Rapid method of generating live attenuated vaccines
11865083 ยท 2024-01-09
Assignee
Inventors
- Eng Eong Ooi (Singapore, SG)
- Kenneth GOH (Singapore, SG)
- Swee Sen KWEK (Singapore, SG)
- Choon Kit TANG (Singapore, SG)
Cpc classification
C12N2770/24122
CHEMISTRY; METALLURGY
C12N2770/24134
CHEMISTRY; METALLURGY
C12N2770/24121
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The present invention relates to a method of generating a live attenuated vaccine. The present invention also relates to a live attenuated vaccine produced according to the method of the invention.
Claims
1. A vaccine comprising a nucleic acid sequence encoding the genome of a maladapted Zika virus, wherein the nucleic acid sequence comprises a sequence selected from the group consisting of SEQ NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, and SEQ ID NO: 42.
2. The vaccine of claim 1, wherein the nucleic acid sequence is a DNA sequence or a messenger RNA (mRNA) sequence.
3. The vaccine of claim 1, wherein the nucleic acid sequence is SEQ ID NO: 40.
4. The vaccine of claim 1, wherein the maladapted Zika virus is generated by passaging a Zika virus at least once in a cell or cell line that is of a species distinct from the intended recipient of the vaccine.
5. The vaccine of claim 1, wherein the maladapted Zika virus is generated by passaging a Zika virus for four rounds in Vero cells, followed by passaging for a single round in C6/36 cells.
6. The vaccine of claim 5, wherein the Zika virus is a French Polynesian strain of Zika virus.
7. The vaccine of claim 6, wherein the Zika virus strain is PF13/251013-18.
8. The vaccine of claim 1, wherein the vaccine is capable of eliciting sterilizing immunity in a subject.
9. The vaccine of claim 1, wherein the vaccine is a live attenuated vaccine.
10. A method of preventing or treating a Zika infection in a subject comprising administering to the subject an effective amount of the vaccine of claim 1.
11. The method of claim 10, wherein the administering comprises intradermal, intramuscular or subcutaneous injection.
12. The method of claim 10, wherein the vaccine is administered alone or in combination with a buffer.
13. The method of claim 10, wherein the vaccine is administered to the subject in a single dose or in multiple doses.
14. A method of inducing sterilizing immunity to a Zika infection in a subject comprising administering to the subject an effective amount of the vaccine of claim 1.
15. The method of claim 14, wherein the administering comprises intradermal, intramuscular or subcutaneous injection.
16. The method of claim 14, wherein the vaccine is administered alone or in combination with a buffer.
17. The method of claim 14, wherein the vaccine is administered to the subject in a single dose or in multiple doses.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION OF THE PRESENT INVENTION
(12) In a first aspect the present invention refers to a method of generating a live attenuated vaccine (LAV) comprising the steps of: a) modifying an original virus to generate at least one genetically distinct maladapted virus; b) infecting a host cell with said at least one maladapted virus; c) selecting a host cell that displays a preselected phenotype in response to said infection with said at least one maladapted virus and isolating the viral nucleic acid of said maladapted virus from the host cell; d) sequencing the isolated viral nucleic acid of said maladapted virus and comparing this to the nucleic acid sequence of an original virus; e) reconstructing the maladapted virus from the original virus to produce a candidate live attenuated vaccine; and f) screening said candidate live attenuated vaccine for a predetermined phenotype.
(13) A virus may be modified to generate one or more genetically distinct maladapted viruses by any means that introduces mutations in the genome of the virus. For example, modification of a virus may be achieved by passaging the virus at least once in a cell or cell line that is of a species distinct from the intended recipient of the LAV. Advantageously, passaging the virus in a cell that is of a species other than the intended host prevents the virus from adapting to the host's innate immunity.
(14) A suitable cell that may be used to modify a virus may be one that is obtained from a primary cell culture or a continuous cell line. The cell culture may be an adherent cell culture or a suspension cell culture. The cell may be from a human, a bovine, a canine, a murine, a rat, a fish, an insect, a rabbit or monkey cell culture line, provided the cell is of a distinct species from the intended host.
(15) Suitable examples of cells that may be used include but are not limited to the human hepatoma cell line HuH-7, the human embryonic kidney cell line HEK293T, human embryonic diploid cells (e.g. human lung fibroblast cells WI-38 and MRCS), C6/36 mosquito cell line, Vero cells, MDCK cells and primary green monkey kidney cells. In a preferred embodiment, the cell used to maladapt a virus for subsequent selection for human vaccine applications is a MDCK cell. In yet another embodiment, the cell used to modify a virus for subsequent selection for human vaccine applications is a primary monkey kidney cell. In a further preferred embodiment, the cell used to modify a virus for subsequent selection for human vaccine applications is a C6/36 mosquito cell. In a further preferred embodiment, the cell used to modify a virus for subsequent selection for human vaccine applications is a Vero mosquito cell.
(16) Modification of a virus may also be achieved by culturing a cell or cell line that has been infected with the virus under sub-optimal conditions. It will generally be understood that sub-optimal conditions refer to conditions under which growth of a cell or cell line is hampered. Sub-optimal conditions may include culturing a cell or cell line at a temperature that is lower or higher than 37 C., passaging the cell or cell line at a density that is too low, passaging the cell or cell line in the suboptimal cell culture medium or exposing the cell to a pH that is lower or higher than 7. In a preferred embodiment, modification of a virus may be achieved by culturing a cell infected with the virus at a temperature that is lower than 37 C.
