interest. The selection of a suitable promoter will be dependent on the vector, the host cell and the encoded protein and is considered to be within the ordinary skills of a worker in the art.
(108) The development of specialized cell lines (termed packaging cells) which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are well characterized for use in gene transfer for gene therapy purposes (for a review see Miller, A. D.; 1990) Blood 76:271). Thus, recombinant retrovirus can be constructed in which part of the retroviral coding sequence (gag, pot, env) has been replaced by subject polynucleotide and renders the retrovirus replication defective. The replication defective retrovirus is then packaged into virions that can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.), J. Wiley & Sons, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include Crip, Cre, 2 and Am. Other examples of packaging cells include, but are not limited to, the PE501, PA317, I-2, yr3S AM, PA12, T1 9-14X, VT-1 9-1 7-H2, ACRE, SCRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pas. 5-14 (1990).
(109) Furthermore, it has been shown that it is possible to limit the infection spectrum of retroviruses and consequently of retroviral-based vectors by modifying the viral packaging proteins on the surface of the viral particle (see, for example PCT publications W093/25234 and W094/06920). For instance, strategies for the modification of the infection spectrum of retroviral vectors include: coupling antibodies specific for cell surface antigens to the viral env protein (Roux et al. (1989) PNAS 86:9079-9083; Julan et al. (1992) J. Gen Virol 73:3251-3255; and Goud et al. (1983) Virology 163:251-254); or coupling cell surface receptor ligands to the viral env proteins (Neda et al. (1991) J. Biol Chem 266: 14143-14146). Coupling can be in the form of the chemical cross-linking with a protein or other variety (for example, lactose to convert the env protein to an asialoglycoprotein), as well as by generating fusion proteins (for example, single-chain antibody/env fusion proteins). This technique, while useful to limit or otherwise direct the infection to certain tissue types, can also be used to convert an ecotropic vector in to an amphotropic vector.
(110) Moreover, use of retroviral gene delivery can be further enhanced by the use of tissue- or cell-specific transcriptional regulatory sequences which control expression of the polynucleotides contained in the vector.
(111) Another viral vector useful in gene therapy techniques is an adenovirus-derived vector. The genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See for example Beriner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155. Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl 324 or other strains of adenovirus (for example, Adz, Ad3, Adz etc.) are well known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain circumstances in that they can be used to infect a wide variety of cell types, including peripheral nerve cells. Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity. Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situations where introduced DNA becomes integrated into the host genome (for example, retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berliner et al. cited supra; Haj-Ahmand and Graham (1986) J. Virol. 57:267). Most replication-defective adenoviral vectors currently in use and contemplated by the present invention are deleted for all or parts of the viral E2 and E3 genes but retain as much as 80% of the adenoviral genetic material (see, e.g., Jones et al. (1979) Cell 16:683; Berliner et al., supra; and Graham et al. in Methods in Molecular Biology, E. J. Murray, Ed. (Humane, Clifton, N.J., 1991) vol. 7. pp. 109-127). Generation and propagation of replication-defective human adenovirus vectors requires a unique helper cell line. Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoetic cells or other human embryonic mesenchymal or epithelial cells. Alternatively, the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus, i.e. that provide, in bans, a sequence necessary to allow for replication of a replication-deficient virus. Such cells include, for example, 293 cells, Vero cells or other monkey embryonic mesenchymal or epithelial cells. The use of non-human adenovirus vectors, such as porcine or bovine adenovirus vectors is also contemplated. Selection of an appropriate viral vector and helper cell line is within the ordinary skills of a worker in the art.
(112) As used herein, subject may be a mammalian subject, for example, but not limited to mouse, cow, sheep, goat, pig, dog, cat, rat, rabbit, primate, or human.
(113) A pharmaceutical composition, often used interchangeably with composition, includes at least one active agent for carrying out a desired effect. The pharmaceutical composition further comprises one or more physiologically acceptable diluents, carriers or excipients. Pharmaceutical compositions and methods of preparing pharmaceutical compositions are known in the art and are described, for example, in Remington: The Science and Practice of Pharmacy (formerly Remingtons Pharmaceutical Sciences); Gennaro, A., Lippincott, Williams & Wilkins, Philadelphia, Pa. (2000).
(114) A cell composition is a composition that contains cells together with one or more physiologically acceptable diluents, carriers or excipients. The cell composition may further comprise one or more active agents. In some cases, the cells may be transformed to express a gene or protein of interest.
(115) A stem cell composition is a composition that contains stem cells together with one or more physiologically acceptable diluents, carriers or excipients. The stem cell composition may comprise one or more active agents, such as a stem cell modulator. In some cases, the stem cells may be transformed to express a gene or protein of interest.
(116) An effective amount is an amount sufficient to achieve a beneficial or desired result. An effective amount may be effective amount in vitro or in vivo. In vivo, an effective amount may also be referred to as a therapeutically effective amount, which can be administered to a patient in one or more doses. In terms of treatment of disease or damage, an effective amount may be an amount that is sufficient to palliate, ameliorate, stabilize, reverse or slow the progression of the disease or damage. The effective amount is generally determined by the physician on a case-by-case basis and is within the skill of one in the art. Several factors are typically taken into account when determining an appropriate dosage to achieve an effective amount. These factors include age, sex and weight of the patient, the condition being treated, the severity of the condition and the form and effective concentration of the antigen-binding fragment administered.
(117) As used herein, the term about refers to a +/5% variation from the nominal value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.
(118) Embodiments of the invention are included within the definitions above, which may be relied upon to define the invention.
(119) In one aspect, there is provided a composition for modulating the division symmetry of a stem cell comprising as an active agent a modulator of planar cell polarity (PCP) signaling in the stem cell. Preferably, the stem cell is an adult stem cell, for example, a satellite stem cell.
(120) In some embodiments, the active agent is an activator of PCP signaling capable of promoting symmetrical division of the stem cell. An activator may comprise one or a combination of molecules. Polypeptide and peptide activators of the PCP signaling pathway include direct activators, as well as activators that exert their activating effect by inhibiting the activity or expression of proteins that inhibit Wnt7a signaling, i.e. indirect activators.
(121) The compositions described herein are useful in vitro or in vivo to promote stem cell expansion. It was demonstrated that activation of the PCP pathway, or components thereof, in satellite stem cells promotes symmetrical stem cell division, largely expanding the stem cell pool without affecting the rate of cell division.
(122) The active agent may, for example, comprise a small molecule, a polynucleotide, a peptide, a polypeptide, a macromolecule, or a combination thereof.
(123) The components of the PCP pathway, including Wnt7a and Fzd7, tend to be highly conserved across species. Therefore, polypeptides and polynucleotides derived from various species are contemplated within the scope of the invention so long as they have the desired characteristics and activity.
(124) In some embodiments, the active agent comprises a peptide or polypeptide capable of binding to and/or activating Fzd7 on the stem cell. Fzd7 comprises a putative cysteine-rich Wnt-binding domain comprising residues 45 to 169 of the polypeptide shown as SEQ ID NO: 6 (mouse) and SEQ ID NO: 8 (human). Based on homology exhibited between human/mouse Fzd7 and mouse Fzd8 and Fzd3 (for which crystal structures of the respective Wnt-binding domain have been reported), residues 56, 58-60, and 62-64 of human/mouse Fzd7 may be particularly important for interaction with Wnt7a. Thus, a polypeptide capable of activating Fzd7 may comprise a polypeptide capable of binding to a Wnt-binding domain of Fzd7.
(125) In some embodiments, the active agent is a Wnt7a polypeptide or an active analogue, variant, fragment, or derivative thereof capable of binding to and activating Fzd7. Exemplary Wnt7a polypeptides are shown in
(126) In some embodiments, the active agent is a polypeptide having a sequence of a Wnt7a polypeptide, or a sequence that is at least about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a Wnt7a polypeptide. In some embodiments the sequence of the Wnt7a polypeptide comprises SEQ ID NO: 2 or SEQ ID NO: 4.
(127) In some embodiments, the active agent is a Wnt7a polypeptide having an amino acid sequence comprising SEQ ID NO: 2 or SEQ ID NO: 4, or a sequence that is at least about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2 or SEQ ID NO: 4.
(128) In some embodiments, the % identity is assessed over at least about 50, 100, 200, 300, or more contiguous amino acids. In some embodiments, the % identity is assessed over the full length of the mature peptide sequence.
(129) In certain embodiments, the active agent comprises a Wnt7a polypeptide.
(130) In some embodiments, the Wnt7a polypeptide is a human Wnt7a polypeptide. In some embodiments, the Wnt7a polypeptide is a murine Wnt7a polypeptide. Other species are also contemplated.
(131) In some embodiments, the Wnt7a polypeptide has an amino acid sequence comprising or consisting of SEQ ID NO: 2 or SEQ ID NO: 4.
(132) In some embodiments, the active agent comprises an isolated polynucleotide encoding a peptide or polypeptide capable of binding to and/or activating Fzd7. The peptide or polypeptide capable of binding to and/or activating Fzd7 may be as described above. Thus, in some embodiments, the polynucleotide encodes a Wnt7a polypeptide or an active analogue, variant, fragment, or derivative thereof capable of binding to and activating Fzd7.
(133) Exemplary Wnt7a polynucleotides are shown in
(134) In some embodiments, the active agent comprises a polynucleotide encoding a polypeptide having an amino acid sequence comprising SEQ ID NO: 2 or SEQ ID NO: 4, or a sequence that is at least about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2 or SEQ ID NO: 4.
(135) In some embodiments, the active agent comprises a polynucleotide having an amino acid sequence comprising SEQ ID NO: 1 or SEQ ID NO: 3, or a sequence that is at least about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1 or SEQ ID NO: 3.
(136) In some embodiments, the % identity is assessed over at least about 50, 100, 200, 300, 500, 750 or 100 or more contiguous nucleotides. In some embodiments, the % identity is assessed over the full length of the polynucleotide.
(137) In some embodiments, the polynucleotide comprises a Wnt7a polynucleotide sequence comprising or consisting of SEQ ID NO: 1 or SEQ ID NO: 3.
(138) In some embodiments, the active agent is a small molecule capable of binding to and/or activating Fzd7.
(139) In some embodiments, the active agent is a polynucleotide or polypeptide capable of increasing expression of Fzd7 on the stem cell. In some embodiments, the active agent comprises a Fzd7 polynucleotide. Exemplary Fzd7 polynucleotides are shown in
(140) In some embodiments, the polypeptides correspond to modulators of Wnt7a signaling, for example, Fzd7, Fzd3, Celsr1, Celsr2, Celsr3, Dvl1, Dvl2, Dvl3, Pk1, Pk2, Pk3, Pk4, Rac/RhoA, Vangl1, Vangl2, Syndecan 4 (Syn4) and 7-1-integrin, or active fragments, variants or derivatives thereof.
