Multicistronic expression constructs
10829783 ยท 2020-11-10
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/14152
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2830/42
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Some aspects of this invention provide nucleic acid constructs for transgene expression. Some aspects of this invention provide multicistronic nucleic acid constructs, for example, comprising an expression cassette encoding a hairpin RNA and a reporter expression cassette. Some aspects of this invention provide nucleic acid constructs comprising two or more self-complementary nucleic acid sequences, for example, hairpin RNA encoding nucleic acid sequences and AAV inverse terminal repeats. Methods for the use of the constructs in therapy and research are also provided.
Claims
1. A nucleic acid construct, comprising: (i) an adeno-associated virus (AAV) inverted terminal repeat (ITR), (ii) a first expression cassette, comprising a nucleic acid encoding a first gene product under the control of a first promoter, wherein the first gene product is a therapeutic protein, and (iii) a second expression cassette, comprising a self-complementary nucleic acid sequence under the control of a second promoter, wherein the self-complementary nucleic acid encodes a hairpin RNA, wherein the AAV ITR lacks a functional terminal resolution site (TRS ITR), wherein the first and the second expression cassette are in the same orientation and the nucleic acid construct comprises less than 500 nucleotides between the TRS ITR and the second expression cassette.
2. The nucleic acid construct of claim 1, wherein the hairpin RNA is a small hairpin RNA or a microRNA.
3. The nucleic acid construct of claim 1, wherein the first promoter is an RNA polymerase II promoter.
4. The nucleic acid construct of claim 1, wherein the second promoter is an RNA polymerase III promoter.
5. The nucleic acid construct of claim 4, wherein the second promoter is a U6 or H1 promoter.
6. The nucleic acid construct of claim 1, wherein the nucleic acid construct comprises at least 150 nucleotides between the ITR and the second expression cassette.
7. The nucleic acid construct of claim 1, wherein the nucleic acid construct comprises at least 50 nucleotides between the ITR and the self-complementary nucleic acid sequence.
8. The nucleic acid construct of claim 1, wherein the nucleic acid construct comprises less than 400 nucleotides between the TRS ITR and the second expression cassette.
9. A recombinant AAV (rAAV), comprising the nucleic acid construct of claim 1 and an AAV capsid protein.
10. A composition comprising the rAAV of claim 9 and a pharmaceutically acceptable salt.
11. The nucleic acid construct of claim 2, wherein the hairpin RNA targets an RNA transcribed from an oncogene, a tumor suppressor gene, or a viral gene.
12. A method, comprising contacting a cell expressing a target gene with the rAAV of claim 9.
13. The method of claim 12, wherein the target gene is an oncogene, a tumor suppressor gene, or a viral gene.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
DETAILED DESCRIPTION
(19) Multicistronic expression constructs allow the expression of a plurality of gene products from a single nucleic acid and are useful in many basic research and therapeutic applications. One beneficial feature of multicistronic expression constructs is the possibility to express two or more gene products from the same nucleic acid construct, achieving simultaneous expression of the two or more gene products in a target cell. For example, some multicistronic expression constructs provided herein allow for expression of a gene product of interest from a first expression cassette of the multicistronic construct, and for monitoring that expression by detecting a reporter expressed from a second expression cassette included in the same multicistronic construct. Multicistronic expression/reporter constructs are of high value in therapeutic and research applications in which expression of the gene product of interest is not easily detectable in a target cell. Examples for such hard-to-detect gene products are non-translated RNAs, such as shRNAs, siRNAs, and microRNAs, as well as proteins that cannot be detected by conventional immunostaining methods, for example, for lack of a suitable antibody. Detecting a reporter expressed from the same nucleic acid construct as the gene product of interest can serve as an efficient proxy for identifying cells that do express the gene product of interest, thus facilitating or enabling monitoring, enrichment, purification, positive and/or negative selection, and observation of cells expressing an otherwise hard or impossible to detect gene product of interest.
(20) Some aspects of this invention are based on the surprising discovery that efficient expression of multiple expression cassettes can be effected from multicistronic expression constructs comprising a first expression cassette including an intron, and a second expression cassette positioned within the intron of the first expression cassette, either in the same or in the opposite orientation of the first expression cassette.
(21) Some aspects of this invention are related to the surprising discovery that such nested multicistronic expression constructs can be introduced into an AAV genome, for example, an scAAV genome, and can be efficiently packaged into infectious AAV virus particles.
(22) Multicistronic Nucleic Acid Constructs
(23) General Structure and Definitions
(24) Some aspects of this invention provide multicistronic nucleic acid constructs.
(25) The term cistron, as used herein, refers to a nucleic acid cassette sufficient for expression of a gene product. In some embodiments, a cistron is an expression cassette. Accordingly, some aspects of this invention provide nucleic acid constructs comprising two or more cistrons, for example, two or more expression cassettes.
(26) The term nucleic acid construct, as used herein, refers to an isolated or artificially generated construct comprising a nucleic acid molecule. Non-limiting examples of nucleic acid constructs are plasmids, cosmids, bacterial artificial chromosomes, and nucleic acid vectors. The term vector is art recognized and refers to any nucleic acid useful to transfer a nucleic acid into a cell. Examples of vectors are plasmid vectors, gene targeting vectors, and viral vectors, for example parvoviral vectors, such as AAV vectors. A vector may comprise a nucleic acid construct in single-stranded or double-stranded form, and may comprise additional molecules, for example, DNA-associated proteins or viral capsid or envelope proteins. Vectors for eukaryotic and prokaryotic cells are well known to those in the art and include, for example, linear and circular DNA or RNA, viral vectors, (e.g., retroviral and parvoviral vectors, such as lentivirus-derived, Moloney murine leukemia virus-derived, adenovirus-derived, and AAV-derived vectors).
(27) The term isolated, refers to the characteristic of a material as provided herein being removed from its original or native environment (e.g., the natural environment if it is naturally occurring). Therefore, a naturally-occurring polynucleotide or protein or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated by human intervention from some or all of the coexisting materials in the natural system, is isolated. An artificial or engineered material, for example, a non-naturally occurring nucleic acid construct, such as the expression constructs and vectors described herein, are, accordingly, also referred to as isolated. A material does not have to be purified in order to be isolated. Accordingly, a material may be part of a vector and/or part of a composition, and still be isolated in that such vector or composition is not part of the environment in which the material is found in nature.
(28) As used herein, the term nucleic acid molecule, refers to an isolated or artificially produced polymer of nucleotides. The term includes, but is not limited to, oligonucleotides and polynucleotides, and single-stranded and double-stranded forms, including hybrids, for example, of DNA and RNA strands, or of strands comprising ribonucleotides, deoxyribonucleotides, and/or modified nucleotides. The polymer may include natural nucleosides (i.e., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, dihydrouridine, methylpseudouridine, 1-methyl adenosine, 1-methyl guanosine, N6-methyl adenosine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2-fluororibose, ribose, 2-deoxyribose, 2-O-methylcytidine, arabinose, and hexose), or modified phosphate groups (e.g., phosphorothioates and 5-N-phosphoramidite linkages).
(29) The term expression cassette, as used herein, refers to a nucleic acid construct comprising nucleic acid elements sufficient for the expression of a gene product. Typically, an expression cassette comprises a nucleic acid encoding a gene product operatively linked to a promoter sequence. The term operatively linked refers to the association of two or more nucleic acid fragments on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operatively linked with a coding sequence when it is capable of affecting the expression of that coding sequence (e.g., the coding sequence is under the transcriptional control of the promoter). Encoding sequences can be operatively linked to regulatory sequences in sense or antisense orientation. In some embodiments, the promoter is a heterologous promoter. The term heterologous promoter, as used herein, refers to a promoter that does is not found to be operatively linked to a given encoding sequence in nature. In some embodiments, an expression cassette may comprise additional elements, for example, an intron, an enhancer, a polyadenylation site, a woodchuck response element (WRE), and/or other elements known to affect expression levels of the encoding sequence. Without wishing to be bound by theory, inclusion of an intron in an expression cassette, for example, between the transcriptional start site and an encoding nucleic acid sequence, for example, a protein-encoding cDNA sequence, is believed to result in increased expression levels of the encoding nucleic acid and the encoded gene product as compared to an expression construct not including an intron.
(30) The term intron is art recognized and refers to a nucleic acid sequence in an expression cassette that is removed after transcription of a primary transcript by a cellular process termed splicing. Intron sequences generally comprise a splice donor and a splice acceptor and sequences of such donor and acceptor sites are well known to those of skill in the art. The term positioned within an intron, as used herein, refers to a nucleic acid construct, for example, an expression cassette, that is positioned between a splice donor and a splice acceptor sites of an intronic sequence.
(31) The term gene product, as used herein, refers to any product encoded by a nucleic acid sequence. Accordingly, a gene product may, for example, be a primary transcript, a mature transcript, a processed transcript, or a protein or peptide encoded by a transcript. Examples for gene products, accordingly, include mRNAs, rRNAs, hairpin RNAs (e.g. microRNAs, shRNAs, siRNAs, tRNAs), and peptides and proteins, for example, reporter proteins or therapeutic proteins.
(32) The term promoter, as used herein, refers to a nucleotide sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a nucleic acid sequence encoding a gene product is located 3 of a promoter sequence. In some embodiments, a promoter sequence consists of proximal and more distal upstream elements and can comprise an enhancer element. An enhancer is a nucleotide sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. In some embodiments, the promoter is derived in its entirety from a native gene. In some embodiments, the promoter is composed of different elements derived from different naturally occurring promoters. In some embodiments, the promoter comprises a synthetic nucleotide sequence. It will be understood by those skilled in the art that different promoters will direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions or to the presence or the absence of a drug or transcriptional co-factor. Ubiquitous, cell-type-specific, tissue-specific, developmental stage-specific, and conditional promoters, for example, drug-responsive promoters (e.g. tetracycline-responsive promoters) are well known to those of skill in the art. In some embodiments, the promoter is a RNA polymerase I promoter. In some embodiments, the promoter is a RNA polymerase II promoter. In some embodiments, the promoter is a RNA polymerase III promoter. Promoters mediating transcription by recruiting RNA polymerase I (e.g. most rRNA gene promoters), II (e.g. U6 and H1 promoters), or III (e.g. most promoters of protein-encoding genes), are well known to those of skill in the art. While protein encoding nucleic acid sequences are typically expressed from RNA pol II promoters and hairpin RNA encoding nucleic acid sequences from RNA pol III promoters, it is possible to express both types of gene products from either promoter type.
