FIBROCARTILAGE PREPARATION METHOD USING TENSILE STIMULATION
20230039188 · 2023-02-09
Assignee
Inventors
Cpc classification
A61L2430/40
HUMAN NECESSITIES
A61L27/3895
HUMAN NECESSITIES
A61L27/3834
HUMAN NECESSITIES
C12N2537/00
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12M21/08
CHEMISTRY; METALLURGY
C12M35/04
CHEMISTRY; METALLURGY
A61L27/3817
HUMAN NECESSITIES
C12N13/00
CHEMISTRY; METALLURGY
C12N5/0697
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a fibrocartilage preparation method and fibrocartilage prepared by the method.
Claims
1. A method for preparing fibrocartilage, the method comprising: culturing one or more cells selected from the group consisting of synovial cells, chondrocytes and mesenchymal stem cells under a tensile stimulus.
2. The method of claim 1, wherein the tensile stimulus is applied for 3 days to 10 days.
3. The method of claim 1, wherein the tensile stimulus is applied with a force of 5% to 20%.
4. The method of claim 1, further comprising: culturing cells under the tensile stimulus, and then releasing the tensile stimulus; and culturing the cells for 10 days to 28 days.
5. The method of claim 1, wherein the fibrocartilage is one or more selected from the group consisting of the intervertebral disc, the interpubic disc and the meniscus cartilage.
6. The method of claim 1, wherein the cartilage cells are any one selected from the group consisting of articular chondrocytes, costal chondrocytes, and meniscal chondrocytes.
7. Fibrocartilage prepared by the method of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0058] Hereinafter, the present invention will be described in detail through the Examples. However, the following Examples are only for exemplifying the present invention, and the present invention is not limited by the following Examples.
Example 1. Confirmation of Tissue Alignment and Whether a Cartilage Matrix Formation by Application of Tensile Stimulus
[0059] 1-1. Confirmation of Tissue Alignment and Whether a Cartilage Matrix Formation by Application of Tensile Stimulus
[0060] After chondrocytes obtained from meniscus cartilage, which is fibrocartilage, were cultured in the form of a sheet, the characteristics of a tissue formed by sequentially culturing a treatment group to which a static tension of 10% was applied and a control to which the tension was not applied in a growth medium (alpha-MEM including 2 mM L-glutamine, 10.sup.−4 M ascorbic acid, 10.sup.−8M dexamethasone, 1 ng/ml rhFGF-2, and 5% fetal bovine serum) and a cartilage differentiation medium (DMEM including 1 M proline, 0.3 mM ascorbic acid, 10.sup.−7M dexamethansone, 10 ng/ml TGF-3, and 1×IT+3) were confirmed.
[0061] First, in order to confirm the arrangement and synthesis amount of type 1 collagen, immunostaining using an antibody against type 1 collagen (Chemicon, product number AB755P) was performed, and trichrome staining was performed with reference to the methods described in L G Luna literature (Histopathologic Methods and Color Atlas of Special Stains and Tissue Artifacts, Johnson Printers, Downers Grove, Ill. P151-152 c 1992).
[0062] Further, after the cells cultured in the medium were fixed using 4% paraformaldehyde, the fixed cells were embedded in paraffin were cut into sections, and then de-paraffinized using xylene. Thereafter, nuclear staining was performed for 5 minutes using Weigert's hematoxylin, and the cells were washed with distilled water for 10 minutes. After 10 minutes, the cells were rinsed using a 70% alcohol solution containing 1% HCl and then stained with 0.02% aqueous fast green for 5 minutes. After being stained with fast green, the cells were washed with 1% acetic acid and stained using 0.1% aqueous safranin 0 for 5 minutes. After staining with safranin O, the sample was immersed in alcohol 2 to 3 times, and then put into xylene for mounting.