(141) In some embodiments, the active agent comprises a polynucleotide or polypeptide capable of modulating a downstream effector molecule in the PCP pathway to thereby promote or inhibit symmetrical cell division. Exemplary polarity effectors that may be modulated to affect cell division decisions in adult stem cells include Prickle, Flamingo (Celsr2), Dishevled (Dsh) or PTK7. Exemplary targets of modulation in the PCP pathway include, but are not limited to, Fzd7, Vangl1, Vangl2, Dvl2, Dvl3, Pk1, Pk2, Celsr2 and 7-integrin.
(142) In some embodiments, the active agent comprises a polynucleotide or polypeptide capable of activating a downstream effector molecule in the PCP pathway to thereby promote symmetrical stem cell division. The downstream effector molecule may, for example be, Vangl2, 7-integrin, Prickle 1 or Celsr2.
(143) In one embodiment, the effector molecule is Vangl2. The active agent may, for example, be a polypeptide or polynucleotide capable of inducing expression or polarized redistribution of Vangl2 in the cell membrane.
(144) In some embodiments, the active agent may comprise a polynucleotide encoding a Vangl2 polypeptide. Exemplary Vangl2 polypeptides are shown in
(145) In some embodiments, the composition additionally comprise one or more stem cell modulators. The stem cell modulator may, for example, promote one more of stem cell proliferation, differentiation, lineage commitment, or terminal differentiation of committed progenitor cells.
(146) In some embodiments, the modulator increases the rate of stem cell division. Any suitable activator of stem cell division rate can be used, such as a suitable growth factor. Known growth factors include FGF, HGF and SDF. In some embodiments, a growth factor that increases stem cell division rate without promoting differentiation is selected.
(147) In some embodiments, the modulator is one that increases proliferation in a population of expanding stem cells, or one that promotes differentiation in a population of stem cells that have been previously expanded by treatment with Wnt7a.
(148) In some embodiments, a stem cell modulator promotes stem cell survival. Exemplary compounds that enhance the survival of the stem cells would include, for example, a sonic hedgehog (Shh) protein.
(149) In some embodiments, a stem cell modulator is an inhibitor of canonical Wnt/-catenin signaling.
(150) In one embodiment, there is provided a composition for enhancing tissue formation, regeneration, maintenance or repair in a mammal comprising as an active agent (a) a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7, or (b) a polynucleotide encoding a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7.
(151) In another embodiment, there is provided a composition for promoting symmetrical stem cell division comprising as active agent one or more activators of the Fzd7 receptor, wherein the one or more activators may include, but are not limited to, one or more small molecules, nucleic acids, polypeptides, peptides, macromolecules, antibodies or a combination thereof, that activate Fzd7 receptor in adult stem cells.
(152) In some embodiments, the adult stem cells are satellite stem cells.
(153) The compositions described herein may be used to deliver a polynucleotide of interest into a cell or tissue. The composition may be administered in vitro, for example, to expand a population of stem cells, or in vivo, for example, in a gene therapy method.
(154) The polynucleotide of interest may be delivered directly into a cell or tissue (e.g. naked). More typically, the polynucleotide will be cloned into an expression vector capable of expressing the encoded polypeptide. A cell or tissue may therefore be transformed to express a polypeptide of interest. Any suitable transformation method known in the art may be employed.
(155) Various expression systems are known in the art and are publically available through a number of sources (e.g. Invitrogen, Clontech). Any suitable expression vector may be used. In some embodiments, the expression vector is a mammalian expression vector. In some embodiments, the expression vector is a plasmid. In some embodiments, the plasmid is an virally-derived plasmid. In some embodiments, the plasmid comprises a CMV promoter sequence. In some embodiments, the plasmid comprises pCMV or pCMV-Sport6. In one embodiment, the plasmid is Wnt7a-CMV.
(156) Gene expression may optionally be under the control of an inducible promoter. Several inducible promoters are known in the art.
(157) In some embodiments, the composition comprises an expression vector carrying a polynucleotide encoding a polypeptide capable of activating PCP signaling in a stem cell, to thereby promote symmetrical stem cell expansion.
(158) In some embodiments, a cell or tissue is transformed to express a modulator of PCP signaling in a stem cell. A number of exemplary modulators have been described above.
(159) In some embodiments, a cell or tissue is transformed to overexpress Wnt7a to thereby induce symmetrical division of a stem cell. Wnt7a may be secreted from the transformed cell and may act on the cell from which is it secreted or may act on a nearby stem cell. In some embodiments, the transformed cell is a helper cell that may be co-cultured or co-administered with the stem cell. The helper cell may also be a resident cell in a tissue that is transformed to overexpress Wnt7a or another protein of interest.
(160) In some embodiments, the helper cell is a myoblast or muscle cell transformed to overexpress Wnt7a.
(161) In some embodiments, muscle tissue is transformed to overexpress Wnt7a. In some embodiments, the muscle tissue is skeletal muscle. Overexpression of Wnt7a expands the satellite stem cell pool in vivo, increases satellite cell numbers, and promotes muscle regeneration and repair.
(162) In some embodiments, a stem cell is transformed to overexpress Fzd7, Vangl2, 7-integrin, or another effector of PCP signaling in the stem cell.
(163) In some embodiments, the composition comprises cells and may therefore be a cell composition. For example, the composition may comprise a helper cell. In some embodiments, the helper cell is transformed to express and secrete Wnt7a. In some embodiments, the helper cell is a myoblast or muscle cell.
(164) In some embodiments, the composition comprises stem cells and is therefore a stem cell composition.
(165) In some embodiments, stem cells may be expanded in vitro using a method according to the invention and may subsequently be added to a composition of the invention to form a stem cell composition. For instance, stem cells can be cultured and expanded in vitro using methods of the invention and then administered to a subject as a therapeutic stem cell composition according to methods known to skilled persons.
(166) In some embodiments, the composition comprises: a stem cell; and an activator of PCP signaling in the stem cell. In some embodiments, the stem cell is a satellite stem cell.
(167) In some embodiments, the composition comprises a stem cell transformed to express a polynucleotide of interest. Any suitable transformation method known in the art may be employed.
(168) In one embodiment, there is provided a composition for enhancing tissue regeneration or repair comprising: a stem cell; and one or more activators or effectors of PCP signaling. Various activators and effectors of PCP signaling have been described above.
(169) In some embodiments, the composition comprises a stem cell transformed to overexpress an activator or effector of the PCP pathway, for example, Wnt7a, Fzd7 or Vangl2.
(170) The composition may comprise a physiologically acceptable diluent, carrier or excipient. Methods of making various pharmaceutical compositions for various routes of administration are known in the art and are further describe in a later section.
(171) In some embodiments, the composition is formulated for injection. For instance, the composition may be formulated for one or more of intravenous injection, intramuscular injection, intracardiac injection, subcutaneous injection, or intraperitoneal injection. In one embodiment, the composition if for systemic injection. In one embodiment, the composition if for intramuscular injection.
(172) In some embodiments, there is provided a use of a composition as described herein for the manufacture of a medicament for promoting stem cell expansion. In some embodiments, there is provided a composition as described herein for use in the manufacture of a medicament for promoting stem cell expansion.
(173) In some embodiments, there is provided a use of a composition as described herein for the manufacture of a medicament for promoting muscle formation, maintenance, repair, or regeneration of muscle in a subject in need thereof. In some embodiments, there is provided a composition as described herein for use in the manufacture of a medicament for promoting muscle formation, maintenance, repair, or regeneration of muscle in a subject in need thereof.
(174) In some embodiments, the composition is for promoting muscle regeneration or repair.
(175) The composition may be administered in an effective amount, such as a therapeutically effective amount.
(176) The invention provides for methods of modulating stem cells, in particular, methods of modulating division symmetry of adult stem cells, such as satellite stem cells.
(177) In some embodiments, there is provided a method for modulating division symmetry of stem cells in vivo or in vitro comprising contacting the stem cells with a composition as described herein.
(178) As described in the embodiments above, the composition comprises as an active agent a modulator of planar cell polarity (PCP) signaling in the stem cell.
(179) Is some embodiments the active agent is an activator of PCP signaling in the stem cell and the method thereby promotes stem cell expansion. Such methods are useful, for example, for increasing the relative proportion of symmetrical to asymmetrical cell divisions in a population of stem cells in vivo or in vitro. Such methods are therefore useful for expanding a population of stem cells in vivo or in vitro.
(180) In some embodiments, the methods disclosed herein are capable of promoting symmetrical stem cell division without altering the rate of stem cell division.
(181) In some embodiments, the methods may be useful for promoting survival of a population of stem cells.
(182) In some embodiments, the methods are administered in vitro.
(183) In some embodiments, the methods are administered in vivo. In some embodiments, the in vivo method comprises administering the composition to a subject in need thereof.
(184) In some embodiments, there is provided a method for expanding a population of satellite stem cells in vivo or in vitro comprising contacting the stem cells with an effective amount of a composition comprising (a) a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7, or (b) a polynucleotide encoding a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7.
(185) In some embodiments, the active agent is a Wnt7a polypeptide or an analogue, derivative, variant or active fragment thereof.
(186) In some embodiments, there is provided a method of promoting satellite stem cell expansion comprising contacting the satellite stem cell with Wnt7a or an active fragment, variant, analogue or derivative thereof capable of activating Fzd7.
(187) In another embodiment, there is provided a method of increasing the number of satellite cells in a tissue, and thereby providing enhanced regeneration potential of the tissue, comprising contacting the stem cells with a composition as described herein.
(188) In some embodiments, the methods of the invention are used in vivo for treatment of resident stem cells in a tissue, e.g. resident satellite stem cells in muscle tissue.
(189) In some embodiments, there are provided methods of promoting stem cell expansion using compounds that activate Wnt7a, result in an increase of endogenous Wnt7a or an increase in endogenous Wnt7a activity. Wnt7a activators may be polypeptides or genes encoding polypeptides that act upstream of Wnt7a in vivo to upregulate expression or activity of Wnt7a, or they may be small molecule activators. Wnt7a activators may act at a genetic level, for example to upregulate the expression of a gene encoding Wnt7a, or they may act at the protein level to increase the activity of a Wnt7a polypeptide or to decrease the activity of an inhibitor of Wnt7a. Wnt7a activators can be, for example, polypeptides and peptides (or analogues, derivatives, variants or peptidomimetic compounds corresponding to polypeptides, as described above), polynucleotides, oligonucleotides, antibodies or antibody fragments, or organic or inorganic small molecules.
(190) In some embodiments, the method may additionally comprise contacting the stem cell with one or more stem cell modulators, for example, a modulator that increases the rate of stem cell division or increases stem cell survival.
(191) In some embodiments, the method comprises administering cells to a subject. The cells may, for example, be administered simultaneously or sequentially with a composition described herein.
(192) In some embodiments, the method comprises administering stem cells to a subject. The stem cells may, for example, be administered simultaneously or sequentially with a composition described herein that promotes stem cell expansion. For example, the stem cells may be administered prior to administration of the composition (i.e. the composition may be administered after a desired period). In some embodiments, the composition itself may comprise the stem cells to be administered.