(33) The term reporter, as used herein, refers to a gene product, encoded by a nucleic acid comprised in an expression construct as provided herein, that can be detected by an assay or method known in the art, thus reporting expression of the construct. Reporters and nucleic acid sequences encoding reporters are well known in the art. Reporters include, for example, fluorescent proteins, such as green fluorescent protein (GFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), enhanced fluorescent protein derivatives (e.g. eGFP, eYFP, eRFP, mCherry, etc.), enzymes (e.g. enzymes catalyzing a reaction yielding a detectable product, such as luciferases, beta-glucuronidases, chloramphenicol acetyltransferases, aminoglycoside phosphotransferases, aminocyclitol phosphotransferases, or puromycin N-acetyl-tranferases), and surface antigens. Appropriate reporters will be apparent to those of skill in the related arts.
(34) Multicistronic Expression Construct Configuration: Position and Orientation of Cassettes
(35) Some aspects of this invention provide multicistronic expression constructs comprising two or more expression cassettes in various configurations.
(36) In different embodiments, multicistronic expression constructs are provided in which the expression cassettes are positioned in different ways. For example, in some embodiments, a multicistronic expression construct is provided in which a first expression cassette is positioned adjacent to a second expression cassette. In some embodiments, a multicistronic expression construct is provided in which a first expression cassette comprises an intron, and a second expression cassette is positioned within the intron of the first expression cassette. In some embodiments, the second expression cassette, positioned within an intron of the first expression cassette, comprises a promoter and a nucleic acid sequence encoding a gene product operatively linked to the promoter.
(37) In different embodiments, multicistronic expression constructs are provided in which the expression cassettes are oriented in different ways. For example, in some embodiments, a multicistronic expression construct is provided in which a first expression cassette is in the same orientation as a second expression cassette. In some embodiments, a multicistronic expression construct is provided comprising a first and a second expression cassette in opposite orientations.
(38) The term orientation as used herein in connection with expression cassettes, refers to the directional characteristic of a given cassette or structure. In some embodiments, an expression cassette harbors a promoter 5 of the encoding nucleic acid sequence, and transcription of the encoding nucleic acid sequence runs from the 5 terminus to the 3 terminus of the sense strand, making it a directional cassette (e.g. 5-promoter/(intron)/encoding sequence-3). Since virtually all expression cassettes are directional in this sense, those of skill in the art can easily determine the orientation of a given expression cassette in relation to a second nucleic acid structure, for example, a second expression cassette, a viral genome, or, if the cassette is comprised in an AAV construct, in relation to an AAV ITR.
(39) For example, if a given nucleic acid construct comprises two expression cassettes in the configuration 5-promoter 1/encoding sequence 1promoter2/encoding sequence 2-3,
(40) the expression cassettes are in the same orientation, the arrows indicate the direction of transcription of each of the cassettes. For another example, if a given nucleic acid construct comprises a sense strand comprising two expression cassettes in the configuration
(41) 5-promoter 1/encoding sequence 1encoding sequence 2/promoter 2-3,
(42) the expression cassettes are in opposite orientation to each other and, as indicated by the arrows, the direction of transcription of the expression cassettes, are opposed. In this example, the strand shown comprises the antisense strand of promoter 2 and encoding sequence 2.
(43) For another example, if an expression cassette is comprised in an AAV construct, the cassette can either be in the same orientation as an AAV ITR (e.g. the structures given in SEQ ID NOs: 1 and 2), or in opposite orientation. AAV ITRs are directional. For example, the 3ITR exemplified in SEQ ID NO: 2 would be in the same orientation as the promoter1/encoding sequence 1 expression cassette of the examples above, but in opposite orientation to the TRS 5ITR provided in SEQ ID NO: 1, if both ITRs and the expression cassette would be on the same nucleic acid strand.
(44) Exemplary multicistronic expression constructs harboring two expression cassettes, a CMV/CB-intron-eGFP cassette and a U6siFluc expression cassette, in the same orientation are shown in
(45) A large body of evidence suggests that multicistronic expression constructs often do not achieve optimal expression levels as compared to expression systems containing only one cistron. One of the suggested causes of sub-par expression levels achieved with multicistronic expression constructs comprising two ore more promoter elements is the phenomenon of promoter interference (see, e.g., Curtin J A, Dane A P, Swanson A, Alexander I E, Ginn S L. Bidirectional promoter interference between two widely used internal heterologous promoters in a late-generation lentiviral construct. Gene Ther. 2008 March; 15(5):384-90; and Martin-Duque P, Jezzard S, Kaftansis L, Vassaux G. Direct comparison of the insulating properties of two genetic elements in an adenoviral vector containing two different expression cassettes. Hum Gene Ther. 2004 October; 15(10):995-1002; both references incorporated herein by reference for disclosure of promoter interference phenomenon). Various strategies have been suggested to overcome the problem of promoter interference, for example, by producing multicistronic expression constructs comprising only one promoter driving transcription of multiple encoding nucleic acid sequences separated by internal ribosomal entry sites, or by separating cistrons comprising their own promoter with transcriptional insulator elements. All suggested strategies to overcome promoter interference are burdened with their own set of problems, though. For example, single-promoter driven expression of multiple cistrons usually results in uneven expression levels of the cistrons. Further some promoters cannot efficiently be isolated and isolation elements are not compatible with some gene transfer vectors, for example, some retroviral vectors.
(46) In some embodiments of this invention, a multicistronic expression construct is provided that allows efficient expression of a first encoding nucleic acid sequence driven by a first promoter and of a second encoding nucleic acid sequence driven by a second promoter without the use of transcriptional insulator elements. Various configurations of such multicistronic expression constructs are provided herein, for example, expression constructs harboring a first expression cassette comprising an intron and a second expression cassette positioned within the intron, in either the same or opposite orientation as the first cassette. Other configurations are described in more detail elsewhere herein.
(47) In some embodiments, multicistronic expression constructs are provided allowing for efficient expression of two or more encoding nucleic acid sequences. In some embodiments, the multicistronic expression construct comprises two expression cassettes. In some embodiments, a first expression cassette of a multicistronic expression construct as provided herein comprises an RNA polymerase II promoter and a second expression cassette comprises an RNA polymerase III promoter.
(48) In some embodiments, the multicistronic expression construct provided is a recombinant AAV (rAAV) construct.
(49) AAV and rAAV
(50) Adeno-associated virus (AAV) is a small (20 nm) replication-defective, nonenveloped DNA virus, that depends on the presence of a second virus, for example, adenovirus or herpesvirus, for productive infection. AAV is not known to cause disease and induces a very mild immune response. AAV can infect both dividing and non-dividing cells and stably incorporates its genome into that of the host cell. AAV vectors based on serotype 2 provided a proof-of-concept for non-toxic and stable gene transfer in murine and large animal models. AAV vectors having distinct tissue targeting capabilities have been developed for gene therapy and research applications. Various serotypes of AAV are known in the art. AAV serotype affects tissue tropism of the respective viral particles and allows to target specific cell types or tissues, making AAV vectors attractive for in vivo gene delivery applications in which only a specific cell type or tissue is targeted and/or gene transfer into non-targeted cells or tissues is not desirable.
(51) Wild type AAV particles harbor a single-stranded DNA genome comprising two genes: The AAV rep gene encodes proteins controlling viral replication, structural gene expression, and integration into the host genome. The AAV cap gene encodes capsid structural proteins. The 5 and 3 termini each comprise an inverted terminal repeat region (ITR), which is involved in multiplication of the AAV genome. In some embodiments, an AAV ITR sequence comprises 145 nucleotides. In general, an AAV ITR sequence is a self-complementary nucleic acid structure that is able to form a hairpin, which plays a role in AAV self-priming for synthesis of the second DNA AAV strand during the viral life cycle. An exemplary ITR is described herein as SEQ ID NO: 2. Recombinant AAV (rAAV) vectors are generally produced by replacing the viral genes, or parts thereof, with a heterologous expression cassettes. Typically, rAAV genomes up to about 5 kb in length can efficiently be packaged into infectious viral particles useful for gene transfer. In some embodiments, the rAAV construct is a single-stranded rAAV construct. That is, the rAAV construct contains two ITRs, a 5ITR and a 3ITR that comprise a functional TRS each. In some embodiments, one of the ITRs, for example, the 5ITR is a TRS ITR. In some such embodiments, the AAV construct is a double-stranded, self-complementary AAV (scAAV) construct. For an overview of AAV biology, ITR function, and scAAV constructs, see McCarty D M. Self-complementary AAV vectors; advances and applications. Mol Ther. 2008 October; 16(10): at pages 1648-51, first full paragraph, incorporated herein by reference for disclosure of AAV and scAAV constructs, ITR function, and role of TRS ITR in scAAV constructs. An exemplary TRS ITR, also referred to as deltaITR, deltaTRS ITR, or ITR herein, is described in SEQ ID NO: 1. A rAAV vector comprising a TRS ITR cannot correctly be nicked during the replication cycle and, accordingly, produces a self-complementary, double-stranded AAV (scAAV) genome, which can efficiently be packaged into infectious AAV particles. Various rAAV, ssAAV, and scAAV vectors, as well as the advantages and drawbacks of each class of vector for specific applications and methods of using such vectors in gene transfer applications are well known to those of skill in the art (see, for example, Choi V W, Samulski R J, McCarty D M. Effects of adeno-associated virus DNAhairpin structure on recombination. J Virol. 2005 June; 79(11):6801-7; McCarty D M, Young S M Jr, Samulski R J. Integration of adeno-associated virus (AAV) and recombinant AAV vectors. Annu Rev Genet. 2004; 38:819-45; McCarty D M, Monahan P E, Samulski R J. Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther. 2001 August; 8(16):1248-54; and McCarty D M. Self-complementary AAV vectors; advances and applications. Mol Ther. 2008 October; 16(10):1648-56; all references cited in this application are incorporated herein by reference for disclosure of AAV, rAAV, and scAAV vectors).