[0063] As a result, it was confirmed that when a tensile stimulus was applied, a high level of tissue alignment was induced, and the degree of arrangement and the synthesis amount of type 1 collagen, which is a fibrous matrix, were both increased, and meanwhile, it was confirmed that no formation of cartilaginous matrix was observed in the group treated with the tensile stimulus (
[0064] 1-2. Confirmation of Signal Factor for Suppressing Cartilaginous Matrix Formation
[0065] In order to confirm whether the tensile stimulus induced the nuclear translocation phenomenon of the YAP protein present in the cytoplasm, immuno-fluorescence (IF) method was performed on the treatment group cultured in 1-1 above.
[0066] Specifically, 3.7% paraformaldehyde was added to the cells and the cells were fixed at room temperature for 20 minutes. Thereafter, the cells were washed 3 times with PBS and treated with 0.1% Triton-X100 for 15 minutes to increase the permeability of the cells. After the cells were again washed 3 times with PBS, the cells were treated with 10% fetal bovine serum (FBS) for 1 hour, an anti-YAP antibody was diluted with 10% FBS, reacted at room temperature for 2 hours, and washed 3 times with 1% FBS for 10 minutes, and then a secondary antibody was diluted with 10% FBS, reacted in the dark for 2 hours, and washed 3 times with 1% FBS for 10 minutes each. In this case, during the second washing, 300 ng/ml DAPI was put into 1% FBS. Next, an encapsulation solution was dropped on a slide glass, and then the slide glass was covered with a cover glass. The surrounding encapsulation solution was removed, the cover glass was covered with enamel, and then observed under a microscope.
[0067] In addition, semi-quantitative PCR (30 cycles optimal) was performed to investigate the expression level of a cartilage differentiation marker Sox-9. Specifically, the primer sequences of SEQ ID NOS: 1 and 2 were used, and the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for the normalization of gene expression values.
TABLE-US-00001 TABLE 1 SEQ ID NO Primer Sequence (5′-3′) 1 Sox-9 forward CTCCGACACCGAGAATACAC 2 Sox-9 reverse CCATTCTTCACCGACTTCCT 3 GAPDH forward TCACCATCTTCCAGGAGCGA 4 GAPDH reverse CACAATGCCGAAGTGGTCGT
[0068] As a result, it was confirmed that the amount of YAP protein translocated to the nucleus was remarkably increased during culture while maintaining the tensile stimulus for 3 weeks (
[0069] Furthermore, it was confirmed that a basal level of Sox-9 expression appeared under a growth medium condition, and the Sox-9 expression was increased in both the control and the treatment group under a cartilage differentiation medium condition. However, under the cartilage differentiation condition, a decrease in Sox-9 expression was observed in the treatment group compared with the control (
[0070] The above results suggest that the localization of YAP protein in the nucleus by a tensile stimulus affects the regulation of Sox-9 expression, resulting in a deterioration in the shape of a cartilaginous matrix.
[0071] 1-3. Confirmation of Ability to Form Cartilage During Treatment with Inhibitor of YAP Protein Nuclear Translocation
[0072] It was confirmed whether the expression of Sox-9, which is a cartilage differentiation marker, was increased during treatment with verteporfin, which suppresses the translocation of YAP protein to the nucleus. The Sox-9 expression level was measured in the same manner as in 1-2.
[0073] Further, a cartilage tissue obtained after the treatment with verteporfin was embedded in paraffin, sectioned to a thickness of 5 to 7 μm, dried, and then subjected to hematoxylin & eosin (H&E) staining. The stained tissue was observed under a high resolution optical microscope.
[0074] As a result, it was confirmed that the expression of the cartilage differentiation marker Sox-9 was remarkably increased during the treatment with verteporfin, suggesting that the cartilage differentiation ability can be highly exhibited as the translocation of the YAP protein to the nucleus is suppressed. Meanwhile, when the treatment group to which the tensile stimulus was applied was treated with verteporfin, the overall matrix forming ability of the tissue was increased, whereas the formation of the fibrous matrix showed a decreasing pattern, suggesting that suppressing the translocation of YAP protein alone does not establish effective fibrocartilage formation conditions.