(193) Stem cells may be maintained and expanded in vitro for subsequent experimental or therapeutic uses. In some embodiments, stem cells, e.g. satellite stem cells, are expanded in vitro and are subsequently administered to a subject in need thereof. For instance, stem cells can be cultured and expanded in vitro using methods of the invention and then administered to a patient as a therapeutic stem cell composition according to methods known to skilled persons.
(194) In some embodiments, stem cells may be obtained from an individual and maintained in culture. The population of cultured stem cells may be treated with Wnt7a, or another activator of PCP signaling, to promote symmetrical expansion in vitro.
(195) In some embodiments, the method may comprise administering helper cells to a subject. The helper cells may, for example, be administered simultaneously or sequentially with the composition. In some embodiments, the composition itself may comprise helper cells.
(196) The present invention also contemplates administration of polynucleotides encoding Wnt7a, a variant or active fragment thereof, or another activator of PCP signaling, and optionally a stem cell modulator, which then express the encoded product in vivo, by various gene therapy methods known in the art.
(197) In some embodiments, the method comprises transforming a cell or tissue. Some exemplary methods have been described previously above. Various methods of transformation are known to those of skill in the art.
(198) In some embodiments, a cell or tissue is transformed to express Wnt7a, or an active fragment or variant thereof, which is then secreted and acts at the surface of stem cells by binding to the Fzd7 receptor.
(199) In some embodiments, helper cells are transformed to overexpress Wnt7a, or an active fragment or variant thereof.
(200) In some embodiments, stem cells are transformed to express Fzd7 or an effector of PCP signaling, such as Vangl2.
(201) In some embodiments, satellite stem cells are transformed to overexpress Wnt7a, or an active fragment or variant thereof, or another activator of PCP signaling. In one embodiment, satellite stem cells are transformed to overexpress Vangl2. In another embodiment, satellite stem cells are transformed to overexpress Fzd7.
(202) In some embodiments, stem cells are co-cultured with a differentiated cell transformed to overexpress and secrete Wnt7a or another stimulator of PCP signaling in the stem cell, e.g. an activator of Fzd7.
(203) In one embodiment, satellite stem cells are co-cultured with muscle cells transformed with CMV-Wnt7a to overexpress and secrete Wnt7a.
(204) Any suitable expression vector may be used, including but not limited to those described previously. Where in vivo methods are performed, cell- or tissue-specific vectors or promoters may also be used. In one embodiment, the vector is a muscle-specific AAV vector. An inducible promoter may optionally be used.
(205) Polypeptide activators or effectors of PCP-signaling may be directly introduced into cells, bypassing the DNA transfection step. Means to directly deliver polypeptides into cells include, but are not limited to, microinjection, electroporation, cationic lipids and the construction of viral fusion proteins. Typically, transfection of a suitable expression system carrying a polynucleotide will be used.
(206) The methods of promoting stem cell expansion can be used to stimulate the ex vivo or in vitro expansion of stem cells and thereby provide a population of cells suitable for transplantation or administration to a subject in need thereof.
(207) The stem cells to be administered may be treated with a stem cell modulator, for example, a modulator that promotes survival of a stem cell. Sequential methods that promote expansion followed by proliferation and/or differentiation of stem cells are also contemplated. For example, a stem cell population may be expanded in vitro by contacting the cells, directly or indirectly, with Wnt7a or another activator of PCP signaling. The expanded population of cells may then be treated with one or more stem cell modulators in vitro or in vivo, e.g. that promote proliferation and/or differentiation of the stem cells in situ or promote stem cell survival. Alternatively, both steps may be conducted in vitro prior to administration of the cells to a subject.
(208) In vitro is sometimes used interchangeably with ex vivo herein. For in vivo and ex vivo transplant methods, the stem cells can be autologous, allogeneic or xenogeneic. In embodiments where stem cells from a donor subject are transplanted into a recipient subject in need thereof, preferably, the donor and recipient are matched for immunocompatibility. For example, but not wishing to be limiting, it is preferable that the donor and the recipient are matched for compatibility to the major histocompatibility complex (MHC) (human leukocyte antigen (HLA))-class I (e.g., loci A, B, C) and -class II (e.g., loci DR, DQ, DRW) antigens. Immunocompatibility between donor and recipient may be determined according to methods generally known in the art (see, e.g., Charron, D. J., Curr. Opin. Hematol., 3: 416-422 (1996); Goldman, J., Curr. Opin. Hematol., 5: 417-418 (1998); and Boisjoly, H. M. et al., Opthalmology, 93: 1290-1297 (1986)).
(209) In one embodiment of the present invention, the gene therapy vector is an adenovirus-derived vector.
(210) In one embodiment, Wnt7a-CMV is administered to a patient under the control of a muscle-specific promoter or vector.
(211) In some embodiments, the subject is a human.
(212) The methods described herein have a number of applications. For example, the methods can be used in vitro to promote expansion of stem cells wherein the cells are destined for further in vitro use, for example, for research or diagnostic purposes. The methods can be used for maintaining stem cell cultures in vitro and also have potential application in the development of new in vitro models for drug testing or screening.
(213) The compositions and methods described herein are also useful for various therapeutic applications. In particular, the compositions and methods described herein are useful for promoting tissue formation, regeneration, repair or maintenance in a subject in need thereof. In some embodiments, the tissue is muscle. In some embodiments, the muscle is skeletal muscle.
(214) Relevant therapeutic applications may pertain to situations where there is a need to regenerate lost or damaged muscle tissue, for example, after chemotherapy or radiation therapy, after muscle injury, or in the treatment or management of diseases and conditions affecting muscle. In some embodiments, the disease or condition affecting muscle may include a wasting disease (e.g. cachexia, which may be associated with an illness such as cancer or AIDS), muscular attenuation or atrophy (e.g. sarcopenia, which may be associated with aging), ICU-induced weakness, prolonged disuse (e.g. coma, paralysis), surgery-induced weakness (e.g. following hip or knee replacement), or a muscle degenerative disease (e.g. muscular dystrophies). This list is not exhaustive.
(215) In some embodiments, compositions and methods described herein are employed where there is a need to prevent loss of tissue, as in wasting diseases or atrophy.
(216) In some embodiments, compositions and methods described herein are employed where there is a need or desire to increase the proportion of resident stem cells, or committed precursor cells, in a muscle tissue, for example, to replace damaged or defective tissue, or to prevent muscle atrophy or loss of muscle mass, in particular, in relation to diseases and disorders such as muscular dystrophy, neuromuscular and neurodegenerative diseases, muscle wasting diseases and conditions, atrophy, cardiovascular disease, stroke, heart failure, myocardial infarction, cancer, HIV infection, AIDS, and the like.
(217) In some embodiments, the methods can be used with satellite stem cells in the treatment, management or prevention of degenerative muscle disorders.
(218) In some embodiments, the compositions and methods are useful for promoting muscle cell formation, for example, for repairing or regenerating dysfunctional skeletal muscle, for instance, in subjects having muscle degenerative diseases.
(219) The subject may therefore have, be suspected of having, or be at risk of at having skeletal muscle damage, degeneration or atrophy. The skeletal muscle damage may be disease related or non-disease related. The human subject may exhibit or be at risk of exhibiting muscle degeneration or muscle wasting. The muscle degeneration or muscle wasting may be caused in whole or in part by a disease, for example aids, cancer, a muscular degenerative disease, or a combination thereof.
(220) Muscle degeneration may be due to a muscle degeneration disease such as muscular dystrophy.
(221) Examples of muscular dystrophies include, but are not limited to Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), myotonic dystrophy (also known as Steinert's disease), limb-girdle muscular dystrophies, facioscapulohumeral muscular dystrophy (FSH), congenital muscular dystrophies, oculopharyngeal muscular dystrophy (OPMD), distal muscular dystrophies and Emery-Dreifuss muscular dystrophy. See, e.g., Hoffman et al., N. Engl. J. Med., 318.1363-1368 (1988); Bonnemann, C. G. et al., Curr. Opin. Ped., 8: 569-582 (1996); Worton, R., Science, 270: 755-756 (1995); Funakoshi, M. et al., Neuromuscul. Disord., 9 (2): 108-114 (1999); Lim, L. E. and Campbell, K. P., Cure. Opin. Neurol., 11 (5): 443-452 (1998); Voit, T., Brain Dev., 20 (2): 65-74 (1998); Brown, R. H., Annu. Rev. Med., 48: 457-466 (1997); Fisher, J. and Upadhyaya, M., Neuromuscul. Disord., 7 (1): 55-62 (1997).
(222) In some embodiments, the muscular dystrophy is Duchenne muscular dystrophy (DMD).
(223) In some forms of urinary continence, the culprit muscle can be treated with a composition or method of the invention, for example, by electroporation of the muscle. Thus, in one embodiment, the method is useful for treating urinary incontinence.
(224) In one aspect, there is provided a method for promoting muscle formation, regeneration or repair in a subject in need thereof comprising administering to the mammal a composition comprising as an active agent (a) a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7, or (b) a polynucleotide encoding a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7.
(225) In another aspect, there is provided a method for preventing muscle wasting, atrophy or degeneration in a subject in need thereof comprising administering to the mammal a therapeutically effective amount of a composition comprising (a) a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7, or (b) a polynucleotide encoding a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7.
(226) In some aspects, the compositions and methods described herein are useful for promoting formation, maintenance, repair or regeneration of skeletal muscle in a human subject in need thereof. In one aspect, there is provided a method for enhancing tissue formation, regeneration, maintenance or repair in a mammal comprising administering to a subject in need thereof a composition comprising as an active agent (a) a Wnt7a polypeptide or an active variant, fragment, analogue or derivative thereof capable of binding to and activating Fzd7, or (b) a polynucleotide encoding a Wnt7a polypeptide or an active variant, fragment, or derivative thereof capable of binding to and activating Fzd7.
(227) The promotion of muscle cell formation can further be, in an embodiment, for preventing or treating muscle destruction or atrophy of a subject, e.g. in subjects with disuse atrophy or sarcopenia. In some embodiments, the compositions are used to treat or prevent atrophy and to maintain muscle mass.
(228) The promotion of muscle cell formation can also be, in an embodiment, for repairing damaged muscle tissue. In an alternative embodiment, the promotion of muscle cell formation can be for increasing muscle mass in a subject.
(229) In a further embodiment, damaged or dysfunctional muscle tissue may be caused by an ischemic event. For instance, the damaged muscle tissue may be cardiac muscle damaged by a cardiovascular event such as myocardial infarct, or heart failure.
(230) In a further embodiment, damaged or dysfunctional muscle tissue may be cardiac muscle. For instance, the damaged muscle tissue may be cardiac muscle damaged by a cardiovascular event such as myocardial infarct, or heart failure, where the target stem cell would be a cardiac stem sell. In accordance with another aspect of the present invention, there is provided a method of promoting cardiac stem cell expansion in a mammal comprising administering to said mammal an effective amount of a composition as described herein.
(231) The compositions and methods described herein may be used in combination with other known treatments or standards of care for given diseases, injury, or conditions. For example, in the context of muscular dystrophy, a composition of the invention for promoting symmetrical stem cell expansion can be administered in conjunction with such compounds as CT-1, pregnisone or myostatin. The treatments may be administered together, separately or sequentially.
