PSMA-BASED MOLECULAR-GENETIC REPORTER SYSTEM
20200347464 ยท 2020-11-05
Assignee
Inventors
- Martin G. Pomper (Baltimore, MD)
- MARK CASTANARES (BALTIMORE, MD, US)
- IL MINN (ELLICOTT CITY, MD, US)
- SHAWN LUPOLD (ELLICOTT CITY, MD, US)
Cpc classification
C12N2710/16222
CHEMISTRY; METALLURGY
A61K51/0455
HUMAN NECESSITIES
C12N2710/10044
CHEMISTRY; METALLURGY
C12N2710/16143
CHEMISTRY; METALLURGY
A61K49/0021
HUMAN NECESSITIES
C12Q1/6897
CHEMISTRY; METALLURGY
C12Y304/17021
CHEMISTRY; METALLURGY
G01N33/57492
PHYSICS
C12N15/86
CHEMISTRY; METALLURGY
A61K51/0406
HUMAN NECESSITIES
C12N2710/10043
CHEMISTRY; METALLURGY
International classification
C12Q1/6897
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
Methods, reporter gene constructs, and kits for using prostate-specific membrane antigen (PSMA) as an imaging reporter to image a variety of cells and tissues are provided.
Claims
1. A method for using prostate-specific membrane antigen (PSMA) as an imaging reporter, the method comprising: a) introducing a reporter gene construct comprising a PSMA gene operably linked to a transcriptional promoter to a cell; b) allowing the cell to express PSMA protein; c) adding an imaging probe that can detect the PSMA protein to the cell; and d) imaging the imaging probe, thereby detecting the PSMA protein.
2. The method of claim 1, wherein the reporter gene construct is a viral reporter gene construct.
3. The method of claim 2, wherein the viral reporter gene construct is an adenoviral reporter gene construct.
4. The method of claim 3, wherein the transcriptional promoter is a constitutive promoter.
5. The method of claim 4, wherein the constitutive promoter is the cytomegalovirus immediate-early gene (CMV) promoter.
6. The method of claim 1, wherein the reporter gene construct is a non-viral, episomal reporter gene construct.
7. The method of claim 6, wherein the transcriptional promoter is the PEG-Promoter.
8. The method of claim 7, wherein the cell is a cancer cell.
9. The method of claim 6, wherein the non-viral, episomal reporter gene construct further comprises a Gal4-VP16 and Upstream Activation Sequence (UAS) transcriptional amplification system.
10. The method of claim 9, wherein the transcriptional amplification system comprises five copies of the UAS.
11. The method of claim 6, wherein the non-viral, episomal reporter gene construct further comprises the EBNA-1 gene.
12. The method of claim 6, wherein the non-viral, episomal reporter gene construct further comprises OriP.
13. The method of claim 1, wherein the PSMA gene comprises the coding sequence of the full-length PSMA protein.
14. The method of claim 1, wherein the PSMA gene is truncated at the 5 end of the coding sequence of the PSMA protein.
15. The method of claim 14, wherein the truncation results in a mutated PSMA protein that is lacking the first 11 amino acids of the wild-type PSMA protein.
16. The method of claim 1, wherein the PSMA protein is mutated such that its second amino acid is glycine instead of tryptophan.
17. The method of claim 1, wherein the PSMA gene is CpG-free.
18. The method of claim 1, wherein the reporter gene construct comprising a PSMA gene is CpG-free.
19. The method of claim 1, wherein the reporter gene construct comprising a PSMA gene further comprises a neomycin or kanamycin resistant gene.
20. The method of claim 1, wherein the imaging probe detects the PSMA protein by binding to the active site of the PSMA protein.
21. The method of claim 1, further comprising the cleavage of the imaging probe by the PSMA protein.
22. The method of claim 21, wherein cleavage of the imaging probe results in at least one cleavage product that is fluorescent and/or radioactive.
23. The method of claim 1, wherein the imaging probe is 2-(3-{1-carboxy-5-[(6-[.sup.18F]fluoro-pyridine-3-carbonyl)-amino]-pentyl}-ureido)-pentanedioic acid (DCFPyL) or N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-4-[4.sup.18F]fluorobenzyl-L-cysteine (DCFBC).
24. The method of claim 1, wherein imaging the PSMA protein occurs by at least one method selected from the group consisting of near-infrared (NIR) optical tomography, positron emission tomography (PET), and single photon emission computed tomography (SPECT).
25. The method of claim 1, wherein the PSMA protein is detected on the surface of the cell.
26. The method of claim 1, wherein the PSMA protein is detected inside the cell.
27. The method of claim 1, wherein the cell is found in a subject.
28. The method of claim 27, wherein the subject is human.
29. An adenoviral reporter gene construct comprising a prostate-specific membrane antigen (PSMA) gene operably linked to a cytomegalovirus immediate-early gene (CMV) promoter.
30. The construct of claim 29, wherein the PSMA gene comprises the coding sequence of the full-length PSMA protein.
31. The construct of claim 29, wherein the PSMA gene is truncated at the 5 end of the coding sequence of the PSMA protein.
32. The construct of claim 31, wherein the truncation results in a mutated PSMA protein that is lacking the first 11 amino acids of the wild-type PSMA protein.
33. The construct of claim 29, wherein the PSMA gene is mutated such that the construct expresses a mutated PSMA protein that has glycine as a second amino acid instead of tryptophan.
34. The construct of claim 29, wherein the PSMA gene is CpG-free.
35. The construct of claim 29, wherein the adenoviral reporter gene construct comprising a PSMA gene is CpG-free.
36. The construct of claim 29, wherein the adenoviral reporter gene construct comprising a PSMA gene further comprises a neomycin or kanamycin resistant gene.
37. A non-viral, episomal reporter gene construct comprising a prostate-specific membrane antigen (PSMA) gene operably linked to a PEG-Promoter.
38. The construct of claim 37, wherein the construct further comprises a Gal4-VP16 and Upstream Activation Sequence (UAS) transcriptional amplification system.
39. The construct of claim 38, wherein the transcriptional amplification system comprises five copies of the UAS.
40. The construct of claim 37, wherein the construct further comprises the EBNA-1 gene.
41. The construct of claim 37, wherein the construct further comprises OriP.
42. The construct of claim 37, wherein the PSMA gene comprises the coding sequence of the full-length PSMA protein.
43. The construct of claim 37, wherein the PSMA gene is truncated at the 5 end of the coding sequence of the PSMA protein.
44. The construct of claim 43, wherein the truncation results in a mutated PSMA protein that is lacking the first 11 amino acids of the wild-type PSMA protein.
45. The construct of claim 37, wherein the PSMA gene is mutated such that the construct expresses a mutated PSMA protein that has glycine as a second amino acid instead of tryptophan.
46. The construct of claim 37, wherein the PSMA gene is CpG-free.
47. The construct of claim 37, wherein the reporter gene construct comprising a PSMA gene is CpG-free.
48. The construct of claim 37, wherein the reporter gene construct comprising a PSMA gene further comprises a neomycin or kanamycin resistant gene.
49. A kit comprising a construct of claim 29 or claim 37.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Having thus described the presently disclosed subject matter in general terms, reference will now be made to the accompanying Figures, which are not necessarily drawn to scale, and wherein:
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020] PSMA-targeted compound (YC-VIII-46); and (B) immunofluorescent analyses of transfected cells using anti-PSMA antibody;
[0021]
[0022]
[0023]
DETAILED DESCRIPTION
[0024] The presently disclosed subject matter now will be described more fully hereinafter with reference to the accompanying Figures, in which some, but not all embodiments of the inventions are shown. Like numbers refer to like elements throughout. The presently disclosed subject matter may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Indeed, many modifications and other embodiments of the presently disclosed subject matter set forth herein will come to mind to one skilled in the art to which the presently disclosed subject matter pertains having the benefit of the teachings presented in the foregoing descriptions and the associated Figures. Therefore, it is to be understood that the presently disclosed subject matter is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims.
