METHODS AND COMPOSITIONS TO MODULATE HAIR GROWTH
20200345772 ยท 2020-11-05
Inventors
Cpc classification
C12N2506/13
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
A61K35/12
HUMAN NECESSITIES
International classification
A61K35/12
HUMAN NECESSITIES
Abstract
Embodiments of the methods and compositions provided herein relate to inducing hair growth in a subject. Some embodiments include screening for agents to modulate hair growth.
Claims
1.-59. (canceled)
60. A method for inducing hair growth in a subject comprising administering a population of stem cell-derived dermal papillae-like cells to the subject, wherein the population of stem cell-derived dermal papillae-like cells were obtained via: differentiation of a population of stem cell-derived neural crest cells into a population of stem cell-derived dermal papillae-like cells by a process comprising selecting adherent cells from the population of stem cell-derived neural crest cells, wherein the population of stem cell-derived neural crest cells lack a marker selected from the group consisting of versican, smooth muscle actin, and alkaline phosphatase, thereby inducing hair growth in the subject.
61. The method of claim 60, wherein the stem cell-derived dermal papillae-like cells are human stem cell-derived dermal papillae-like cells.
62. The method of claim 60, wherein the population of stem cell-derived neural crest cells were obtained via differentiation of a population of stem cells into a population of stem cell-derived neural crest cells, wherein the population of stem cell-derived neural crest cells lack a marker selected from the group consisting of versican, smooth muscle actin, and alkaline phosphatase.
63. The method of claim 62, wherein the population of stem cells is a population of human stem cells.
64. The method of claim 63, wherein the population of human stem cells comprises human embryonic stem cells or human induced pluripotent stem cells.
65. The method of claim 64, wherein the human induced pluripotent stem cells were generated from fibroblasts, renal epithelial cells, or blood cells.
66. The method of claim 64, wherein the human induced pluripotent stem cells were generated from human BJ fibroblasts
67. The method of claim 62, wherein the population of stem cells was cultured under conditions to form clusters.
68. The method of claim 60, wherein the population of stem cell-derived neural crest cells was analyzed to confirm the presence of at least one marker selected from Sox10, Foxd3, integrin alpha 4, cognate receptor for fibronectin, CD47, CD 184, CD44, P-75, and nestin.
69. The method of claim 60, wherein the population of stem cell-derived neural crest cells was analyzed to confirm the presence of at least one marker selected from P-75, nestin, versican, smooth muscle actin, alkaline phosphatase, and vimentin.
70. The method of claim 62, wherein the population of stem cells was obtained from the subject.
71. The method of claim 62, wherein the population of stem cells was not obtained from the subject.
72. The method of claim 60, wherein administering a population of stem cell-derived dermal papillae-like cells to the subject comprises subcutaneous transplantation.
73. The method of claim 60, wherein the population of stem cell-derived dermal papillae-like cells is administered to a location comprising hair on a skin of the subject.
74. The method of claim 73, wherein the location is scalp, face, upper lip, chin, eyebrow, eyelash, arm, leg, back, torso, or abdomen.
75. The method of claim 73, wherein the location comprises scar tissue.
76. The method of claim 60, wherein the subject has alopecia.
77. The method of claim 60, wherein the subject is a mammal.
78. The method of claim 60, wherein the subject is a human.
79. An isolated induced dermal papillae cell wherein the induced dermal papillae cell is generated from a human induced pluripotent stem cell.
80. A method for screening an agent to modulate hair growth comprising: contacting a population of induced dermal papillae cells with a test agent; and measuring an effect on hair growth in the population of induced dermal papillae cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION
[0036] Embodiments of the methods and compositions provided herein relate to inducing hair growth in a subject. In some embodiments, a population of induced dermal papillae cells can be generated from a population of induced neural crest cells, which in turn can be generated from a population of stem cells. The population of induced dermal papillae cells can be subcutaneously transplanted into a subject, and generate hair. Advantageously, each population of cells can be amplified to provide a vast population of induced dermal papillae cells available for use, such as use in a transplant. The induced dermal papillae cells can be used to treat subjects having skin disorders, such as burns, scars, and hair loss. Other embodiments include screening for agents to modulate hair growth. Test agents can contact a population of induced dermal papillae cells and the effects measured. Agents can be tested that produce effects related to rate of hair growth, formation of terminal hair or vellus hair, color of hair shaft, thickness of hair shaft, and level of disulphide bonding in a hair shaft
[0037] Dermal Papillae (DP) is a unique population of mesenchymal cells that regulate hair follicle formation and growth cycle. During development most DP cells are derived from mesoderm, however, functionally equivalent DP cells of cephalic hairs originate from Neural Crest (NC). NC is a cell population that transiently arises from the dorsal neural tube in development and gives rise to multiple tissues including the peripheral neural system, adrenal medulla, melanocytes and various craniofacial mesenchymal tissues [19]. NC-specific (Wnt1-Cre) lineage tracing using Lox-STOP-Rosa26 or Z/EG reporter mice provided the genetic evidence of NC contribution to a large proportion of cephalic DP cells [20,21,22].