(232) The present invention also contemplates methods of inhibiting symmetrical stem cell expansion, for example, using compounds that inhibit components of PCP signaling pathway. In another aspect, there is provided a method for promoting asymmetrical stem cell division comprising contacting a stem cell or population of stem cells with an inhibitor of PCP signaling.
(233) In one aspect, there is provided a composition wherein the active agent is an inhibitor of PCP signaling capable of inhibiting symmetrical division of the stem cell. The inhibitor may, for example, be a peptide, polypeptide, polynucleotide or small molecule capable of directly or indirectly inhibiting PCP signaling via inhibition of Wnt7a, Fzd7, or a an effector molecule in the PCP pathway, e.g., Vangl2, 7-integrin, Prickle 1 or Celsr2.
(234) In some embodiments, the inhibitor is a polynucleotide capable of inhibiting expression of Wnt7a, Fzd7, or an effector molecule in the PCP pathway, e.g. siRNA or miRNA. In one embodiment, the inhibitor is Vangl2 siRNA or Fzd7 siRNA.
(235) Inhibition of PCP signaling in stem cells could be used, for example, in the treatment of cancer, such as in the case of muscle tumors rhabdomyosarcoma, or to treat diseases such as Fibrodysplasia Ossificans Progressiva.
(236) In some embodiments, the method may comprise contacting stem cells with an inhibitor of canonical Wnt/-catenin signaling in the stem cell. Such inhibition may further promote symmetrical stem cell division. In some embodiments, the composition may comprise a polynucleotide or polypeptide inhibitor of canonical Wnt/-catenin signaling in the stem cell.
(237) The present invention further provides pharmaceutical compositions comprising Wnt7a, an analogue, derivative, variant or active fragment thereof, another activator or effector of PCP signaling, and a pharmaceutically acceptable diluent or excipient. The pharmaceutical compositions may optionally further comprise one or more stem cell modulators, one or more stem cells, or a combination thereof. Administration of the pharmaceutical compositions may be via a number of routes depending upon whether local or systemic treatment is desired and upon the area to be treated. Typically, the compositions are administered systemically or locally to the area to be treated.
(238) Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary (e.g. by inhalation or insufflation of powders or aerosols, including by nebulizer), intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection, for example, but not limited to intracardial injection or infusion, or intracranial, e.g. intrathecal or intraventricular administration. In some embodiments, compositions are administered by injection or infusion.
(239) The compositions of the present invention may be delivered in combination with a pharmaceutically acceptable vehicle. Preferably, such a vehicle would enhance the stability and/or delivery properties. Examples include liposomes, microparticles or microcapsules. In various embodiments of the invention, the use of such vehicles may be beneficial in achieving sustained release of the active component. When formulated for parenteral injection, the pharmaceutical compositions are preferably used in the form of a sterile solution, containing other solutes, for example, enough saline or glucose to make the solution isotonic.
(240) For administration by inhalation or insufflation, the pharmaceutical compositions can be formulated into an aqueous or partially aqueous solution, which can then be utilized in the form of an aerosol. For topical use, the modulators or pharmaceutical compositions comprising the modulators can be formulated as dusting powders, creams or lotions in pharmaceutically acceptable vehicles, which are applied to effected portions of the skin.
(241) In some embodiments, where the composition comprises a palmitylated protein, such as Wnt7a, a lipid carrier may be employed.
(242) The dosage requirements for the pharmaceutical compositions vary with the particular compositions employed, the route of administration and the particular subject being treated. Dosage requirements can be determined by standard clinical techniques known to a worker skilled in the art. Treatment will generally be initiated with small dosages less than the optimum dose of each compound. Thereafter the dosage is increased until the optimum effect under the circumstances is reached. In general, the pharmaceutical compositions are administered at a concentration that will generally afford effective results without causing any harmful or deleterious side effects. Administration can be either as a single unit dose or, if desired, the dosage can be divided into convenient subunits that are administered at suitable times throughout the day.
(243) When ex vivo methods of treating the stem cells are employed, the stem cells can be administered to the subject by a variety of procedures. Typically, administration of the stem cells is localized. The stem cells can be administered by injection as a cell suspension in a pharmaceutically acceptable liquid medium. Alternatively, the stem cells can be administered in a biocompatible medium which is, or becomes in site a semi-solid or solid matrix. For example, the matrix maybe an injectable liquid which forms a semi-solid gel at the site of tissue damage or degeneration, such as matrices comprising collagen and/or its derivatives, polylactic acid or polyglycolic acid, or it may comprise one or more layers of a flexible, solid matrix that is implanted in its final boron, such as impregnated fibrous matrices. Such matrices are letdown in the art (for example, Gelfoam available from Upjohn, Kalamazoo, Mich.) and function to hold the cells in place at the site of injury, which enhances the opportunity for the administered cells to expand and thereby for a reservoir of stem cells, to develop.
(244) The stem cells may or may not be cryopreserved at some point.
(245) In some embodiments, the stem cells are administered with a compound for promoting stem cell expansion to minimize risk of stem cell depletion following transplantation. In some embodiments, the transplanted stem cells have been transformed to overexpress an activator of PCP signaling, such as Fzd7 or Vangl2.
(246) In some embodiments, the stem cells are co-administered with muscle cells or other satellite cells transformed to overexpress and secrete Wnt7a.
(247) In some embodiments, the stem cells are injected intramuscularly.
(248) In a preferred embodiment, satellite stem cells or a composition comprising satellite stem cells is injected into muscle tissue, preferably in an area proximal to diseased, injured or damaged tissue. However, injection into the circulation or at a distal site is also contemplated. Intracardiac administration is also contemplated.
(249) The present invention additionally provides for kits comprising a composition as described herein together with one or more of instructions for use in promoting stem cell expansion or promoting tissue (e.g. muscle) formation, repair, regeneration, or maintenance.
(250) The present invention additionally provides for therapeutic kits containing one or more modulators of the PCP pathway in stem cells, in pharmaceutical compositions.
(251) The present invention additionally provides for therapeutic or diagnostic kits containing Wnt7a, an analogue, derivative, variant or active fragment thereof, or another activator of PCP signaling, and optionally one or more stem cell modulators in pharmaceutical compositions.
(252) Individual components of the kit would be packaged in separate containers and, associated with such containers, can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human or animal administration.
(253) When the components of the kit may be provided in one or more liquid solutions, the liquid solution can be an aqueous solution, for example a sterile aqueous solution. In this case the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the composition may be administered to a patient.
(254) The components of the kit may also be provided in dried or lyophilized form and the kit can additionally contain a suitable solvent for reconstitution of the lyophilized components. Irrespective of the number or type of containers, the kits of the invention also may comprise an instrument for assisting with the administration of the composition to a patient. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.
(255) Further, in addition to using the stem cells in transplants, stem cells, or compositions comprising stem cells may be used as a research tool and/or as part of a diagnostic assay or kit. Without wishing to be limiting a kit may comprise muscle stem cells, a promoter of Wnt 7a signaling, cell culture or growth medium, cell cryopreservation medium, one or more pharmaceutically acceptable delivery media, one or more nucleotide sequences or genetic constructs, one or more devices for implantation or delivery of cells to a subject in need thereof, instructions for using, delivering, implanting, culturing, cryopreserving or any combination thereof the cells as described herein.
(256) The ability of Wnt7a, analogues, derivatives, variants and active fragments thereof, or PCP activators or effectors, alone or in combination with other stem cell modulators, to promote stem cell expansion can be tested in vitro or in vivo using standard techniques including, but not limited to, those described herein. Inhibition of stem cell expansion by one more inhibitors can also be measured in vitro or in vivo.
(257) Candidate activators and inhibitors of stem cell expansion can also be tested and identified using in vitro methods know to those skilled in the art. Methods of maintaining stem cells in culture are known in the art (see, for example, Madlambayan, G. J., et al., (2001) J. Hematother. Stem CellRes. 10, 481-492; Hierlihy, A. M., et al., (2002) FEBSLett. 530, 239-243; Asakura, A., et al., (2002) JCell Biol. 159, 123-134). The stem cells can be cultured alone as a monoculture or they can be co-cultured with educator cells. Additional steps may be included in the screening methods before, during, or after the culture period, such as steps to identify or isolate cell populations or otherwise contribute to the success of the assay. For example, growth factors or other compounds may be employed to isolate and expand the stem cell population. EGF and FGF have been used for this purpose with neural stem cells as described by Gritti et al (J. Neurosci. (1999) 19:3287-3297), and 13c1-2 has been used in the isolation of muscle stem cell populations (see U.S. Pat. No. 6,337,184). In one embodiment, the culture medium used in DMEM plus 10% FCS.
(258) Various screening methods known in the art can be employed to identify candidate activators of Wnt7a or another component of the PCP pathway, such as Vangl2. For example, activators that up- or down-regulate a target gene can be identified by monitoring cells treated with the candidate activator for an increase or decrease in the expression of the target gene. Methods such as Northern blot analysis, quantitative RT-PCR or microarray analysis can be used for this purpose. Alternatively, an increase or decrease in the corresponding protein level can be monitored, for example, by Western blot analysis.
(259) For polypeptide or peptide activators (or analogues, derivatives, variants or peptidomimetic compounds corresponding to the polypeptides) that bind a specific protein, for example, Fzd7, the binding ability can be determined using one of a variety of binding assays known in the art (see, for example, Coligan et al., (eds.) Current Protocols in Protein Science, J. Wiley & Sons, New York, N.Y.).
(260) For antibody or antibody fragment activators, various immunoassays can be used.
(261) In order to identify potential enhancers of symmetrical stem cell division, a population of stem cells can be cultured and exposed to various test compounds. Furthermore, stem cells can be transfected to express various test genes of interest. Alternatively, stem cells can be co-cultured with educator cells, the educator cells are exposed to the test compound(s) and at least one indicator of expansion is subsequently monitored in the stem cells. Educator cells may be exposed to the test compound(s) prior to, or during, co-culture. Adult stem cells derived from a variety of tissues can be used. Examples include, but are not limited to, stem cells from cardiac or skeletal muscle, pancreatic tissue, neural tissue, liver tissue or bone marrow, haematopoletic cells, myoblasts, hepatocytes, thymocytes, cardiomyocytes, and the like. Embryonic stem cells may also be used.
(262) Generally, a compound is tested over a range of concentrations, typically about a 1000-fold range, and a suitable exposure protocol can be readily established by one skilled in the art. When a co-culture is used, stem cell exposure to a compound can occur before, during or after the initial exposure of the stem cells to the educator cells.
(263) Alternatively, when the test compound is a polynucleotide or a compound encoded by a polynucleotide, such as a polypeptide or peptide, the stem cells can be transfected with the nucleic acid, or an expression vector comprising the polynucleotide, using standard methods described herein and elsewhere, such that the test compound is produced endogenously. Additionally, the stem cells can be exposed to a test compound by co-culture of the stem cells with another cell line, which has been transfected with the polynucleotide, or an expression vector comprising the polynucleotide, and which expresses the test compound.