[0025] Molecular-genetic imaging is the visualization, characterization, and measurement of biological processes at the molecular and cellular levels by using reporter gene/reporter probe systems. The prostate-specific membrane antigen (PSMA) is a human transmembrane protein that possesses many properties that are desirable as a reporter for an imaging system. PSMA is internalized upon the binding of certain ligands (Liu et al., 1998), providing a mechanism to accumulate PSMA-targeting agents within cells. The expression of PSMA is limited to the prostate, the proximal tubules of the kidney, and the brain (Rajasekaran et al., 2005). Alternative processing results in both cell surface and cytoplasmic isoforms, the latter of which is primarily expressed in the healthy prostate (Mlcochova et al., 2009). PSMA expression is low and isolated in healthy tissues, allowing imaging at high sensitivity and specificity for metastatic prostate tumors that overexpress the cell surface isoform (Afshar-Oromieh et al., 2013; Barrett et al., 2013; Cho et al., 2012). There are several PSMA-binding ligands that have been developed for the delivery of imaging and therapeutic agents for prostate cancer, including low-molecular-weight nuclear, fluorescent, and multi-modality imaging probes (Chen et al., 2009; Banerjee et al., 2011). This combination of tissue-restricted expression, human biocompatibility, available probe diversity, and proven clinical utility are some of the advantages of using PSMA as an imaging reporter. The presently disclosed subject matter provides a PSMA-based gene reporter/probe system that can be generalized for a variety of cell and tissue types.
I. PSMA Reporter Gene Constructs And Kits
[0026] In some embodiments, the presently disclosed subject matter provides a reporter gene construct comprising a PSMA gene. The PSMA gene may be from a variety of organisms, although in preferred embodiments, the gene will be a human gene (e.g., GenBank Accession No. DD461260 or NG_029170) and the PSMA protein expressed from the gene will be a human protein (e.g., GenBank Accession No. NP_004467). In some embodiments, the PSMA gene will have substantial percent identity to the sequence identified as GenBank Accession No. DD461260 NG_029170 and the PSMA protein will have substantial percent identity to the sequence identified as GenBank Accession No. NP_004467.
[0027] The term percent identity, as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Identity and similarity can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignments of the sequences may be performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters, including default parameters for pairwise alignments.
[0028] The term sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. Sequence analysis software may be commercially available or independently developed. Typical sequence analysis software will include but is not limited to the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.), BLASTP, BLASTN, BLASTX (Altschul et al. (1990) J. Mol. Biol. 215:403-410, and DNASTAR (DNASTAR, Inc., Madison, Wis.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the default values of the program referenced, unless otherwise specified. As used herein default values will mean any set of values or parameters which originally load with the software when first initialized.
[0029] It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying genes and proteins for use in the presently disclosed subject matter, for example wherein genes and proteins from a different species but have the same or similar function or activity. The term substantial identity or substantial percent identity in its various grammatical forms comprises a sequence that has a desired percent identity, for example, at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% compared to a reference sequence using one of the alignment programs described using standard parameters.
[0030] The term imaging reporter, as used herein, refers to a protein that, in combination with an imaging probe, can be used to mark cells, intracellular organelles, and the like. Examples of reporter systems include reporters that encode -galactosidase, chloramphenicol acetyltransferase, luciferase, and green fluorescent protein (GFP). In some embodiments, the imaging reporter may act as both an imaging probe to visualize the target molecule, as well as a therapeutic agent, such as to inhibit a disease process, for example.
[0031] The term reporter gene construct, as used herein, refers to a vector comprising the gene encoding for the imaging reporter. The reporter gene construct can contain a number of components, including, but not limited to one or more of the following: an origin of replication; a selectable marker gene; one or more expression control elements, such as a transcriptional control element (e.g., a promoter, an enhancer, a terminator), and/or one or more translation signals; and a signal sequence or leader sequence for targeting to the secretory pathway in a selected host cell. In some embodiments, the presently disclosed construct comprises all or part of a PSMA gene.
[0032] The term promoter or transcriptional promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3 to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as constitutive promoters. Promoters that cause a gene to be expressed in a specific cell type are commonly referred to as cell-specific promoters or tissue-specific promoters. Promoters that cause a gene to be expressed at a specific stage of development or cell differentiation are commonly referred to as developmentally-specific promoters or cell differentiation-specific promoters. Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as inducible promoters or regulatable promoters. In some embodiments, the promoter is tumor-specific, such as the promoter from a minimal promoter region of progression elevated gene-3 (Peg-3), which allows cancer-selective expression. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.
[0033] A coding sequence is under the control of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then spliced (if the coding sequence contains introns) and translated into the protein encoded by the coding sequence.
[0034] Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding sequence in a host cell. In eukaryotic cells, polyadenylation signals are control sequences.
[0035] The term operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
[0036] In some embodiments, the reporter gene construct is based on a viral vector, such as a retroviral vector including a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and the like. In some embodiments, the reporter gene construct is based on an adenoviral vector. Advantages of adenoviral vectors include, but are not limited to, that they are a means to transfer equal amounts of transgene reporters, the adenovirus genome is maintained episomally and is not influenced by integration site or copy number, and adenoviruses have been applied successfully in imaging reporter gene comparisons (Gil et al., 2012; Min et al., 2003; Miyagawa et al., 2005).
[0037] In some embodiments, the presently disclosed subject matter provides an adenoviral reporter gene construct comprising a prostate-specific membrane antigen (PSMA) gene operably linked to a cytomegalovirus immediate-early gene (CMV) promoter. The CMV promoter induces high-level constitutive expression in a variety of mammalian cell lines.
[0038] In some embodiments, the presently disclosed subject matter provides a non-viral, episomal reporter gene construct. In general, in eukaryotes, episomes are closed circular DNA molecules that are replicated in the nucleus and remain physically separate from host cell chromosomes. In other embodiments, the presently disclosed subject matter provides a non-viral, episomal reporter gene construct comprising a prostate-specific membrane antigen (PSMA) gene operably linked to a PEG-Promoter, a tumor-specific promoter from a minimal promoter region of progression elevated gene-3 (Peg-3), which allows cancer-selective expression of PSMA.
[0039] In some embodiments, the non-viral, episomal reporter gene construct further comprises a Gal4-VP16 and Upstream Activation Sequence (UAS) transcriptional amplification system. In this system, the Gal4-VP16 component, a fusion protein of yeast transcriptional activator protein Gal4 and herpes simplex virus VP16, acts as an activator and the UAS component acts as an enhancer to which Gal4 specifically binds to activate gene transcription. In other embodiments, each UAS is 17 base pairs long, roughly palindromic, and in the form of CGG-N11-CCG. In other embodiments, the UAS is 5-(T/C)GGAGTACTGTCCTCCG-3 (SEQ ID NO: 1). Multiple copies of the UAS can be inserted onto one construct, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, or more. These copies may be separated by other nucleotides. In further embodiments, the transcriptional amplification system comprises five copies of the UAS. In still further embodiments, the five copies of the UAS has the sequence:
TABLE-US-00001 (SEQIDNO:2) CGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTC CTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAG.