(17) Another method of modification of a virus may also be achieved by exposure to a chemical compound. For example, the chemical compound may be a chemically derived mutagen, such as ribavirin and 5-fluorouracil. The virus may be exposed to the mutagen once or may be subjected to continuous or repeated exposure. It will generally be understood, and appreciated by those of skill in the art, that the chemical compound used as well as the length of exposure to the chemical compound in order to achieve modification would vary depending on the type of virus or virus strain.
(18) Another possible method of modifying a virus may be by random mutation of the viral genome. Random mutagenesis may be achieved by error prone polymerase chain reaction (PCR). Error prone PCR may utilize low fidelity or error prone DNA polymerase that does not have proof-reading capability. Error prone PCR may also utilize variations in reaction conditions of the PCR to introduce errors. For example, the concentration and components within the PCR reaction buffer may be varied. Thermal cycling conditions may also be varied. An example of an error prone DNA polymerase is error prone Taq DNA polymerase which has an error rate of 2.210.sup.5 errors per nucleotide per cycle.
(19) Subsequent to error prone PCR, PCR products may be gel purified and assembled to obtain an infectious clone. In one embodiment, assembly of PCR products may be by Gibson assembly.
(20) It will generally be understood that modification of a virus may take place via one or more of the methods described herein, either alone or in combination.
(21) In one embodiment, the maladapted virus may be generated by exposure of cells, infected with a virus, to 5-fluorouracil during cell culture. In another embodiment, the maladapted virus may be generated by exposure of cells, infected with a virus, to ribavirin during cell culture. In yet another embodiment, the maladapted virus may be generated by exposure of cells, infected with a virus, to 5-fluorouracil and ribavirin during cell culture.
(22) The concentration of mutagen used may range from about 10 M to about 10 mM, from about 50 M to about 5 mM, from about 100 M to about 3 mM, from about 100 M to about 2 mM, from about 100 M to about 1 mM, from about 200 M to about 900 M, from about 300 M to about 800 M, from about 400 M to about 700 M or from about 500 M to about 600 M. In a preferred embodiment, the concentration of 5-fluorouracil is about 100 M to about 1 mM.
(23) Cells infected with a virus may also be exposed to one or more mutagens for at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days or at least 1 week. In a preferred embodiment, cells are exposed to one or more mutagens for 5 days.
(24) The virus may be passaged one or more times in a cell either in the presence or absence of a chemical mutagen. For example, a cell infected with the virus may be passaged 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times. In a preferred embodiment, a virus may be passaged in a cell no more than 10 times, or no more than 5 times. In a further preferred embodiment, a virus may be passaged in a cell no more than 5 times. In a preferred embodiment, the virus may be passaged once in the presence of a chemical mutagen. The cells may be exposed to a chemical mutagen at every passage. The cells may also be exposed to a chemical mutagen at every second passage. Variation in the exposure of cells to a chemical mutagen and/or number of passages performed will be understood to be routine in the art.
(25) In one embodiment, the virus to be modified is derived from a clinical isolate. A clinical isolate may include but is not limited to blood, blood plasma, serum, buccal smear, amniotic fluid, prenatal tissue, sweat, nasal swab, urine, organs, tissues, fractions, and cells isolated from mammals including humans. Clinical isolates also may include sections of the biological sample including tissues (for example, sectional portions of an organ or tissue). Clinical isolates may also include extracts from a biological sample, for example, an antigen from a biological fluid (for example, blood or urine). In a preferred embodiment, a clinical isolate is a virus strain isolated from blood or serum.
(26) In one embodiment, the maladapted virus generated as described herein is then isolated, using standard methods known in the art, and used to infect a host cell, at step b) of the method as described herein. Advantageously, this host cell may also be used to select for a specific maladapted virus that induces a preselected phenotype in the host cell. For example, the host cell may comprise an inducible reporter gene, operably linked to at least one promoter associated with innate immunity to at least one virus, and the host cell may then be used to select for a specific maladapted virus with a propensity to activate, for example, a type I interferon response. Typically, when using a host cell to select for a specific maladapted virus of interest, a host cell that is of the same species as the intended vaccine is used. In one embodiment, the host cell used to select for a specific maladapted virus that induces a predetermined phenotype in the host cell is a cell of human origin. For example, a suitable host cell is a cell of a human hepatoma cell line or a human kidney cell line. In one embodiment, the host cell used to select for specific maladapted viruses that induce a predetermined phenotype in the host cell is a HEK293T cell. In a preferred embodiment, the host cell used to select for a specific virus that induces a predetermined phenotype in the host cell is a HuH-7 cell.
(27) It will be appreciated that inducible reporter genes are well known in the art and are typically expressed under the control of a promoter. Suitable examples of reporter genes include but are not limited to green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), -galactosidase and luciferase. In a preferred embodiment, the inducible reporter is green fluorescent protein (GFP).
(28) The promoter element of an inducible reporter gene may be activated by one or more markers. A marker may provide an indication of a physiological state, based on its presence or absence or based on its relative levels in a cell or organism. In some embodiments the one or more markers may comprise a nucleic acid, a protein or a chemical. In yet another embodiment, a marker may be a protein or a compound associated with a biochemical pathway or with the innate immune response. Suitable examples of markers associated with innate immunity include proteins and/or genes of, or associated with, the interferon and inflammatory response pathways, such as type I interferon; an interferon-stimulated gene (ISG); Signal Transducer and Activator of Transcription 1 (STAT1); interferon regulatory factors, for example IRF3, IRF7 or IRF9; and Nuclear Factor Kappa-Light Chain-Enhancer of Activated B cells (NF-B). Type I interferons may include IFN- (alpha), IFN- (beta), IFN- (kappa), IFN- (delta), IFN- (epsilon), IFN- (tau), IFN- (omega), and IFN- (zeta).