(264) As indicated above, it is further contemplated that the stem cells may not be directly exposed to the compound. For example, an educator cell population or a third cell type can be first treated with the compound and subsequently co-cultured with the stem cells. Alternatively, the stem cells can be indirectly exposed by the addition of medium that has been conditioned by such a cell population, but which is not itself included in the co-culture. In addition, it is contemplated that the stem cells may be exposed to a compound that has been incorporated into a non-liquid medium of the culture, for example, a solid, gel or semi-solid growth support such as agar, a polymer scaffold, matrix or other construct.
(265) Indicators of stem cell expansion may be monitored qualitatively or quantitatively and include, for example, changes in gross morphology, total cell number, histology, histochemistry or immunohistochemistry, or the presence, absence or relative levels of specific cellular markers. The presence, absence or relative levels of cellular markers can be analyzed by, for example, histochemical techniques, immunological techniques, electrophoresis, Western blot analysis, FACS analysis, flow cytometry and the like. Alternatively the presence of mRNA expressed from the gene encoding the cellular marker protein can be detected, for example, using PCR techniques, Northern blot analysis, the use of suitable oligonucleotide probes and the like.
(266) For those cells treated with both Wnt7a (or another PCP activator or effector) and a stem cell modulator, one or more indicators of differentiation may also be monitored in the stem cell population after treatment with the modulator. Typically differentiation is monitored by changes in gross morphology, as described above, or by the presence of lineage specific cellular markers, which can be analyzed using a number of standard techniques as indicated above. Suitable lineage-specific cellular markers that can be monitored are known in the art.
(267) Furthermore screening methods can be employed to identify new modulators capable of promoting stem cell expansion or promoting muscle regeneration and repair.
(268) In one aspect of the invention, there is provided a method of screening for a compound useful in the repair or regeneration of muscle. For example, the method could comprise (a) providing a population of satellite stem cells; (b) treating the stem cells with a test compound; and (c) determining the proportion of symmetrical to asymmetrical divisions of the treated stem cells compared to control, wherein a increase in the proportion of symmetrical divisions compared to control indicates that the compound is useful in the repair or regeneration of muscle.
(269) In another aspect of the invention, there is provided a method of screening for a compound useful in the repair or regeneration of muscle. For example, the method could comprise (a) providing a population of satellite stem cells; (b) treating the stem cells with a test compound; and (c) determining whether the compound activates stimulates PCP signaling in the treated stem cells, wherein a increase in PCP signaling indicates that the compound is useful in the repair or regeneration of muscle.
(270) In some embodiments, the stimulation of PCP signaling occurs via activation of Fzd7. In some embodiments, the increase is an increase of at least about 10%, 25%, 50%, 75% or greater.
(271) Alternatively, the ability of Wnt7a, analogues, derivatives, variants and active fragments thereof, or another activator or effector of PCP signaling, to promote stem cell expansion, optionally in combination with one or more stem cell modulators, may be tested in vivo on resident stem cell populations in an appropriate experimental animal. Similarly inhibitors may be tested in vivo. Typically, the test compound(s) are administered directly to the tissue being investigated, for example, by injection. After a suitable period of time, cells are harvested from the animal and the stem cell population is analyzed as described above.
(272) If desired, an inhibitor can also be tested, for example an inhibitor of canonical Wnt/-catenin signaling. The compound and the inhibitor may be provided to the stem cells concomitantly, or the compound may be provided before or after the inhibitor.
(273) In one embodiment, the ability of the compound(s) to promote stem cell expansion is tested in vivo in murine skeletal muscle tissue. The increase in satellite stem cells isolated from treated mice is monitored and compared to that in control mice, which are either untreated or treated with a placebo, such as buffer or saline solution. In accordance with one embodiment of the invention, a compound is considered to promote stem cell expansion when the satellite stem cell population increases by at least about 10%, e.g. compared to control. Another measure is an increase in the proportion of symmetrical to asymmetrical divisions. The increase in stem cells is measured over a time period of at least 24 hours and more typically over a period of at least 96 hours.
(274) The ability of Wnt7a, analogues, derivatives, variants and active fragments thereof, or other PCP activators or effectors to repair damaged or dysfunctional tissue can be tested in a suitable animal model. Exemplary animal models are described in the Methods section. For example, the ability of the compound(s) and treatments to repair damaged muscle tissue can be tested by administering the compound(s) or treatments to mice exposed to freeze-induced or cardiotoxin induced muscle damage, and monitoring repair of the damaged muscle (see Megeney et al., (1996) Genes Dev., 10:1173-1183; Asakura et al., (2000) J: Cell Biol., 159:123-134).
(275) It has been demonstrated that Fzd7 may be used as a marker for satellite stem cells when used in combination with at least one other stem cell marker. This feature can be used to identify or isolate stem cells for subsequent analysis, treatment, and/or transplantation. It was found that Fzd7 was particularly expressed on quiescent satellite stem cells. Therefore, Fzd7 could also be used as a marker of proliferative state in a stem cell.
(276) It has also been demonstrated that a satellite stem cell may be identified or isolated by selecting for the marker Pax7+ in combination with YFP or Myf. In one embodiment, there is provided a method of identifying or isolating satellite stem cells based on the characteristics YFP/Pax7+. The method can be used to identify and isolate cells for subsequent analysis, treatment, and/or transplantation.
SUMMARY OF EXPERIMENTAL FINDINGS
(277) This section is a summary of the research findings described below in the Examples. The scope of the invention is not in any way limited to the content of this summary or the Examples that follow.
(278) The present inventors previously identified a small population of satellite stem cells and reported that satellite cells represent a heterogeneous population of stem cells and progenitor cells. The satellite stem cells were shown to be capable of self-renewal and long-term reconstitution of the satellite cell niche following transplantation (Kuang et al., 2007).
(279) Through diligent research efforts, the present inventors have now determined that the non-canonical Wnt receptor Fzd7 is specifically expressed in quiescent satellite cells (
(280) The Wnt-PCP pathway plays a role in patterning by instituting polarity of cells within a tissue, such as with the organized orientation of epithelial cells in Drosophila (Zallen, 2007). In vertebrates, PCP signaling, and particularly its effecter Vangl2 (also known as Strabismus), is required for the polarization of stereociliary bundles in the cochlea (Montcouquiol et al., 2003), for convergent extension (CE) movements regulating gastrulation and neurulation (Torban et al., 2004), neural tube closure (Torban et al., 2008), and in regulating myocyte orientation in the developing myotome (Gros et al., 2009). During zebrafish neurulation, loss of Vangl2 abrogates polarization of neural keel cells by preventing re-intercalation of daughter cells into the neuroepithelium, resulting in ectopic neural progenitor accumulation (Ciruna et al., 2006). Based on the findings presented herein, it is now proposed that the symmetric expansion of satellite stem cells results from a PCP-mediated orientation of the axis of stem cell division. Since PCP is a positional signaling relying on the redistribution of effector proteins, polarization of PCP core molecules on opposite poles of the daughter cells allows both cells to maintain contact with the basal lamina and thus preserve their orientation relative to the niche (
(281) The experiments suggest that polarized distribution of Vangl2 protein at the poles of a couplet of daughter cells allows both cells to remain attached to the basal lamina, and therefore maintain a stem cell state, resulting in expansion of the stem cell population. Subsequent cell divisions will generate larger numbers of committed daughter cells through apical-basal asymmetric divisions that will undergo normal expansion and differentiation (
(282) Canonical Wnt-signaling plays a well-documented role in regulating myogenic growth and differentiation. The experiments described herein indicate that activation of Wnt/-catenin signaling using Wnt3a did not interfere with satellite stem cell choice between commitment and symmetric expansion (
(283) In Xenopus embryos, the Vangl2 homolog Strabismus inhibits Wnt/-catenin activated transcription by competing for Disheveled (Park and Moon, 2002). Thus, without wishing to be bound by theory, PCP signaling may also act to keep satellite stem cells in an uncommitted state by antagonizing canonical Wnt/-catenin signaling. In Drosophila eye development, Frizzled (Fzd)/PCP signaling induces cell-fate specification of the R3/R4 photoreceptors through regulation of Notch activation in R4 (del Alamo and Mlodzik, 2006). This raises the possibility that cross-talk between Frizzled/PCP and Notch pathways, as well as Wnt/-catenin pathways, act to coordinate satellite stem cell choice between self-renewal/commitment versus expansion. Molecular characterization of satellite stem cells is providing important insights into the molecular mechanisms regulating their function. The present identification of a role for the Wnt7a/Fzd7/Vangl2 signal transduction cascade reveals an unanticipated role for the PCP pathway in regulating the symmetric expansion of satellite stem cells. This finding represents a significant advance in our understanding of satellite cell biology and muscle regeneration. Future experiments will investigate both the utility of modulating the PCP pathway to augment muscle regeneration towards ameliorating the loss of muscle function in neuromuscular disease.
EXAMPLES
Example 1
(284) Frizzled7 is Highly Expressed in Quiescent Satellite Stem Cells
(285) Satellite cells are a heterogeneous population composed of stem cells and committed progenitors. All satellite cells express Pax7 and markers such as CXCR4, however, the present inventors identified a subset of about 10% of Pax7+ cells that have never expressed Myf5 during their developmental history (
(286) FACS-purified satellite cells were further separated on the basis of Myf5-conditional YFP fluorescence (
(287) To confirm the differential expression suggested by Real-Time PCR, Fzd7 protein expression was examined in myofibers fixed immediately following isolation from extensor digitorum longus (EDL) muscles. Immunohistological analysis revealed that 123% of Pax7.sup.+ satellite cells expressed readily detectable levels of Fzd7 (n=3 mice, >150 cells/mouse). Analysis of myofibers isolated from Myf5-Cre/ROSA26-YFP EDL muscles demonstrated that Fzd7 was specifically upregulated in satellite stem cells (Pax7.sup.30 /Myf5.sup.) that do not contain detectable levels of YFP (
(288) Taken together, these results demonstrate that, in resting muscle, the Wnt receptor Fzd7 is specifically expressed in quiescent satellite stem cells. However, Fzd7 is also upregulated in proliferating satellite cells and myoblasts. Thus, the Fzd7 receptor may be considered a marker of quiescent satellite stem cells in resting muscle, and may be particularly useful as a marker of quiescent satellite stem cells in combination with other stem cells markers. The Fzd7 receptor may also be used as a target for purification of quiescent satellite stem cells, for instance, employing antibodies reactive to Fzd7.