[0040] In some embodiments, the non-viral, episomal reporter gene construct further comprises the EBNA-1 (Epstein-Barr nuclear antigen 1) gene, which encodes a viral protein associated with the Epstein-Barr virus, for prolonged action in transfected cells. In other embodiments, the non-viral, episomal gene construct further comprises OriP, a viral origin of plasmid replication.
[0041] In some embodiments, the PSMA gene comprises the coding sequence of the full-length PSMA protein. In other embodiments, the PSMA gene is truncated at the 5 end of the coding sequence of the PSMA protein. It has been found that N-terminal truncations of the PSMA protein, such as truncation of the first 11 amino acids, still allows the N-terminally modified PSMA to successfully localize to the cell membrane and centrosome. In still other embodiments, the truncation results in a mutated PSMA protein that is lacking the first 11 amino acids of the wild-type PSMA protein. In addition, substitution of the second amino acid in the PSMA protein from glycine to tryptophan also allows the modified PSMA protein to localize correctly. In further embodiments, the PSMA protein is mutated such that its second amino acid is glycine instead of tryptophan. In still further embodiments, the PSMA gene is mutated such that the construct expresses a mutated PSMA protein that has glycine as a second amino acid instead of tryptophan.
[0042] As used herein, the term mutation or mutated is used herein to refer to an alteration in a polynucleotide sequence, which results in an altered gene product or protein. A mutation according to the presently disclosed subject matter can involve substitution, insertion or deletion. A polynucleotide or protein in which a mutation has occurred is called a mutant. Mutation may be introduced to one or both strands of a double-stranded polynucleotide. The strand of a double-stranded polynucleotide in which a mutation has occurred is referred to as a mutant strand; the strand with no mutation introduced is called a non-mutant strand. The term mutagenesis according to the invention refers to the introduction of mutations into a polynucleotide sequence. The term wild-type as used herein refers to the normal, non-mutated version of a gene or protein.
[0043] Previous efforts have shown that PSMA expression has not significantly altered cellular phenotype in vitro in multiple mammalian cell types. In still further embodiments, functional modifications that alter PSMA enzymatic activity, ligand binding ability, cellular internalization, and the like are employed, for example in cases of negative effects of transgene expression (Anilkumar et al., 2003; Rajasekaran et al., 2003).
[0044] In some embodiments, a CpG-free version of PSMA is used that has a modified cDNA sequence that contains no CpG sequences. This modification at the DNA level does not change the protein sequence. Therefore, the CpG-free PSMA also has substantial percent identity to the protein sequence identified as GenBank Accession No. NP_004467. Accordingly, in some embodiments, the PSMA gene is CpG-free.
[0045] In other embodiments, the reporter gene construct comprising a PSMA gene is CpG-free. In still other embodiments, a presently disclosed clinically compatible vector is equipped with CpG-free sequences. In further embodiments, a CpG-free-PEG-PSMA vector comprises a CpG-free R6K gamma origin of replication, a CpG-free polyadenylation signal, a CpG-free Neomycin/Kanamycin resistant gene, a CpG-free S/MAR sequence and a CpG-free PSMA. Using the CpG-free DNA prevents harmful immune reaction in human via Toll-like receptor 9 (Bauer et al., 2001) and using a Neomycin/Kanamycin resistant gene allows the presently disclosed vectors to be employed for clinical use (FDA, 1996).
[0046] As used herein, a CpG site is a region of DNA where a cytosine nucleotide occurs next to a guanine nucleotide. Cytosines in CpG sites can be methylated to form 5-methylcytosine. As used herein, the term CpG-free means that the gene and/or construct does not have any CpG sites.
[0047] In some embodiments, the presently disclosed subject matter provides a kit comprising a presently disclosed construct. In general, a presently disclosed kit contains some or all of the components, reagents, supplies, and the like to practice a method according to the presently disclosed subject matter. In other embodiments, the term kit refers to any intended article of manufacture (e.g., a package or a container) comprising a presently disclosed reporter gene construct and a set of particular instructions for practicing the methods of the presently disclosed subject matter.
II. Methods for Using PSMA as an Imaging Reporter
[0048] In some embodiments, the presently disclosed subject matter provides a method for using prostate-specific membrane antigen (PSMA) as an imaging reporter, the method comprising: a) introducing a reporter gene construct comprising a PSMA gene operably linked to a transcriptional promoter to a cell; b) allowing the cell to express PSMA protein; c) adding an imaging probe that can detect the PSMA protein to the cell; and d) imaging the imaging probe, thereby detecting the PSMA protein. The presently disclosed constructs can be used in the presently disclosed methods and are described in detail hereinabove.
[0049] In some embodiments, the reporter gene construct is a viral reporter gene construct. In other embodiments, the viral reporter gene construct is an adenoviral reporter gene construct. In still other embodiments, the reporter gene construct is a non-viral, episomal reporter gene construct.
[0050] In some embodiments, the transcriptional promoter is a constitutive promoter. In other embodiments, the constitutive promoter is the cytomegalovirus immediate-early gene (CMV) promoter. In still other embodiments, the transcriptional promoter is the PEG-Promoter.
[0051] In some embodiments, the non-viral, episomal reporter gene construct further comprises a Gal4-VP16 and Upstream Activation Sequence (UAS) transcriptional amplification system. In other embodiments, the transcriptional amplification system comprises five copies of the UAS.
[0052] In some embodiments, the non-viral, episomal reporter gene construct further comprises the EBNA-1 gene. In other embodiments, the non-viral, episomal reporter gene construct further comprises OriP.
[0053] In some embodiments, the PSMA gene comprises the coding sequence of the full-length PSMA protein. In other embodiments, the PSMA gene is truncated at the 5 end of the coding sequence of the PSMA protein. In still other embodiments, the truncation results in a mutated PSMA protein that is lacking the first 11 amino acids of the wild-type PSMA protein. In further embodiments, the PSMA protein is mutated such that its second amino acid is glycine instead of tryptophan.
[0054] In some embodiments, the PSMA gene is CpG-free. In other embodiments, the reporter gene construct comprising a PSMA gene is CpG-free. In still other embodiments, the reporter gene construct comprising a PSMA gene further comprises a neomycin or kanamycin resistant gene.
[0055] In some embodiments, the presently disclosed method comprises introducing a reporter gene construct comprising a PSMA gene operably linked to a transcriptional promoter to a cell. Introducing the reporter gene construct to a cell may be performed using electroporation, DEAE Dextran transfection, calcium phosphate transfection, cationic liposome fusion, protoplast fusion, creation of an in vivo electric field, DNA-coated microprojectile bombardment, injection with recombinant replication-defective viruses, homologous recombination, in vivo gene therapy, ex vivo gene therapy, viral vectors, naked DNA transfer, and any other method that will allow the reporter gene construct to enter the cell.
[0056] In some embodiments, the cell is found in a subject, in which case introducing the reporter gene construct to a cell may also occur by any suitable route of administration, including orally, nasally, transmucosally, ocularly, rectally, intravaginally, parenterally, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intra-articular, intra-sternal, intra-synovial, intra-hepatic, intralesional, intracranial, intraperitoneal, intranasal, or intraocular injections, intracisternally, topically, as by powders, ointments or drops (including eyedrops), including buccally and sublingually, transdermally, through an inhalation spray, or other modes of delivery known in the art.