[0038] Applicant has developed methods and compositions that include the derivation of functional DP-like cells from human embryonic stem cells (hESCs). See Gnedeva K., et al., Derivation of Hair-Inducing Cell from Human Pluripotent Stem Cells (2015) Derivation of Hair-Inducing Cell from Human Pluripotent Stem Cells. PLoS ONE 10(1): e0116892. doi:10.1371/journal.pone.0116892 which is incorporated herein by reference in its entirety. In some embodiments, hESCs may be used to generate NC cells, and then hair-inducing DP-like cells in culture. hESC-derived DP-like cells (hESC-DPs) expressed markers typically found in adult human DP cells (e.g. p-75, nestin, versican, SMA, alkaline phosphatase) and were able to induce hair follicle formation when transplanted under the skin of immunodeficient NUDE mice. hESC-derived DP-like cells engineered to express GFP incorporated into DP of newly formed hair follicles and expressed appropriate markers. BMP signaling is a factor in hESC-DP derivation since BMP inhibitor dorsomorphin eliminated hair-inducing activity from hESC-DP cultures.
Methods for Inducing Hair Growth
[0039] Some embodiments of the methods and compositions provided herein include methods for inducing hair growth in a subject. In some such embodiments, a population of induced dermal papillae cells is administered to the subject. Methods of administration can include transplantation of induced dermal papillae cells into the skin of the subject, for example administration can include subcutaneous transplantation of induced dermal papillae cells. The induced dermal papillae cells can be administered to any location of a subject's skin, for example, a location of the subject's skin such scalp, face, upper lip, chin, eyebrow, eyelash, arm, leg, back, torso, hand, foot, and abdomen. In some embodiments, the location of the subject's skin includes scar tissue. In some embodiments, the subject has alopecia. In some embodiments, the subject the subject is mammalian, such as human.
[0040] In some embodiments, a population of induced dermal papillae cells can include an isolated population of cells with characteristics of dermal papillae cells that have been generated from other cell types, such as isolated induced neural crest cells. In some embodiments, characteristics of induced dermal papillae cells can include markers associated with dermal papillae cells, such as proteins, expressed nucleic acids, activity to induce hair follicle formation, activity to induce keratinocytes morphogenesis, and activity to induce hair shaft growth. Example markers include BMP-4, noggin, N-CAM, and p-75, extracellular matrix proteins such as versican (VCAN), alkaline phosphatase activity (AP), nestin, smooth muscle actin, and vimentin.
[0041] In some embodiments, induced dermal papillae cells can be generated from induced neural crest cells. In some embodiments, adherent cells are selected from a population of induced neural crest cells to generate an isolated population of induced dermal papillae cells. For example, the population of induced neural crest cells can be plated on a substrate, adherent cells can be allowed to attach to the substrate, and non-adherent cells can be washed from the substrate. In some embodiments, the substrate is plastic.
[0042] In some embodiments, characteristics of induced neural crest cells can include markers associated with neural crest cells, such as proteins, expressed nucleic acids, activity capable of generating cells such as melanocytes, craniofacial cartilage and bone, smooth muscle, peripheral and enteric neurons and glia. Example markers include Sox10, Foxd3, integrin alpha 4, cognate receptor for fibronectin, CD47, CD184, CD44, P-75, and nestin. In some embodiments the population of induced neural crest cells lack a marker selected from the group consisting of OCT4, SSEA4, veriscan, smooth muscle actin, and alkaline phosphatase.
[0043] In some embodiments, induced neural crest cells can be generated from a population of stem cells. Example methods to generate induced neural crest cells from stem cells are described in Bajpai R., et al. Cell Death and Differentiation (2009) 16, 807-825, and Curchoe C L, et al. (2010) Early acquisition of neural crest competence during hESCs neuralization. PLoS One 5: e13890 which are each incorporated by reference in its entirety. In some embodiments, a population of stem cells under conditions to form clusters of the stem cells. In some embodiments, the clusters are cultured in suspension to form spheres. In some embodiments, plating the spheres are plated on the surface of a substrate. In some embodiments, the surface is coated with fibronectin or polyornithine.