[0075] Through the above results, it was confirmed that when a tensile stimulus is applied, the fibrous matrix could be formed in a tissue anisotropy direction, but cartilage matrix formation was suppressed by promoting the translocation of YAP protein to the nucleus, and thus, it was difficult to form a fibrocartilage tissue.
Example 2. Search for Tensile Application Conditions Under which Tissue Anisotropy is Maintained
[0076] 2-1. Confirmation of Conditions for Suppressing Translocation of YAP Protein to Nucleus
[0077] Conditions for eliminating the effect of suppressing cartilage differentiation according to the nuclear localization tendency of YAP protein were confirmed. First, after a cell sheet was detached from a plastic culture dish, only cell-cell contact was allowed to be maintained. One day later, the intracellular distribution of YAP protein was confirmed in the same manner as in Example 1-2.
[0078] As a result, it was confirmed that when the stimulus that induced the translocation of YAP protein disappeared, the short-term localization of YAP was adjusted, and thus the YAP was distributed in the cytoplasm (
[0079] 2-2. Confirmation of Whether Tissue Alignment is Maintained when Tensile Stimulus is Applied and then Tension is Released
[0080] Based on the experimental results of 2-1 above, it was confirmed whether tissue alignment was maintained even after a tensile stimulus was applied for 1 to 10 days, and then the tension was released.
[0081] First, chondrocytes cultured in the form of a sheet were rolled up longitudinally to form a cell cable, and a tensile stimulus of 10% was applied for 1 to 10 days using the static tension chamber designed in
[0082] As a result of macroscopic observation of the tissue form, it was confirmed that when the tensile stimulus was applied for 3 days or more, the form was produced and tissue alignment was maintained, and when the tensile stimulus was applied for 7 days or more, the form was maintained for 5 days or more even after the tensile stimulus was released (
[0083] As a result of confirmation using immunofluorescent staining to determine whether tissue alignment is maintained based on the arrangement form of the cytoskeleton and extracellular matrix, it was confirmed that when a tensile stimulus was applied for 3 days, and then the tensile stimulus was released, the alignment of the cytoskeleton and extracellular matrix became disordered after 5 days, whereas when the tensile stimulus was applied for 7 days or more, and then the tensile stimulus was released, the uniaxial anisotropic tissue alignment was maintained for 5 days (
[0084] 2-3. Confirmation of Nuclear Localization Tendency of YAP Protein when Tensile Stimulus is Applied and then Tension is Released
[0085] Based on the 2-1 experiment, an experiment was conducted to confirm whether YAP protein was translocated to the nucleus when a tensile stimulus was applied for 1, 3, 7, and 10 days, and then the tension was released. The experiment was performed in the same manner as in 1-2 above.
[0086] As a result, it was confirmed that the nuclear localization tendency of YAP protein was remarkably reduced 24 hours after the release of the tensile stimulus under all the tensile stimulus conditions, and it was confirmed that the temporary tensile stimulus applied in the form of a cell cable did not induce irreversible changes in regard to the translocation of YAP protein to the nucleus, and thus, the effect of suppressing cartilage differentiation may not be sustained (
[0087] From the above results, it was confirmed that the duration of tensile stimulus application needs to exceed at least 3 days in order to maintain tissue alignment at the initial stage (5 to 7 days) of the cartilaginous matrix formation, while a tensile stimulus needs to be applied within a maximum of 10 days in order to prevent the irreversible nuclear localization tendency of YAP protein.