(29) In one embodiment, the inducible reporter gene may be operably linked to at least one promoter associated with innate immunity; for example, an interferon stimulated response element (ISRE). In a preferred embodiment, the inducible reporter comprises an ISRE operably linked to a green fluorescent protein (GFP) gene. In a more preferred embodiment the ISRE is associated with an IRF3-mediated response.
(30) Selection of host cells expressing a reporter gene may be done by flow cytometry, fluorescence activated cell sorting (FACS), magnetic activated cell sorting (MACS) or laser capture microdissection. In a preferred embodiment, the host cell may be selected and isolated by FACS.
(31) In another example, a preselected phenotype may be plaque size in a plaque assay. Plaque assays are generally understood in the art to be used for purifying or isolating a clonal population of virus or to determine viral titer. Plaque sizes may be compared relative to another plaque within the same assay or within the same plate, or relative to another plaque in a separate assay or on a separate plate. A plaque of interest may then be selected by picking the plaque from the assay or plate for subsequent applications. In a preferred embodiment, the preselected phenotype may be small plaque size relative to a host cell that has been infected with the original virus. In another embodiment, the preselected phenotype may be small plaque size relative to another plaque within the same assay or plate.
(32) The selected host cell is then treated with general methods well known in the art to isolate the nucleic acid of the maladapted virus from the host cell.
(33) The isolated nucleic acid of the maladapted virus from step c) is then sequenced (step d). In one embodiment, sequencing may be by Sanger sequencing or Next-Generation Sequencing. It will be appreciated by those of skill in the art that Next-Generation Sequencing encompasses a wide variety of sequencing methods including, but not limited to, whole genome sequencing, transcriptome sequencing and epigenome sequencing. In one embodiment, the Next-Generation Sequencing platform used is Deep Sequencing.
(34) The sequence of the isolated nucleic acid of the maladapted virus is then compared to the nucleic acid sequence of the original virus. In one embodiment, the viral nucleic acid sequence of one or more maladapted viruses is compared to the nucleic acid sequence of the original virus to identify mutations that occur in more than a threshold percentage of the isolated maladapted virus sequences; for example, one or more mutations that occur in, for example, over 50% of isolated sequences. In one embodiment, the threshold percentage is at least 10% of the viral nucleic acid sequences isolated from step c). In some embodiments, the threshold percentage is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of the viral nucleic acid sequences isolated from step c). It will be understood that a consensus nucleic acid sequence may be determined using the threshold percentage. For example, for a given nucleic acid position, if 40% of analyzed sequences have an adenine (A), 30% of analyzed sequences have a cytosine (C), and 30% of analyzed sequences have a guanine (G), the consensus nucleic acid at this given position would be adenine (A). A consensus nucleic acid sequence may be obtained by comparing the viral nucleic acid sequence of at least 2 maladapted viruses to the nucleic acid sequence of the original virus.
(35) Comparison of the sequence of the isolated nucleic acid of the maladapted virus to the nucleic acid sequence of the original virus from which the maladapted virus is derived may include the use of bioinformatics tools to assemble and analyze the sequences of the isolated and original viral nucleic acid. For example, sequences may be aligned to a reference genome using Burrows-Wheeler Aligner (BWA) and its variants, for example, BWA-MEM; Clustal and its variants, for example, ClustalW; or MUSCLE. SAMtools may also be used to manage and convert alignment files. A consensus sequence may also be obtained with SAMtools. Variants in nucleic acid sequence from a reference genome can also be derived with SAMtools or other programs such as LoFreq, Geneious, Unipro UGENE and the like. It will be appreciated by those of skill in the art that one, or a combination, of the tools described herein may be utilized for purposes of analyzing sequencing results.
(36) Accordingly, it will be generally understood that the nucleic acid sequence of the maladapted virus from step c) can be obtained by Sanger sequencing or Next-Generation Sequencing (e.g. Deep sequencing), by determining a consensus sequence using a threshold percentage, by using bioinformatics tools, or combinations thereof.
(37) In some embodiments, the maladapted virus is mutated at one or more positions within a consensus nucleic acid sequence. In other embodiments, the maladapted virus sequence is mutated at one or more positions in the maladapted virus sequence with respect to the nucleic acid sequence of the original virus. In yet another embodiment, the maladapted virus is mutated at position 876 from thymine (T) to cytosine (C), or at position 2925 from adenine (A) to guanine (G) or both.
(38) Using the results of the sequence comparison from step d), the maladapted virus may then be reconstructed from the original virus (step e). In one embodiment, reconstruction of the maladapted virus in step e) comprises performing site directed mutagenesis on the nucleic acid sequence of the original virus to conform said original viral nucleic acid sequence to the nucleic acid sequence of the maladapted virus.
(39) It will generally be understood that reconstruction of the maladapted virus involves standard methods known in the art. Briefly, an infectious clone of the original virus is generated. Mutations that were identified in step d) that occur in more than a threshold percentage of the isolated maladapted virus sequences are introduced into the infectious clone either by site-directed mutagenesis and/or by excision or insertion of segments of nucleic acids to replicate the genetic changes identified in the maladapted virus. The reconstructed virus may then be packaged using methods known in the art to generate a candidate live attenuated vaccine.
(40) It will be generally understood that vaccine candidates may be screened in vitro and/or in vivo for a predetermined phenotype. A predetermined phenotype may provide an indication of the suitability and safety of the vaccine.