[0044] In some embodiments, the stem cells include embryonic stem cells, or induced pluripotent stem cells. Induced pluripotent stem cells can be generated from various sources, such as fibroblast, renal epithelial cell, and blood cell. Example methods to generate induced pluripotent stem cells include those described in Takahashi, K. and Yamanaka, S (2006) Cell 126 (4): 663-76; Zhou H, et al. (2009) Cell Stem Cell 4 (5): 381-4; Zhou, et al., (2012) Nature Protocols 7 (12): 2080-2089; and Moad, M., et al. (2013) European Urology 64 (5): 753-761 which are each incorporated by reference in its entirety. In some embodiments, the population of stem cells comprises cells such as H9 cells, or human induced pluripotent stem cells generated from human BJ fibroblasts. In some embodiments, the population of induced dermal papillae cells is obtained from a donor subject. For example, a sample of cells can be taken from a donor subject and a population of induced pluripotent stem cells generated from the sample of cells. In some embodiments, the donor subject and the subject are the same. In some embodiments, the donor subject and the subject are different.
Methods for Screening an Agent to Modulate Hair Growth
[0045] Some embodiments of the methods and compositions provided herein include methods for screening an agent to modulate hair growth. Some such embodiments include contacting a population of induced dermal papillae cells with a test agent; and measuring the effect on hair growth in the population of induced dermal papillae cells. In some embodiments, an agent can include a compound, a composition comprising several compounds, and physical conditions such as temperature, and pH.
[0046] In some embodiments, the effect can include a change in the rate of hair growth in the population of induced dermal papillae cells compared to a population of induced dermal papillae cells not contacted with the test agent, such as an increase or a decrease in the rate of hair growth in the population of induced dermal papillae cells. The rate of hair growth can be measured by the rate of formation of a hair shaft, or the rate of formation of hair follicles having activity to form a hair shaft.
[0047] In some embodiments, the effects can include growth of hair characteristic of a specific location of a subject's skin selected from the group consisting of scalp, face, upper lip, chin, eyebrow, eyelash, arm, leg, back, torso, and abdomen. Example characteristics of hair of a specific location of a subject's skin can include thickness, length, strength of a hair shaft, and length of the hair cycle. In some embodiments, the effects can include growth of hair such as terminal hair, or vellus hair. In some embodiments, the effects can include the color of the hair shaft, such as brown, black, red, white, gray, and blond. In some embodiments, the effects can include the degree of curl in a hair shaft. In some embodiments, the effects can include the thickness of a hair shaft. In some embodiments, the effects can include the level of disulphide bonds in a hair shaft.
[0048] In some embodiments, the population of induced dermal papillae cells is contacted with the test agent in vivo. For example, the induced dermal papillae cells may be transplanted into the skin of a subject. In some embodiments, the population of induced dermal papillae cells is contacted with the test agent in vitro.
Examples
[0049] Derivation of hESC-DP Using NC Cells Intermediate
[0050] Human DP-like cells were obtained from hESCs via a NC intermediate (
[0051] Neural crest is a multipotent population of cells that give rise to precursors for various mesenchymal tissues [19]. The FACS analysis showed that hESC-NC cells on 14 days of differentiation expressed mesenchymal stem cell markers CD47 (99.95%), CD184 (20%), and CD44 (52.58%) (
Characterization of hESC-DP Cells
[0052] The signature genes of mouse dorsal skin DP cells have been compiled [7], however little is known about the gene expression in human cephalic dermal papillae cells. Markers for both mouse and human DP cells were used to characterize mesenchymal hESC-DP. Markers common for DP and neural crest, P-75 and Nestin, were detected in hESC-NC cells, cultured human DP cells (hDP) (isolated from normal human skin) and hESC-DP cells (
Hair-Inducing Properties of hESC-DP Upon Transplantation
[0053] Whether hESC-DP cells are competent to induce the formation of hair follicles upon transplantation in athymic nu/nu (Nude) mice was investigated. The patch method of cell transplantation previously used to demonstrate the hair-inducing potential of mouse skin-derived dermal precursors was used [27]. Briefly, cells of interest were combined with mouse epidermal cells (keratinocytes) isolated from the newborn animals and transplanted subcutaneously into the Nude mice as a thick cell suspension. Because Nude mice have the BALB/c (albino) genetic background, newly formed and preexisting hairs were distinguishable by using the epidermal cells from dark haired C57BL/6 mice for transplantation. Hair-inducing capacity was measured as the number of hairs formed per transplant. Patch method does not allow newly formed hairs to enter the skin surface that perturbs hair follicle morphology on the advanced stages of morphogenesis. Therefore the analysis was carried out at 14 days post transplantation when hair follicles were formed, but not fully developed. Transplantation of epidermal cells alone resulted in minimal hair induction, likely due to the presence of endogenous DP cells (
[0054] To monitor the dynamics of hair inducing properties during the differentiation of hESCs towards DP-like cells hESC-DPs and several related cell populations were transplanted, namely, hESC differentiated for two weeks in DP medium skipping the intermediate step of NC induction (hESC), hESC-NC and partially differentiated hESC-DPs (7 days of differentiation) (
[0055] These results suggest that hESC-DP cells described here have a robust hair-inducing capacity similar to that of neonatal mouse dermal cells and that hESC-NCs acquire this capacity along the differentiation procedure.