[0057] In those embodiments where the cell is found in a subject, the cell is desirably a human cell, although it is to be understood that the methods described herein are effective with respect to the cells of all vertebrate species, which are intended to be included in the term subject. Suitable animal cells include mammals including, but not limited to, primates, e.g., humans, monkeys, apes, gibbons, chimpanzees, orangutans, macaques and the like; bovines, e.g., cattle, oxen, and the like; ovines, e.g., sheep and the like; caprines, e.g., goats and the like; porcines, e.g., pigs, hogs, and the like; equines, e.g., horses, donkeys, zebras, and the like; felines, including wild and domestic cats; canines, including dogs; lagomorphs, including rabbits, hares, and the like; and rodents, including mice, rats, guinea pigs, and the like. An animal cell may be a transgenic animal cell. In some embodiments, the cell is a human cell including, but not limited to, fetal, neonatal, infant, juvenile, and adult human cells. Further, a cell can include a diseased cell, such as a cancer cell. In other embodiments, the subject is human.
[0058] In some embodiments, after introducing a reporter gene construct comprising a PSMA gene operably linked to a transcriptional promoter of a cell, the methods comprise allowing the cell to express the PSMA protein. By express or expressing, it is meant the process by which information from a gene is used in the synthesis of a functional gene product, such as a protein.
[0059] In some embodiments, an imaging probe is then added to detect the PSMA protein. By detect or detecting, it is meant that the imaging probe binds, is cleaved by, or in some way interacts with the expressed PSMA protein. A variety of imaging probes can be used, although in a preferred embodiment, the imaging probe allows for sensitive, non-invasive imaging. In another preferred embodiment, the imaging probe is compatible with human use (non-immunogenic).
[0060] In some embodiments, PSMA-binding ligands can be used as imaging probes, such as low-molecular-weight nuclear, fluorescent, and multi-modality imaging probes. In other embodiments, the imaging probe is chosen depending on the pharmacokinetics and sensitivity required for a particular indication. In still other embodiments, a high-affinity imaging probe is used that does not serve as a substrate. In still further embodiments, the imaging probe may bind the active site of PSMA electrostatically, treating it essentially as a receptor (receptor probe). In further embodiments, the imaging probe may be a PSMA inhibitor.
[0061] Accordingly, in some embodiments, the imaging probe detects the PSMA protein by binding to the active site of the PSMA protein. In other embodiments, (aminostyryl)pyridinium (ASP) dyes are used as imaging probes. In still other embodiments, the imaging probe is 2-(3-{1-carboxy-5-[(6-[.sup.18F]fluoro-pyridine-3-carbonyl)-amino]-pentyl}-ureido)-pentanedioic acid (DCFPyL) or N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-4-[.sup.18F]fluorobenzyl-L-cysteine (DCFBC).
[0062] An advantage of using PSMA as an imaging reporter is that it possesses enzymatic activity. Therefore, in some embodiments, the imaging probe may be an enzymatic probe, the cleavage products of which can be fluorescent and/or radioactive. In other embodiments, the cleavage products of the probe intercalate within the target cell membrane. In still other embodiments, an enzymatic imaging probe is used for the detection of cellular events. Accordingly, in some embodiments, the presently disclosed methods further comprise the cleavage of the imaging probe by the PSMA protein. In other embodiments, cleavage of the imaging probe results in at least one cleavage product that is fluorescent and/or radioactive.
[0063] In some embodiments, after adding the imaging probe, the presently disclosed methods comprise imaging the probe, thereby detecting the PSMA protein. Molecular imaging can be performed with a range of instruments, most of which utilize a specific region of the electromagnetic spectrum. These imaging modalities include, but are not limited to, magnetic resonance imaging (MRI), x-ray computed tomography (CT), positron emission tomography (PET), single photon emission computed tomography (SPECT), and optical (bioluminescence and fluorescence imaging). In other embodiments, imaging the PSMA protein occurs by at least one method selected from the group consisting of near-infrared (NIR) optical tomography, positron emission tomography (PET), and single photon emission computed tomography (SPECT).
[0064] In some embodiments, the PSMA protein is detected on the surface of the cell.
[0065] In other embodiments, the PSMA protein is detected inside the cell. In still other embodiments, the imaging probe is imaged on the cell surface. In further embodiments, the imaging probe is imaged inside the cell. The term surface of the cell or cell surface as used herein means the outer surface of the cell, including the cell or plasma membrane. In further embodiments, the PSMA protein or imaging probe may intercalate within the cell membrane, which means herein that the PSMA protein or imaging probe is still on the cell surface.
[0066] In some embodiments, the presently disclosed subject matter enables non-invasive imaging of in vivo gene expression, such as for the study of signal transduction pathways and protein interaction networks, the study of the underlying physiology or pathophysiology of disease, such as cancer and neurodegenerative diseases, help in developing new, selective drugs for various diseases, and the like.
[0067] Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this presently described subject matter belongs.
[0068] Following long-standing patent law convention, the terms a, an, and the refer to one or more when used in this application, including the claims. Thus, for example, reference to a subject includes a plurality of subjects, unless the context clearly is to the contrary (e.g., a plurality of subjects), and so forth.
[0069] Throughout this specification and the claims, the terms comprise, comprises, and comprising are used in a non-exclusive sense, except where the context requires otherwise. Likewise, the term include and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items.
[0070] For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing amounts, sizes, dimensions, proportions, shapes, formulations, parameters, percentages, parameters, quantities, characteristics, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term about even though the term about may not expressly appear with the value, amount or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are not and need not be exact, but may be approximate and/or larger or smaller as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art depending on the desired properties sought to be obtained by the presently disclosed subject matter. For example, the term about, when referring to a value can be meant to encompass variations of, in some embodiments, 100% in some embodiments 50%, in some embodiments 20%, in some embodiments 10%, in some embodiments 5%, in some embodiments 1%, in some embodiments 0.5%, and in some embodiments 0.1% from the specified amount, as such variations are appropriate to perform the disclosed methods or employ the disclosed compositions.
[0071] Further, the term about when used in connection with one or more numbers or numerical ranges, should be understood to refer to all such numbers, including all numbers in a range and modifies that range by extending the boundaries above and below the numerical values set forth. The recitation of numerical ranges by endpoints includes all numbers, e.g., whole integers, including fractions thereof, subsumed within that range (for example, the recitation of 1 to 5 includes 1, 2, 3, 4, and 5, as well as fractions thereof, e.g., 1.5, 2.25, 3.75, 4.1, and the like) and any range within that range.
EXAMPLES
[0072] The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The following Examples are offered by way of illustration and not by way of limitation.
Example 1
[0073] Genetic reporters provide a non-invasive method to monitor and evaluate a population of cells. The ideal properties of a gene reporter-probe system include biocompatibility, lack of immunogenicity, low background expression or signal, and high sensitivity of detection. The prostate-specific membrane antigen (PSMA) is an attractive candidate for a genetic reporter as it is a human transmembrane protein with a very selective expression pattern and there are several PSMA imaging agents available for clinical and pre-clinical applications. The present studies evaluated the use of PSMA as a genetic imaging reporter by comparison to two clinically established reporters, the mutant herpes simplex virus type I thymidine kinase and the human sodium-iodide symporter. Adenoviruses expressing each reporter were constructed and validated in vitro for expression and function. To compare PSMA to existing imaging reporters, a bilateral matrigel suspension model was established with nude mice bearing cells equally infected with each reporter or control adenovirus. Dynamic PET scans were performed and time-activity curves were generated for each reporter-probe pair. A comparison of peak target-to-background ratios revealed that PSMA offered the highest ratio relative to the control matrigel suspension as well as muscle. Further, PSMA was applied as an imaging reporter to monitor adenoviral liver transduction with both nuclear and optical imaging probes.
