<i>Streptococcus mutans </i>glucosyl transferase inhibitors for dental caries therapy

11866416 ยท 2024-01-09

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention is related to the inhibition of the formation of Streptococci biofilms through the inhibition of glucosyl transferase (Gtf). Compounds, compositions and methods for inhibiting Streptococcus biofilm formation, as well as for preventing, inhibiting and/or treating the formation of dental caries, and methods of identifying compounds that prevent, inhibit and/or treat the formation of dental caries are provided.

Claims

1. A compound selected from the group consisting of: ##STR00251##

2. A compound selected from the group consisting of: ##STR00252##

3. A pharmaceutical formulation comprising a compound of claim 1, and a pharmaceutically acceptable carrier.

4. A method of inhibiting biofilm formation in a subject in need thereof, comprising administering to the subject an effective amount of the pharmaceutical formulation of claim 3, thereby inhibiting biofilm formation.

5. The method of claim 4, wherein the biofilm is a Streptococcus mutans biofilm.

6. The method of claim 4, wherein the subject is a human subject.

7. The method of claim 4, wherein the pharmaceutical formulation is in a form selected from the group consisting of a tooth paste, oral rinse, gel, an additive to a digestible product and a strip comprising the pharmaceutical formulation to be applied to the teeth of a subject.

8. A method of preventing, inhibiting and/or treating the formation of dental caries in a subject in need thereof, comprising administering to the subject an effective amount of the pharmaceutical formulation of claim 3, thereby inhibiting and/or treating the formation of dental caries.

9. A method of preventing, inhibiting and/or treating the formation of denture plaques in a denture of a subject in need thereof, comprising contacting the denture with an effective amount of the pharmaceutical formulation of claim 3, thereby preventing, inhibiting and/or treating the formation of denture plaques.

10. The method of claim 9, wherein the pharmaceutical formulation is in a form of a soaking solution or rinse.

11. The method of claim 9, wherein the denture is contacted while in the subject.

12. A pharmaceutical formulation comprising a compound of claim 2, and a pharmaceutically acceptable carrier.

13. A method of inhibiting biofilm formation in a subject in need thereof, comprising administering to the subject an effective amount of the pharmaceutical formulation of claim 12, thereby inhibiting biofilm formation.

14. The method of claim 13, wherein the biofilm is a Streptococcus mutans biofilm.

15. The method of claim 13, wherein the subject is a human subject.

16. The method of claim 13, wherein the pharmaceutical formulation is in a form selected from the group consisting of a tooth paste, oral rinse, gel, an additive to a digestible product and a strip comprising the pharmaceutical formulation to be applied to the teeth of a subject.

17. A method of preventing, inhibiting and/or treating the formation of dental caries in a subject in need thereof, comprising administering to the subject an effective amount of the pharmaceutical formulation of claim 12, thereby inhibiting and/or treating the formation of dental caries.

18. A method of preventing, inhibiting and/or treating the formation of denture plaques in a denture of a subject in need thereof, comprising contacting the denture with an effective amount of the pharmaceutical formulation of claim 12, thereby preventing, inhibiting and/or treating the formation of denture plaques.

19. The method of claim 18, wherein the pharmaceutical formulation is in a form of a soaking solution or rinse.

20. The method of claim 18, wherein the denture is contacted while in the subject.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows known inhibitors of S. mutans biofilm and S. mutans Gtfs and general structures of flavone and hydroxychalcone.

(2) FIG. 2A shows structures of the seven most potent Gtf inhibitors of S. mutants biofilms. FIG. 2B shows biofilm inhibitory activities of the potent inhibitors at 12.5 M as determined by the crystal violet assay.

(3) FIGS. 3A-3C show Gtf patterns of S. mutans UA159 and its mutant variants. Culture supernatants were prepared from S. mutans UA159 and gtf double mutants, and then subjected to SDS-PAGE analysis with equivalent amount of proteins in each lane. The upper panel was stained with Coomassie blue to monitor the total protein amounts while the lower panel shows enzymatic activities of Gtfs with the treatment of the lead by the zymographic assay. The intensity of the bands were quantified using ImageJ in comparison to DMSO. FIG. 3A shows effects of lead compounds #G16 and #G43 at 25 M on the activity of Gtfs from wild type S. mutans. FIG. 3B shows effects of lead compounds #G16 and #G43 at 25 M on the activity of GtfB from S. mutans GtfCD mutants. FIG. 3C shows effects of lead compounds #G16 and #G43 at 25 M on the activity of Gtfs from wild type S. mutans. FIG. 3C shows effects of lead compounds #G16 and #G43 at 25 M on the activity of GtfC from S. mutans GtfBD mutants.

(4) FIGS. 4A-4B show the binding curves of compound #G43 at varying concentrations with (FIG. 4A) GtfB, and (FIG. 4B) FtgC catalytic domain.

(5) FIG. 5 shows the effect of the compound #G43 on expression of gtfs in S. mutans UA159 cells treated with different concentration of #G43 and then harvested and used to prepare RNA. The expression of gtfs was examined by real time RT-PCR. The mRNA expression levels were calibrated by 16S rRNA. Values represent the meansstandard deviations from three independent experiments. NS indicates no significant difference between DMSO control and compound-treated groups. The P value>0.05 is considered to be not significant.

(6) FIG. 6A-6C show effects of the lead compound #G43 on cell viability. FIG. 6A shows effects on S. mutans. S. mutans was treated with DMSO and a serial dilution of #G43. The cell viability was determined by the numbers of CFU in a logarithmic scale. FIG. 6B shows effects on commensal species. S. gordonii, S. sanguinis, and S. mutans were treated with 200 M of the compound or DMSO, and bacterial growth was measured at OD.sub.470, and normalized to the DMSO control (100%). FIG. 6C shows effects on Aggregatibacter actinomycetemcomitans and Actinomyces naeslundii. A. actinomycetemcomitans and A. naeslundii were treated with the lead compound at 200 M or 25 M or DMSO control, bacterial growth was measured at OD.sub.470, and normalized to the DMSO control (100%). Values represent the meansstandard deviations from three independent experiments. NS indicates that the cell viability between DMSO control and compound-treated groups was not significantly different. The P value>0.05 is considered to be not significant.