hESC-DP Incorporate into DP of De Novo Formed Hair Follicles
[0056] Transplanted hESC-DP may either recruit/activate endogenous mouse DP cells, or directly mediate the observed induction of hair follicle formation. To address this question hESC-DPs were engineered to express GFP and analyzed newly formed hair follicles in situ (
Derivation and Characterization of hIP SC-DP
[0057] In addition to H9 line of human ESC, three previously characterized human induced pluripotent stem cells (hIPSC) lines generated from normal human BJ fibroblasts were used [30]. The hIPSC-NC cells were generated following previously described protocol and analyzed for the presence of neuroephitelial markers Sox2, Sox9 and nestin. hIPSC-NC obtained from all three lines showed a similar pattern of expression. Only about 50% of hIPSC-NC cells expressed Sox2 and Sox9, additionally nestin staining revealed morphological differences when compared to hESC-NC cells (
[0058] hIPSC-NC cells were differentiated to obtain hIPSC-DP using the protocol described above. The immunostaining for DP markers SMA, p-75 and nestin as well as Q-PCR analysis of Versican, Nexin-1, p-75, Vimentin and SMA showed that only one hIPSC line (BJ16) gave rise to cells with some expression of DP markers when compared to hESC-DP cells (
[0059] BJ16 IPSC-DP cells were further characterized by patch transplantation. This cell population did not induce significant number of hairs when compared to negative control. However, the transplantation of GFP-positive BJ16 IPSC-DP cells resulted in formation of hairs with GFP-positive dermal papillae and dermal capsules albeit with much lower frequencies (1 hair out of 50) then in case of hESC-DP cells. The presence of GFP-positive cells within DP of these hairs was confirmed in sections (
[0060] Noteworthy, the integration of transplanted cells into the papillae and capsule area of newly formed hairs was observed only in the case of hESC-DP and hIPSC-DP cells. Although transplanted human DP cells engineered to express GFP were present in the dermis, these cells were not found in the DP of neighboring hair follicles (
Role of BMP Signaling in Derivation of hESC-DP
[0061] The mechanisms involved in generation of DP from migratory NC during development are unknown. However, fetal bovine serum used to induce DP differentiation from NC cells is known to contain bone morphogenetic proteins (BMPs) [31], which are essential in mesoderm specification during embryo development [32,33] and mesoderm induction from hESC in vitro [34]. BMP signaling was found to be a mechanism maintaining the hair follicle-inducing potential in mouse back skin DP [9]. Whether BMP signaling plays a role in the derivation of hESC-DP cells from hESC-NC cells using a well-studied selective BMP inhibitor dorsomorphin was investigated [35]. The addition of dorsomorphin during the NC to DP conversion resulted in obvious changes in cell morphology compared to the positive control, in particular, hESC-DP cells had characteristic fibroblast-like elongated morphology whereas dorsomorphin treated cells were hexagonal and demonstrated presence on multiple granules in their cytoplasm (
[0062] The results suggest that hESC-derived NC cells cultured in serum-containing medium progressively acquire the markers of human DP cells and give rise to adherent cell population with hair-inducing potential. Robust hair-inducing capacity of hESC-DP as compared to human DP cells might reflect a major resemblance of the former to an embryonic or neonatal population of dermal papilla precursor cells, which are known to induce hair follicle formation through different mechanisms [36].