(41) In one embodiment, the screening in step f) may be performed in vitro and/or in vivo. In vitro and in vivo screening may be performed sequentially or simultaneously. In vitro screening may include, but is not limited to, analysis of the growth or replication rate of the candidate live attenuated vaccine; the infectivity or uptake of the candidate live attenuated vaccine; the ability of the candidate live attenuated vaccine to trigger or induce the innate immune response in the host cell and plaque size formation. In one embodiment, in vitro screening may involve measuring: one or more of increased growth rate, immunogenicity, generation of small plaques in plaque assays and increased rate of virus uptake, relative to at least one other candidate vaccine.
(42) The growth or replication rate of a candidate live attenuated vaccine may be determined by measuring the levels of a specific nucleic acid in a host cell that has been infected. For example, the growth rate of the candidate live attenuated dengue vaccine may be measured using the specific viral DENV E protein or nucleic acid. Growth or replication rate may also be measured at predetermined time intervals, for example, at 6-hour, 12-hour, 24-hour and 36-hour intervals. In one embodiment, measurement of growth or replication rate may be determined at 24-hour intervals.
(43) It will be understood that prior to measuring the growth rate of the candidate live attenuated vaccine, the host cell may be infected for a preselected period of time. For example, the host cell may be infected for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours or 36 hours prior to the levels of a specific viral nucleic acid in a host cell being measured. In a preferred embodiment, the host cell is infected for 2 hours prior to measurement.
(44) In addition to growth and replication rate of a candidate live attenuated vaccine, another factor that contributes to the suitability of a candidate as a live attenuated vaccine is its immunogenicity. Immunogenicity may be determined for example by measuring virus uptake in the host cell. Virus uptake may be determined by measuring the amount of viral-specific nucleic acid sequences or protein within the host cell or host organism. In one embodiment, the viral-specific nucleic acid is a DENV specific cross-serotype sequence. It will be generally understood that amounts of viral nucleic acids for all DENV serotypes can be determined by measuring the amounts or expression levels of nucleic acids using conserved sequences (i.e. cross-serotype/pan-serotype sequences) between the various serotypes.
(45) In vivo screening may include, but is not limited to, exposing an animal to the candidate live attenuated vaccine and analyzing the safety and potency of the candidate. Suitable animals may include mouse or non-human primate animal models. In some embodiments, such models may be inoculated with a vaccine candidate and then infected with a virus, for example dengue virus or Zika virus, and monitored for viremia, disease, weight loss, sterilizing immunity or mortality.
(46) It will be appreciated by those of skill in the art that the present invention applies to viruses in general. Examples of viruses include but are not limited to dengue virus, Zika virus, yellow fever virus, respiratory syncytial virus, cytomegalovirus, Kaposi's sarcoma-associated herpes virus, Epstein-Barr virus, Human papillomavirus and Japanese encephalitis virus. In one embodiment, the virus is a virus of the Flaviviridae family. In another embodiment, the virus is selected from a dengue virus, a yellow fever virus, human immunodeficiency virus (HIV), Zika virus or a Japanese encephalitis virus. In a preferred embodiment, the virus is selected from the Aedes mosquito-borne group of flaviviruses, in particular DENV-1, DENV-2. DENV-3, DENV-4 and Zika. In yet another preferred embodiment, the virus is DENV-2 or DENV-3.
(47) Examples of virus strains include, but are not limited to, strains derived from a clinical isolate. For example, a virus strain may be a strain derived by exposure of a clinical isolate to a chemical mutagen and/or multiple passaging. In one embodiment, a virus strain is DENV-2 PDK53 or DENV-2 16681. In another embodiment, a virus strain is DENV-3 PGMK30 or DENV-3 16562. In another embodiment, a virus strain is a French Polynesian strain of Zika virus (ZIKV). In a preferred embodiment, the ZIKV strain is PF13/251013-18.
(48) The vaccine disclosed in the present invention will be generally understood as being administered to a subject in need thereof either in a single dose or in multiple doses. In one embodiment, the vaccine may be administered in a single dose. In another embodiment, the vaccine may be administered in two or more doses. The vaccine disclosed in the present invention may be administered alone or in combination with a buffer. An example of a suitable buffer is phosphate buffered saline. The vaccine of the present invention may be in lyophilized or aqueous form, with or without stabilizers in the final formulation. It will generally be understood by one of skill in the art that a lyophilized vaccine must be reconstituted in a suitable medium prior to administration to a subject.
(49) Suitable routes of administration of the pharmaceutical composition or vaccine described herein, to a subject, in particular to a human subject, may include, without limitation, oral, rectal, transmucosal or intestinal administration or intramuscular, subcutaneous, intramedullary, intrathecal, direct intraventricular, intravenous, intravitreal, intraperitoneal, intranasal, intradermal or intraocular injections. In a preferred embodiment, the route of administration is by intradermal or subcutaneous injection.
(50) In another embodiment, there is provided a live attenuated vaccine produced according to the method as described herein.
EXPERIMENTAL SECTION
Background
(51) DENV-2 PDK53 and DENV-3 PGMK30, which are two DENV LAVs that had been previously used in a clinical trial, were studied. DENV-2 PDK53 was generated from the wild-type strain DENV-2 16681 while DENV-3 PGMK30 was generated from the wild-type strain DENV-3 16562. In the trial, DENV-2 PDK53 was well tolerated and induced protective immune responses, whilst DENV-3 PGMK30 caused dengue-like syndrome in vaccinees. Both strains were developed using the same attenuation process, which involved serial passaging of clinical isolates in primary mammalian cells with periodic selection for viral clones that displayed small plaque phenotype. Until now, it has been believed that viruses which produce smaller plaques are less fit and are, hence, attenuated. Although the preparation of both attenuated strains was guided by the same selection guidelines, the disparate clinical results suggest a fundamental difference in the cellular events leading to the same outcome in this empirically defined criterion.