Example 3. Confirmation of Tissue Formation According to Application of Tensile Structure
[0088] Based on the experimental results of Example 2, a cartilage tissue to be formed while being cultured using the cartilage differentiation medium for 3 weeks was confirmed in a state where a tensile stimulus of 5 to 20% was applied. The duration and conditions of culturing while applying a tensile stimulus of 5 to 20% are as illustrated in
[0089] The thickness of the tissue formed for 3 weeks was observed with the naked eye, and as a result, it was confirmed that the growth of the tissue was increased over time throughout the entire tensile stimulus range of 5 to 20% (
[0090] Furthermore, in order to induce cartilage differentiation by applying the tensile stimulus as described above and confirm the characteristics of a cartilage tissue obtained after 3 weeks, the tissue was observed after being stained with safranin O, trichrome, and H&E. As a result, it was confirmed that a tissue with uniaxial anisotropic tissue alignment was formed by a tensile stimulus of 5 to 20%, and the alignment of the tissue appeared more consistently, particularly in a tensile stimulus range of 5 to 15%.
Example 4. Confirmation of Formation of Cartilage Tissue in which Anisotropy is Implemented
[0091] 4-1. Confirmation of Fibrocartilage Formation after Tensile Stimulus
[0092] Based on the experimental results of Example 2, it was confirmed whether fibrocartilage could be formed after a tensile stimulus of 10% was applied for 7 days.
[0093] First, fibrocartilage tissue was formed by culturing a treatment group in which a tensile stimulus of 10% was applied to chondrocytes for 7 days in a cartilage differentiation medium for 3 weeks. Thereafter, it was observed under a microscope whether tissue formation occurred.
[0094] As a result, it was confirmed that the cartilage tissue was formed when the cells were cultured for 2 to 3 weeks by applying a tensile stimulus of 10% for 7 days, and then releasing tension (
[0095] 4-2. Confirmation of Maintenance of Tissue Alignment after Tensile Stimulus
[0096] The degree of tissue alignment maintenance after cartilage differentiation was evaluated by investigating an angle exhibited by the nuclei, and thereafter, it was confirmed under a microscope whether alignment was maintained.
[0097] As a result, it was confirmed that when the tensile stimulus was not applied, alignment in a specific direction did not appear, but a high level of alignment was maintained in a group treated with the tensile stimulus for 7 days or a group continuously treated with the tensile stimulus for 3 weeks (
[0098] 4-3. Confirmation of Cartilage Differentiation Characteristics after Tensile Stimulus
[0099] After a tensile stimulus of 10% was applied for 7 days, immunostaining and histological staining were performed on a fibrous matrix and a cartilaginous matrix. The experimental method was performed in the same manner as in Example 1-1, and for staining of type 2 collagen, immunohistochemical staining was performed using an antibody against type 2 collagen (Abcam, product number AB53047).
[0100] As a result, it was confirmed that in a group cultured in a state in which a tensile stimulus was applied for 7 days, and then released, the formation of both type 1 collagen and the cartilaginous matrix appeared, and the area of extracellular matrix formed per cell was shown to be remarkably high compared to the tensile stimulus maintenance group. On the other hand, in the control to which the tensile stimulus was not applied, the degree of type 1 collagen formation appeared very low, and when the tensile stimulus was continuously applied for 3 weeks, almost no cartilaginous matrix formation appeared.
[0101] Through the above results, it can be seen that when chondrocytes are cultured under a tensile stimulus, and then cultured in a tension-released state, the ability to form both a fibrous matrix and a cartilaginous matrix is excellent, suggesting that by applying the method of the present invention to culture chondrocytes, it is possible to form a tissue capable of simultaneously exhibiting tensile strength and compressive strength that can withstand the load applied in the joint.
[0102] The above-described description of the present invention is provided for illustrative purposes, and those skilled in the art to which the present invention pertains will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the above-described embodiments are only exemplary in all aspects and are not restrictive. For example, each constituent element which is described as a singular form may be implemented in a distributed form, and similarly, constituent elements which are described as being distributed may be implemented in a combined form.
[0103] The scope of the present invention is represented by the following claims, and it should be interpreted that the meaning and scope of the claims and all the changes or modified forms derived from the equivalent concepts thereof fall within the scope of the present invention.