Example 2
(289) Wnt Expression During Muscle Regeneration
(290) The present inventors hypothesized that Wnt7a was a candidate ligand for Fzd7 receptor. Coexpression of Fzd7 and Wnt7a during embryonic myogenesis had been reported (Cossu and Borello, 1999) and Wnt7a had been implicated as a regulator of embryonic and adult myogenesis (Chen et al., 2005; Polesskaya et al., 2003; Tajbakhsh et al., 1998). Real-Time PCR-Array analysis of freeze-injured TA muscle was employed to document Wnt expression during regenerative myogenesis. Freeze injury of muscle was chosen because of the significantly reduced inflammatory response relative to other methods such as cardiotoxin (CTX) injection. Changes in gene expression were analyzed at 3 days post-injury, during the acute phase of regeneration, where most of the Pax7.sup.+ cells are proliferating, and at 6 days post-injury, when satellite cells have returned to a quiescent sub-laminar position (
(291) At 3 days post-injury significant increases (as compared to contralateral leg, n=3 mice, p<0.05) in 31 transcripts were detected, including those for multiple Wnts (Wnt-1, 2, 5b, 8b, 10a, 16a), Frizzled receptors and sFRP inhibitors. Notably, at 6 days post-injury a significant increase (n=3 mice, p<0.05) was detected in the transcript levels for Wnt7a and Wnt10a, (
(292) To confirm Wnt7a up-regulation during muscle regeneration in another muscle injury model, immunohistochemical analysis of Wnt7a protein expression was performed on cryosections of CTX-injured TA (fixed 4 days post-injury) and the contralateral resting TA. In undamaged muscle, Wnt7a was not expressed at detectable levels (
(293) To determine whether Wnt7a is a ligand for Fzd7, cultured satellite cell-derived myoblasts were incubated with recombinant human Wnt7a protein for 30 minutes, washed, fixed and immunostained with anti-Wnt7a antibody. Cells incubated with BSA did not show membrane staining for Wnt7a protein. By contrast, cells incubated with Wnt7a protein exhibited immunostaining on the membrane (
(294) Wnt7a has been described as either a canonical (Hirabayashi et al., 2004) or non canonical Wnt (Kengaku et al., 1998), depending on cell-type and receptor context. To evaluate the possible function of Wnt7a as a canonical Wnt, satellite cell-derived myoblasts were stimulated with Wnt7a and Wnt3a proteins for 24 hours. Wnt3a activates the canonical Wnt pathway in myogenic cells (Brack et al., 2008), and in the present experiment, Wnt3a stimulation resulted in increased expression of -catenin/TCF target genes, for example a 5-fold and 50-fold increase of Tcf7 and Axin2 mRNAs respectively, (n=5, p0.001). By contrast, Wnt7a stimulation did not result in any significant change in Tcf7 and Axin2 levels which were similar to BSA-treated samples (
(295) Taken together, these results indicate that Wnt7a is markedly upregulated by newly formed myofibers during regenerative myogenesis, binds to the Fzd7 receptor at the surface of myogenic cells, and does not utilize the canonical Wnt/-catenin signaling pathway.
Example 3
(296) Symmetry of Satellite Stem Cell Divisions is Regulated by Wnt7a-Frizzled7
(297) The expression of Fzd7 in quiescent satellite stem cells and the marked upregulation in Wnt7a during muscle regeneration suggested that Wnt7a-Fzd7 signaling is involved in regulating muscle stem cell function. In addition, Wnt7a had no effect on the growth or differentiation of cultured primary myoblasts in vitro (
(298) Satellite stem cells (YFP.sup.) either underwent a symmetrical cell division to give rise to two YFP.sup. daughter cells, or an asymmetric cell division to give rise to one YFP.sup. stem cell and one YFP.sup.+ committed precursor (
(299) The experimental analysis suggested that Wnt7a specifically binds the Fzd7 receptor (
(300) These results demonstrate that Wnt7a signals via Fzd7 to stimulate symmetric satellite stem cell division and thus drive the expansion of the satellite stem cell pool.
Example 4
(301) Role for the PCP Component Vangl2 in Satellite Stem Cell Self-Renewal
(302) The analysis indicated that Wnt7a does not activate the canonical Wnt/-catenin signaling pathway (
(303) Vangl2 is a crucial regulator of PCP and non-canonical Wnt-signaling in Drosophila and vertebrates (Torban et al., 2004). In cells with active PCP signaling, Vangl2 protein is distributed at the poles at either end of the axis of polarization and this distribution is lost in PCP mutants (Montcouquiol et al., 2006). Vangl2 protein was not detected in quiescent satellite cells on isolated myofibers, but was upregulated in activated satellite cells as they entered the cell cycle by 24 hours in culture. After 48 h, all Pax7.sup.+ activated satellite cells were also positive for Vangl2 (100%, n=3 mice, 100 cells per mouse) (
(304) Importantly, in the presence of Wnt7a, a significant proportion of dividing doublets of satellite cells on cultured myofibers (294%, n=3, 240 pairs, p0.006) exhibited polarized localization of Vangl2 on opposite poles of the daughter cells (
(305) To investigate the role of Vangl2 in satellite stem cell function, siRNA silencing of Vangl2 was performed on single Myf5-Cre/ROSA26-YFP myofibers stimulated with Wnt7a. Myofibers were first stained with Pax7 and Syndecan4 antibodies to allow visualization of the plane of satellite cell division relative to the fiber, and cell divisions scored as either planar or apical-basal (
(306) To analyze the role of Vangl2 in regulating symmetric satellite cell cell divisions, fibers were cultured for 50 hours and assessed Vangl2 silencing by immunostaining (
(307) These data demonstrate that Wnt7a signaling through Fzd7 requires Vangl2 to induce symmetric expansion of the satellite stem cell pool. Wnt7a also induces polarized distribution of Vangl2 protein at the opposite poles of cells undergoing a symmetric planar cell division. Hence, Wnt7a utilizes the planar cell polarity pathway to control the orientation of satellite cell division and their fate within the niche.
Example 5
(308) Wnt7a Enhances Muscle Regeneration by Expanding the Stem Cell Pool
(309) To investigate the role of the Wnt7a-Fzd7-Vangl2 pathway in muscle regeneration in vivo, Wnt7a was over-expressed by electroporation of a CMV-Wnt7a expression plasmid into TA muscles of 3-month old mice. Histological analysis of muscles electroporated with CMV-LacZ plasmid revealed that majority (>80%) of the myofibers expressed the -galactosidase (
(310) Notably, TA muscles electroporated with CMV-Wnt7a exhibited an 184% (p=0.009, n=8) increase in mass after 3 weeks. Examination of serial sections of electroporated muscles revealed an increase in the overall size of the muscle as well as a significant increase in caliber size and numbers of fibers throughout the body of the muscle (
(311) As previously noted, Wnt7a treatment did not alter the growth or differentiation of activated satellite cells or primary myoblasts in vitro (
(312) To assess whether Wnt7a similarly stimulates the expansion of satellite stem cells in vivo, the numbers of satellite cells and satellite stem cells in regenerated muscle were assessed following electroporation of CMV-Wnt7a. Over-expression of Wnt7a resulted in about a 2-fold increase in the number of Pax7.sup.+ satellite cells per myofiber on sections at 3 weeks after electroporation (p=0.03, n=4). By contrast, over-expression of Wnt3a did not alter the number of satellite cells (
(313) To investigate satellite stem cell function in the absence of Wnt7a, the regeneration phenotype of 3 mo-old Wnt7a.sup./ null mice (Miller and Sassoon, 1998) was examined. Quantification of Pax7-expressing satellite cells on freshly isolated myofibers from EDL muscle demonstrated that Wnt7a.sup./ null mice exhibit about an 18% decrease in number of satellite cells per fiber (p=0.03, n=4) (
(314) Overexpression of Wnt7a in muscle drives expansion of the satellite stem cell pool, and conversely, the satellite cell compartment becomes depleted in the absence of Wnt7a. Together, these data demonstrate a novel role for Wnt7a signaling via the PCP pathway to stimulate satellite stem cell symmetrical cell division to drive expansion. Therefore, Wnt7a regulates the homeostatic levels of the satellite stem cell compartment and thus regulates the efficiency of regenerative myogenesis in adult skeletal muscle.
Example 6
(315) Electroporation of Wnt7a Expression Vector in Mdx Mice Results in Enhanced Number of Satellite Cells and Increased Fiber Diameter
(316) Mdx mice are a well known mouse model for Duchenne muscular dystrophy. The mdx mice harbor a mutation in exon 23 of the dystrophin gene resulting in the generation of a stop codon. The mutation in the dystrophin gene leads to a disruption of the DGC complex (dystrophin-glycoprotein complex) which is crucial for the integrity of muscle fibers.
(317) Referring to
(318) Referring to
(319) Referring to
(320) In summary, electroporation of Wnt7a cDNA into the TA muscle of wt as well as mdx mice increased the number of satellite cells. Also the fiber diameter was increased in wt and mdx mice. These findings suggest that Wnt7a could be a possible treatment for Duchenne muscular dystrophy by increasing the number of satellite cells and thereby preventing an exhaustion of the satellite cell pool. The application of Wnt7a could also be used to increase healing of skeletal muscle after injury or surgery.
Example 7
(321) Administration of Wnt7a Recombinant Protein Produces Effects Similar to Electroporation of a Wnt7a Expression Vector
(322) Referring to
EXPERIMENTAL PROCEDURES
(323) Mice and Animal Care
(324) Adult (8-12 weeks of age) Myf5-Cre/ROSA26-YFP mice were obtained by crossing the knock-in Myf5-Cre (Tallquist et al., 2000) heterozygous mice with ROSA26-YFP (Srinivas et al., 2001) homozygous reporter mice. ROSA26-YFP mice were used as wild type controls. Wnt7a-null mice and their littermates controls were obtained by crossing heterozygous Wnt7a.sup.+/ mice. All mice were maintained inside a barrier facility and experiments were performed following the University of Ottawa regulations for animal care and handling.
(325) Cell Sorting
(326) Mononucleated muscle derived cells were isolated from hind-limb muscles and staining was performed as previously described (Ishibashi et al., 2005; Kuang et al., 2007). Cells were separated on a MoFlo cytometer (DakoCytomation), equipped with 3 lasers. Dead cells and debris were excluded by Hoescht staining, and by gating on forward and side scatters profiles (
(327) Myofiber Isolation, Culture and Immunohistochemistry
(328) Single myofibers were isolated from the EDL muscles as previously described (Charge et al., 2002). Isolated myofibers were cultured in suspension in 6-well plates coated with horse serum to prevent fiber attachment (Kuang et al., 2006). Fibers were incubated in plating medium consisting of 15% FBS (Hyclone) and 1% chick embryo extract (CEE, Accurate Chemicals) in DMEM containing 2% L-glutamine, 4,5% Glucose and 110 mg/ml Sodium Pyruvate. For myoblast culture, satellite cells were sorted and plated on collagen-coated dishes in Ham's F10 medium supplemented with 20% FBS and 5 ng/ml of basic FGF (Invitrogen). For Wnt stimulation, recombinant Wnt7a or Wnt3a proteins were added in the plating medium (25 ng/ml, R&D Systems). For in vivo activation of satellite cells, regeneration was induced by CTX injection in the TA muscle, and four days later, individual myofibers were isolated from the neighboring EDL muscle. Immunochemical labeling of cryosections, myofibers and cells were performed at previously reported (Kuang et al., 2006). The primary antibodies used are listed in Supplemental Table 1.