(7) FIGS. 7A-7F show effects of compound #G43 on commensal single and dual species biofilms. FIG. 7A shows S. mutans, S. gordonii, and S. sanguinis treated with DMSO or 25 M of compound #G43, and the biomasses of each treated biofilm quantitated by crystal violet staining and measured at OD.sub.562. FIG. 7B shows the cell viability of dual species biofilms, determined by the numbers of CFU in a logarithmic scale using S. mutans and S. sanguinis. FIG. 7C shows the cell viability of dual species biofilms, determined by the numbers of CFU in a logarithmic scale using S. mutans and S. gordonii. FIG. 7D shows species distribution in dual species biofilms with S. mutans and S. sanguinius. FIG. 7E shows species distribution in dual species biofilms with S. mutans and S. gordonii. Bars in FIGS. 7D and 7E represent the mean and standard deviations of three independent experiments. FIG. 7F shows the species distribution in dual species biofilms with S. mutans and S. sanguinius and, S. mutans and S. gordonii in tabular form. Bars represent the mean and standard deviations of three independent experiments. *P<0.05.

(8) FIGS. 8A-8E show effects of the lead compound #G43 and its inactive analog #G43-D. FIG. 8A shows chemical structures of lead and its inactive analog. Docking poses of (FIG. 8B) Compound #G43 and (FIG. 8C) Compound #G43-D in skeleton are shown. Three key residue interactions are depicted by displaying residue chains. FIG. 8D shows the effects of active and inactive compound on the activity of Gtfs by zymographic assays. Glucan zymographic assays (bottom panel) were performed using SDS-PAGE analysis of Gtfs from culture supernatants of S. mutans UA159 incubated with vehicle control DMSO, the synthesized active #G43, and its derivative at 50 M. SDS-PAGE analysis of Gtfs (top panel) was used as a loading control. FIG. 8E shows fluorescent microscopy images of S. mutans UA159 biofilms treated with DMSO control, the synthesized #G43, and its derivative #G43-D at 100 M. Viable bacterial cells were stained with 2.5 M Syto9.

(9) FIG. 9 shows the effects of the lead compound on bacterial colonization and mean caries scores in vivo.

(10) FIGS. 10A-10B show NMR spectra for (FIG. 10A) compound #G43 .sup.1H NMR and (FIG. 10B) #G43 .sup.13C NMR.

(11) FIGS. 11A-11B show NMR spectra for (FIG. 11A) compound #G43-D .sup.1H NMR and (FIG. 11B) #G43-D .sup.13C NMR.

(12) FIG. 12A shows microscopic evaluation of S. mutans biofilms inhibited by compound 9. S. mutans UA159 wild type was co-incubated with compound 9 at various concentrations and its subsequent biofilms were stained with Syto9. FIG. 12B shows S. mutans growth and biofilm affected by compound 9. S. mutans UA159 was co-incubated with compound 9 at various concentrations and their growth was measured at OD.sub.470. Using the crystal violet protocol, their biofilm was measured at OD.sub.562. FIG. 12C shows the effect of compound 9 on commensal streptococci. S. mutans UA159, S. sanguinis, S. gordonii were co-incubated with compound 9 at various concentrations and their growth was measured at OD.sub.470.

(13) FIG. 13A shows Gtf level and activity determined by SDS-PAGE analysis and zymographic assay. S. mutans UA159 wild type were co-incubated with compounds of interest at 50 M. Gtfs were concentrated from S. mutans UA159 wild type and then ran through duplicate SDS-PAGE. The upper panel (I.) is Coomassie blue staining of proteins analyzed by SDS-PAGE. The bottom panel (II.) shows glucan bands produced in the zymographic assay. The intensity of the bands reflects Gtf enzyme activity. FIG. 13B shows effects of compound 9b at different concentrations. S. mutans UA159 wild type bacteria were co-incubated with compound 9b various concentrations. Protein profiling (I) and activity (II) of Gtfs were evaluated as described in FIG. 13A. FIG. 13C shows Docking poses of compounds 9a in blue and 9b in green and the key residues interactions of GtfC active site. FIG. 13D shows fluorescent microscopy images of S. mutans colonization in Drosophila, with the following conditions: (Panel a) treatment with DMSO, (Panel b) gtfB mutant strain, (Panel c) treatment with 50 M 9b and (Panel d) treatment with 50 M 9a.

(14) FIG. 14 shows chemical structures of some known natural product S. mutans biofilm and Gft inhibitors. Left) Alpha-Mangostin; Middle) Myricetin; Right) Honokiol.

(15) FIG. 15A shows a comparison of piceatannol and structural analogs at 200 M in the crystal violet biofilm assay. FIG. 15B shows fluorescence microscopy images of the S. mutan's biofilms treated with 8 200-50 M. Top images correspond to bacteria stained with Syto9 while bottom images correspond to the fluorescent glucans within the biofilm tracked by the Cascade Blue labeled Dextran. FIG. 15C shows 2D diagram of the proposed residues interacting with piceatannol. FIG. 15D shows the docking pose of piceatannol and acarbose in the GtfC active site.

(16) FIG. 16A-16F show OctetRed96 Analysis of (FIG. 16A) Piceatannol and GtfB, (FIG. 16B) Piceatannol and GtfC, (FIG. 16C) Resveratrol and GtfB, and (FIG. 16D) Resveratrol and GtfC. FIG. 16E shows results of the zymogram assay conducted with serial dilution concentrations of piceatannol. FIG. 16F shows results of the zymogram assay comparing effect of compound treatment on the GTF enzyme production.

(17) FIG. 17A shows effect of piceatannol on growth of S. mutans, S. gordonii, and S. sanguinis assessed by an alamar blue protocol. FIG. 17B shows fluorescent microscopy images of S. mutans colonization in Drosophila with the following conditions: (panel B1) treatment with sucrose, (panel B2) treatment with DMSO, (panel B3) gtfB mutant strain and (panel B4) treatment with 50 M Piceatannol.

(18) FIG. 18A-18B show effect of resveratrol and piceatannol treatment on the susceptibility of gnotobiotic rats to S. mutans UA159 induced dental caries. FIG. 18A shows mean enamel caries scores (SEM) of rats infected starting at 19 days of age and placed on Diet 305. FIG. 18B shows CFU/mandible determined by plating on MS plates. Resveratrol to Water, p<0.05; Piceatannol to Water, p<0.01.