Materials and Methods
[0074] Chemicals and primers were purchased from Sigma-Aldrich (St. Louis, Mo.). Cell culture reagents were purchased from Mediatech, Inc. (Manassas, Va.), Gemini Bio-Products (Woodland, Calif.), and Invitrogen (Carlsbad, Calif.). Restriction enzymes and DNA modifying enzymes were purchased from New England Biolabs (Ipswich, Mass.). Plasmid and gel purification components were purchased from Qiagen, Inc. (Valencia, Calif.) or Sigma-Aldrich. Transfection reagent was purchased from Invitrogen. Adenovirus purification kits were purchased from Puresyn, Inc. (Malvern, Pa.). [.sup.3H]Gancyclovir ([.sup.3H]GCV) was purchased from Moravek Biochemicals (Brea, Calif.). [.sup.125I]NaI was purchased from MP Biomedicals (Solon, Ohio). The J591 antibody was kindly provided by Dr. Neil Bander (Weill Cornell Medical College, N.Y.).
[0075] Cell Culture. Cell culture media contained 50 g/mL gentamycin and 5 g/mL ciprofloxacin to prevent bacterial contamination. HCT116 cells were obtained from Dr. Bert Vogelstein (Johns Hopkins University, MD) and grown in McCoy's 5A supplemented with 10% FBS. DPL cells were generated in the lab of Dr. Ronald Rodriguez and grown in DMEM supplemented with 10% FBS (Hoti et al., 2007). PC3-CAR cells were obtained from Dr. J. T. Hsieh (University of Texas Southwestern Medical School, TX) and grown in RPMI 1640 medium supplemented with 10% FBS and 300 g/mL G418.
[0076] Cloning of Adenoviral Vectors. Viruses were generated using the AdEasy vector system (Luo et al., 2007). PSMA was sub-cloned from pDonor-CMV-PSMA into pAd-Track-CMV using BglII and NotI. hNIS was sub-cloned from pDonor-CMV-hNIS into pAd-Track-CMV using BglII and NotI. The CMV promoter was sub-cloned by PCR using primers 5-CMV (ACGAAGATCTTAATAGTAATCAATTACGGGG) (SEQ ID NO: 3) and 3-CMV (TCCGGAATTCCTAGCGGATCTGACGGTTCAC) (SEQ ID NO: 4) upstream of sr39tk-GFP in the shuttle plasmid pGal-mNLS-sr39tk-EGFP using BglII and EcoRI restriction sites. The expression cassette from pCMV-mNLS-sr39tk-EGFP was then cloned into RpSWC1 using NotI and SalI restriction sites. The resulting plasmids, pAd-Track-CMV-PSMA, pAd-Track-CMV-NIS, or RpS-CMV-mNLS-sr39tk-EGFP were recombined with pAdEasy-1 vector in BJ5183 Escherichia coli and selected for kanamycin resistance. Each resulting viral genome was linearized with Pac I and transfected into DPL cells for virus production. The resulting adenoviruses were column purified using Adenopure adenovirus purification kit and titered in HEK293 cells by GFP and Hexon staining with Adeno-X rapid titer kit (Clonetech, Mountain View, Calif.) 36 hours post-infection.
[0077] Preparation of J591 Antibody Conjugated to IRDye 800CW. The J591 antibody was labeled by using IRDye 800CW NHS Ester (LI-COR, Lincoln, Nebr.). Briefly, 20 L of 3 mM IRDye 800CW NHS Ester (10 molar fold excess in DMSO) were added to 200 L of J591 antibody (5 mg/mL in PBS) and kept 1 h at ambient temperature. The unreacted dye was removed by passing through Zeba desalting column (Pierce, Thermo Fisher Scientific, Rockford, Ill.). The conjugation of dye was confirmed by measuring Absorbance at 280 and 750 nm and by SDS-PAGE.
[0078] Western Blot. Cells were washed with 1 PBS and re-suspended in RIPA lysis buffer supplemented with protease inhibitor cocktail (Roche, Indianapolis, Ind.) and incubated on ice for 30 minutes and then centrifuged for 10 minutes at 4 C. Total protein concentration was measured using the Micro BCA Protein Assay Kit (Thermo Scientific, Rockford, Ill.) according to the manufacturer's protocol. Equal amounts of proteins were separated by SDS-PAGE and transferred to PVDF membrane, blocked with 5% nonfat dry milk in PBS for 1 hour at room temperature, and then incubated with primary antibody (mouse monoclonal anti-hNIS from ABCAM [SPM186], mouse monoclonal anti-PSMA J591, rabbit polyclonal anti-HSV TK obtained from Dr. William Summers (Yale University, New Haven, Conn.) overnight at 4 C. The membrane was then probed with anti-mouse IR800 conjugated secondary antibody or anti-rabbit IR680 conjugated secondary antibody for 1 hour and scanned on the Odyssey Infrared Imager (LI-COR, Lincoln, Nebr.) using the manufacturer's protocol.
[0079] Fluorescent Cellular Immunoassay. Control cells or cells infected with reporter virus were plated on 96-well plates. When 90% confluent, cells were washed with 1 PBS and fixed with 4% paraformaldehyde for 30 minutes at room temperature. After fixation, cells were washed with 1 PBS, blocked with 1% BSA in PBS for 1 hour at room temperature, and incubated with primary antibodies described above at 37 C. for 1 hour. Cells were then probed with secondary antibody conjugated with IR800 for 1 hour and scanned on the Odyssey Infrared Imager using the manufacturer's protocol.
[0080] Cell Uptake Assays. Cellular uptake of .sup.125I was measured in a fashion similar to that of De la Vieja (De la Vieja et al., 2005), while HSV-SR39TK expression was measured as described by Yaghoubi et al. (2006). PSMA expression was assessed by measuring cellular uptake of the known, high-affinity PSMA targeting ligand, 2-[3-[1-carboxy-5-(4-[.sup.125I]iodo-benzoylamino)-pentyl]-ureido]-pentanedioic acid (YC-I-27) (Chen et al., 2008). For uptake of .sup.125I, cells were harvested in PBS using a cell scraper and placed in a FACS tube for quantification in an automated -counter (1282 Compugamma CS, Pharmacia/LKB Nuclear, Inc., Gaithersburg, Md.). For [.sup.3H]GCV, the amount of radiolabeled substrate retained was quantified by scintillation counting on a Microbeta Wallac (Perkin-Elmer, Waltham, Mass.). YC-I-27 uptake was also measured using the automated -counter. In each case, uptake was calculated as amount of radioactivity in the cells divided by radioactivity in the media and normalized by the degree of expression of green fluorescent protein (GFP).
[0081] In Vivo Imaging. Studies were performed according to protocols approved by the Animal Care and Use Committee at Johns Hopkins University. A matrigel suspension model was developed to enable imaging of similar numbers of cells in vivo. Four- to six-week-old athymic male nude mice (Harlan Laboratories Inc., Frederick, Md.) were used for all experiments. 410.sup.6 infected cells were injected subcutaneously in the presence of Matrigel (BD Biosciences, Bedford, Mass.) at a 2:1 (cell:matrigel) ratio.