[0063] The hESC-DP cultures are likely to be heterogeneous. The average hair inducing capacity shown by these cultures was similar to that of neonatal mouse dermal cells. Prospectively purified primary mouse DP cells were shown to be about five times more efficient in hair induction than mouse dermal preparations [27]. Therefore, it is possible that hESC-DP cultures comprise a sub-population of hair inducing DP-like cells, with even higher heir-inducing capacity than the average reported above. Additionally, when GFP-positive hESC-DP were transplanted, the presence of GFP-positive cells in other compartments of hair follicles (i.e. outer root sheath, inner root sheath and hair matrix) was observed. Since melanocytes are known to originate from migratory NC during development, it is likely that some hESC-NC cells give rise to melanocyte precursors within hESC-DP cultures. Similarly, it is possible that some hESC-NCs are able to give rise to keratinocytes of newly formed hairs since rodent NC cells can give rise to the epidermal stem cells in the whisker's bulge [37]. These data suggest that hESC-DP is a mixed population of NC-derived cells that contain DP-like cells with hair-inducing properties, but also might contain melanocyte and keratinocyte forming cells.
[0064] The results suggest that the intermediate step of hESC differentiation into the NC lineage seems is critical, skipping the NC induction results in a complete loss of hair-inducing activity. Directing hESCs to the NC cells might limit the variety of mesenchymal cell types to the subset that is developmentally specified downstream from NC cells in skin (e.g. cephalic DP during development, melanocytes, cephalic bulge). Therefore, the hESC-DP-like cells become prominently enriched in heir-inducing DP-like cells using relatively common mesenchymal-enriching conditions such as differentiation in serum containing medium and selection for the adherent cell types.
[0065] Different iPSC lines may have variable propensity to differentiate towards DP-like cells. The hiPSC-DP cells were not able to induce hair follicle formation when transplanted using patch method and had low frequency of incorporation into the DP of newly formed hair follicles. This might be a result of the epigenetic memory phenomenon, known to influence IPSC differentiation [38,39,40]. The IPSC lines used for these experiments were derived from BJ fibroblasts [30]. Their mesodermal origin could cause difficulties on the first step of differentiationinduction of the ectodermal neural crest cells. Indeed, only some hIPSC-NC cells expressed neuroepithelial markers Sox2 and Sox9 (
[0066] Recently, SKPs were shown to be highly potent in hair induction [27], but progressive loss of SKPs in a process of aging might hamper the isolation of autologous SKPs for hair regenerative therapies for aged people [43]. The derivation of hair-inducing DP-like cells from hESCs represents the first step towards development of a cell-based treatment for people with hair loss.
Materials and Methods
[0067] hESCs culture: H9 hESC line was maintained on eradiated mouse embryonic fibroblast feeder layers as previously described [24]. Generation of NC cells from hESC: the differentiation protocol is previously described [24,25]. Generation of ESC-DP: NC cells on passage one were cultured for 3 days with DP Medium of the following composition: DMEM/F-12 Glutamax (Gibco 10829-018), 10% FBS (Gibco #10437), 1 mM L-glutamine (Gibco 25030-081), 1antibiotic/antimycotic (Omega Scientific AA-40). After that, they were dissociated to single-cell suspension with 0.25% Trypsin-EDTA solution (Gibco 25200) and plated on uncoated culture dishes in density 100 thousands cells/mm.sup.2. Floating cells failed to attach after 24 hours were removed with medium change on the following day. Attached cells were grown on uncoated plastic dishes with Medium change every other day; culture was passed every 4-5 days.
[0068] Immunohistochemistry and FACS analysis: cell cultures were fixed with 4% PFA in PBS for 10 minutes at room temperature; tissue samples were fixed at 4 overnight. After fixation cells were washed in PBS 3 times for 5 minutes, and tissue samples were embedded in OCT for frozen sections or used for hair dissections and whole mount preparations. Cells and sections were blocked in 4% BSA or 10% goat serum with 0.05%-0.3% Triton X 100 (Sigma T8787) in PBS for one hour prior to staining. Primary antibodies were applied over night at 4 C. Cells or sections were then washed in PBS for 3 times 15 minutes each. Secondary antibodies (diluted 1:500 in PBS) were applied for 1 hour at room temperature in dark. Cells were washed in PBS for 3 times 10 minutes each. Nuclei were labeled with Hoechst or Dapi. For FACS analysis, cells of interest were detached with Accutase and resuspended in 3% BSA/PBS for 20 minutes to block non-specific binding. Then cells were incubated with primary antibodies for 30 minutes on ice. Then cells were washed in 3 ml of PBS and resuspended in 3% BSA/PBS with appropriate secondary antibodies (1:1000) for 30 minutes and washed with 3 ml of PBS before being resuspended in 1% BSA/PBS and incubated with propidium iodide (PI). Cells were sorted according to fluorescence (FACSVantageSE DiVa, BD Biosciences, San Jose) and data were analyzed with FlowJo software. The following antibodies were used: mouse monoclonal CD47 (R&D), mouse monoclonal CD184 (eBioscience), mouse monoclonal CD44 (Novus), goat polyclonal Foxd3 (Santa Cruz), rabbit polyclonal GFP (Invitrogen), mouse monoclonal ITGA4 (R&D), mouse monoclonal Nestin (Chemicon), mouse monoclonal OCT3/4 (Santa Cruz), rabbit polyclonal P-75 (Chemicon), mouse monoclonal SMA (Chemicon), rabbit polyclonal Sox2 (Abcam), rabbit polyclonal Sox9 (Millipore), rabbit polyclonal Sox10 (Abcam), mouse monoclonal SSEA4 (R&D), mouse monoclonal Versican (Seikagaku Corporation).