DETAILED DESCRIPTION OF THE INVENTION

(19) In the following detailed description, embodiments of the present invention are described in detail to enable practice of the invention. Although the invention is described with reference to these specific embodiments, it should be appreciated that the invention can be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. All publications cited herein are incorporated by reference in their entireties for their teachings.

(20) The invention includes numerous alternatives, modifications, and equivalents as will become apparent from consideration of the following detailed description.

(21) Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

(22) Alkyl as used herein alone or as part of another group, refers to a straight or branched chain hydrocarbon containing from 1 to 10 carbon atoms (e.g., C1-C10 alkyl, C1-C9 alkyl, C1-C8 alkyl, C1-C7 alkyl, C1-C6 alkyl, C1-C4 alkyl, C1-C3 alkyl, and/or C1-C2 alkyl). Representative examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, n-decyl, and the like. The term akyl is intended to include both substituted and unsubstituted alkyl groups unless otherwise indicated and these groups may be substituted with groups selected from halo (e.g., haloalkyl), alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylalkyl, aryl, arylalkyl, heterocyclo, heterocycloalkyl, hydroxyl, alkoxy (thereby creating a polyalkoxy such as polyethylene glycol), alkenyloxy, alkynyloxy, haloalkoxy, cycloalkoxy, cycloalkylalkyloxy, aryloxy, arylalkyloxy, heterocyclooxy, heterocyclolalkyloxy, mercapto, alkyl-S(O).sub.m, haloalkyl-S(O).sub.m, alkenyl-S(O).sub.m, alkynyl-S(O).sub.m, cycloalkyl-S(O).sub.m, cycloalkylalkyl-S(O).sub.m, aryl-S(O).sub.m, arylalkyl-S(O).sub.m, heterocyclo-S(O).sub.m, heterocycloalkyl-S(O).sub.m, amino, carboxy, alkylamino, alkenylamino, alkynylamino, haloalkylamino, cycloalkylamino, cycloalkylalkylamino, arylamino, arylalkylamino, heterocycloamino, heterocycloalkylamino, disubstituted-amino, acylamino, acyloxy, ester, amide, sulfonamide, urea, alkoxyacylamino, aminoacyloxy, nitro or cyano where m=0, 1, 2 or 3.

(23) Alkenyl as used herein alone or as part of another group, refers to a straight or branched chain hydrocarbon containing from 2 to 10 carbon atoms (e.g., C2-C10 alkenyl, C2-C9 alkyenyl, C2-C8 alkenyl, C2-C7 alkenyl, C2-C6 alkenyl, C2-C5 alkenyl, C2-C4 alkenyl, and/or C2-C3 alkenyl) which include 1 to 4 double bonds in the normal chain. Representative examples of alkenyl include, but are not limited to, vinyl, 2-propenyl, 3-butenyl, 2-butenyl, 4-pentenyl, 3-pentenyl, 2-hexenyl, 3-hexenyl, 2,4-heptadiene, and the like. The term alkenyl is intended to include both substituted and unsubstituted alkenyl groups unless otherwise indicated and these groups may be substituted with groups as described in connection with alkyl above.

(24) Alkynyl as used herein alone or as part of another group, refers to a straight or branched chain hydrocarbon containing from 2 to 10 carbon atoms (e.g., C2-C10 alkynyl, C2-C9 alkynyl, C2-C8 alkynyl, C2-C7 alkynyl, C2-C6 alkynyl, C2-C5 alkynyl, C2-C4 alkynyl, and/or C2-C3) which include 1 triple bond in the normal chain. Representative examples of alkynyl include, but are not limited to, 2-propynyl, 3-butynyl, 2-butynyl, 4-pentynyl, 3-pentynyl, and the like. The term alkynyl is intended to include both substituted and unsubstituted alkynyl groups and these groups may be substituted with the same groups as set forth in connection with alkyl above.

(25) Halo as used herein refers to any suitable halogen, including F, Cl, Br, and I.

(26) Also as used herein, the terms treat, treating or treatment may refer to any type of action that imparts a modulating effect, which, for example, can be a beneficial and/or therapeutic effect, to a subject afflicted with a condition, disorder, disease or illness, including, for example, improvement in the condition of the subject (e.g., in one or more symptoms), delay in the progression of the condition, disorder, disease or illness and/or change in clinical parameters of the condition, disorder, disease or illness, etc., as would be well known in the art.

(27) As used herein, the terms prevent, preventing or prevention of (and grammatical variations thereof) may refer to prevention and/or delay of the onset of a disease, disorder and/or a clinical symptom(s) in a subject and/or a reduction in the severity of the onset of the disease, disorder and/or clinical symptom(s) relative to what would occur in the absence of the methods of the invention. In representative embodiments, the term prevent, preventing, or prevention of (and grammatical variations thereof) refer to prevention and/or delay of the onset of a disease in the subject, with or without other signs of clinical disease. The prevention can be complete, e.g., the total absence of the disease, disorder and/or clinical symptom(s). The prevention can also be partial, such that the occurrence of the condition, disease, disorder and/or clinical symptom(s) in the subject and/or the severity of onset are less than what would occur in the absence of the present invention.

(28) An effective amount or therapeutically effective amount may refer to an amount of a compound, composition or formulation of this invention that is sufficient to produce a desired effect, which can be a therapeutic and/or beneficial effect. The effective amount will vary with the age, general condition of the subject, the severity of the condition being treated, the particular agent administered, during the duration of the treatment, the nature of any concurrent treatment, the pharmaceutically acceptable carrier used, and like factors within the knowledge and expertise of those skilled in the art. As appropriate, an effective amount or therapeutically effective amount in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and/or by using routine experimentation. (See, for example, Remington, The Science and Practice of Pharmacy (latest edition)).

(29) The term pharmaceutically acceptable indicates approval by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia such as the European Pharmacopeia, for use in animals, and more particularly in humans. One method for solubilizing poorly water soluble or water insoluble drugs is to form a salt of the drug or to prepare a prodrug that is more soluble itself or that can be used to form a water soluble salt of the prodrug. Methods for forming salts and pharmaceutically acceptable salt forms are known in the art and include, without limitation, salts of acidic or basic groups that may be present in the drug or prodrug of interest. Compounds that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to sulfuric, citric, maleic, acetic, oxalic, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., 1, 1-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Compounds that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium lithium, zinc, potassium, and iron salts.