[0082] PET was performed for in vivo reporter comparison. 9-(4[.sup.18F]Fluoro-3-[hydroxymethyl]butyl)guanine (FHBG) and 2-(3-{1-carboxy-5-[(6-[.sup.18F]fluoro-pyridine-3-carbonyl)-amino]-pentyl}-ureido)-pentanedioic acid (DCFPyL) were synthesized as previously described (Ponde et al., 2004; Chen et al., 2011). [.sup.124I]NaI was kindly provided by Dr. Jason Lewis (Memorial Sloan-Kettering Cancer Center, NY). Athymic nude mice contralaterally implanted with reporter or control expressing matrigel suspensions in the upper flanks were used for imaging. Mice were anesthetized with 3% isoflurane in oxygen for induction and were maintained under 1.5% isoflurane in oxygen at a flow rate of 0.8 L/min. Mice were then placed in the prone position on the gantry of a GE eXplore VISTA small animal PET scanner (GE Healthcare Life Sciences, Pittsburgh, Pa.) and injected intravenously with 7.4 MBq (200 Ci) in 200 L of PBS of each respective radiotracer. Images were acquired as a dynamic scan of 18 five-minute frames at 250 to 700 keV for .sup.18F and 400-700 keV for .sup.124I. Images were reconstructed using the FORE/2D-OSEM method (1 iteration, 16 subsets) and included correction for radioactive decay, scanner dead time, and scattered radiation. After PET imaging, the mobile mouse holder was placed on the gantry of an X-SPECT (Gamma Medica-Ideas, Salem, N.H.) small animal imaging device to acquire the corresponding CT. PET and CT data were co-registered using AMIDE software (sourceforge.net).
[0083] To apply PSMA as a reporter by imaging transduced hepatocytes, near-infrared (NIR) optical and single photon emission computed tomographic (SPECT) imaging were performed. Nude mice were injected intravenously with 110.sup.7 IU of Ad-Track-PSMA or Ad-Track-Luciferase in a 200 L volume. Luciferase was not used for imaging in this instance but as a control gene. For NIR imaging, 24 hours after Ad-Track-PSMA or Ad-Track-Luciferase animals were administered 15 g or 30 g of Anti-PSMA Antibody, J591 conjugated with IR800 in 200 L of PBS via the lateral tail vein. For SPECT animals received 7.4 MBq (200 Ci) of the known, high-affinity PSMA targeting ligand, 2-(3-[1-carboxy-5-[([.sup.125I]iodo-pyridine-3-carbonyl)-amino]-pentyl]-ureido)-pentanedioic acid (YC-VI-11) (Chen et al., 2008) in 200 L of PBS also at 24 hours after Ad-Track-PSMA or Ad-Track-Luciferase. Animals received inhalational anesthesia (isoflurane) through a nose cone attached to the imaging bed. NIR images were acquired 48 hours post-injection of conjugated J591 and imaged using the Pearl Impulse (LI-COR, Lincoln, Nebr.), while SPECT images were acquired after 15 minutes of radiopharmaceutical uptake using the X-SPECT. For SPECT scans, mice were scanned over 180 in 5.5, 30 second increments. SPECT images were co-registered with CT. For each modality, images for Ad-Track-PSMA or Ad-Track-Luciferase were acquired at the same parameter settings and scaled to the same maximum values.
[0084] Statistical Analysis. Statistical analysis was performed using GraphPad Prism software (GraphPad Software, Inc., La Jolla, CA). An unpaired, 2-tailed t test was used and P-values <0.05 were considered significant.
[0085] Radiochemical Syntheses. Radiotracers used for PET, i.e., FHBG, [.sup.124I]NaI, DCFPyL and N-[4N-[(S)-1,3-dicarboxypropyl]carbamoyl]-4-[.sup.18F]fluorobenzyl-L-cysteine (DCFBC) (Cho et al., 2012), were synthesized at specific activities of 34014 Ci/mmol (12.60.5 GBq/mol), with no carrier added, 1,180665 Ci/mmol (43.724.6 GBq/mol) and 21,23314,651 Ci/mmol (786542 GBq/mol), respectively. Despite the significant difference in specific activity between DCFPyL and DCFBC, similar results were obtained on imaging (see herein below).
Adenoviral Reporter Comparison Model
[0086] The presently disclosed subject matter provides the development of PSMA as an imaging reporter and the comparison of PSMA to established imaging reporters. Three putative reporter genes, PSMA, mutant herpes simplex virus thymidine kinase (HSV-sr39tk), and human sodium iodide symporter (hNIS), were sub-cloned downstream of a cytomegalovirus (CMV) promoter in the El region of non-replicating serotype 5 adenoviruses (Table 1). HSV-sr39tk and hNIS have been applied clinically (Barton et al., 2008; Yaghoubi et al., 2001). Each viral construct also expressed GFP for fluorescence detection of viral infection and titering. Two cell line models, HCT116 colon cancer cells and PC3 prostate cancer cells engineered to express stably the coxsackie adenovirus receptor (PC3-CAR), were applied to viral reporter studies. The expression of each reporter was validated by western blot analysis of infected HCT116 cells (multiplicity of infection, MOI=1) 48 hours after infection.
[0087] Each reporter was detected at the appropriate molecular weight in infected cells and no endogenous expression was visible under mock-infected or Ad-Track (GFP) infected control conditions (
TABLE-US-00002 TABLE 1 Description of reporter adenoviruses and respective imaging modalities used for detection of reporter genes. Virus Reporter Gene Imaging Modalities Ad-Track- prostate-specific membrane Optical, PET, PSMA antigen SPECT Ad-Track- human sodium iodide PET, SPECT hNIS symporter Ad-HSV- herpes simplex virus mutant PET sr39tk thymidine kinase
In Vitro Functionality of Adenoviral Reporter Vectors
[0088] Functional assays for each reporter were analyzed using HCT116 and PC3-CAR cell lines by [.sup.3H]GCV uptake, .sup.125I uptake, and YC-I-27 binding. Cells were infected with each reporter adenovirus. After 48 hours, the level of adenovirus infection was quantified by GFP fluorescence and the level of imaging reporter activity was quantified by functional binding and/or uptake of radiolabeled probes. Specific assay conditions were applied for each reporter gene due to the different mechanisms of reporter probe binding and/or uptake. Conditions were based on previously established assay conditions from previous efforts and in the literature (De la Vieja, 2005; Yaghoubi et al., 2006). For GCV uptake, a prolonged washout period was not performed and as a result does not differentiate between phosphorylated GCV and unphosphorylated GCV that is associated with the cells at time of harvest. YC-I-27 uptake in PSMA infected cells proved more time dependent than the corresponding radiotracers were for NIS or HSV-sr39tk. Without wishing to be bound to any one particular theory, it is believed that this may be due to the mechanism of sequestration, whereby [.sup.124I]NaI and GCV were able to diffuse passively or are transported into cells where they are trapped, whereas YC-I-27 can only enter the cell via binding and internalization of PSMA at a 1:1 stoichometry. Despite those caveats, in all cases specific and significant uptake was observed in cells infected with reporter adenovirus resulting in a signal-to-noise ratio of at least 10- to 20-fold relative to control adenovirus (
In Vivo Comparison of Adenoviral Imaging Reporters
[0089] To compare reporter-probe systems in vivo, a matrigel suspension model was developed (
[0090] The next day (48 hours after implantation), animals were subjected to a dynamic PET study whereby 7.4 MBq (200 Ci) of each respective radiotracer was administered intravenously and cellular uptake was quantified for a duration of 90 minutes. FHBG was applied for HSV-sr39tk imaging, [.sup.124I]NaI for hNIS imaging, and DCFPyL was applied for imaging of PSMA (Yaghoubi et al., 2001; Chen et al., 2011; Dingli et al., 2006). This model was used for comparing the reporter-probe systems for at least three reasons: (1) in vitro infection allowed equal transgene delivery of reporters and direct evaluation of implantation by GFP imaging; (2) the application of a relatively small number of cells and the short duration of the experiment minimized the influence of biologic events, such as cell growth or substantial development of tumor vasculature, on imaging reporter activity; and (3) the reporter virus was compared to a control virus within the same animal, providing an additional control to obviate animal-to-animal variation.