(52) The term recombinant AAV construct refers to an AAV construct comprising an AAV 5ITR, at least one recombinant expression cassette, and a 3ITR. In some embodiments, a rAAV vector is packaged into a capsid protein and delivered to a selected target cell. In some embodiments, the transgene is an expression cassette, comprising a nucleic acid sequence heterologous to the AAV sequences, and encoding a gene product. The encoding nucleic acid coding sequence is operatively linked to a regulatory component, for example, a promoter, in a manner permitting transcription, translation, and/or expression of the gene product in a cell of a target tissue. Recombinant AAV based vectors harboring multicistronic expression constructs are provided herein. In some embodiments, rAAV vectors are engineered to target specific cells, cell types, or tissues, for example, liver tissue.
(53) The AAV sequences of a rAAV construct provided herein typically comprise the cis-acting 5 and 3 inverted terminal repeat sequences (See, e.g., B. J. Carter, in Handbook of Parvoviruses, ed., P. Tijsser, CRC Press, pp. 155 168 (1990)). The ITR sequences are about 145 bp in length. Preferably, substantially the entire sequences encoding the ITRs are used in the molecule, although some degree of minor modification of these sequences is permissible. The ability to modify these ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al, Molecular Cloning. A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520 532 (1996)). AAV ITR sequences may be obtained from any known AAV, including presently identified mammalian AAV types.
(54) In addition to the major elements identified above for the rAAV vectors and constructs, a rAAV vector may also include additional transcriptional control elements. Transcriptional control elements are known to those of skill in the art and exemplary elements include transcription initiation, termination, promoter and enhancer sequences, RNA processing signals such as splicing and polyadenylation (polyA) signals, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (e.g., Kozak consensus sequences), sequences that enhance protein stability, and, if appropriate, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters which are native, constitutive, inducible and/or tissue-specific, are known in the art and may be utilized.
(55) In some embodiments, transcriptional control elements or sequences impart tissue-specific gene expression capabilities to a multicistronic expression construct as provided herein. In some embodiments, tissue-specific transcriptional control sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art.
(56) rAAVs: Production Methods
(57) Methods for obtaining rAAV preparations having a desired capsid protein are well known in the art. (See, for example, US 2003/0138772), the contents of which are incorporated herein by reference in their entirety). Typically the methods involve culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein or fragment thereof; a functional rep gene; a recombinant AAV vector composed of, AAV inverted terminal repeats (ITRs) and an expression cassette encoding a transgene; and sufficient helper functions to permit packaging of the recombinant AAV vector into the AAV capsid proteins.
(58) The components to be cultured in the host cell to package a rAAV vector in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., recombinant AAV vector, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art. Most suitably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion of regulatory elements suitable for use with the transgene. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, a stable host cell may be generated which is derived from 293 cells (which contain E1 helper functions under the control of a constitutive promoter), but which contain the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.
(59) The recombinant AAV vector, rep sequences, cap sequences, and helper functions required for producing the rAAV of the invention may be delivered to the packaging host cell using any appropriate genetic element (vector). The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, J. Virol., 70:520-532 (1993) and U.S. Pat. No. 5,478,745.
(60) In some embodiments, recombinant AAVs may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650). Typically, the recombinant AAVs are produced by transfecting a host cell with an recombinant AAV vector (comprising a transgene) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector. An AAV helper function vector encodes the AAV helper function sequences (i.e., rep and cap), which function in trans for productive AAV replication and encapsidation. Preferably, the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use with the present invention include pHLP19, described in U.S. Pat. No. 6,001,650 and pRep6cap6 vector, described in U.S. Pat. No. 6,156,303, the entirety of both incorporated by reference herein. The accessory function vector encodes nucleotide sequences for non-AAV derived viral and/or cellular functions upon which AAV is dependent for replication (i.e.,accessory functions). The accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus.
(61) In some aspects, the invention provides transfected host cells. The term transfection is used to refer to the uptake of foreign DNA by a cell, and a cell has been transfected when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more exogenous nucleic acids, such as a nucleotide integration vector and other nucleic acid molecules, into suitable host cells. Transfection may be achieved, for example, by infecting a cell with an rAAV harboring an rAAV vector.
(62) A host cell refers to any cell that harbors, or is capable of harboring, a substance of interest. Often a host cell is a mammalian cell. A host cell may be used as a recipient of an AAV helper construct, an AAV transgene plasmid, e.g., comprising a promoter operably linked with an miRNA inhibitor, an accessory function vector, or other transfer DNA associated with the production of recombinant AAVs. The term includes the progeny of the original cell which has been transfected. Thus, a host cell as used herein may refer to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.
(63) As used herein, the term cell line refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.
(64) As used herein, the terms recombinant cell refers to a cell into which an exogenous DNA segment, such as DNA segment that leads to the transcription of a biologically-active polypeptide or production of a biologically active nucleic acid such as an RNA, has been introduced.
(65) Nucleic Acid Constructs Harboring Multiple Self-Complementary Nucleic Acid Sequences
(66) Some aspects of this invention provide rAAV constructs harboring a heterologous self-complementary nucleic acid sequence, for example, as part of a hairpin RNA expression cassette. Some aspects of this invention relate to the surprising discovery that an expression cassette comprising a nucleic acid sequence encoding a self-complementary RNA positioned in proximity to an AAV-ITR, can efficiently be expressed if the ITR is a TRS ITR, independent of the orientation of the expression cassette. In some embodiments, an AAV expression construct is provided comprising an expression cassette encoding a hairpin RNA in close proximity to a rAAV ITR. In some embodiments, proximal positioning refers to the expression cassette and the ITR being separated by less than about 500, less than about 400, less than about 300, less than about 250, less than about 200, less than about 100, less than about 50, less than about 25, or less than about 10 nucleotides.
(67) In some embodiments, a multicistronic AAV expression construct is provided comprising an expression cassette encoding a hairpin RNA and oriented in opposite orientation to a second expression cassette comprised in the expression construct. In some embodiments, the hairpin expression cassette is positioned in proximity to the ITR.
(68) In some embodiments, a multicistronic AAV expression vector is provided in which a hairpin expression cassette is positioned adjacent to a functional ITR. In some embodiments, the expression cassette and the functional ITR are separated by at least about 150, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1000 nucleotides.
(69) Methods of Use
(70) The multicistronic expression constructs provided herein are useful in various research and therapeutic applications. In some embodiments, a cell is contacted with an expression construct as provided herein. In some embodiments, the cell expresses a transcript comprising a target sequence corresponding or complementary to a hairpin RNA sequence encoded by the expression construct. In some embodiments, expression of the target sequence is decreased by expression of a corresponding hairpin RNA sequence in the cell. In some embodiments, the effect of expression of a multicistronic expression construct as provided herein on a phenotypic parameter of the cell is monitored after the cell has been contacted with the expression construct. Examples for phenotypic parameters of a cell include, but are not limited to, cell viability, cell survival, cell proliferation rate, cell growth rate, cell shape, cell size, cell volume, cell expression profile, cell surface marker expression, resistance to antibiotic drugs, and cell reaction to drug treatment. Methods of determining and monitoring such parameters are well known to those of skill in the relevant arts.
(71) Some aspects of this invention provide a cell contacted with a multicistronic expression construct provided herein. In some embodiments, the cell comprises the multicistronic expression construct, or a fragment thereof, integrated into the cell's genome. In some embodiments, the cell is a non-human mammalian cell. In some embodiments, the cell is a human cell.
(72) Methods for contacting a cell with a nucleic acid construct, for example, a nucleic acid construct provided herein, are well known to those of skill in the art and include, for example, electroporation of naked nucleic acid constructs, transfection of nucleic acid constructs complexed with transfection agents, such as Fugene or Lipofectamine, or transduction of cells with nucleic acid constructs packaged into viral particles, for example, AAV, or retroviral particles. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells. In some embodiments, a cell is contacted with an expression construct in vitro. In some embodiments, a cell is contacted in vivo, for example, in a subject. In some embodiments, a cell is obtained from a subject, contacted ex vivo, and subsequently returned to a subject, for example, to the same subject the cell was obtained from.
(73) Recombinant AAV Administration Methods
(74) In some embodiments, the multicistronic rAAV expression constructs provided herein are delivered to a subject in compositions according to any appropriate methods known in the art. The rAAV, preferably suspended in a physiologically compatible carrier (i.e., in a composition), may be administered to a subject, such as, for example, a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or a non-human primate (e.g., Macaque).
(75) In some embodiments, delivery of the rAAV expression constructs provided herein to a subject is effected via intravenous injection, e.g., injection into a portal vein. Administration into the bloodstream may be by injection into a vein, an artery, or any other vascular conduit. In some embodiments, rAAVs are injected into the bloodstream by way of isolated limb perfusion, a technique well known in the surgical arts, the method essentially enabling the artisan to isolate a limb from the systemic circulation prior to administration of the rAAV virions. A variant of the isolated limb perfusion technique, described in U.S. Pat. No. 6,177,403, can also be employed by the skilled artisan to administer the rAAVs into the vasculature of an isolated limb to potentially enhance transduction into muscle cells or tissue. Moreover, in some embodiments, it may be desirable to deliver the virions to the CNS of a subject. CNS refers to all cells and tissue of the brain and spinal cord of a vertebrate. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cereobrospinal fluid (CSF), interstitial spaces, bone, cartilage and the like. Recombinant AAVs may be delivered directly to the CNS or brain by injection into, e.g., the ventricular region, as well as to the striatum (e.g., the caudate nucleus or putamen of the striatum), spinal cord and neuromuscular junction, or cerebellar lobule, with a needle, catheter or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000).