(30) The present invention is based on the inhibition of Gtf and the inhibition of biofilm formation, more particularly Streptococcus-mediated biofilm formation, for the prevention, treatment and/or inhibition of the formation of dental caries, or the prevention, treatment and/or inhibition of the formation of denture plaques, in a subject in need thereof.

(31) In an embodiment of the invention, provided are compounds that are inhibitors of Gtf and that inhibit Streptococcus-mediated biofilm formation for the prevention, treatment and/or inhibition of the formation of dental caries, or the prevention, treatment and/or inhibition of the formation of denture plaques, in a subject in need thereof. In some embodiments, the Streptococcus biofilms are Streptococcus mutans biofilms.

(32) In an embodiment of the invention, a compound inhibiting Gtf and/or biofilm formation is a compound of formula (I):

(33) ##STR00001##
wherein:

(34) A is NH, O, CH.sub.2, S(O), S(O).sub.2, NHC(NH)NH, NHC(O)NH, or a bond;

(35) B is a structure selected from the group consisting of:

(36) ##STR00002##

(37) W is selected from the group consisting of H, N.sub.3, -Halo (e.g., Cl, Br, F, I), NH.sub.2, NO.sub.2, CN, OH, SH, C(O)OH, C(O)H, CH.sub.2(Halo), CH(Halo).sub.2, C(Halo).sub.3, O(C.sub.1-C.sub.6 alkyl) (e.g., OCH.sub.3), NH(C.sub.1-C.sub.6 alkyl), C(O)NH.sub.2, S(C.sub.1-C.sub.6 alkyl), OC(O)(C.sub.1-C.sub.6 alkyl), NHC(O)(C.sub.1-C.sub.6 alkyl), C(O)O(C.sub.1-C.sub.6 alkyl) (e.g., C(O)OCH.sub.3), C(O)(C.sub.1-C.sub.6 alkyl), C(O)NH(C.sub.1-C.sub.6 alkyl), C.sub.2-C.sub.10 alkenyl, C.sub.2-C.sub.10 alkynyl, C.sub.1-C.sub.10 alkyl (e.g., C.sub.1-C.sub.4 alkyl), and

(38) ##STR00003##

(39) X.sub.1, X.sub.3, and X.sub.4 are independently selected from the group consisting of N, S and O;

(40) X.sub.2, X.sub.5 and X.sub.6 are independently selected from N or C;

(41) Y.sub.1, Y.sub.2, Y.sub.3, Y.sub.4, and Y.sub.5 are independently selected from the group consisting of H, N.sub.3, -Halo (e.g., Cl, Br, F, I), NO.sub.2, CN, OH, SH, C(O)OH, C(O)H, C(O)NH.sub.2, 4, 5-OCH.sub.2O, CH.sub.2(Halo), CH(Halo).sub.2, C(Halo).sub.3, O(C.sub.1-C.sub.6 alkyl) (e.g., OCH.sub.3), NH(C.sub.1-C.sub.6 alkyl), S(C.sub.1-C.sub.6 alkyl), OC(O)(C.sub.1-C.sub.6 alkyl), NHC(O)(C.sub.1-C.sub.6 alkyl), C(O)O(C.sub.1-C.sub.6 alkyl) (e.g., C(O)OCH.sub.3), C(O)(C.sub.1-C.sub.6 alkyl), C(O)O(C.sub.1-C.sub.6 alkyl), C(O)NH(C.sub.1-C.sub.6 alkyl), CH.sub.2NHZ.sub.3, NHZ.sub.4, C.sub.2-C.sub.10 alkenyl, C.sub.2-C.sub.10 alkynyl, C.sub.10 alkyl (e.g., C.sub.1-4 alkyl), and

(42) ##STR00004##

(43) X.sub.7, X.sub.8, X.sub.9, X.sub.10, and X.sub.1 are independently selected from the group consisting of H, N.sub.3, -Halo (e.g., Cl, Br, F, I), NO.sub.2, CN, OH, SH, C(O)OH, C(O)H, C(O)NH.sub.2, CH.sub.2(Halo), CH(Halo).sub.2, C(Halo).sub.3, O(C.sub.1-C.sub.6 alkyl) (e.g., OCH.sub.3), NH(C.sub.1-C.sub.6 alkyl), CH.sub.2NHZ.sub.7, NHZ.sub.8, S(C.sub.1-C.sub.6 alkyl), OC(O)(C.sub.1-C.sub.6 alkyl), NHC(O)(C.sub.1-C.sub.6 alkyl), C(O)O(C.sub.1-C.sub.6 alkyl), C(O)(C.sub.1-C.sub.6 alkyl), C(O)NH(C.sub.1-C.sub.6 alkyl), C.sub.2-C.sub.10 alkenyl, C.sub.2-C.sub.10 alkynyl, C.sub.1-C.sub.10 alkyl (e.g., C.sub.1-4 alkyl),

(44) ##STR00005##
wherein Z.sub.1, Z.sub.2, Z.sub.3, Z.sub.4, Z.sub.5, Z.sub.6, Z.sub.7, Z.sub.8, Z.sub.9, and Z.sub.10 are independently selected from H or a nitrogen protecting group;

(45) or a salt thereof.

(46) In some embodiments of the invention, the a nitrogen protecting group is selected from, but not limited to, a carbobenzyloxy (Cbz) group, a p-methoxybenzyl carbonyl (Moz or MeOZ) group, a tert-butyloxycarbonyl (BOC) group, a 9-fluorenylmethyloxycarbonyl (FMOC) group, an acetyl (Ac) group, a benzoyl (Bz) group, a benzyl (Bn) group, a carbamate group, a p-methoxybenzyl (PMB) group, a 3,4-dimethoxybenzyl (DMPM) group, a p-methoxyphenyl (PMP) group, a tosyl (Ts) group, a troc (trichloroethyl chloroformate) group, and a sulfonamide (e.g., Nosyl or Nps) group;

(47) In some embodiments of the invention, the compound of formula (I) is a compound, wherein Z.sub.1, Z.sub.2, Z.sub.3, Z.sub.4, Z.sub.5, Z.sub.6, Z.sub.7, Z.sub.8, Z.sub.9, and Z.sub.10 are independently selected from the group consisting of H, -Boc and -Ts.