[0069] Q-PCR: total RNA was extracted using the RNeasy kit and 1 g of total RNA was reverse transcribed using the Quantitect kit (Qiagen) according to the manufacturer's suggestions to make cDNA. Q-PCR was performed with SyberGreen master mix (Invitrogen) according to the manufacturer's recommendation. For Q-PCR, 18S expression level was used for normalization and the data were analyzed using the standard curve method. Q-PCR was performed as follows: initial denaturation: 10 min at 95 C.; 40 cycles of denaturation: 30 sec at 95 C., annealing: 1 min at 56 C., extension: 30 sec at 72 C.; and one final cycle of denaturation for 1 min at 95 C., annealing for 30 sec at 65 C. and final denaturation for 30 sec at 95 C. Real time Q-PCR primers are summarized in TABLE 1.
TABLE-US-00001 TABLE1 Primer Sequence SEQIDNO: 18S AGTCCCTGCCCTTTGTACA SEQIDNO:01 forward CA 18S CGATCCGAGGGCCTCACTA SEQIDNO:02 reverse Corin AACCCAGTGGACATATCTGT SEQIDNO:03 forward GGCT Corin TGTTGATGCCAAGCACCACTTT SEQIDNO:04 reverse CC Nexin TGTGAAGTCGAGGCCTCATGAC SEQIDNO:05 forward AA Nexin TCTTGGAGACGATGGCCTTGTT SEQIDNO:06 reverse GA P-75 TTCAAGGGCTTACACGTGGAGG SEQIDNO:07 forward AA P-75 AATTCCTTCTTGCCGCATTCCC SEQIDNO:08 reverse AC Versican TGAGCATGACTTCCGTTGGACT SEQIDNO:09 forward GA Versican CCACTGGCCATTCTCATGCCAA SEQIDNO:10 reverse AT Vimentin AGAACCTGCAGGAGGCAGAAGA SEQIDNO:11 forward AT Vimentin TTCCATTTCACGCATCTGGCGT SEQIDNO:12 reverse TC
[0070] Cells: ESC-DP cells on different passages were obtained. Cells were dissociated to single-cell suspension with 0.1% Trypsin-EDTA (Gibco 25200) and washed 3 times with PBS by serial centrifuging (1200 RPM for 5 minutes). Finally cells were resuspended in DP medium at concentration 5 million per 100 l and kept on ice until transplanted.
[0071] Mouse epidermal and dermal cells were obtained from p0-p2 BL6 mice skin. Back skins were isolated and placed on ice, washed in PBS with antibiotic/antimycotic (final 1; Omega Scientific AA-40) 5 times for 5 minutes shaking and incubated in 0.01% Dispase (Sigma) in PBS overnight at 40 C. Epidermal layers of skins were isolated with forceps, washed in PBS for 5 min and incubated in 0.1% Trypsin-EDTA solution at 370 C for 8 minutes. Dermal layers of skin were homogenized with scissors and digested with 0.1% Trypsin-EDTA solution at 370 C for 45 minutes. Enzyme activity was blocked with addition of DP medium and epidermises or dermises were pipetted vigorously for 10 minutes. Cell suspension was isolated with cell strainer (BD Falcon 9261365) and washed in PBS by centrifuging 3 times (1200 RPM for 5 minutes). Cells were resuspended in DP medium at 5 million cells per 100 l and kept on ice until transplanted.
[0072] Human dermal papillae cells: the use of human tissue-derived samples in this study was limited to use of skin waste tissue from 2 cosmetic medical procedures. Skins were washed in PBS with antibiotic/antimycotic (final 1; Omega Scientific AA-40) 15 times for 5 minutes shaking. Then fat containing hair follicles was isolated with scalpel and incubated in 0.2% Dispase (Sigma) in DMEM/F12 overnight at 40 C. Hair follicles were isolated from fat with the forceps and incubated in 0.1% Collagenase type I (Sigma) in DMEM/F12 for 5-7 hours. Then DPs were detached from the rest of follicles by vigorous pipetting for 10 minutes. After hair follicles settle on the bottom DP staid in supernatant and were isolated by centrifuging 1000 RPM for 5 minutes.