(52) Accordingly, by studying the differences in the various attributes of DENV infection that are thought to influence plaque sizes, the present study investigated whether DENV-2 PDK53 and DENV-3 PGMK30 produced smaller plaques compared to their respective parental clinical isolates due to distinct mechanisms.
(53) The present study also used a novel method for generating a candidate LAV.
(54) Materials and Methods
(55) General materials and methods used in the study are provided below.
(56) Cells, Viruses and Reagents
(57) Vero, HuH-7 and Raji cells stably expressing dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) receptor were cultured in Dulbecco's Modified Essential Medium (DMEM) while human monocytic cells THP-1, BHK21 cells and C6/36 cells were cultured in RPMI Medium 1640 (Gibco) supplemented with 10% foetal calf serum. Primary human monocytes were derived from blood obtained from a donor wherein whole blood was spun down in a Ficoll gradient to isolate peripheral blood mononuclear cells (PBMCs). The PBMCs were then allowed to adhere to plastic tissue culture flasks for 48 hours. Non-adherent cells were washed off with sterile PBS, leaving behind cells enriched for primary human monocytes. DENV strains of the original Mahidol stocks (DENV-2 16681, DENV-2 PDK53, DENV-3 16562 and DENV-3 PGMK30FRhL3) were obtained from Dr Claire Huang (Centres for Disease Control and Prevention, USA) and were passaged three times in C6/36 cells. To achieve sufficiently high titres for subsequent experiments, supernatant of PDK53 cultures were concentrated by high-speed centrifugation and reconstituted in 1/100 of its original culture volume. Viral genome sequences were uploaded to GenBank with the accession numbers listed in Table 1. Yellow fever YF-17D was commercially obtained (Sanofi Pasteur).
(58) TABLE-US-00001 TABLE 1 Dengue and Zika genome sequences. GenBank Virus Strain Accession Number DENV-2 16681 KU725663 DENV-2 PDK53 KU725664 DENV-3 16562 KU725665 DENV-3 PGMK30FRhL3 KU725666
(59) Random Mutagenesis by PCR
(60) Six PCR products derived from DENV2 strain were generated by 6 sets of primer pairs that are routinely used in the laboratory for Gibson assembly (Table 7). For this PCR reaction, high fidelity Q5 High-Fidelity DNA polymerase (New England BioLabs) is used. To introduce random mutagenesis to each of these fragments, Taq DNA polymerase was used instead for PCR amplification of each fragments. The PCR products are gel purified and assembled by Gibson assembly to obtain infectious clone which will then be transfected into HEK293T cells. Supernatant was plagued to observe for different plaque size. Small plaque phenotype were individually picked and expanded for sequencing analysis.
(61) TABLE-US-00002 TABLE2 PrimersusedforGibsonassemblyforZIKV Fragment1 (2137bp) PF13F1Fwd AGAGCTCGTTTAGTGAACCGAGTTGTTGATCTG (SEQIDNO:1) PF13F1Rev GTGGATCAAGTTCCAGCATCATCTTAGAGTTCTC AGTGC(SEQIDNO:2) Fragment2 (2316bp) PF13F2Fwd GCACTGAGAACTCTAAGATGATGCTGGAACTTGA TCCAC(SEQIDNO:3) PF13F2Rev CACCTGCTCTTTCAATGTACATGTCCACACTCTT TCCTGA(SEQIDNO:4) Fragment3 (1832bp) PF13F3Fwd TCAGGAAAGAGTGTGGACATGTACATTGAAAGAG CAGGTG(SEQIDNO:5) PF13F3Rev CTAAGCTTGAACTCTCCCTCAATGGCTGCTACTT TGTCG(SEQIDNO:6) Fragment4 (2570bp) PF13F4Fwd CGACAAAGTAGCAGCCATTGAGGGAGAGTTCAAG CTTAG(SEQIDNO:7) PF13F4Rev CATACGGTGTGGTGTCGGTCATGGCTATTCCTGT GACTCC(SEQIDNO:8) Fragment5 (2145bp) PF13F5Fwd GGAGTCACAGGAATAGCCATGACCGACACCACAC CGTATG(SEQIDNO:9) PF13F5Rev ATGCCATGCCGACCCAGACCCATGGATTTCCCCA CACCGG(SEQIDNO:10) Vector Amplification PF13Vector TGGGGAAATCCATGGGTCTGGGTCGGCATGGCAT Fwd CTCCAC(SEQIDNO:11) PF13Vector CACAGATCAACAACTCGGTTCACTAAACGAGCTC Rev TGCT(SEQIDNO:12)
(62) Plaque Purification
(63) BHK-21 was seeded in a 6-well plate 2 days before it was infected with approximately 15 plaque-forming units of PF13/251013-18 per well. After 1-hour adsorption of inoculum at 37 C., inoculum was removed and overlaid with maintenance media containing 0.9% agarose. Plaques that have big or small plaques were isolated for Sanger sequencing and also passaging in Vero for verification of plaque size by plaque assay.
(64) Infectious Clone Generation
(65) Genomic RNA of PF13/251013-18 and DV2-3295 were extracted using QIAamp Viral RNA Mini Kit (Qiagen) and cDNA synthesized using SuperScript III First-Strand Synthesis Kit (Invitrogen) before PCR amplification as 5 fragments for PF13/251013-18 and 6 fragments for DV2-3295 (primers in Tables 2 and 7 respectively) using Q5 High-Fidelity 2 Master Mix (New England BioLabs). TA cloning of these fragments into pGEMT vector (Promega) was performed to generate individual plasmids for each fragment. Site-directed mutagenesis on relevant plasmids was performed to generate specific mutations identified for DN-1, DN-2, DN-3, DN-4, D2-A and D2-B using QuikChange II Site-Directed Mutagenesis Kit (Agilent). Infectious clones for the different mutant were generated using Gibson assembly with NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs) to assemble their genomes into a vector containing a constitutive CMV immediate-early promoter.