(48) In some embodiments of the invention, the compound of formula (I) is a compound, wherein W is selected from the group consisting of H, N.sub.3, -Halo, NH.sub.2, NO.sub.2, OCH.sub.3 and

(49) ##STR00006##

(50) In some embodiments of the invention, the compound of formula (I) is a compound, wherein Y.sub.1, Y.sub.2, Y.sub.3, Y.sub.4, and Y.sub.5 are independently selected from the group consisting of H, OCH.sub.3, OH, N.sub.3, NO.sub.2, -Halo, C.sub.1-4 alkyl, CH.sub.2NHZ.sub.3, NHZ.sub.4, C(O)NH.sub.2, C(O)OH, C(O)OCH.sub.3,

(51) ##STR00007##

(52) In some embodiments of the invention, the compound of formula (I) is a compound, wherein X.sub.7, X.sub.8, X.sub.9, X.sub.10, and X.sub.11 are independently selected from the group consisting of H, OCH.sub.3, OH, N.sub.3, NO.sub.2, -Halo, C.sub.1-4 alkyl, CH.sub.2NHZ.sub.7, NHZ.sub.8, C(O)NH.sub.2, C(O)OH, C(O)OCH.sub.3,

(53) ##STR00008##
In some embodiments of the invention, the compound of formula (I) is a compound is selected from the group consisting of:

(54) ##STR00009##

(55) In some embodiments of the invention, the compound of formula (I) is compound:

(56) ##STR00010##

(57) In some embodiments of the invention, the compound of formula (I) is a compound, wherein the salt is a fluoride salt or a chloride salt.

(58) In some embodiments of the invention, the compound of formula (I) is a compound, wherein the salt is a pharmaceutically acceptable salt.

(59) In some embodiments of the invention, the compound of formula (I) is a compound selected from the group consisting of

(60) ##STR00011##

(61) In an embodiment of the invention, a compound inhibiting Gtf and/or biofilm formation is a compound of formula (II):

(62) ##STR00012##
wherein:

(63) R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are independently selected from the group consisting of H, N.sub.3, Halo (e.g., Cl, Br, F, I), 4, 5-OCH.sub.2O, NH.sub.2, NO.sub.2, CN, OH, SH, C(O)OH, C(O)H, C(O)NH, CH.sub.2(Halo), CH(Halo).sub.2, C(Halo).sub.3, O(C.sub.1-C.sub.6 alkyl) (e.g., OCH.sub.3), NH(C.sub.1-C.sub.6 alkyl), CH.sub.2NHZ.sub.1, NHZ.sub.12, S(C.sub.1-C.sub.6 alkyl), OC(O)(C.sub.1-C.sub.6 alkyl), NHC(O)(C.sub.1-C.sub.6 alkyl), C(O)O(C.sub.1-C.sub.6 alkyl), C(O)(C.sub.1-C.sub.6 alkyl), C(O)NH(C.sub.1-C.sub.6 alkyl), C.sub.2-C.sub.10 alkenyl, C.sub.2-C.sub.10 alkynyl, C.sub.1-C.sub.10 alkyl (e.g., C.sub.1 alkyl),

(64) ##STR00013##

(65) R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are independently selected from the group consisting of H, N.sub.3, -Halo (e.g., Cl, Br, F, I), NO.sub.2, CN, OH, SH, C(O)OH, C(O)H, C(O)NH.sub.2, CH.sub.2(Halo), CH(Halo).sub.2, C(Halo).sub.3, O(C.sub.1-C.sub.6 alkyl) (e.g., OCH.sub.3), NH(C.sub.1-C.sub.6 alkyl), S(C.sub.1-C.sub.6 alkyl), OC(O)(C.sub.1-C.sub.6 alkyl), NHC(O)(C.sub.1-C.sub.6 alkyl), C(O)O(C.sub.1-C.sub.6 alkyl) (e.g., C(O)OCH.sub.3), C(O)(C.sub.1-C.sub.6 alkyl), C(O)O(C.sub.1-C.sub.6 alkyl), C(O)NH(C.sub.1-C.sub.6 alkyl), CH.sub.2NHZ.sub.15, NHZ.sub.16C.sub.2-C.sub.10 alkenyl, C.sub.2-C.sub.10 alkynyl, C.sub.1_.sub.10 alkyl (e.g., C.sub.1-4 alkyl), and

(66) ##STR00014##
wherein Z.sub.11, Z.sub.12, Z.sub.13, Z.sub.14, Z.sub.15, Z.sub.16, Z.sub.17 and Z.sub.18 are independently selected from H or a nitrogen protecting group;

(67) or a salt thereof.

(68) In some embodiments of the invention, the a nitrogen protecting group is selected from, but not limited to, a carbobenzyloxy (Cbz) group, a p-methoxybenzyl carbonyl (Moz or MeOZ) group, a tert-butyloxycarbonyl (BOC) group, a 9-fluorenylmethyloxycarbonyl (FMOC) group, an acetyl (Ac) group, a benzoyl (Bz) group, a benzyl (Bn) group, a carbamate group, a p-methoxybenzyl (PMB) group, a 3,4-dimethoxybenzyl (DMPM) group, a p-methoxyphenyl (PMP) group, a tosyl (Ts) group, a troc (trichloroethyl chloroformate) group, and a sulfonamide (e.g., Nosyl or Nps) group

(69) In some embodiments of the invention, the compound of formula (II) is a compound, wherein Z.sub.11, Z.sub.12, Z.sub.13, Z.sub.14, Z.sub.15, Z.sub.16, Z.sub.17 and Z.sub.18 are independently selected from the group consisting of H, -Boc and -Ts.

(70) In some embodiments of the invention, the compound of formula (II) is a compound wherein R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are independently selected from the group consisting of H, OH, OMe, NMe.sub.2, and 4, 5-OCH.sub.2O.

(71) In some embodiments of the invention, the compound of formula (II) is a compound wherein R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are independently selected from the group consisting of H, OH, OMe, and -Halo.

(72) In some embodiments of the invention, the compound of formula (II) is a compound wherein at least 2 R groups selected from R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are OH.

(73) In some embodiments of the invention, the compound of formula (II) is a compound wherein R.sub.7 is not H.

(74) In some embodiments of the invention, the compound of formula (II) is a compound wherein, R.sub.7 is OH, and R.sub.5 or R.sub.6 is OH.

(75) In some embodiments of the invention, the compound of formula (II) is a compound, wherein R.sub.1 is OH, and R.sub.2 and R.sub.3 are OH or OMe.