[0073] Cell transplantation: the method of cell transplantation was described previously in detail [27]. Briefly, 100 l of suspension (510.sup.5 cells) of cells of interest (ESC-NC, early ESC-DP, ESC-DP, rDP p2) were combined with 100 l of suspension of epidermal cells (510.sup.5 cells) and transplanted with subcutaneous injections to immunodeficient mice (strain Athymic Nu/Nu). After 14-21 days mice were euthanized and transplants were analyzed. For negative control epidermal cells alone were transplanted.
REFERENCES
[0074] Each of the following references is expressly incorporated herein by reference in its entirety. [0075] 1. Hardy M H (1992) The secret life of the hair follicle. Trends Genet 8: 55-61. [0076] 2. Jahoda C A, Reynolds A J (1996) Dermal-epidermal interactions. Adult follicle-derived cell populations and hair growth. Dermatol Clin 14: 573-583. [0077] 3. Millar S E (2002) Molecular mechanisms regulating hair follicle development. J Invest Dermatol 118: 216-225. [0078] 4. Driskell R R, Clavel C, Rendl M, Watt F M (2011) Hair follicle dermal papilla cells at a glance. J Cell Sci 124: 1179-1182. [0079] 5. Schmidt-Ullrich R, Paus R (2005) Molecular principles of hair follicle induction and morphogenesis. Bioessays 27: 247-261. [0080] 6. Botchkarev V A, Paus R (2003) Molecular biology of hair morphogenesis: development and cycling. J Exp Zool B Mol Dev Evol 298: 164-180. [0081] 7. Rendl M, Lewis L, Fuchs E (2005) Molecular dissection of mesenchymal-epithelial interactions in the hair follicle. PLoS Biol 3: e331. [0082] 8. Kishimoto J, Burgeson R E, Morgan B A (2000) Wnt signaling maintains the hair-inducing activity of the dermal papilla. Genes Dev 14: 1181-1185. [0083] 9. Rendl M, Polak L, Fuchs E (2008) BMP signaling in dermal papilla cells is required for their hair follicle-inductive properties. Genes Dev 22: 543-557. [0084] 10. Greco V, Chen T, Rendl M, Schober M, Pasolli H A, et al. (2009) A two-step mechanism for stem cell activation during hair regeneration. Cell Stem Cell 4: 155-169. [0085] 11. Weinberg W C, et al. (1993) Reconstitution of hair follicle development in vivo: determination of follicle formation, hair growth, and hair quality by dermal cells. J Invest Dermatol 100: 229-236. [0086] 12. Driskell R R, Giangreco A, Jensen K B, Mulder K W, Watt F M (2009) Sox2-positive dermal papilla cells specify hair follicle type in mammalian epidermis. Development 136: 2815-2823. [0087] 13. Jahoda C A, Home K A, Oliver R F (1984) Induction of hair growth by implantation of cultured dermal papilla cells. Nature 311: 560-562. [0088] 14. Jahoda C A, et al. (2001) Trans-species hair growth induction by human hair follicle dermal papillae. Exp Dermatol 10: 229-237. [0089] 15. Wu J J, et al. (2006) Hair follicle reformation induced by dermal papilla cells from human scalp skin. Arch Dermatol Res 298: 183-190. [0090] 16. Chermnykh E S, et al. (2010) Dermal papilla cells induce keratinocyte tubulogenesis in culture. Histochem Cell Biol 133: 567-576. [0091] 17. Lichti U, et al. (1993) In vivo regulation of murine hair growth: insights from grafting defined cell populations onto nude mice. J Invest Dermatol 101: 124S-129S. [0092] 18. Yang C C, Cotsarelis G (2010) Review of hair follicle dermal cells. J Dermatol Sci 57: 2-11. [0093] 19. Bronner-Fraser M (1994) Neural crest cell formation and migration in the developing embryo. FASEB J 8: 699-706. [0094] 20. Danielian P S, Muccino D, Rowitch D H, Michael S K, McMahon A P (1998) Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr Biol 8: 1323-1326. [0095] 21. Fernandes K J, et al. (2004) A dermal niche for multipotent adult skin-derived precursor cells. Nat Cell Biol 6: 1082-1093. [0096] 22. Nagoshi N, et al. (2008) Ontogeny and multipotency of neural crest-derived stem cells in mouse bone marrow, dorsal root ganglia, and whisker pad. Cell Stem Cell 2: 392-403. [0097] 23. Metallo C M, Ji L, de Pablo J J, Palecek S P (2008) Retinoic acid and bone morphogenetic protein signaling synergize to efficiently direct epithelial differentiation of human embryonic stem cells. Stem Cells 26: 372-380. [0098] 24. Curchoe C L, et al. (2010) Early acquisition of neural