[0091] Kinetic uptake of each imaging reporter in target and control tissue was represented as a standardized uptake value (SUV) (
[0092] Kinetics of the PSMA imaging reporter using DCFPyL displayed rapid probe uptake with the signal peaking 15 minutes post-injection, followed by a plateau shortly thereafter (
[0093] Maximum signal-to-noise ratios were observed at 90 minutes, with the PSMA system having the highest ratio relative both to the luciferase matrigel suspension and the muscle (
Application of the Adenoviral PSMA Reporter System
[0094] It has been previously reported in rodent models that adenoviral vectors administered via systemic injection will result in hepatocyte infection and transgene expression (Johnson et al., 2006). Optical imaging of mouse livers was performed 72 hours post-infection and 48 hours post-administration of 15 or 30 g of J591-IR800 (
Non-Viral PSMA Reporter System
[0095] Three non-viral vector systems were created for systemic delivery and expression of PSMA as an imaging reporter (
[0096] One of the vectors comprised additional features to enhance its functionality as an imaging reporter vector (
[0097] A third vector was created to comply with the clinical requirement for human application. This vector featured CpG-free sequences for reduced immunity and used the FDA-approved Neomycin resistant gene as a selection marker (
[0098] Various truncations of PSMA were also created in addition to the full-length gene (
[0099] The basic expression vectors (
Discussion
[0100] The presently disclosed subject matter provides PSMA, a biomarker for prostate cancer located on the cell membrane which possesses receptor, transporter and enzymatic functions, as an imaging reporter. The results demonstrate that PSMA is able to sequester imaging ligands with high affinity and with a high target-to-background ratio. Additional studies support PSMA as an imaging reporter with PET, SPECT, and optical imaging modalities.
[0101] The PSMA probes evaluated herein, as well as other probes in clinical and preclinical development, bind to the active site of PSMA on the surface of the cell.
[0102] Enzymatic and transporter based reporter genes are able to amplify the signal by accumulation of probe, whereas receptor based reporters can only yield a 1:1 stoichiometry of probe to reporter gene molecule. The presently disclosed subject matter suggests that ligand binding alone is sufficient for detection and yields a higher signal-to-noise ratio with the PSMA-based reporter-probe system than the hNIS and HSV-sr39tk reporter-probe systems. In addition, after ligand binding, PSMA can internalize and the enzymatic and/or transporter properties of PSMA can be exploited for signal retention and amplification. As advances in cell engineering and gene therapies emerge, PSMA can provide a sensitive and non-immunogenic reporter by which to follow their fate in vivo, non-invasively.
REFERENCES
[0103] All publications, patent applications, patents, and other references mentioned in the specification are indicative of the level of those skilled in the art to which the presently disclosed subject matter pertains. All publications, patent applications, patents, and other references are herein incorporated by reference to the same extent as if each individual publication, patent application, patent, and other reference was specifically and individually indicated to be incorporated by reference. It will be understood that, although a number of patent applications, patents, and other references are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
[0104] Afshar-Oromieh, A.; Malcher, A.; Eder, M. et al. PET imaging with a [68Ga]gallium-labelled PSMA ligand for the diagnosis of prostate cancer: biodistribution in humans and first evaluation of tumour lesions. Eur. J. Nucl. Med. Mol. I. 2013, 40(4):486-495.
[0105] Anilkumar, G.; Rajasekaran, S. A.; Wang, S.; Hankinson, O.; Bander, N. H.; Rajasekaran, A. K. Prostate-specific membrane antigen association with filamin A modulates its internalization and NAALADase activity. Cancer Research. 2003, 63(10):2645-2648.
[0106] Bacich, D. J.; Pinto, J. T.; Tong, W. P.; Heston, W. D. Cloning, expression, genomic localization, and enzymatic activities of the mouse homolog of prostate-specific membrane antigen/NAALADase/folate hydrolase. Mamm Genome. 2001, 12(2):117-123.
[0107] Banerjee, S. R.; Pullambhatla, M.; Byun, Y. et al. Sequential SPECT and optical imaging of experimental models of prostate cancer with a dual modality inhibitor of the prostate-specific membrane antigen. Angewandte Chemie (International ed.) 2011, 50(39):9167-9170.
[0108] Banerjee, S. R.; Pullambhatla, M.; Shallal, H.; Lisok, A.; Mease, R. C.; Pomper, M. G. A modular strategy to prepare multivalent inhibitors of prostate-specific membrane antigen (PSMA). Oncotarget 2011; 2(12):1244-1253.
[0109] Barrett, J. A.; Coleman, R. E.; Goldsmith, S. J. et al. First-in-man evaluation of 2 high-affinity PSMA-avid small molecules for imaging prostate cancer. J Nucl Med. 2013; 54(3):380-387.
[0110] Barton, K. N.; Stricker, H.; Brown, S. L. et al. Phase I study of noninvasive imaging of adenovirus-mediated gene expression in the human prostate. Mol Ther. 2008, 16(10):1761-1769.
[0111] Bauer S, Kirschning C J, Hacker H, Redecke V, Hausmann S, Akira S, Wagner H, Lipford GB. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proceedings of the National Academy of Sciences of the United States of America 2001; 98(16):9237-9242.
[0112] Beeres, S. L.; Bengel, F. M.; Bartunek, J. et al. Role of imaging in cardiac stem cell therapy. J. Am. Coll. Cardiol. 2007, 49(11):1137-1148.
[0113] Brader, P.; Serganova, I.; Blasberg, R. G. Noninvasive molecular imaging using reporter genes. J Nucl Med. 2013, 54(2):167-172.
[0114] Campbell, D. O.; Yaghoubi, S. S.; Su, Y. et al. Structure-guided engineering of human thymidine kinase 2 as a positron emission tomography reporter gene for enhanced phosphorylation of non-natural thymidine analog reporter probe. The J. Biol. Chem. 2012, 287(1):446-454.
[0115] Chang, S. S.; O'Keefe, D. S.; Bacich, D. J.; Reuter, V. E.; Heston, W. D.; Gaudin, P. B. Prostate-specific membrane antigen is produced in tumor-associated neovasculature. Clin Cancer Res. 1999; 5(10):2674-2681.
[0116] Chen, Y.; Dhara, S.; Banerjee, S. R. et al. A low molecular weight PSMA-based fluorescent imaging agent for cancer. Biochem. Biophys. Res. Comm. 2009, 390(3):624-629.
[0117] Chen, Y.; Foss, C. A.; Byun, Y. et al. Radiohalogenated prostate-specific membrane antigen (PSMA)-based ureas as imaging agents for prostate cancer. J. Med. Chem. 2008, 51(24):7933-7943.
[0118] Chen, Y.; Pullambhatla, M.; Foss, C. A. et al. 2-(3-{1-Carboxy-5-[(6-[.sup.18F]fluoropyridine-3-carbonyl)-amino]-pentyl}-ureido)-pentanedioic acid, [.sup.18F]DCFPyL, a PSMA-based PET imaging agent for prostate cancer. Clin Cancer Res. 2011, 17(24):7645-7653.
[0119] Cho, S. Y.; Gage, K. L.; Mease, R. C. et al. Biodistribution, tumor detection, and radiation dosimetry of .sup.18F-DCFBC, a low-molecular-weight inhibitor of prostate-specific membrane antigen, in patients with metastatic prostate cancer. J Nucl Med. 2012, 53(12):1883-1891.