(76) In some embodiments of the invention, the compound of formula II is not a compound wherein R.sub.7 is OMe and

(77) R.sub.6 is OH, and R.sub.3 and R.sub.4 are OMe or OCH.sub.2O; or

(78) R.sub.3 is OH, and R.sub.2 and R.sub.4 are NMe.sub.2; or

(79) R.sub.1 and R.sub.4 are OH; or

(80) R.sub.6 and R.sub.8 are OMe, and R.sub.3 is OH.

(81) In some embodiments of the invention, the compound of formula II is not a compound wherein R.sub.5 is OH, and

(82) R.sub.3 is OH and R.sub.4 is OMe; or

(83) R.sub.1 and R.sub.3 are OH; or

(84) R.sub.7 and R.sub.2 are OH; or

(85) R.sub.2 is OH and R.sub.6 and R.sub.8 are C.sub.1 or H.

(86) In some embodiments of the invention, the compound of formula II is not a compound wherein R.sub.1 is OH and

(87) R.sub.7 is OH and R.sub.6 is OMe or H; or

(88) R.sub.6 or R.sub.3 is OH; or

(89) R.sub.5, R.sub.7, and R.sub.8 are OH.

(90) In some embodiments of the invention, the compound of formula (II) is

(91) ##STR00015##

(92) In some embodiments of the invention, the compound of formula (II) is

(93) ##STR00016##

(94) In an embodiment of the invention, a compound inhibiting Gtf and/or biofilm formation is a compound of formula IA or IB:

(95) ##STR00017##
or a salt thereof.

(96) In some embodiments of the invention, the compound of formula IA or IB is selected from the group consisting of:

(97) ##STR00018##

(98) In some embodiments of the invention, a compound inhibiting Gtf and/or biofilm formation is a compound selected from the group consisting of:

(99) ##STR00019##

(100) In some embodiments of the invention, the compound inhibiting Gtf and/or biofilm formation is selected from the group consisting of:

(101) ##STR00020##

(102) Unless otherwise stated, structures depicted herein are meant to include all geometric (or conformational) forms of the structure; for example, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers. Therefore, single geometric (or conformational) isomers as well as mixtures of the present compounds are within the scope of the invention.

(103) In other embodiments of the invention, provided are compositions, pharmaceutical compositions, and pharmaceutical formulations comprising a therapeutically effective amount of the compounds of the present invention. In other embodiments, the composition, pharmaceutical composition or pharmaceutical formulation further comprises a pharmaceutically acceptable carrier. The term pharmaceutically acceptable carrier as used herein refers to any substance, not itself a therapeutic agent, used as at least in part as a vehicle for delivery of a therapeutic agent to a subject. Non-limiting examples of pharmaceutically acceptable components include, without limitation, any of the standard pharmaceutical carriers such as phosphate buffered saline solutions, water, emulsions such as oil/water emulsions or water/oil emulsions, microemulsions, and various types of wetting agents. Further, in preparing such pharmaceutical compositions comprising the active ingredient or ingredients in admixture with components necessary for the formulation of the compositions, other conventional pharmacologically acceptable additives may be incorporated, for example, excipients, stabilizers, wetting agents, emulsifying agents, lubricants, sweetening agents, coloring agents, flavoring agents, isotonicity agents, buffering agents, antioxidants and the like. Additives may include, for example, starch, mannitol, sorbitol, precipitated calcium carbonate, crystalline cellulose, carboxymethylcellulose, dextrin, gelatin, acacia, EDTA, magnesium stearate, tale, hydroxypropylmethylcellulose, sodium metabisulfite, and the like.

(104) Formulations suitable for administering the compounds and compositions of the present invention may be suitable for oral or buccal (sublingual) administration. The formulation may either be in the form of a solid or a liquid. In some embodiments, forms of formulations suitable for oral administration of the compounds and compositions of the present invention include, but are not limited to, a tooth paste or dentifrice composition, an oral hygiene product, for example, an oral hygiene tablet, an oral care composition, for example, an oral rinse (e.g., a mouth wash), a gel or an additive to a digestible product. Formulations suitable for buccal (sub-lingual) administration include lozenges, tablets, capsules, chewing gum and the like, comprising the active compound, with suitable carriers and additives that would be appreciated by one of skill in the art, for example, binders, diluents, lubricants, disintegrating agents and the like.

(105) Formulations for the prevention of denture plaques may include liquid solutions and/or rinses, either when worn by a subject, or when removed and not being worn by the subject, for example, a solution or rinse for soaking the dentures for a period of time therein.

(106) Liquid formulations include, but are not limited to, solutions, emulsions, dispersions, suspensions and the like with suitable carriers. Additives may include water, alcohols, oils, glycols, preservatives and the like.

(107) In some embodiments, formulations suitable for administering the compounds and compositions of the present invention may also include additives that may provide greater patient compliance, for example, coloring agents, flavoring agents and the like.

(108) In some other embodiments, the formulations for administering the compounds and compositions of the present invention may further comprise an additional agent or agents. Such agents may include, but are not limited to, agents for removing plaque, whitening and/or remineralizing teeth, and the like. In still other embodiments, the formulation may further comprise a delivery system, for example, a film or a strip of material, which can be placed against the surface of the teeth of the subject in order to deliver the formulation, for example, as set forth in U.S. Pat. Nos. 5,989,569 and 6,045,811.

(109) Subjects suitable to be treated with the compounds, compositions and formulations of the present invention include, but are not limited to mammalian subjects. Mammals according to the present invention include, but are not limited to, canines, felines, bovines, caprines, equines, ovines, porcines, rodents (e.g., rats and mice), lagomorphs, primates, humans and the like, and mammals in utero. Any mammalian subject in need of being treated or desiring treatment according to the present invention is suitable. Human subjects of any gender (for example, male, female or transgender) and at any stage of development (i.e., neonate, infant, juvenile, adolescent, adult, or elderly) may be treated according to the present invention.