(66) Mutant Virus Production
(67) Assembled infectious clones of DN-1, DN-2, DN-3, DN-4, DV2-3295, D2-A and D2-B were transfected into HEK293T cells using Lipofectamine 2000 as per manufacturer's instructions and viruses produced from these cells were harvested 48 hours post-transfection. Virus progeny was amplified in Vero cells up to 2 passages to generate working viral stocks.
(68) Infection of A129 Mice
(69) Virus stocks for animal infection were diluted in sterile PBS and titers determined prior to injection. Male A129 mice between 11 to 14 weeks old were injected intraperitoneally with 200 L of inoculum corresponding to intended number of pfu per dose. Daily weight of mice was measured and serum samples for viremia studies were collected by submandibular bleeding on Days 1 to 4, 6, 8, 10, 12, 15 and 21 post-infection and/or post-challenge.
(70) Quantification of Viral Load by Quantitative PCR (qPCR)
(71) Serum viral RNA was extracted using QIAamp Viral RNA Mini Kit (Qiagen) according to manufacturer's instructions. qPCR was performed using qScript One-Step qRT-PCR kit (Quanta) using ZIKV 1086 and ZIKV 1162c primers and ZIKV 1107-FAM probe. In vitro transcribed RNA containing the target region for primer and probe set was used to generate a standard curve for quantification of serum viral RNA copy number (Table 3).
(72) TABLE-US-00003 TABLE3 Primersusedforquantificationofviralload Primer Sequence ZIKV1086 YCGYTGCCCAACACAAG(SEQIDNO:13) ZIKV1162c CCACTAAYGTTCTTTTGCAGACAT(SEQID NO:14) ZIKV1107-FAM AGCCTACCTTGACAAGCARTCAGACACTCAA (SEQIDNO:15)
(73) Animal Models
(74) C57BL/6 mice were purchased from InVivos (Singapore). The SingHealth Institutional Animal Care and Use Committee approved all mouse experiments. Mice were infected by injecting 100 L of 110.sup.6 pfu/mL DENV subcutaneously into the hind footpads. Draining popliteal lymph nodes were collected 24 hours post-infection, snap frozen in O.C.T. Compound (Tissue-Tek), then cryosectioned (10 m thick sections). Sections were fixed with acetone at 4 C. then stained using J2 anti-dsRNA antibody (English and Scientific Consulting) and FITC-conjugated anti-mouse antibody (Jackson ImmunoResearch). Slides were imaged by confocal microscopy. Images were prepared using ImageJ (National Institutes of Health, USA).
Example 1
(75) Investigation of Factors Contributing to the Limitation of Plaque Sizes.
(76) A major contributing factor to the limitation of plaque sizes is the antiviral response triggered by the innate immune function of host cells used in the assay. It is a cascade of cellular events initiated by infected cells, which releases cellular products such as cytokines that activate antiviral responses in surrounding uninfected cells to prevent infection.
(77) To investigate the antiviral response triggered by the innate immune function of the host cells to each of the viral strains, HuH-7 cells seeded in a confluent monolayer were infected with 10 multiplicity of infection (MOI) of DENV-2 16681 or the DENV-3 strains; or 1MOI and 10MOI of DENV-2 PDK53. At 24 hours post-infection, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen) and then analysed on the Illumina HumanHT-12 v4 Expression Beadchip (Illumina). Results were analysed using Partek Genomics Suite v6.6 2014 (Partek). Pathway analysis was done using Gene Set Enrichment Analysis (Broad Institute, USA).
(78) The data in this study showed that DENV-2 PDK53 infection induced a significantly stronger innate immune response in host cells compared to its parental strain DENV-2 16681, while DENV-3 PGMK30 and its parental strain DENV-3 16562 were similarly weakly immunogenic (
(79) A possible explanation for this difference in the immunogenicity of DENV-2 PDK53 and DENV-3 PGMK30 in HuH-7 cells could be the difference in cell line through which the viruses were generated: primary dog kidney and primary green monkey kidney cells, respectively. As observed in
Example 2
(80) Investigation of Effective Spreading of Antiviral Responses Due to Superior Immunogenic Properties as a Contributing Factor to the Formation of Smaller Plaques in DENV-2 PDK53.
(81) Next, the possibility that effective spreading of antiviral responses due to superior immunogenic properties could be a contributing factor to the formation of smaller plaques in DENV-2 PDK53 was investigated. This was studied by detecting the migration of phosphorylated STAT1 (pSTAT1), which is a marker of STAT1 activation resulting from interferon activation, in uninfected cells surrounding infected foci.
(82) BHK-21 cells in a confluent monolayer on glass coverslips were infected with 30 plaque-forming units (pfu) of virus and incubated for 72 hours at 37 C. IFN (Abcam) was used as a positive control. The cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, then stained with anti-phospho-STAT1 (Y701) rabbit polyclonal IgG (R&D Systems), J2 anti-dsRNA mouse antibody, DAPI, AlexaFluor488 anti-rabbit, and AlexaFluor594 anti-mouse secondary antibodies (Invitrogen). Coverslips were affixed onto glass slides using Mowiol 4-88 (Sigma-Aldrich) and imaged using an LSM 710 confocal microscope (Carl Zeiss).