(76) In certain circumstances it will be desirable to deliver the rAAV-based therapeutic constructs in suitably formulated pharmaceutical compositions disclosed herein either subcutaneously, intrapancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, the administration modalities as described in U.S. Pat. Nos. 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety) may be used to deliver rAAVs. In some embodiments, a preferred mode of administration is by portal vein injection.
(77) The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
(78) For administration of an injectable aqueous solution, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, a sterile aqueous medium that can be employed will be known to those of skill in the art. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, Remington's Pharmaceutical Sciences 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.
(79) Sterile injectable solutions are prepared by incorporating the active rAAV in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
(80) The compositions of the invention may comprise an rAAV alone, or in combination with one or more other viruses (e.g., a second rAAV encoding having one or more different transgenes). In some embodiments, a compositions comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs each comprising one or more different expression cassettes or configurations.
(81) Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the rAAV is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present invention.
(82) Optionally, the compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.
(83) The rAAVS are administered in sufficient amounts to transfect the cells of a desired tissue and to provide sufficient levels of gene transfer and expression without undue adverse effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the selected organ (e.g., intraportal delivery to the liver), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parental routes of administration. Routes of administration may be combined, if desired.
(84) The dose of rAAV virions required to achieve a particular therapeutic effect, e.g., the units of dose in vector genomes/per kilogram of body weight (vg/kg), will vary based on several factors including, but not limited to: the route of rAAV virion administration, the level of gene or RNA expression required to achieve a therapeutic effect, the specific disease or disorder being treated, and the stability of the gene or RNA product. One of skill in the art can readily determine a rAAV virion dose range to treat a patient having a particular disease or disorder based on the aforementioned factors, as well as other factors that are well known in the art.
(85) An effective amount of an rAAV is an amount sufficient to target infect an animal, target a desired tissue. In some embodiments, an effective amount of an rAAV is an amount sufficient to produce a stable somatic transgenic animal model. The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. For example, a effective amount of the rAAV is generally in the range of from about 1 ml to about 100 ml of solution containing from about 10.sup.9 to 10.sup.16 genome copies. In some cases, a dosage between about 10.sup.11 to 10.sup.12 rAAV genome copies is appropriate. In certain preferred embodiments, 10.sup.12 rAAV genome copies is effective to target heart, liver, and pancreas tissues. In some cases, stable transgenic animals are produced by multiple doses of an rAAV.
(86) Formulation of pharmaceutically-acceptable excipients and carrier solutions is well-known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens.
(87) Typically, these formulations may contain at least about 0.1% of the active compound or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of active compound in each therapeutically-useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
(88) The rAAV constructs and compositions disclosed herein may also be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.
(89) As used herein, carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase pharmaceutically-acceptable refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.
(90) Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells. In particular, the rAAV vector delivered trangenes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
(91) Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids or the rAAV constructs disclosed herein. The formation and use of liposomes is generally known to those of skill in the art. Recently, liposomes were developed with improved serum stability and circulation half-times (U.S. Pat. No. 5,741,516). Further, various methods of liposome and liposome like preparations as potential drug carriers have been described (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).
(92) Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of the DNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trails examining the effectiveness of liposome-mediated drug delivery have been completed.
(93) Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs). MLVs generally have diameters of from 25 nm to 4 m. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 .ANG., containing an aqueous solution in the core.
(94) Alternatively, nanocapsule formulations of the rAAV may be used. Nanocapsules can generally entrap substances in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 m) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.
(95) In addition to the methods of delivery described above, the following techniques are also contemplated as alternative methods of delivering the rAAV compositions to a host. Sonophoresis (e.g., ultrasound) has been used and described in U.S. Pat. No. 5,656,016 as a device for enhancing the rate and efficacy of drug permeation into and through the circulatory system. Other drug delivery alternatives contemplated are intraosseous injection (U.S. Pat. No. 5,779,708), microchip devices (U.S. Pat. No. 5,797,898), ophthalmic formulations (Bourlais et al., 1998), transdermal matrices (U.S. Pat. Nos. 5,770,219 and 5,783,208) and feedback-controlled delivery (U.S. Pat. No. 5,697,899).
(96) Compositions and Kits
(97) The multicistronic expression constructs described herein may, in some embodiments, be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. A kit may include one or more containers housing the components of the invention and instructions for use. Specifically, such kits may include one or more agents described herein, along with instructions describing the intended application and the proper use of these agents. In certain embodiments agents in a kit may be in a pharmaceutical formulation and dosage suitable for a particular application and for a method of administration of the agents. Kits for research purposes may contain the components in appropriate concentrations or quantities for running various experiments.
(98) The kit may be designed to facilitate use of the methods described herein by researchers and can take many forms. Each of the compositions of the kit, where applicable, may be provided in liquid form (e.g., in solution), or in solid form, (e.g., a dry powder). In certain cases, some of the compositions may be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit. As used herein, instructions can define a component of instruction and/or promotion, and typically involve written instructions on or associated with packaging of the invention. Instructions also can include any oral or electronic instructions provided in any manner such that a user will clearly recognize that the instructions are to be associated with the kit, for example, audiovisual (e.g., videotape, DVD, etc.), Internet, and/or web-based communications, etc. The written instructions may be in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions can also reflects approval by the agency of manufacture, use or sale for animal administration.
(99) The kit may contain any one or more of the components described herein in one or more containers. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and/or isolating and mixing a sample and applying to a subject. The kit may include a container housing agents described herein. The agents may be in the form of a liquid, gel or solid (powder). The agents may be prepared sterilely, packaged in syringe and shipped refrigerated. Alternatively it may be housed in a vial or other container for storage. A second container may have other agents prepared sterilely. Alternatively the kit may include the active agents premixed and shipped in a syringe, vial, tube, or other container. The kit may have one or more or all of the components required to administer the agents to an animal, such as a syringe, topical application devices, or iv needle tubing and bag, particularly in the case of the kits for producing specific somatic animal models.
(100) Hairpin RNAs and RNAi
(101) Some aspects of this invention provide methods for the use of expression constructs provided herein to effect RNA interference (RNAi) in a target cell. In some embodiments, the construct used to effect RNAi in the target cell is a multicistronic expression construct as provided herein comprising a hairpin RNA expression cassette.
(102) RNAi, a key cellular pathway utilizing double-stranded RNAs, such as shRNAs or microRNAs as provided herein, as sequence-specific regulators, can be harnessed for a wide spectrum of potential therapeutic and basic research applications. RNAi has been proposed as a cellular response to the presence of double-stranded RNA (dsRNA) in the cell. It is believed that dsRNAs, for example, small hairpin RNAs (shRNAs) and microRNAs (miRNAs) are cleaved into 20-base pair (bp) duplexes of small-interfering RNAs (siRNAs) by Dicer. It is further believed that siRNAs, either exogenously introduced into a cell or generated by Dicer from shRNA, miRNA, or other substrates, bind to the RNA-induces silencing complex (RISC), where they are unwound and the sense strand, also called the passenger strand is discarded. The antisense strand of the siRNA, also referred to as the guide strand, complexed with RISC then binds to a complementary target sequence, for example, a target sequence comprised in an mRNA, which is subsequently cleaved by Slicer, resulting in inactivation of the nucleic acid molecule comprising the target sequence. As a result, the expression of mRNAs containing the target sequence is reduced.
(103) Target sequence recognition and binding by the siRNA guide strand is not completely stringent. While guide strands complementary to a given target sequence have been demonstrated to effect efficient target sequence cleavage and inhibition of expression, it is also known in the art that nucleic acid sequences containing sequences corresponding to the siRNA guide strand can also be efficiently targeted. In connection with RNAi, two nucleic acid sequences are referred to as corresponding sequences, if they are either complementary, or if the degree of complementarity is high enough to allow recognition and binding of the target sequence by the guide strand under physiological conditions. Methods and algorithms to engineer efficient siRNA sequences complementary or corresponding to a given target sequence, or to determine whether a given siRNA sequence will effect inhibition of target sequence expression, are well known to those in the art. Suitable algorithms are publicly available (e.g., from Whitehead Institute for Biomedical Research, Cambridge, Mass., at jura.wi.mit.edu/bioc/siRNAext/). Methods to engineer and synthesize hairpin RNAs and nucleic acid sequences encoding such hairpin RNAs are also well known to those of skill in the art. The term hairpin RNA refers to a self-complementary, single-stranded RNA comprising a first nucleic acid sequence and a second nucleic acid sequence complementary to the first nucleic acid sequence positioned in a manner that allows the two sequences to anneal. In some embodiments, the two complementary sequences are separated by a third nucleic acid sequence, the hairpin loop sequence, that is not self-complementary and remains single-stranded after the two complementary sequences have annealed to form the double-stranded stem region of the hairpin, thus allowing formation of a hairpin structure. In some embodiments, the first nucleic acid sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides long. In some embodiments, the first nucleic acid sequence is between about 50 to about 100 nucleotides long. Accordingly, a nucleic acid encoding a hairpin structure comprises a self-complementary sequence that may form a secondary structure by self-annealing of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or about 50 to about 100 consecutive nucleotides forming intramolecular base pairs. In some embodiments, the stem region of a hairpin RNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 base pair mismatches.