(110) The method of administration of the compound, pharmaceutical composition or pharmaceutical formulation as described herein is not particularly limited, and any method of administration may be used that would be appreciated by one of skill in the art for the compound, pharmaceutical composition or pharmaceutical formulation as described herein. Non-limiting examples of methods of administration include direct application to the teeth e.g., via brushing, spraying, painting, and/or rinsing (e.g., a mouth wash), and/or application into a container (e.g., a mouth guard and/or other dental mold) which may then be placed in contact with the teeth. The method of administration of the compound, pharmaceutical composition or pharmaceutical formulation may be applied at a medical facility by a clinician (e.g., a dentist, orthodontist, and/or dental hygienist), and/or may be applied at home (e.g., self-applied by a subject). The schedule of administration of the compound, pharmaceutical composition or pharmaceutical formulation as described herein is not particularly limited, and any schedule of administration may be used that would be appreciated by one of skill in the art for the compound, pharmaceutical composition or pharmaceutical formulation as described herein. In some embodiments, a schedule of administration that is suitable by one of skill in the art may be multiple times a day (e.g., 2, 3, 4, or 5 times) or once a day. In some embodiments, a schedule of administration that is suitable by one of skill in the art may be multiple times a week (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 times) or once a week. In some embodiments, a schedule of administration that is suitable by one of skill in the art may be multiple times a month (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times) or once a month. In some embodiments, a schedule of administration that is suitable by one of skill in the art may be multiple times a year (e.g., 1, 2, 3, 4, 5, or 6 times a year) or once a year (e.g., at routine dentist visits). In some embodiments, a compound, pharmaceutical composition or pharmaceutical formulation as described herein may be applied to all teeth, some teeth, and/or one or more tooth having a cavity and/or filling. In some embodiments, application of a compound, pharmaceutical composition or pharmaceutical formulation as described herein may begin (e.g., may be indicated) before a cavity is found, after a cavity is found, and/or in subjects susceptible to cavities (e.g., children (e.g., under age 18, 17, 16, 15, 14, 13, or 12), subjects with poor oral hygiene, subjects with increased genetic and/or environmental susceptibility to cavities).

(111) In other embodiments of the invention, provided are methods of inhibiting biofilm formation in a subject in need thereof, comprising administering to the subject of an effective amount of the compound, composition or pharmaceutical formulation of the invention, thereby inhibiting biofilm formation. Biofilm formation may be inhibited by at least about 10%, e.g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%, relative to a subject in the absence of the method of the invention.

(112) In other embodiments of the invention, provided are methods of preventing, inhibiting and/or treating the formation of dental caries in a subject in need thereof comprising administering to the subject of an effective amount of the compound, composition, or pharmaceutical formulation of the invention thereby preventing, inhibiting and/or treating the formation of dental caries. Dental caries formation may be inhibited by at least about 10%, e.g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%, relative to a subject in the absence of the method of the invention.

(113) In other embodiments of the invention, provided are methods of preventing, inhibiting and/or treating the formation of denture plaques in a denture of a subject in need thereof comprising contacting the denture with an effective amount of the compound, composition, or pharmaceutical formulation of the invention thereby inhibiting and/or treating the formation of denture plaques. In some embodiments, the denture is contacted while in the subject. Denture plaque formation may be inhibited by at least about 10%, e.g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%, relative to a subject in the absence of the method of the invention.

(114) Methods of identifying a compound that can inhibit Streptococcus-mediated biofilm formation may include determining and/or screening the ability of a compound to bind and/or inhibit the activity of Gtfs. Gtfs include GtfA, GtfB, GtfC and GtfD. In some embodiments, the Gtf is GtfC. In some embodiments, the determining and/or screening may include utilization of 3D structures of the Gtf, for example, the GtfC catalytic domain, complexed with a compound and/or inhibitor of Gtf, for example, acarbose. In some embodiments, the screening may be an in silico method, which include steps implemented by a computer and/or computer program products to screen and/or predict binding affinities of a compound to Gtf, including analog and/or digital hardware, and/or computer program instructions. For example, a computer program, such as, but not limited to, FlexX/LeadIT, may be used for the in silico screening of a compound that may bind to the Gtf catalytic domain using the 3D structure of, for example, GtfC complexed with acarbose. These computer program instructions may be provided to a processor of a general purpose computer, special purpose computer, Application Specific Integrated Circuits (ASIC), and/or other programmable data processing apparatus, such that the instructions, which execute via the processor of the computer and/or other programmable data processing apparatus, create means for implementing the functions/acts specified. Other software, such as an operating system, also may be included.

(115) The present invention is more particularly described in the following examples that are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art.

Example 1

(116) Table 1 lists the IC.sub.50 for S. mutans biofilm inhibition for various compounds selected by in silico screening. Biofilm assays using 96-well flat-bottom polystyrene microtiter plates were performed to evaluate S. mutans biofilm formation at various conditions as described (Liu et al. (2011) Antimicrobial Agents and Chemotherapy 55, 2679; Zhang et al. (2015) International Journal of Antimicrobial Agents 46, 174), the disclosures of which are incorporated herein by reference in their entirety). Each assay was replicated three times. Compounds that inhibited biofilm formation at minimum concentration (MBIC) were determined by serial dilutions.