crest competence during hESCs neuralization. PLoS One 5: e13890. [0099] 25. Cimadamore F, et al. (2011) Human ESC-Derived Neural Crest Model Reveals a Key Role for SOX2 in Sensory Neurogenesis. Cell Stem Cell 8: 538-551. [0100] 26. Mould A P, et al. (1994) Integrin alpha 4 beta 1-mediated melanoma cell adhesion and migration on vascular cell adhesion molecule-1 (VCAM-1) and the alternatively spliced IIICS region of fibronectin. J Biol Chem 269: 27224-27230. [0101] 27. Biernaskie J, Paris M, Morozova O, Fagan B M, Marra M, et al. (2009) SKPs derive from hair follicle precursors and exhibit properties of adult dermal stem cells. Cell Stem Cell 5: 610-623. [0102] 28. Hoogduijn M J, Gorjup E, Genever P G (2006) Comparative characterization of hair follicle dermal stem cells and bone marrow mesenchymal stem cells. Stem Cells Dev 15: 49-60. [0103] 29. Pittenger M F, et al. (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284: 143-147. [0104] 30. Liu G H, et al. (2011) Recapitulation of premature ageing with iPSCs from Hutchinson-Gilford progeria syndrome. Nature. [0105] 31. Kodaira K, et al. (2006) Purification and identification of a BMP-like factor from bovine serum. Biochem Biophys Res Commun 345: 1224-1231. [0106] 32. Winnier G, Blessing M, Labosky P A, Hogan B L (1995) Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev 9: 2105-2116. [0107] 33. Mishina Y, Suzuki A, Ueno N, Behringer R R (1995) Bmpr encodes a type I bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis. Genes Dev 9: 3027-3037. [0108] 34. Zhang P, Li J, Tan Z, Wang C, Liu T, et al. (2008) Short-term BMP-4 treatment initiates mesoderm induction in human embryonic stem cells. Blood 111: 1933-1941. [0109] 35. Yu P B, et al. (2008) Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nat Chem Biol 4: 33-41. [0110] 36. Inamatsu M, et al. (2006) Embryonic dermal condensation and adult dermal papilla induce hair follicles in adult glabrous epidermis through different mechanisms. Dev Growth Differ 48: 73-86. [0111] 37. Sieber-Blum M, Grim M (2004) The adult hair follicle: cradle for pluripotent neural crest stem cells. Birth Defects Res C Embryo Today 72: 162-172. [0112] 38. Kim K, et al. (2010) Epigenetic memory in induced pluripotent stem cells. Nature 467: 285-290. [0113] 39. Jandial R, Levy M L (2011) Cellular alchemy: induced pluripotent stem cells retain epigenetic memory. World Neurosurg 75: 5-6. [0114] 40. Bar-Nur O, Russ H A, Efrat S, Benvenisty N (2011) Epigenetic memory and preferential lineage-specific differentiation in induced pluripotent stem cells derived from human pancreatic islet Beta cells. Cell Stem Cell 9: 17-23. [0115] 41. Boulting G L, et al. (2011) A functionally characterized test set of human induced pluripotent stem cells. Nat Biotechnol 29: 279-286. [0116] 42. Bock C, et al. (2011) Reference Maps of human E S and iPS cell variation enable high-throughput characterization of pluripotent cell lines. Cell 144: 439-452. [0117] 43. Zouboulis C C, Adjaye J, Akamatsu H, Moe-Behrens G, Niemann C (2008) Human skin stem cells and the ageing process. Exp Gerontol 43: 986-997.
[0118] The term comprising as used herein is synonymous with including, containing, or characterized by, and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
[0119] The above description discloses several methods and materials of the present invention. This invention is susceptible to modifications in the methods and materials, as well as alterations in the fabrication methods and equipment. Such modifications will become apparent to those skilled in the art from a consideration of this disclosure or practice of the invention disclosed herein. Consequently, it is not intended that this invention be limited to the specific embodiments disclosed herein, but that it cover all modifications and alternatives coming within the true scope and spirit of the invention.
[0120] All references cited herein, including but not limited to published and unpublished applications, patents, and literature references, are incorporated herein by reference in their entirety and are hereby made a part of this specification. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.