(104) A hairpin RNA, accordingly, may be any RNA comprising a self-complementary nucleic acid sequence able to form a hairpin structure, for example, as described above. Non-limiting examples for hairpin RNAs are mRNAs comprising a hairpin structure, tRNAs, small hairpin RNAs also referred to as short hairpin RNAs (shRNAs) and microRNAs, also referred to as miRNAs or miRs. A nucleic acid molecule encoding a hairpin RNA is necessarily a nucleic acid comprising a self-complementary nucleic acid sequence (encoding the stem-loop-stem structure of the hairpin RNA). In single-stranded form, such encoding nucleic acids may form a hairpin structure by self annealing of the self-complementary nucleic acid sequence in analogy to the encoded hairpin RNA. Without wishing to be bound by theory, it is believed that a hairpin RNA expressed in a target cell is processed by the cell's RNAi machinery, as described in more detail elsewhere herein and as known to those of skill in the art, to form a small interfering RNA (siRNA). As described elsewhere herein and as known to those of skill in the related arts, siRNAs can efficiently and specifically inhibit expression of their target gene. Nucleic acid sequences encoding hairpin RNAs and methods and algorithms for designing and generating hairpin RNAs targeted to a given gene are well known to those of skill in the art. As used herein, the term target sequence refers to a nucleotide sequence targeted by a nucleic acid molecule, for example a nucleic acid molecule provided herein, as part of the RNAi mechanism. For example, in some embodiments, a target sequence is a sequence of an mRNA encoding a protein to which a given nucleic acid molecule, for example a nucleic acid molecule complexed with RISC would bind. In some embodiments, a target sequence is a sequence that is specific for a transcript to be targeted. For example, in some embodiments, a target sequence of a specific mRNA is a sequence unique to the specific mRNA.
(105) In general, the guide strand of a given siRNA recognizes and binds to a target sequence that is complementary to the guide strand sequence. Stringent complementarity between guide strand and target sequence is, however, not required, as it is known in the art that a guide strand still efficiently recognizes and binds to a target sequence with single or multiple base pair mismatches. Accordingly, while stringent complementarity between guide strand and target sequence is preferred in some embodiments, a sufficient degree of complementarity between guide strand and target sequence is given, where the guide strand sequence and the target sequence are complementary for all but 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base pair mismatch. In some embodiments, a sufficient degree of complementarity between guide strand and target sequence is given, where the guide strand sequence and the target sequence share 100%, about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, about 90%, about 89%, about 88%, about 87%, about 86%, about 85%, about 84%, about 83%, about 82%, about 81%, or about 8%.
(106) RNAi Applications
(107) Various methods and vectors for the expression of siRNAs in a variety of target cells are known in the art, including direct delivery of siRNA complexes or expression from a nucleic acid construct comprising a nucleic acid encoding an siRNA precursor, for example, a hairpin RNA, such as a shRNA or miRNA. In some embodiments, a nucleic acid construct for siRNA expression comprises an expression cassette including a self-complementary nucleic acid sequence encoding a transcript comprising a self-complementary region, for example, a hairpin RNA.
(108) Methods for hairpin RNA and, thus, siRNA expression include, but are not limited to, transient expression methods, for example, methods involving transfection or transduction of non-integrating DNA or RNA constructs into a target cell, or constitutive expression methods, for example, methods involving transfection or transduction of nucleic acid constructs that integrate into the genome of the target cell or are maintained epichromosomally in the target cell.
(109) The function and advantage of these and other embodiments of the present invention will be more fully understood from the examples below. The following examples are intended to illustrate the benefits of the present invention, but do not exemplify the full scope of the invention.
EXAMPLES
(110) Materials and Methods
(111) Nucleic Acid Constructs
(112) In order to test the positional effects in nucleic acid constructs harboring a plurality of expression cassettes and/or a plurality of self-complementary nucleic acid sequences, a series of non-viral and viral expression constructs was generated.
(113) The expression cassettes used were (1) a CMV/CB-intron-eGFP cassette, comprising a CMV enhancer (SEQ ID NO: 3), a CB promoter (SEQ ID NO: 4), an intron (SEQ ID NO: 5), a nucleic acid encoding enhanced green fluorescent protein (eGFP) (SEQ ID NO: 6), and a 3UTR/polyadenylation signal/GRE element (SEQ ID NO: 7); and (2) a U6siFluc cassette (SEQ ID NO: 10), comprising a U6 promoter (SEQ ID NO: 8) and a nucleic acid encoding an shRNA targeting a luciferase mRNA (siFluc) (SEQ ID NO: 9).
(114) Some of the nucleic acid constructs were AAV constructs, further comprising a 5ITR (an inverted terminal repeat lacking a functional terminal resolution site, SEQ ID NO: 2) and a 3ITR (a functional AAV ITR including a functional TRS, SEQ ID NO: 1). Both ITR and 5ITR sequences comprise self-complementary nucleic acid sequences.
(115) In some of the constructs generated the expression cassettes (1) and (2) were in the same orientation, while in some other constructs they were in opposite, or inverted, orientation to each other. The constructs in which the expression cassettes were in opposite orientation, comprised an inverted U6siFluc cassette, U6Fluc.sup.inv (SEQ ID NO: 11). The constructs generated, non-viral constructs A1 and A2, and AAV constructs A, B1, B2, C1, C2, D1, and D2, are disclosed in SEQ ID NOs: 12-20 and the respective vector maps are shown in
(116) AAV Genome Copy (GC) Number Titration
(117) The genome copy (GC) number of an AAV vector preparation is a measure of the number of AAV particles with full genome content in that preparation and can be determined by real time PCR, or Q-PCR. Typically, validated controls representing known GC benchmarks are assayed in parallel to a given AAV preparation and the actual GC number can be determined from comparing the results obtained from the benchmark samples to the given AAV preparation.
(118) AAV Infectious Titer Determination (Q-PCR)
(119) AAV titers can be determined by standard techniques, for example, the infectious center assay (ICA). Alternatively, Q-PCR assays can be employed to determine AAV titers. Typically, such Q-PCR assays are based upon limiting dilution of the vector and an endpoint or 50% endpoint determination of viral DNA replication using real-time PCR. AAV vectors may be serially diluted and a cell line expressing AAV rep and cap may be co-infected with these dilutions plus wildtype Ad5 in parallel replicates. The presence of AAV rep and adenovirus helper genes allows for the replication of AAV DNA. After a suitable incubation period, DNA is extracted and endpoint or 50% endpoint determination is performed. Validation samples may be included. A GC:infectivity (GC:I) ratio may be calculated based upon the results of both the GC copy number titration and Q-PCR assay results. The GC:I ratio is used as a measure of infectivity of the preparation with low GC:I ratios indicating more infectious vector lots. The GC:I ratios between different lots of the same serotype are useful in assessing the relative potency of a particular preparation.
Example 1
(120) Expression of eGFP and siRNA from Expression Constructs Comprising an eGFP and a Hairpin Expression Cassette in Different Positional Configurations.
(121) The AAV constructs A, B1, C1, and D1, comprising the U6siFluc cassette at three different positions (see
(122) To compare siFluc expression levels among the AAV constructs mentioned above, they were further assayed for their ability to inhibit expression of their target luciferase mRNA. Cells expressing the target luciferase mRNA were transfected with plasmid DNA comprising the respective construct and luciferase activity was measured subsequent to transfection (
(123) Together, the eGFP and siFluc expression results indicate that a hairpin expression cassette can be positioned upstream, downstream, or within an intron of a second expression cassette, for example, a reporter expression cassette without affecting the expression level of the hairpin RNA encoded by the hairpin RNA expression cassette or the gene product encoded by the second expression cassette. Further, the results indicate that a hairpin RNA expression cassette can be positioned in close proximity of a promoter of a second expression cassette without affecting the expression levels of the encoded hairpin RNA or the gene product encoded by the second expression cassette, for example, through promoter interference. Finally, a siRNA can efficiently be expressed from a hairpin RNA expression cassette positioned within an intron of a second expression cassette, without affecting the expression level of the gene product, for example, a reporter (e.g., eGFP), encoded by the second expression cassette.
Example 2
(124) Expression of eGFP and siFluc from Constructs Comprising an eGFP Expression Cassette and an siRNA Expression Cassette in Different Orientation Configurations.
(125) To investigate the effect of the orientation of the hairpin expression cassette relative to the second expression cassette on expression of siFluc and eGFP, constructs B2, C2, and D2, comprising the hairpin RNA expression cassette at the same position as constructs B1, C1, and D1, respectively, but in opposite orientation, were transfected into cells and eGFP expression was examined by fluorescent microscopy. Construct A served as a control construct.
(126) To compare siFluc expression levels among the AAV constructs mentioned above, they were further assayed for their ability to inhibit expression of their target luciferase mRNA. As described above, cells expressing the target luciferase mRNA were transfected with plasmid DNA comprising the respective construct and luciferase activity was measured subsequent to transfection, using the same positive and negative pRNA controls as described above (
(127) Together, the eGFP and siFluc expression results indicate that a hairpin expression cassette can be positioned upstream, downstream, or within an intron of a second expression cassette, for example, a reporter expression cassette, and in either the same or in the opposite direction of the second expression cassette, without affecting the expression level of the hairpin RNA encoded by the hairpin RNA expression cassette or the gene product encoded by the second expression cassette. Further, the results indicate that a hairpin RNA expression cassette can be positioned in close proximity of a promoter of a second expression cassette, and in either the same or in the opposite orientation as the second expression cassette, without affecting the expression levels of the encoded hairpin RNA or the gene product encoded by the second expression cassette, for example, through promoter interference. Finally, a siRNA can efficiently be expressed from a hairpin RNA expression cassette positioned within an intron of a second expression cassette, and either in the same or in the opposite orientation as the second expression cassette, without affecting the expression level of the gene product, for example, a reporter (e.g., eGFP), encoded by the second expression cassette.
Example 3
(128) Effect of a Hairpin Expression Cassette on Yield and Titer of AAV Constructs.
(129) In order to investigate the effect of a hairpin cassette on AAV packaging efficiency, the yield and titer of AAV construct A (no hairpin cassette) was compared to the yield and titer of construct D1 (hairpin expression cassette cloned between eGFP expression cassette and 3 ITR in the same orientation as the eGFP cassette).
(130) Both yield and titer were decreased in the sh scAAV vector as compared to non-hairpin scAAV vector, indicating that the presence of a hairpin RNA expression cassette in the configuration of AAV construct D1 can inhibit AAV packaging (
Example 4
(131) Positional and Orientation Effects of a Hairpin Cassette on Yield and Titer of AAV Constructs.