(83) As expected, there were greater levels of STAT1 activation in cells surrounding foci of DENV-2 PDK53 infection compared to DENV-2 16681 (
(84) To confirm this observation, plaque assays were performed on BHK-21 cells silenced of major transcription factors for interferon and inflammatory responses; namely: IRF3, STAT1 and NF-kB (p65 and p50) (
(85) TABLE-US-00004 TABLE4 BHK21siRNASequences(Mesocricetusauratus) GeneTarget siRNASequence IRF3 Sense:GGAACAAUGGGAGUUCGAAdTdT (SEQIDNO:16) Antisense:UUCGAACUCCCAUUGUUCCdTdT (SEQIDNO:17) STAT1 Sense:CCGUUUCCAUGACCUCCUUdTdT (SEQIDNO:18) Antisense:AAGGAGGUCAUGGAAACGGdTdT (SEQIDNO:19) NF-kBp65 Sense:GCAUCCAGACCAACAAUAAdTdT (SEQIDNO:20) Antisense:UUAUUGUUGGUCUGGAUGCdTdT (SEQIDNO:21) NF-kBp50 Sense:CCUCAUGUUCACCGCCUUUdTdT (SEQIDNO:22) Antisense:AAAGGCGGUGAACAUGAGGdTdT (SEQIDNO:23)
(86) It was found that DENV-2 PDK53 formed greater number of plaques across all knocked-down (KD) cells, with differences in IRF3 being most significant (
Example 3
(87) Investigation of Virus Infectivity as a Factor that Determines Plaque Size.
(88) With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.
(89) To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3 UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.
(90) TABLE-US-00005 TABLE5 PCRprimersequences. GeneTarget PrimerSequence DENVLYL3UTR Forward:TTGAGTAAACYRTGCTGCCTGTA TGCC(SEQIDNO:24) Reverse:GAGACAGCAGGATCTCTGGTCTY TC(SEQIDNO:25) GAPDH(Human) Forward:GAGTCAACGGATTTGGTCGT (SEQIDNO:26) Reverse:TTGATTTTGGAGGGATCTCG (SEQIDNO:27) CXCL10(Human) Forward:GGTGAGAAGAGATGTCTGAATCC (SEQIDNO:28) Reverse:GTCCATCCTTGGAAGCACTGCA (SEQIDNO:29) ISG20(Human) Forward:ACACGTCCACTGACAGGCTGTT (SEQIDNO:30) Reverse:ATCTTCCACCGAGCTGTGTCCA (SEQIDNO:31) IFIT2(Human) Forward:GAAGAGGAAGATTTCTGAAG (SEQIDNO:32) Reverse:CATTTTAGTTGCCGTAGG (SEQIDNO:33) IFN(Canine) Forward:GCTCTTGTGACCACTACACCA (SEQIDNO:34) Reverse:AAGACCTTCTGGGTCATCACG (SEQIDNO:35) IFN(Canine) Forward:GGATGGAATGAGACCACTGTCG (SEQIDNO:36) Reverse:ACGTCCTCCAGGATTATCTCCA (SEQIDNO:37)
(91) The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).
(92) Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (
(93) Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.
(94) Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.
(95) Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.
Example 4
(96) Strategy for Attenuating Viruses for Vaccine Applications
(97) A description of the procedure and the amount of time required for each step is detailed in Table 6 below.
(98) Table 6. Description of procedures and the estimated time required to achieve each of the steps in the proposed method of manufacturing attenuated vaccines.
(99) TABLE-US-00006 Estimated shortest time Steps required 1. Passaging of virus from clinical isolates in 2 weeks cultured cells distinct from intended host for no more than 5 passages, random mutagenesis, mutagenesis with a chemically-derived mutagen, culture at temperature lower than 37 C., or a combination thereof 2. Infecting intended host cells, selecting a 1 week host cell displaying a preselected phenotype, isolating viral nucleic acid from the selected host cell 3. Sequencing of virus from single/pooled 2 weeks selected cells 4. Reconstruction of candidate live 2-3 weeks attenuated vaccines in infectious clones 5. Production of candidate live attenuated 1 week vaccines 6. In-vitro and/or in-vivo screening of 2 weeks candidate live attenuated vaccines for desired phenotypes
(100) General Description of Steps in Table 6
(101) The objective of step 1 is to generate a virus population with a diverse genetic makeup from clinical isolates. A cell or cell line from a species other than the intended vaccine is infected so that there is no adaptation of the virus to the innate immunity of the intended host. Mutagenesis of the virus may occur through serial passaging of the infected cell no more than 5 times, culture of the infected cell under sub-optimal conditions (e.g. at a temperature lower than 37 C.) or by random mutagenesis (e.g. error-prone PCR or using a mutagen). A chemically derived mutagen such as Ribavirin and 5-fluorouracil may be added to further enhance the mutagenesis of the virus. Alternatively, a chemically derived mutagen is used on its own to generate the population of genetically diverse virus. Generating a diverse population of viruses increases the chances of generating strains that fit the desired selection criteria (i.e.: fast growing and with strong immunogenic properties). After a short period of infection (e.g.: 24 hours), the virus is isolated and used in step 2.
(102) The objective of step 2 is to select for specific viruses that induce a specific phenotype that may be indicative of viral infectivity and/or immunogenicity. A specific phenotype may be small plaque size relative to the original virus or the wild-type virus, or high ISRE responses, which is an indication of their propensity to activate type-I-interferon responses. Where the specific phenotype is plaque size, this is performed by infecting cells of the same species as the target vaccine with the viruses derived from step 1, collecting the supernatant and using the supernatant in a plaque assay. Plaques of interest are then selected and purified. Where the specific phenotype is the induction of ISRE response, this is performed by infecting cells of the same species as the target vaccinee that carry the ISRE-driven GFP reporter gene with the viruses derived from step 1. GFP expression in these cells indicates the activation of ISRE. Cells expressing high level of GFP fluorescence, which is indicative of high ISRE activation, are isolated through cell sorting by flow cytometry. Viruses extracted from these cells are therefore the specific ones that induce high ISRE responses and are assumed to exhibit the characteristics of fast viral entry and strong immunogenicity, which are the traits of successfully attenuated viruses.