(329) siRNA Knock-Down
(330) For EDL myofibers, transfections were carried at 4 hours and 24 hours post-dissection in plating medium using Lipofectamine 2000 reagent (Invitrogen) as per manufacturer's instructions. Fibers were re-fed in fresh media on the next mornings and fixed after 42 hours to 72 hours of culture. For Satellite cell-derived myoblasts, cells were re-fed 3 hours prior to transfection and transfections were carried in growth medium. Cells were washed and re-fed with Ham's Complete media 6 hours following transfections. RNA was harvested 48 hours following transfection. siRNA duplexes were from Ambion siFzd7 (ID s66314), siVangl2 (ID s96802) and used at the final concentration of 10 nM each. Transfection efficiency was monitored using Cy3-labeled siRNA. Knock-down efficiency was assessed by real-time PCR (
(331) Real-Time PCR
(332) RNA was isolated using the RNEasy kits (Qiagen) and subjected to on column DNase digestion as per manufacturers instructions. cDNA synthesis was performed using the Superscript III reverse transcriptase and random hexamer primers (Invitrogen). Real-Time PCR was carried out as previously described (Ishibashi et al., 2005). Transcript levels were normalized to GAPDH transcript levels. Relative fold change in expression was calculated using the CT method (CT values <30). For relative transcript quantification, each cDNA sample was run on a 5-point standard curve as to assure a PCR efficiency of 95%. Wnt Signaling Pathway PCR Arrays were purchased from Superarray Bioscience Corporation (PAMM-043) and analysis was performed as per manufacturer' instructions. See Table 2 for primer sequences.
(333) Statistical Analysis
(334) A minimum of 3 and up to 5 replicates was done for experiments presented. Data are presented as standard error of the mean. Results were assessed for statistical significance using Student's T Test (Microsoft Excel) and differences were considered statistically significant at the p<0.05 level. Table 1 below lists antibodies used in carrying out the various experiments performed in connection with the present invention. Table 2 below lists PCR primers used in carrying out the various experiments performed in connection with the present invention.
(335) Muscle Injury
(336) For freeze-induced muscle regeneration, skin and fascia of anesthetized mice were opened and the TA muscles were subjected to three consecutive cycles of freezing-thawing by applying a liquid nitrogen-cooled metallic rod, and the wound closed by suture. For CTX-induced muscle regeneration, 25 ul of diluted cardiotoxin were directly injected into the TA muscle without opening of the skin.
(337) In Vivo Electroporation
(338) 40 g of plasmid DNA in 0.9% NaCl or 0.9% NaCl (saline) was injected directly into the left TA muscle of anesthetized mice, that had been exposed by an incision through the skin. Immediately after injection, electric stimulation was applied directly to the TA by a pulse generator (ECM 830, BTX) of 100-150 volts for 6 pulses, with a fixed duration of 20 ms and an interval of 200 ms using 5 mm needle electrodes (BTX). Experimental and contralateral TA muscles were isolated and embedded in OWNT7A5% Sucrose (Tissue-Tek) and frozen with isopentane cooled by cold nitrogen.
(339) In Vivo Electroporation of Mdx Mice
(340) We electroporated mdx mice (3 month old, male, 3 animals per group) with either 40 ug of a vector containing the coding region of the Wnt7a protein connected to the sequence for an HA (hemagglutinin) epitope under control of the CMV promoter (pHANpuro-Wnt7a-HA) or the pSPORT6-lacZ vector (Invitrogen) as a control. The latter vector was also used to determine the efficiency of the electroporation. Electroporation was carried out as described by LeGrand et al. 2009, mice were sacrificed 2 weeks after electroporation. Electroporation was carried out using the tibialis anterior (TA) muscle. The plasmid used for electroporation was dissolved in 0.9% NaCl, the total volume per TA muscle was 40 ul. For the experiments only one TA was injected and electroporated, the other TA was used as a control.
(341) Sections (14 um) of the TA muscle were stained for Pax7, a marker for all satellite cells, as well as myf5, a marker for committed progenitor cells. Cells which were stained positively for both marker proteins were counted as committed progenitor cells whereas cells only positive for Pax7 were counted as satellite stem cells.
(342) Histology and Quantification
(343) Transverse sections (8 m) of experimental and contralateral muscles were cut with a cryostat (Leica CM1850). The entire TA muscles were sectioned, in order to compare experimental and contralateral muscles at the same level on serial sections (around 400 sections were obtained from each TA muscle). For LacZ reaction, cryosections were fixed with 0.1% gluteraldehyde and exposed to X-gal solution. For H&E and immonostaining, sections were fixed with 4% paraformaldehyde. For enumeration of fibers, pictures of laminin-stained cryosections were assembled and counted on Adobe Photoshop CS2. Quantification of myofibers caliber was performed with ImageJ. The satellite cell enumeration was performed on Photoshop, on pictures of Pax7 and Laminin co-immunostained cryosections taken in regenerated areas where all the fibers had centrally located nuclei. Satellite Cell Content represents the number of sub-laminar Pax7+ve satellite cells normalized per fiber number, and to the contralateral leg.
(344) Subtractive Hybridization
(345) RNA samples (10 ng) from sorted YFP+ and YFP satellite cells were amplified using the Super-SMART cDNA amplification kit (Clontech) following the protocols provided. 2 ug of representative cDNA from each sample were used to generate a subtractive library with the PCR-Select kit (Clontech) as per manufacturer' instructions. The amplified cDNA from sorted YFP.sup. was used as tester and the amplified cDNA from sorted YFP.sup.+ was used as driver. SSH products were cloned in pCR2.1 vector using a TA cloning Kit (Invitrogen) and 200 clones from the SSH library were sequenced with nested primers using the ABI 3730 DNA Analyzers (Applied Biosystems), according to the manufacturers' protocols and manuals.
(346) TABLE-US-00001 TABLE 1 Antibodies Catalog Dilution Supplier number 7-Integrin 1/200 MBL International K0046-3 Active--Catenin 1/500 Millipore Corp 05-665 CD11b 1/200 eBiosciences 12-0112 CD144 1/200 BD Biosciences 555289 CD31 1/200 eBiosciences 12-0451 CD34 1/50 BD Biosciences 553732 CD45 1/200 eBiosciences 12-0311 Celsr2 1/200 MBL International LS-A1943 CXCR4 1/100 BD Biosciences 551968 Frizzled7 1/100 R&D Systems MAB-1981 GFP 1/500 Invitrogen A21311 Laminin 2 1/200 Alexis Biochemicals ALX-804-190 Myf5 1/50 Santa Cruz sc-302 Biotechnology Inc MyoD 1/50 Santa Cruz sc-304 Biotechnology Inc Myogenin 1/100 Santa Cruz sc-578 Biotechnology Inc Myosin Heavy Chain 1/20 DSHB MF20 Pax7 1/10 DSHB PAX7 Prickle1 1/100 Abcam Ab15577 Sca1 1/202 eBiosciences 12-5981 Syndecan4 1/5000 Gift from Brad Olwin Vangl2 1/200 Santa Cruz sc-46561 Biotechnology Inc Wnt7a 1/100 Santa Cruz sc-26360 Biotechnology Inc
(347) TABLE-US-00002 TABLE2 PCRPrimers SEQ ID Primer Sequence Exon Amplicon NO Axin2_F AAGAGAAGCGACCCAGTCAA 2 198 13 Axin2_R CTGCGATGCATCTCTCTCTG 3 14 Celsr1_F GGGGACTACTGCGAGACTGA 2 177 15 Celsr1_R CCCGTTTTTGCATACTCCAC 3 16 Celsr2_F CCGAGGTGGACCTCTGTTAC 2 186 17 Celsr2_R CCACCAACAGGTTGACACAG 3 18 Celsr3_F ATGACCCGGATGTCTCTGAC 1 216 19 Celsr3_R ACTCCTCCGTGATGATGACC 2 20 Dvl1_F CTTACCAGGACCCTGGCTTC 11 246 21 Dvl1_R CCTGACTTCGAGGGCTACTG 12 22 Dvl2_F TATGTCTTCGGGGACCTCAG 13 212 23 Dvl2_R CGAAGAAAGCTCGTGGTAGG 14 24 Dvl3_F GCCTATGGCTTTCCCTTACC 14 198 25 Dvl3_R ACTTGGAGTCCCCAGCTTTT 15 26 Fzd1_F CAAGGTTTACGGGCTCATGT 1 180 27 Fzd1_R GTAACAGCCGGACAGGAAAA 1 28 Fzd3_F CCTTGAGGATGTGCCAAGAT 2 178 29 Fzd3_R GCTATAGGCACGCTGACACA 3 30 Fzd4_F AACCTCGGCTACAACGTGAC 1 150 31 Fzd4_R TGGCACATAAACCGAACAAA 2 32 Fzd6_F AATGGACACTTTTGGCATCC 3 223 33 Fzd6_R AGGGGCACACTGTTCAATTC 4 34 Fzd7_F GCTTCCTAGGTGAGCGTGAC 1 216 35 Fzd7_R AACCCGACAGGAAGATGATG 1 36 Gapdh_F ATGCCAGTGAGCTTCCCGTC 1 470 37 Gapdh_R CATCACCATCTTCCAGGAGC 1 38 Myf5_F TGAAGGATGGACATGACGGACG 1 133 39 Myf5_R TTGTGTGCTCCGAAGGCTGCTA 1 40 MyoD_F TACCCAAGGTGGAGATCCTG 1 200 41 MyoD_R CATCATGCCATCAGAGCAGT 1 42 Myogenin_F GAAAGTGAATGAGGCCTTCG 1 248 43 Myogenin_R ACGATGGACGTAAGGGAGTG 3 44 Notch3_F GATGACACATCAGCCAGCAT 32 248 45 Notch3_R GAGCGGTTCCTGATGAGAAT 33 46 Pax7_F CTGGATGAGGGCTCAGATGT 3 245 47 Pax7_R GGTTAGCTCCTGCCTGCTTA 4 48 Tcf7_F CCCCAGCTTTCTCCACTCTA 4 165 49 Tcf7_R TCACAGTATGGGGGAGCTGT 5 50 Vangl1_F GCACTACCACAGCATGGAGA 7 235 51 Vangl1_R ATTGACCACGAGGCTGAAGT 8 52 Vangl2_F CCCCAGTTCACACTCAAGGT 4 157 53 Vangl2_R ACTTGGGCAGGTTGAGGAG 5 54 Yfp_F GCACGACTTCTTCAAGTCCGCC 1 263 55 ATGCC Yfp_R GCGGATCTTGAAGTTCACCTTG 1 56 ATGCC
NON-PATENT REFERENCES
(348) Anakwe, K., Robson, L., Hadley, J., Buxton, P., Church, V., Allen, S., Hartmann, C., Harfe, B., Nohno, T., Brown, A. M., et al. (2003). Wnt signalling regulates myogenic differentiation in the developing avian wing. Development 130, 3503-3514.