(132) In order to investigate whether a hairpin RNA expression cassette could be introduced into an scAAV genome at a different position or in a different orientation than the configuration provided in AAV construct D1 without detrimental effect on AAV genome packaging efficiency, titers and yields of AAV constructs B1-D2 were determined (
(133) A comparison of packaging efficiencies of constructs B1, B2, C1, C2, D1, and D2 with two different shRNA expression cassettes is shown in
(134) In order to elucidate the packaging efficiencies of the different AAV constructs in more detail, the genome copy number (GC) and the number of AAV particles (VP) was assessed for the 6 different AAV constructs B1-D2 with two different shRNA expression cassettes. Genome copy numbers were analyzed by qPCR for the 6 AAV constructs (
(135) The results of the yield determination of the different AAV constructs was similar: AAV constructs B1-C2 achieved yields comparable to or higher than those obtained with the positive control vector, while AAV construct D1 yields were significantly diminished (
(136) Viral particle number was assessed for the 6 AAV constructs by SDS-PAGE and GC/VP ratios were calculated for each construct (
(137)
(138) Southern blot analysis of AAV replication was assessed for all AAV constructs at three different time points and the data obtained is shown in
(139)
(140) Together, these results demonstrate that hairpin RNA expression cassettes can efficiently be expressed from scAAV vectors comprising a reporter expression cassette. In order to maximize packaging efficiency, yield, and infectivity of shRNA AAV preparations, the hairpin RNA cassette may be positioned either between the ITR and the reporter expression cassette, or within the intron, if present, of the reporter expression cassette. If positioned between the reporter expression cassette and a functional ITR, the hairpin cassette may either be inserted in an orientation in which the promoter of the hairpin RNA cassette is between the self-complementary nucleic acid sequence encoding the hairpin RNA and the functional ITR, or, alternatively, at a minimum distance of at least 300 nucleotides from the ITR, with greater numbers between the self-complementary The resulting multicistronic scAAV constructs can efficiently be packaged and expressed in target cells regardless of the orientation of the hairpin cassette.
REFERENCES
(141) The entire contents of all of the references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference for the purposes or subject matter referenced herein.
SEQUENCES
(142) The following sequences are exemplary sequences of nucleic acid constructs disclosed herein, or parts thereof. Exemplary nucleic constructs comprising some of the sequences provided below are shown in
(143) TABLE-US-00001 5TRSITR(5ITR,AAVinvertedterminalrepeat withterminalresolutionsitedeleted)(SEQID NO:1): ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcg ggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagg gagtg 3ITR(SEQIDNO:2): aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcg ctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccg ggcggcctcagtgagcgagcgagcgcgcag CMVenhancer(SEQIDNO:3): tacggtaaatggcccgcctggctgaccgcccaacgaccccgcccattgac gtcaataatgacgtatgttcccatagtaacgccaatagggactttccatt gacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacat caagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaa atggcccgcctggcattatgcccagtacatgaccttatgggactttccta cttggcagtacatctactcgaggccacgttctgctt CBpromoter(SEQIDNO:4): tctccccatctcccccccctccccacccccaattttgtatttatttattt tttaattattttgtgcagcgatgggggaggggggggggggggggggggcg cgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcgga gaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttcctttt atggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcg ggcgggagcgggatc Intron(SEQIDNO:5): gaactgaaaaaccagaaagttaactggtaagtttagtctttttgtcttt tatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcct cagtggatgttgcctttacttctaggcctgtacggaagtgttacttctg ctctaaaagctgcggaattgtaccc eGFPencodingnucleicacidsequence(SEQID NO:6): atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctgg tcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcga gggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgc accaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctga cctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagca cgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcacc atcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagt tcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgactt caaggaggacggcaacatcctggggcacaagctggagtacaactacaac agccacaacgtctatatcatggccgacaagcagaagaacggcatcaagg tgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgc cgaccactaccagcagaacacccccatcggcgacggccccgtgctgctg cccgacaaccactacctgagcacccagtccgccctgagcaaagacccca acgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgg gatcactctcggcatggacgagctgtacaag BGH3UTR/PolyA/GRE(partial)(SEQIDNO:7): ctcgactgtgccttctagttgccagccatctgttgtttgcccctccccc gtgccttccttgaccctggaaggtgccactcccactgtcctttcctaat aaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattct ggggggtggggtggggcaggacagcaagggggaggattgggaagacaat U6promoter(SEQIDNO:8) aattccccagtggaaagacgcgcaggcaaaacgcaccacgtgacggagc gtgaccgcgcgccgagcgcgcgccaaggtcgggcaggaagagggcctat ttcccatgattccttcatatttgcatatacgatacaaggctgttagaga gataattagaattaatttgactgtaaacacaaagatattagtacaaaat acgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaat tatgttttaa NucleicacidsequenceencodingsiFluc:SEQID NO:9) aatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttg ggtttatatatcttgtggaaaggacgcgggatcccgcttacgctgagta cttcgattcaagagatcgaagtactcagcgtaagttttttccaaa
(144) Bold: first and second nucleic acid sequences encoding stem regions of hairpin RNA targeting luciferase mRNA; underlined: hairpin loop region.
(145) TABLE-US-00002 U6siF1uc(SEQIDNO:10): aattccccagtggaaagacgcgcaggcaaaacgcaccacgtgacggagcg tgaccgcgcgccgagcgcgcgccaaggtcgggcaggaagagggcctattt cccatgattccttcatatttgcatatacgatacaaggctgttagagagat aattagaattaatttgactgtaaacacaaagatattagtacaaaatacgt gacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgt tttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgattt cttgggtttatatatcttgtggaaaggacgcgggatcccgcttacgctga gtacttcgattcaagagatcgaagtactcagcgtaagttttttccaaa U6siFluc.sup.inv(SEQIDNO:11): gcttttggaaaaaacttacgctgagtacttcgatctcttgaatcgaagta ctcagcgtaagcgggatcccgcgtcctttccacaagatatataaacccaa gaaatcgaaatactttcaagttacggtaagcatatgatagtccattttaa aacataattttaaaactgcaaactacccaagaaattattactttctacgt cacgtattttgtactaatatctttgtgtttacagtcaaattaattctaat tatctctctaacagccttgtatcgtatatgcaaatatgaaggaatcatgg gaaataggccctcttcctgcccgaccttggcgcgcgctcggcgcgcggtc acgctccgtcacgtggtgcgttttgcctgcgcgtctttccactgggg
(146) Non-viral Constructs:
(147) Construct A1. CMV/CB-intron-U6Fluc-intron-eGFP, U6Fluc cassette positioned within intron of eGFP cassette, both expression cassettes in same orientation (SEQ ID NO: 12, see
(148) TABLE-US-00003 tacggtaaatggcccgcctggctgaccgcccaacgaccccgcccattgac gtcaataatgacgtatgttcccatagtaacgccaatagggactttccatt gacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacat caagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaa atggcccgcctggcattatgcccagtacatgaccttatgggactttccta cttggcagtacatctactcgaggccacgttctgcttcactctccccatct cccccccctccccacccccaattttgtatttatttattttttaattattt tgtgcagcgatgggggcggggggggggggggggggggcgcgcgccaggcg gggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcg gcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcg gcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagcgg gatcagccaccgcggtggcggccctagagtcgatcgaggaactgaaaaac cagaaagttaactggtaagtttagtctttttgtcttttatttcagaattc cccagtggaaagacgcgcaggcaaaacgcaccacgtgacggagcgtgacc gcgcgccgagcgcgcgccaaggtcgggcaggaagagggcctatttcccat gattccttcatatttgcatatacgatacaaggctgttagagagataatta gaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgt agaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaa aatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttgg gtttatatatcttgtggaaaggacgcgggatcccgcttacgctgagtact tcgattcaagagatcgaagtactcagcgtaagttttttccaaagtcccgg atccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcctt tacttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaa ttgtacccgcggccgatccaccggtcgccaccatggtgagcaagggcgag gagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgt aaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacct acggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtg ccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcag ccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgc ccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaac tacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccg catcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggc acaagctggagtacaactacaacagccacaacgtctatatcatggccgac aagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcga ggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcg gcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtcc gccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctgga gttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagt aaagcggccatcaagcttatcgataccgtcgactagagctcgctgatcag cctcgactgtgccttctagttgccagccatctgttgtttgcccctccccc gtgccttccttgaccctggaaggtgccactcccactgtcctttcctaata aaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctgg ggggtggggtggggcaggacagcaagggggaggattgggaagacaat
(149) Construct A2. CMV/CB-intron-U6Fluc.sup.inv-intron-eGFP, U6Fluc cassette positioned within intron of eGFP cassette, expression cassettes in opposite orientation (SEQ ID NO: 13, see
(150) TABLE-US-00004 tacggtaaatggcccgcctggctgaccgcccaacgaccccgcccattgac gtcaataatgacgtatgttcccatagtaacgccaatagggactttccatt gacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacat caagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaa atggcccgcctggcattatgcccagtacatgaccttatgggactttccta cttggcagtacatctactcgaggccacgttctgcttcactctccccatct cccccccctccccacccccaattttgtatttatttattttttaattattt tgtgcagcgatgggggcggggggggggggggggggggcgcgcgccaggcg gggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcg gcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcg gcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagcgg gatcagccaccgcggtggcggccctagagtcgatcgaggaactgaaaaac cagaaagttaactggtaagtttagtctttttgtcttttatttcaggcttt tggaaaaaacttacgctgagtacttcgatctcttgaatcgaagtactcag cgtaagcgggatcccgcgtcctttccacaagatatataaacccaagaaat cgaaatactttcaagttacggtaagcatatgatagtccattttaaaacat aattttaaaactgcaaactacccaagaaattattactttctacgtcacgt attttgtactaatatctttgtgtttacagtcaaattaattctaattatct ctctaacagccttgtatcgtatatgcaaatatgaaggaatcatgggaaat aggccctcttcctgcccgaccttggcgcgcgctcggcgcgcggtcacgct ccgtcacgtggtgcgttttgcctgcgcgtctttccactgggggtcccgga tccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgccttt acttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaat tgtacccgcggccgatccaccggtcgccaccatggtgagcaagggcgagg agctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgta aacggccacaagttcagcgtgtccggcgagggcgagggcgatgccaccta cggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgc cctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagc cgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcc cgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaact acaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgc atcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggca caagctggagtacaactacaacagccacaacgtctatatcatggccgaca agcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgag gacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcgg cgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccg ccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggag ttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagta aagcggccatcaagcttatcgataccgtcgactagagctcgctgatcagc ctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccg tgccttccttgaccctggaaggtgccactcccactgtcctttcctaataa aatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggg gggtggggtggggcaggacagcaagggggaggattgggaagacaat