(103) The objective of step 3 is to characterize the virus that has been isolated from step 2, so that its genetic identity is known and a blueprint can therefore be created to make replicas of it. To characterize the virus, sequencing of its genetic make-up, through the use of various techniques such as Sanger sequencing or Next-Generation sequencing, is performed in conjunction with the use of other bioinformatics tools to assemble the whole viral genome.
(104) The objective of step 4 is to reconstruct the identified virus after its genetic blue print from step 3 is obtained. To do this, mutagenesis of infectious clones that were generated from the initial input of clinical virus isolate is performed.
(105) The objective of step 5 is the production of the reconstructed virus from step 4. Briefly, the infectious clone plasmids are linearized and in vitro transcribed to produce viral RNA, which is then introduced into host cells through electroporation or transfection. Replicas of these viruses are replicated and released from the host cells, which is harvested from the cell culture media. Alternatively, the infectious clone plasmids may contain a constitutive promoter that drives transcription of viral RNA. These infectious clone plasmids may be introduced into host cells through electroporation or transfection and the viral genome is transcribed to produce viral RNA, which serves as a template for viral protein synthesis and viral replication.
(106) The objective of step 6 is to screen and assess if the resulting virus from step 5 is a fit candidate for live attenuated vaccine production. The virus may be assessed in vitro to determine if it possesses one or more of the desirable phenotypes displayed by successfully attenuated LAVs: rapid replication in host cells; ability to trigger robust host innate immune responses; and the generation of small plaques in plaque assays. With the completion of in vitro assessment of the LAV, in vivo assessment of protective efficacy on animal models, such as mice and macaques, may follow. Alternatively, the in vitro and in vivo screening steps may be performed independently or simultaneously.
Example 5
(107) Generation of a Zika Virus LAV
(108) A French Polynesian strain of Zika virus (ZIKV), PF13/251013-18 (SEQ ID NO: 38), was passaged in Vero and C6/36. Following 4 rounds of passage in Vero and a single round passage in C6/36, next-generation sequencing (NGS) of PF13/251013-18 revealed 2 amino acid sequence changes as compared to its reference genome (GenBank ID KX369547). Furthermore, plaque assay of PF13/251013-18 also identified virus plaques of different sizes (
(109) DN-1 was tested in a Type I interferon receptor-deficient mouse model, A129. 10.sup.3 plaque-forming units (pfu) of DN-1 were injected through the intraperitoneal route into male A129 mice. As compared to another French Polynesian ZIKV strain, H/PF/2013, which was lethal in the A129 mouse model, mice that received DN-1 showed 100% survival rate in contrast to H/PF/2013 where the survival rate was 0% (
Example 6
(110) Generation of a Dengue Virus LAV
(111) One strain each of DENV-2 (DV2-3295, GenBank ID: EU081177) and DENV-4 (DV4-2270, GenBank ID: GQ398256) were put through the workflow highlighted in
(112) Sanger sequencing was then performed to identify mutations present in sorted cells and the mutations are shown in
(113) Four mutations were identified from the sorted GFP-positive cells infected with mutagenized DV4-2270 infection (
(114) TABLE-US-00007 TABLE7 GibsonAssemblyPrimersforDENV2 PrimerName Sequence Fragment1 (2212bp) D2-F1 AGAGCTCGTTTAGTGAACCGAGTTGTTAGTCTACGT GGACCGAC(SEQIDNO:43) D2-R1 GCTGTGTCACCTAAAATGGCCATTCTCTTC(SEQ IDNO:44) Fragment2 (1370bp) D2-F2 GAAGAGAATGGCCATTTTAGGTGACACAGC(SEQ IDNO:45) D2-R2 GGAACAATGCCATTCCCAAGACTCCTAGTG(SEQ IDNO:46) Fragment3 (1432bp) D2-F3 CACTAGGAGTCTTGGGAATGGCATTGTTCC(SEQ IDNO:47) D2-R3 GGAGATCCTGACGTTCCAGGAGAAAAGTCC(SEQ IDNO:48) Fragment4 (2098bp) D2-F4 GGACTTTTCTCCTGGAACGTCAGGATCTCC(SEQ IDNO:49) D2-R4 GGAATTTTCAATGCTATGTCTCAACATTGGTG (SEQIDNO:50) Fragment5 (1632bp) D2-F5 CACCAATGTTGAGACATAGCATTGAAAATTCC (SEQIDNO:51) D2-R5 CTGTCATTGCCATCTGTGTCACCATGGG(SEQID NO:52) Fragment6 (2165bp) D2-F6 CCCATGGTGACACAGATGGCAATGACAG(SEQID NO:53) D2-R6 GATGCCATGCCGACCCAGAACCTGTTGATTCAACAG CACC(SEQIDNO:54) Vector Amplification D2-F7 GGTGCTGTTGAATCAACAGGTTCTGGGTCGGCATGG CATCTCCAC(SEQIDNO:55) D2-R7 GTCGGTCCACGTAGACTAACAACTCGGTTCACTAAA CGAGCTCT(SEQIDNO:56)
(115) The present invention is based on novel procedures that identify and select for a virus that exhibits susceptibility to a host defense mechanism in order to generate a live attenuated vaccine. Advantageously, mutations of the coding regions of the virus that confer virulence in order to weaken or attenuate the virus are not necessary.