(349) Bae, G. U., Gaio, U., Yang, Y. J., Lee, H. J., Kang, J. S., and Krauss, R. S. (2008). Regulation of myoblast motility and fusion by the CXCR4-associated sialomucin, CD164. J Biol Chem 283, 8301-8309.
(350) Borello, U., Berarducci, B., Murphy, P., Bajard, L., Buffa, V., Piccolo, S., Buckingham, M., and Cossu, G. (2006). The Wnt/beta-catenin pathway regulates Gli-mediated Myf5 expression during somitogenesis. Development 133, 3723-3732.
(351) Brack, A. S., Conboy, I. M., Conboy, M. J., Shen, J., and Rando, T. A. (2008). A temporal switch from notch to Wnt signaling in muscle stem cells is necessary for normal adult myogenesis. Cell Stem Cell 2, 50-59.
(352) Cerletti, M., Jurga, S., Witczak, C. A., Hirshman, M. F., Shadrach, J. L., Goodyear, L. J., and Wagers, A. J. (2008). Highly efficient, functional engraftment of skeletal muscle stem cells in dystrophic muscles. Cell 134, 37-47.
(353) Charge, S. B., Brack, A. S., and Hughes, S. M. (2002). Aging-related satellite cell differentiation defect occurs prematurely after Ski-induced muscle hypertrophy. Am J Physiol Cell Physiol 283, C1228-1241.
(354) Charge, S. B., and Rudnicki, M. A. (2004). Cellular and molecular regulation of muscle regeneration. Physiol Rev 84, 209-238.
(355) Chen, A. E., Ginty, D. D., and Fan, C. M. (2005). Protein kinase A signalling via CREB controls myogenesis induced by Wnt proteins. Nature 433, 317-322.
(356) Ciruna, B., Jenny, A., Lee, D., Mlodzik, M., and Schier, A. F. (2006). Planar cell polarity signalling couples cell division and morphogenesis during neurulation. Nature 439, 220-224.
(357) Clevers, H. (2006). Wnt/beta-catenin signaling in development and disease. Cell 127, 469-480.
(358) Collins, C. A., Olsen, I., Zammit, P. S., Heslop, L., Petrie, A., Partridge, T. A., and Morgan, J. E. (2005). Stem cell function, self-renewal, and behavioral heterogeneity of cells from the adult muscle satellite cell niche. Cell 122, 289-301.
(359) Cornelison, D. D., Filla, M. S., Stanley, H. M., Rapraeger, A. C., and Olwin, B. B. (2001). Syndecan-3 and syndecan-4 specifically mark skeletal muscle satellite cells and are implicated in satellite cell maintenance and muscle regeneration. Dev Biol 239, 79-94.
(360) Cornelison, D. D., Wilcox-Adelman, S. A., Goetinck, P. F., Rauvala, H., Rapraeger, A. C., and Olwin, B. B. (2004). Essential and separable roles for Syndecan-3 and Syndecan-4 in skeletal muscle development and regeneration. Genes Dev 18, 2231-2236.
(361) Cossu, G., and Borello, U. (1999). Wnt signaling and the activation of myogenesis in mammals. Embo J 18, 6867-6872.
(362) Dann et al. Nature, 412, Jul. 5, 2001, p. 86-90
(363) del Alamo, D., and Mlodzik, M. (2006). Frizzled/PCP-dependent asymmetric neuralized expression determines R3/R4 fates in the Drosophila eye. Dev Cell 11, 887-894.
(364) Diatchenko, L., Lau, Y., Campbell, A., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E., et al. (1997). Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA 93, 6025-6030.
(365) Egger-Adam, D., and Katanaev, V. L. (2008). Trimeric G protein-dependent signaling by Frizzled receptors in animal development. Front Biosci 13, 4740-4755.
(366) Goto, T., Davidson, L., Asashima, M., and Keller, R. (2005). Planar cell polarity genes regulate polarized extracellular matrix deposition during frog gastrulation. Curr Biol 15, 787-793.
(367) Gros, J., Serralbo, O., and Marcelle, C. (2009). WNT11 acts as a directional cue to organize the elongation of early muscle fibres. Nature 457, 589-593.
(368) Hirabayashi, Y., Itoh, Y., Tabata, H., Nakajima, K., Akiyama, T., Masuyama, N., and Gotoh, Y. (2004). The Wnt/beta-catenin pathway directs neuronal differentiation of cortical neural precursor cells. Development 131, 2791-2801.
(369) Ishibashi, J., Perry, R. L., Asakura, A., and Rudnicki, M. A. (2005). MyoD induces myogenic differentiation through cooperation of its NH2- and COOH-terminal regions. J Cell Biol 171, 471-482.
(370) Kengaku, M., Capdevila, J., Rodriguez-Esteban, C., De La Pena, J., Johnson, R. L., Belmonte, J. C., and Tabin, C. J. (1998). Distinct WNT pathways regulating AER formation and dorsoventral polarity in the chick limb bud. Science 280, 1274-1277.
(371) Kuang, S., Charge, S. B., Seale, P., Huh, M., and Rudnicki, M. A. (2006). Distinct roles for Pax7 and Pax3 in adult regenerative myogenesis. J Cell Biol 172, 103-113.
(372) Kuang, S., Gillespie, M. A., and Rudnicki, M. A. (2008). Niche regulation of muscle satellite cell self-renewal and differentiation. Cell Stem Cell 2, 22-31.
(373) Kuang, S., Kuroda, K., Le Grand, F., and Rudnicki, M. A. (2007). Asymmetric self-renewal and commitment of satellite stem cells in muscle. Cell 129, 999-1010.
(374) Matthews, H. K., Marchant, L., Carmona-Fontaine, C., Kuriyama, S., Larrain, J., Holt, M. R., Parsons, M., and Mayor, R. (2008). Directional migration of neural crest cells in vivo is regulated by Syndecan-4/Rac1 and non-canonical Wnt signaling/RhoA. Development 135, 1771-1780.
(375) McKinnell, I. W., Ishibashi, J., Le Grand, F., Punch, V. G., Addicks, G. C., Greenblatt, J. F., Dilworth, F. J., and Rudnicki, M. A. (2008). Pax7 activates myogenic genes by recruitment of a histone methyltransferase complex. Nat Cell Biol 10, 77-84.
(376) Miller, C., and Sassoon, D. A. (1998). Wnt-7a maintains appropriate uterine patterning during the development of the mouse female reproductive tract. Development 125, 3201-3211.
(377) Montarras, D., Morgan, J., Collins, C., Relaix, F., Zaffran, S., Cumano, A., Partridge, T., and Buckingham, M. (2005). Direct isolation of satellite cells for skeletal muscle regeneration. Science 309, 2064-2067.
(378) Montcouquiol, M., Rachel, R. A., Lanford, P. J., Copeland, N. G., Jenkins, N. A., and Kelley, M. W. (2003). Identification of Vangl2 and Scrb1 as planar polarity genes in mammals. Nature 423, 173-177.
(379) Montcouquiol, M., Sans, N., Huss, D., Kach, J., Dickman, J. D., Forge, A., Rachel, R. A., Copeland, N. G., Jenkins, N. A., Bogani, D., et al. (2006). Asymmetric localization of Vangl2 and Fz3 indicate novel mechanisms for planar cell polarity in mammals. J Neurosci 26, 5265-5275.
(380) Munoz, R., Moreno, M., Oliva, C., Orbenes, C., and Larrain, J. (2006). Syndecan-4 regulates non-canonical Wnt signalling and is essential for convergent and extension movements in Xenopus embryos. Nat Cell Biol 8, 492-500.
(381) Oustanina, S., Hause, G., and Braun, T. (2004). Pax7 directs postnatal renewal and propagation of myogenic satellite cells but not their specification. The EMBO journal 23, 3430-3439.
(382) Park, M., and Moon, R. T. (2002). The planar cell-polarity gene stbm regulates cell behaviour and cell fate in vertebrate embryos. Nat Cell Biol 4, 20-25.
(383) Polesskaya, A., Seale, P., and Rudnicki, M. A. (2003). Wnt signaling induces the myogenic specification of resident CD45+adult stem cells during muscle regeneration. Cell 113, 841-852.
(384) Rochat, A., Fernandez, A., Vandromme, M., Moles, J. P., Bouschet, T., Carnac, G., and Lamb, N. J. (2004). Insulin and wnt1 pathways cooperate to induce reserve cell activation in differentiation and myotube hypertrophy. Mol Biol Cell 15, 4544-4555.
(385) Sacco, A., Doyonnas, R., Kraft, P., Vitorovic, S., and Blau, H. M. (2008). Self-renewal and expansion of single transplanted muscle stem cells. Nature 456, 502-506.
(386) Seale, P., Sabourin, L. A., Girgis-Gabardo, A., Mansouri, A., Gruss, P., and Rudnicki, M. A. (2000). Pax7 is required for the specification of myogenic satellite cells. Cell 102, 777-786.
(387) Seifert, J. R., and Mlodzik, M. (2007). Frizzled/PCP signalling: a conserved mechanism regulating cell polarity and directed motility. Nat Rev Genet 8, 126-138.
(388) Srinivas, S., Watanabe, T., Lin, C. S., William, C. M., Tanabe, Y., Jessell, T. M., and Costantini, F. (2001). Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1, 4.
(389) Tajbakhsh, S., Borello, U., Vivarelli, E., Kelly, R., Papkoff, J., Duprez, D., Buckingham, M., and Cossu, G. (1998). Differential activation of Myf5 and MyoD by different Wnts in explants of mouse paraxial mesoderm and the later activation of myogenesis in the absence of Myf5. Development 125, 4155-4162.
(390) Tallquist, M. D., Weismann, K. E., Hellstrom, M., and Soriano, P. (2000). Early myotome specification regulates PDGFA expression and axial skeleton development. Development 127, 5059-5070.
(391) Torban, E., Kor, C., and Gros, P. (2004). Van Gogh-like2 (Strabismus) and its role in planar cell polarity and convergent extension in vertebrates. Trends Genet 20, 570-577.
(392) Torban, E., Patenaude, A. M., Leclerc, S., Rakowiecki, S., Gauthier, S., Andelfinger, G., Epstein, D. J., and Gros, P. (2008). Genetic interaction between members of the Vangl family causes neural tube defects in mice. Proc Natl Acad Sci USA 105, 3449-3454.
(393) Torrente, Y., Belicchi, M., Sampaolesi, M., Pisati, F., Meregalli, M., D'Antona, G., Tonlorenzi, R., Porretti, L., Gavina, M., Mamchaoui, K., et al. (2004). Human circulating AC133(+) stem cells restore dystrophin expression and ameliorate function in dystrophic skeletal muscle. J Clin Invest 114, 182-195.
(394) Zallen, J. A. (2007). Planar polarity and tissue morphogenesis. Cell 129, 1051-1063. All references cited are incorporated herein by reference in their entirety.
(395) The above-described embodiments of the invention are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art without departing from the scope of the invention, which is defined solely by the claims appended hereto.