[0120] De la Vieja, A.; Ginter, C. S.; Carrasco, N. Molecular analysis of a congenital iodide transport defect: G543E impairs maturation and trafficking of the Na+/I-symporter. Mol. Endocrinol. 2005, 19(11):2847-2858.
[0121] Dingli, D.; Kemp, B. J.; O'Connor, M. K.; Morris, J. C.; Russell, S. J.; Lowe, V. J. Combined I-124 positron emission tomography/computed tomography imaging of NIS gene expression in animal models of stably transfected and intravenously transfected tumor. Mol Imaging Biol. 2006; 8(1):16-23.
[0122] FDA. Points to consider on plasmid DNA vaccines for preventive infectious disease indications. Center for Biologics Evaluation and Research 1996;Docket No. :96N-0400.
[0123] Forss-Petter S, Danielson P E, Catsicas S, et al. Transgenic mice expressing betagalactosidase in mature neurons under neuron-specific enolase promoter control. Neuron 1990, 5:187-197.
[0124] Gil, J. S.; Machado, H. B.; Herschman, H. R. A method to rapidly and accurately compare the relative efficacies of non-invasive imaging reporter genes in a mouse model and its application to luciferase reporters. Mol Imaging Biol. 2012, 14(4):462-471.
[0125] Grant, C. L.; Caromile, L. A.; Ho, V. et al. Prostate specific membrane antigen
[0126] (PSMA) regulates angiogenesis independently of VEGF during ocular neovascularization. PloS One 2012, 7(7):e41285.
[0127] Haberkorn, U. Gene therapy with sodium/iodide symporter in hepatocarcinoma. Exp Clin Endocrinol Diabetes. 2001, 109(1):60-62.
[0128] Heston, W. D. Characterization and glutamyl preferring carboxypeptidase function of prostate specific membrane antigen: a novel folate hydrolase. Urology 1997, 49(3A Suppl):104-112.
[0129] Hoti, N.; Li, Y.; Chen, C. L. et al. Androgen receptor attenuation of Ad5 replication: implications for the development of conditionally replication competent adenoviruses. Mol Ther. 2007, 15(8):1495-1503.
[0130] Ilies, M. A.; Seitz, W. A.; Ghiviriga, I. et al. (2004) Pyridinium cationic lipids in gene delivery: a structure-activity correlation study. J Med Chem 2004, 47:3744-3754.
[0131] Johnson, M.; Huyn, S.; Burton, J.; Sato, M.; Wu, L. Differential biodistribution of adenoviral vector in vivo as monitored by bioluminescence imaging and quantitative polymerase chain reaction. Hum. Gene Ther. 2006; 17(12):1262-1269.
[0132] Likar, Y.; Zurita, J.; Dobrenkov, K. et al. A new pyrimidine-specific reporter gene: a mutated human deoxycytidine kinase suitable for PET during treatment with acycloguanosine-based cytotoxic drugs. J Nucl Med. 2010, 51(9):1395-1403.
[0133] Liu, H.; Rajasekaran, A. K.; Moy, P. et al. Constitutive and antibody-induced internalization of prostate-specific membrane antigen. Cancer Res. 1998, 58(18):4055-4060.
[0134] Luo, J.; Deng, Z. L.; Luo, X. et al. A protocol for rapid generation of recombinant adenoviruses using the AdEasy system. Nature Protocols. 2007, 2(5):1236-1247.
[0135] Mease, R. C.; Dusich, C. L.; Foss, C. A. et al. N-[N-[(S)-1,3-Dicarboxypropyl]carbamoyl]-4-[.sup.18F]fluorobenzyl-L-cysteine, [.sup.18F]DCFBC: a new imaging probe for prostate cancer. Clin Cancer Res. 2008; 14(10):3036-3043.
[0136] Min, J. J.; Iyer, M.; Gambhir, S. S. Comparison of [.sup.18F]FHBG and [.sup.14C]FIAU for imaging of HSV1-tk reporter gene expression: adenoviral infection vs stable transfection. Eur. J. Nucl. Med. Mol. I. 2003, 30(11):1547-1560.
[0137] Miyagawa, M.; Anton, M.; Wagner, B. et al. Non-invasive imaging of cardiac transgene expression with PET: comparison of the human sodium/iodide symporter gene and HSV1-tk as the reporter gene. Eur. J Nucl. Med. Mol. I. 2005; 32(9):1108-1114.
[0138] Mlcochova, P.; Barinka, C.; Tykvart, J.; Sacha, P.; Konvalinka, J. Prostate-specific membrane antigen and its truncated form PSM'. The Prostate. 2009, 69(5):471-479.
[0139] Overbeek P A, Chepelinsky A B, Khillan J S, Piatigorsky J, Westphal H. Lens-specific expression and developmental regulation of the bacterial chloramphenicol acetyltransferase gene driven by the murine alpha A-crystallin promoter in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 1985, 82:7815-7819.
[0140] Ponde, D. E.; Dence, C. S.; Schuster, D. P.; Welch, M. J. Rapid and reproducible radiosynthesis of [.sup.18F] FHBG. Nucl. Med.Biol. 2004, 31(1):133-138.
[0141] Ponomarev, V.; Doubrovin, M.; Shavrin, A. et al. A human-derived reporter gene for noninvasive imaging in humans: mitochondrial thymidine kinase type 2. J Nucl Med. 2007; 48(5):819-826.
[0142] Rajasekaran, A. K.; Anilkumar, G.; Christiansen, J. J. Is prostate-specific membrane antigen a multifunctional protein? Am. J. Physiol. 2005, 288(5):C975-981.
[0143] Rajasekaran, S. A.; Anilkumar, G.; Oshima, E. et al. A novel cytoplasmic tail MXXXL motif mediates the internalization of prostate-specific membrane antigen. Mol. Biol. Cell 2003; 14(12):4835-4845.
[0144] Tjuvajev, J. G.; Doubrovin, M.; Akhurst, T. et al. Comparison of radiolabeled nucleoside probes (FIAU, FHBG, and FHPG) for PET imaging of HSV1-tk gene expression. J Nucl Med. 2002; 43(8): 1072-1083.
[0145] van der Woude, I.; Wagenaar, A.; Meekel, A. A. et al. Novel pyridinium surfactants for efficient, nontoxic in vitro gene delivery. Proc Natl Acad Sci USA 1997, 94:1160-1165.
[0146] Yaghoubi, S. S.; Barrio, J. R.; Dahlbom, M. et al. Human pharmacokinetic and dosimetry studies of [(18)F]FHBG: a reporter probe for imaging herpes simplex virus type-1 thymidine kinase reporter gene expression. J Nucl Med. 2001, 42(8):1225-1234.
[0147] Yaghoubi, S. S.; Campbell, D. O.; Radu, C. G.; Czernin, J. Positron emission tomography reporter genes and reporter probes: gene and cell therapy applications. Theranostics 2012, 2(4):374-391.
[0148] Yaghoubi, S. S.; Gambhir, S. S. Measuring herpes simplex virus thymidine kinase reporter gene expression in vitro. Nat. Protoc. 2006, 1(4):2137-2142.
[0149] Yao, V.; Berkman, C. E.; Choi, J. K.; O'Keefe, D. S.; Bacich, D. J. Expression of prostate-specific membrane antigen (PSMA), increases cell folate uptake and proliferation and suggests a novel role for PSMA in the uptake of the non-polyglutamated folate, folic acid. The Prostate 2010; 70(3):305-316.
[0150] Although the foregoing subject matter has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be understood by those skilled in the art that certain changes and modifications can be practiced within the scope of the appended claims.