(151) AAV Constructs:
(152) Construct A. AAV 5ITR CMV/CB-intron-eGFP 3ITR (SEQ ID NO: 14, see
(153) TABLE-US-00005 ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtc gggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagaga gggagtgtagccatgctctaggaagatcaattcggtacaattcacgcgt cgacattgattattgactctggtcgttacataacttacggtaaatggcc cgcctggctgaccgcccaacgaccccgcccattgacgtcaataatgacg tatgttcccatagtaacgccaatagggactttccattgacgtcaatggg tggagtatttacggtaaactgcccacttggcagtacatcaagtgtatca tatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcc tggcattatgcccagtacatgaccttatgggactttcctacttggcagt acatctactcgaggccacgttctgcttcactctccccatctcccccccc tccccacccccaattttgtatttatttattttttaattattttgtgcag cgatgggggcggggggggggggggggggggcgcgcgccaggcggggcgg ggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagc caatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcgg cggcggcggccctataaaaagcgaagcgcgcggcgggcgggagcgggat cagccaccgcggtggcggccctagagtcgatcgaggaactgaaaaacca gaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccg gatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcc tttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcg gaattgtacccgcggccgatccaccggtcgccaccatggtgagcaaggg cgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggc gacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatg ccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagct gcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcag tgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaagga cgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacacc ctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggca acatcctggggcacaagctggagtacaactacaacagccacaacgtcta tatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatc cgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagc agaacacccccatcggcgacggccccgtgctgctgcccgacaaccacta cctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgat cacatggtcctgctggagttcgtgaccgccgccgggatcactctcggca tggacgagctgtacaagtaaagcggccatcaagcttatcgataccgtcg actagagctcgctgatcagcctcgactgtgccttctagttgccagccat ctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccac tcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctg agtaggtgtcattctattctggggggtggggtggggcaggacagcaagg gggaggattgggaagacaattaggtagataagtagcatggcgggttaat cattaactacaaggaacccctagtgatggagttggccactccctctctg cgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcc cgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag
(154) Construct B1. AAV 5ITR U6shFluc CMV/CB-intron-eGFP 3ITR, U6 promoter between ITR and shRNA encoding nucleic acid, expression cassettes in same orientation (SEQ ID NO: 15, see
(155) TABLE-US-00006 ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcg ggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagg gagtgtagccatgctctaggaagatcaattcggtacaattcaaattcccc agtggaaagacgcgcaggcaaaacgcaccacgtgacggagcgtgaccgcg cgccgagcgcgcgccaaggtcgggcaggaagagggcctatttcccatgat tccttcatatttgcatatacgatacaaggctgttagagagataattagaa ttaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtaga aagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaat ggactatcatatgcttaccgtaacttgaaagtatttcgatttcttgggtt tatatatcttgtggaaaggacgcgggatcccgcttacgctgagtacttcg attcaagagatcgaagtactcagcgtaagttttttccaaacgcgtcgaca ttgattattgactctggtcgttacataacttacggtaaatggcccgcctg gctgaccgcccaacgaccccgcccattgacgtcaataatgacgtatgttc ccatagtaacgccaatagggactttccattgacgtcaatgggtggagtat ttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaag tacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatg cccagtacatgaccttatgggactttcctacttggcagtacatctactcg aggccacgttctgcttcactctccccatctcccccccctccccaccccca attttgtatttatttattttttaattattttgtgcagcgatgggggcggg gggggggggggggggggcgcgcgccaggcggggcggggcggggcgagggg cggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgc gctccgaaagtttccttttatggcgaggcggcggcggcggcggccctata aaaagcgaagcgcgcggcgggcgggagcgggatcagccaccgcggtggcg gccctagagtcgatcgaggaactgaaaaaccagaaagttaactggtaagt ttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaa tcaaagaactgctcctcagtggatgttgcctttacttctaggcctgtacg gaagtgttacttctgctctaaaagctgcggaattgtacccgcggccgatc caccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtg gtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcag cgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctga agttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacat gaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccagg agcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgag gtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcat cgacttcaaggaggacggcaacatcctggggcacaagctggagtacaact acaacagccacaacgtctatatcatggccgacaagcagaagaacggcatc aaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagct cgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgc tgcccgacaaccactacctgagcacccagtccgccctgagcaaagacccc aacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgg gatcactctcggcatggacgagctgtacaagtaaagcggccatcaagctt atcgataccgtcgactagagctcgctgatcagcctcgactgtgccttcta gttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctg gaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatc gcattgtctgagtaggtgtcattctattctggggggtggggtggggcagg acagcaagggggaggattgggaagacaattaggtagataagtagcatggc gggttaatcattaactacaaggaacccctagtgatggagttggccactcc ctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgccc gacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag
(156) Construct B2. AAV 5ITR U6siFluc.sup.inv CMV/CB-intron-eGFP 3ITR, U6 promoter flanks shRNA encoding nucleic acid sequence on the opposite side of the ITR, expression cassettes in opposite orientation (SEQ ID NO: 16, see
(157) TABLE-US-00007 ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtc gggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagaga gggagtgtagccatgctctaggaagatcaattcggtacaattcagcttt tggaaaaaacttacgctgagtacttcgatctcttgaatcgaagtactca gcgtaagcgggatcccgcgtcctttccacaagatatataaacccaagaa atcgaaatactttcaagttacggtaagcatatgatagtccattttaaaa cataattttaaaactgcaaactacccaagaaattattactttctacgtc acgtattttgtactaatatctttgtgtttacagtcaaattaattctaat tatctctctaacagccttgtatcgtatatgcaaatatgaaggaatcatg ggaaataggccctcttcctgcccgaccttggcgcgcgctcggcgcgcgg tcacgctccgtcacgtggtgcgttttgcctgcgcgtctttccactgggg cgcgtcgacattgattattgactctggtcgttacataacttacggtaaa tggcccgcctggctgaccgcccaacgaccccgcccattgacgtcaataa tgacgtatgttcccatagtaacgccaatagggactttccattgacgtca atgggtggagtatttacggtaaactgcccacttggcagtacatcaagtg tatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggc ccgcctggcattatgcccagtacatgaccttatgggactttcctacttg gcagtacatctactcgaggccacgttctgcttcactctccccatctccc ccccctccccacccccaattttgtatttatttattttttaattattttg tgcagcgatgggggcggggggggggggggggggggcgcgcgccaggcgg ggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcg gcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggc ggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagc gggatcagccaccgcggtggcggccctagagtcgatcgaggaactgaaa aaccagaaagttaactggtaagtttagtctttttgtcttttatttcagg tcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatg ttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaag ctgcggaattgtacccgcggccgatccaccggtcgccaccatggtgagc aagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctgg acggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgaggg cgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggc aagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcg tgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttctt caagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttc aaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcg acaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagga cggcaacatcctggggcacaagctggagtacaactacaacagccacaac gtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttca agatccgccacaacatcgaggacggcagcgtgcagctcgccgaccacta ccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaac cactacctgagcacccagtccgccctgagcaaagaccccaacgagaagc gcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactct cggcatggacgagctgtacaagtaaagcggccatcaagcttatcgatac cgtcgactagagctcgctgatcagcctcgactgtgccttctagttgcca gccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggt gccactcccactgtcctttcctaataaaatgaggaaattgcatcgcatt gtctgagtaggtgtcattctattctggggggtggggtggggcaggacag caagggggaggattgggaagacaattaggtagataagtagcatggcggg ttaatcattaactacaaggaacccctagtgatggagttggccactccct ctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccg acgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag
(158) Construct C1. AAV 5ITR CMV/CB-intron-U6siFluc-intron-eGFP 3ITR, U6siFluc cassette positioned within intron of eGFP cassette, expression cassettes in same orientation (SEQ ID NO: 17, see
(159) TABLE-US-00008 ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtc gggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagaga gggagtgtagccatgctctaggaagatcaattcggtacaattcacgcgt cgacattgattattgactctggtcgttacataacttacggtaaatggcc cgcctggctgaccgcccaacgaccccgcccattgacgtcaataatgacg tatgttcccatagtaacgccaatagggactttccattgacgtcaatggg tggagtatttacggtaaactgcccacttggcagtacatcaagtgtatca tatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcc tggcattatgcccagtacatgaccttatgggactttcctacttggcagt acatctactcgaggccacgttctgcttcactctccccatctcccccccc tccccacccccaattttgtatttatttattttttaattattttgtgcag cgatgggggcggggggggggggggggggggcgcgcgccaggcggggcgg ggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagc caatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcgg cggcggcggccctataaaaagcgaagcgcgcggcgggcgggagcgggat cagccaccgcggtggcggccctagagtcgatcgaggaactgaaaaacca gaaagttaactggtaagtttagtctttttgtcttttatttcagaattcc ccagtggaaagacgcgcaggcaaaacgcaccacgtgacggagcgtgacc gcgcgccgagcgcgcgccaaggtcgggcaggaagagggcctatttccca tgattccttcatatttgcatatacgatacaaggctgttagagagataat tagaattaatttgactgtaaacacaaagatattagtacaaaatacgtga cgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgtt ttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgattt cttgggtttatatatcttgtggaaaggacgcgggatcccgcttacgctg agtacttcgattcaagagatcgaagtactcagcgtaagttttttccaaa gtcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggat gttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaa gctgcggaattgtacccgcggccgatccaccggtcgccaccatggtgag caagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctg gacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagg gcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccgg caagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggc gtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttct tcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttctt caaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggc gacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagg acggcaacatcctggggcacaagctggagtacaactacaacagccacaa cgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttc aagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccact accagcagaacacccccatcggcgacggccccgtgctgctgcccgacaa ccactacctgagcacccagtccgccctgagcaaagaccccaacgagaag cgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactc tcggcatggacgagctgtacaagtaaagcggccatcaagcttatcgata ccgtcgactagagctcgctgatcagcctcgactgtgccttctagttgcc agccatctgttgtttgcccctcccccgtgccttccttgaccctggaagg tgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcat tgtctgagtaggtgtcattctattctggggggtggggtggggcaggaca gcaagggggaggattgggaagacaattaggtagataagtagcatggcgg gttaatcattaactacaaggaacccctagtgatggagttggccactccc tctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgccc gacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag
(160) Construct C2. AAV 5ITR CMV/CB-intron-U6siFluc.sup.inv-intron-eGFP 3ITR, U6siFluc cassette positioned within intron of eGFP cassette, expression cassettes in opposite orientation (SEQ ID NO: 18, see
(161) TABLE-US-00009 ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtc gggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagaga gggagtgtagccatgctctaggaagatcaattcggtacaattcacgcgt cgacattgattattgactctggtcgttacataacttacggtaaatggcc cgcctggctgaccgcccaacgaccccgcccattgacgtcaataatgacg tatgttcccatagtaacgccaatagggactttccattgacgtcaatggg tggagtatttacggtaaactgcccacttggcagtacatcaagtgtatca tatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcc tggcattatgcccagtacatgaccttatgggactttcctacttggcagt acatctactcgaggccacgttctgcttcactctccccatctcccccccc tccccacccccaattttgtatttatttattttttaattattttgtgcag cgatgggggcggggggggggggggggggggcgcgcgccaggcggggcgg ggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagc caatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcgg cggcggcggccctataaaaagcgaagcgcgcggcgggcgggagcgggat cagccaccgcggtggcggccctagagtcgatcgaggaactgaaaaacca gaaagttaactggtaagtttagtctttttgtcttttatttcaggctttt ggaaaaaacttacgctgagtacttcgatctcttgaatcgaagtactcag cgtaagcgggatcccgcgtcctttccacaagatatataaacccaagaaa tcgaaatactttcaagttacggtaagcatatgatagtccattttaaaac ataattttaaaactgcaaactacccaagaaattattactttctacgtca cgtattttgtactaatatctttgtgtttacagtcaaattaattctaatt atctctctaacagccttgtatcgtatatgcaaatatgaaggaatcatgg gaaataggccctcttcctgcccgaccttggcgcgcgctcggcgcgcggt cacgctccgtcacgtggtgcgttttgcctgcgcgtctttccactggggg tcccggatccggtggtggtgcaaatcaaagaactgctcctcagtggatg ttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaag ctgcggaattgtacccgcggccgatccaccggtcgccaccatggtgagc aagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctgg acggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgaggg cgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggc aagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcg tgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttctt caagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttc aaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcg acaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagga cggcaacatcctggggcacaagctggagtacaactacaacagccacaac gtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttca agatccgccacaacatcgaggacggcagcgtgcagctcgccgaccacta ccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaac cactacctgagcacccagtccgccctgagcaaagaccccaacgagaagc gcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactct cggcatggacgagctgtacaagtaaagcggccatcaagcttatcgatac cgtcgactagagctcgctgatcagcctcgactgtgccttctagttgcca gccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggt gccactcccactgtcctttcctaataaaatgaggaaattgcatcgcatt gtctgagtaggtgtcattctattctggggggtggggtggggcaggacag caagggggaggattgggaagacaattaggtagataagtagcatggcggg ttaatcattaactacaaggaacccctagtgatggagttggccactccct ctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccg acgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag
(162) Construct D1. AAV 5ITR CMV/CB-intron-eGFP U6siFluc 3ITR, U6 promoter flanking shRNA encoding sequence on opposite site of functional ITR, expression cassettes in same orientation (SEQ ID NO: 19, see
(163) TABLE-US-00010 ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtc gggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagaga gggagtgtagccatgctctaggaagatcaattcggtacaattcacgcgt cgacattgattattgactctggtcgttacataacttacggtaaatggcc cgcctggctgaccgcccaacgaccccgcccattgacgtcaataatgacg tatgttcccatagtaacgccaatagggactttccattgacgtcaatggg tggagtatttacggtaaactgcccacttggcagtacatcaagtgtatca tatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcc tggcattatgcccagtacatgaccttatgggactttcctacttggcagt acatctactcgaggccacgttctgcttcactctccccatctcccccccc tccccacccccaattttgtatttatttattttttaattattttgtgcag cgatgggggcggggggggggggggggggggcgcgcgccaggcggggcgg ggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagc caatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcgg cggcggcggccctataaaaagcgaagcgcgcggcgggcgggagcgggat cagccaccgcggtggcggccctagagtcgatcgaggaactgaaaaacca gaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccg gatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcc tttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcg gaattgtacccgcggccgatccaccggtcgccaccatggtgagcaaggg cgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggc gacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatg ccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagct gcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcag tgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaagga cgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacacc ctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggca acatcctggggcacaagctggagtacaactacaacagccacaacgtcta tatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatc cgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagc agaacacccccatcggcgacggccccgtgctgctgcccgacaaccacta cctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgat cacatggtcctgctggagttcgtgaccgccgccgggatcactctcggca tggacgagctgtacaagtaaagcggccatcaagcttatcgataccgtcg actagagctcgctgatcagcctcgactgtgccttctagttgccagccat ctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccac tcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctg agtaggtgtcattctattctggggggtggggtggggcaggacagcaagg gggaggattgggaagacaaaattccccagtggaaagacgcgcaggcaaa acgcaccacgtgacggagcgtgaccgcgcgccgagcgcgcgccaaggtc gggcaggaagagggcctatttcccatgattccttcatatttgcatatac gatacaaggctgttagagagataattagaattaatttgactgtaaacac aaagatattagtacaaaatacgtgacgtagaaagtaataatttcttggg tagtttgcagttttaaaattatgttttaaaatggactatcatatgctta ccgtaacttgaaagtatttcgatttcttgggtttatatatcttgtggaa aggacgcgggatcccgcttacgctgagtacttcgattcaagagatcgaa gtactcagcgtaagttttttccaaattaggtagataagtagcatggcgg gttaatcattaactacaaggaacccctagtgatggagttggccactccc tctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgccc gacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag
(164) Bold: hairpin RNA encoding sequence; underlined: 3ITR. Distance between hairpin RNA encoding sequence and 3ITR: 52 nucleotides.
(165) Construct D2. AAV 5ITR CMV/CB-intron-eGFP U6siFluc.sup.inv 3ITR, U6promoter between shRNA encoding nucleic acid sequence and ITR, expression cassettes in opposite orientation (SEQ ID NO: 20, see
(166) TABLE-US-00011 ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtc gggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagaga gggagtgtagccatgctctaggaagatcaattcggtacaattcacgcgt cgacattgattattgactctggtcgttacataacttacggtaaatggcc cgcctggctgaccgcccaacgaccccgcccattgacgtcaataatgacg tatgttcccatagtaacgccaatagggactttccattgacgtcaatggg tggagtatttacggtaaactgcccacttggcagtacatcaagtgtatca tatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcc tggcattatgcccagtacatgaccttatgggactttcctacttggcagt acatctactcgaggccacgttctgcttcactctccccatctcccccccc tccccacccccaattttgtatttatttattttttaattattttgtgcag cgatgggggcggggggggggggggggggggcgcgcgccaggcggggcgg ggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagc caatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcgg cggcggcggccctataaaaagcgaagcgcgcggcgggcgggagcgggat cagccaccgcggtggcggccctagagtcgatcgaggaactgaaaaacca gaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccg gatccggtggtggtgcaaatcaaagaactgctcctcagtggatgttgcc tttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcg gaattgtacccgcggccgatccaccggtcgccaccatggtgagcaaggg cgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggc gacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatg ccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagct gcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcag tgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaagga cgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacacc ctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggca acatcctggggcacaagctggagtacaactacaacagccacaacgtcta tatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatc cgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagc agaacacccccatcggcgacggccccgtgctgctgcccgacaaccacta cctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgat cacatggtcctgctggagttcgtgaccgccgccgggatcactctcggca tggacgagctgtacaagtaaagcggccatcaagcttatcgataccgtcg actagagctcgctgatcagcctcgactgtgccttctagttgccagccat ctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccac tcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctg agtaggtgtcattctattctggggggtggggtggggcaggacagcaagg gggaggattgggaagacaagcttttggaaaaaacttacgctgagtactt cgatctcttgaatcgaagtactcagcgtaagcgggatcccgcgtccttt ccacaagatatataaacccaagaaatcgaaatactttcaagttacggta agcatatgatagtccattttaaaacataattttaaaactgcaaactacc caagaaattattactttctacgtcacgtattttgtactaatatctttgt gtttacagtcaaattaattctaattatctctctaacagccttgtatcgt atatgcaaatatgaaggaatcatgggaaataggccctcttcctgcccga ccttggcgcgcgctcggcgcgcggtcacgctccgtcacgtggtgcgttt tgcctgcgcgtctttccactggggttaggtagataagtagcatggcggg ttaatcattaactacaaggaacccctagtgatggagttggccactccct ctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccg acgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag
(167) Bold: hairpin RNA encoding sequence; underlined: 3ITR. Distance between hairpin RNA encoding sequence and 3ITR: 377 nucleotides.
SCOPE AND EQUIVALENTS
(168) While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all methods, reagents, and configurations described herein are meant to be exemplary and that the actual methods, reagents, and configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the embodiments described herein are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, reagent, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, reagents, kits, and/or methods are not mutually inconsistent, is included within the scope of the present invention.
(169) All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
(170) The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
(171) The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
(172) As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
(173) As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently, at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
(174) It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one act, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are recited.