(117) TABLE-US-00001 TABLE 1 Biofilm inhibitory activity of compounds Biofilm Inhibition IC.sub.50 Code Structure Notebook (M).sup.a 3A embedded image SN-I-204 16.7 3B embedded image SN-I-201 45.6 3C embedded image SN-I-211 >500.sup.b 3D embedded image SN-I-209 >500.sup.b 3E embedded image SN-I-202 >500.sup.b 3F embedded image SN-I-203 145.5 3G embedded image SN-I-205 68.8 3H embedded image SN-I-208 >500.sup.b 3I embedded image SN-I-199 15.3 3J 0embedded image SN-I-200 106.3 3K embedded image SN-I-207 102.7 3L embedded image SN-I-210 >500.sup.b 3M embedded image SN-I-216 10.2 3N embedded image SN-I-222 89.3 3O embedded image SN-I-217 9.6 3P embedded image SN-I-225b 42.3 3Q embedded image SN-I-225a 50.4 3R embedded image SN-I-225c 8.6 3S embedded image SN-I-237c 92.3 3T 0embedded image SN-I-234c >500.sup.b 3U embedded image SN-I-238a 54.4 3V embedded image SN-I-237b 41.2 3W embedded image SN-I-235e 56.6 3X embedded image SN-I-235b 115.9 3Y embedded image SN-I-234b 45.6 3Z embedded image SN-I-235d 38.8 AA embedded image SN-I-238c 147.3 AB embedded image SN-I-238f 31.4 AC embedded image SN-I-237d 144.0 AD 0embedded image SN-I-236 63.7 AE embedded image SN-I-238d 2.7 AF embedded image SN-I-259b >500.sup.b AG embedded image SN-I-234d 238.7 AH embedded image SN-I-248j 160.1 AI embedded image SN-I-247b 43.4 AJ embedded image SN-I-247a 51.5 AK embedded image SN-I-247c 52.8 AL embedded image SN-I-248c 135.6 AM embedded image SN-I-248a 106.2 AN 0embedded image SN-I-248h 93.3 AO embedded image SN-I-247j 56.8 AP embedded image SN-I-247l 67.5 AQ embedded image SN-I-243j 55.6 AR embedded image SN-I-241j 79.9 AS embedded image SN-I-240i 84.1 AT embedded image SN-I-241i 67.7 AU embedded image SN-I-240j >500.sup.b AV embedded image SN-I-241l 111 AW embedded image SN-I-242j >500.sup.b AX 0embedded image SN-I-243i 98.3 AY embedded image SN-I-240l >500.sup.b AZ embedded image SN-I-257i 121.3 BA embedded image SN-I-259d 278.6 BB embedded image SN-I-257d 71.4 BC embedded image SN-I-258l 54.4 BD embedded image SN-I-257l 89.5 BE embedded image SN-I-257b 74.9 BF embedded image SN-I-257c 446.2 BG embedded image HW-1-151 >500.sup.b BH 0embedded image HW-1-159 204.2 BI embedded image HW-1-157 122.1 BJ embedded image HW-1-169 262.0 BK embedded image HW-1-162 >500.sup.b BL embedded image HW-1-171 157.7 BM embedded image HW-1-170 162.3 BN embedded image SN-I-242g 56.9 BO embedded image SN-I-241k 49.4 BP embedded image SN-I-241g 270.1 BQ embedded image SN-I-240h 445.5 BR 0embedded image SN-I-242h 167.3 BS embedded image SN-I-241h 195.2 BU embedded image SN-I-230 >500.sup.b BV embedded image SN-I-258a 394.9 BW embedded image SN-I-238e 112.8 BX embedded image SN-I-248b 209.0 BY embedded image SN-I-234e >500.sup.b BZ embedded image SN-I-237f 196.1 DMSO No Compound DMSO >500.sup.b .sup.aDetermined by S. mutans biofilm inhibition assay. .sup.bNo inhibition up to 500 M.

(118) Tables 2, 3 and 4 list the IC.sub.50 for S. mutans biofilm inhibition for additional compounds as well as the MIC.sub.50 growth inhibition, which was determined according to the experimental procedures provided in Examples 2 and/or 3 and/or 4.

(119) TABLE-US-00002 TABLE 2 Biofilm and Growth inhibitory activity of compounds Biofilm Growth Inhibition Inhibition Code Structure IC.sub.50 (M).sup.a MIC.sub.50 (M) SN-I-204 embedded image 16.7 >300.sup.b SN-I-201 embedded image 45.6 >300.sup.b SN-I-203 00embedded image 145.5 >300.sup.b SN-I-205 01embedded image 68.8 >300.sup.b SN-I-199 02embedded image 15.3 >300.sup.b SN-I-200 03embedded image 106.3 >300.sup.b SN-I-207 04embedded image 102.7 >300.sup.b SN-I-216 05embedded image 10.2 >300.sup.b SN-I-222 06embedded image 89.3 >300.sup.b SN-I-217 07embedded image 9.6 >300.sup.b SN-I-225B 08embedded image 42.3 >300.sup.b SN-I-225A 09embedded image 50.4 >300.sup.b SN-I-225C 0embedded image 8.6 >300.sup.b SN-I-237C embedded image 92.3 >300.sup.b SN-I-238A embedded image 54.4 >300.sup.b SN-I-237B embedded image 41.2 >300.sup.b SN-I-235E embedded image 56.6 >300.sup.b SN-I-235B embedded image 115.9 >300.sup.b SN-I-234B embedded image 45.6 >300.sup.b SN-I-235D embedded image 38.8 >300.sup.b SN-I-238C embedded image 147.3 >300.sup.b SN-I-238F embedded image 31.4 >300.sup.b SN-I-237D 0embedded image 144.0 >300.sup.b SN-I-236 embedded image 63.7 >300.sup.b SN-I-238D embedded image 2.7 >300.sup.b SN-I-248J embedded image 160.1 >300.sup.b SN-I-247B embedded image 43.4 >300.sup.b SN-I-247A embedded image 51.5 >300.sup.b SN-I-247C embedded image 52.8 >300.sup.b SN-I-248C embedded image 135.6 >300.sup.b SN-I-248A embedded image 106.2 >300.sup.b SN-I-248H embedded image 93.3 >300.sup.b SN-I-247J 0embedded image 56.8 >300.sup.b SN-I-247L embedded image 67.5 >300.sup.b SN-I-243J embedded image 55.6 >300.sup.b SN-I-241J embedded image 79.9 >300.sup.b SN-I-241I embedded image 67.7 >300.sup.b SN-I-241L embedded image 111 >300.sup.b SN-I-243I embedded image 98.3 >300.sup.b SN-I-257I embedded image 121.3 >300.sup.b SN-I-257D embedded image 71.4 >300.sup.b SN-I-258L embedded image 54.4 >300.sup.b SN-I-257L 0embedded image 89.5 >300.sup.b SN-I-257B embedded image 74.9 >300.sup.b HW-1-157 embedded image 122.1 >300.sup.b HW-1-171 embedded image 157.7 >300.sup.b HW-1-170 embedded image 162.3 >300.sup.b SN-I-242G embedded image 56.9 >300.sup.b SN-I-241K embedded image 49.4 >300.sup.b SN-I-242H embedded image 167.3 >300.sup.b SN-I-241H embedded image 195.2 >300.sup.b SN-I-238e embedded image 112.8 >300.sup.b SN-I-248b 0embedded image 209.0 >300.sup.b SN-I-237f embedded image 196.1 >300.sup.b SN-I-272VH embedded image 179.84 >300.sup.b SN-I-272OH embedded image 15.6 >300.sup.b SN-I-271U embedded image 36.1 >300.sup.b SN-I-271S embedded image 12.8 >300.sup.b HW-1-179 embedded image 65.1 >300.sup.b SN-I-287 embedded image 250 >300.sup.b SN-I-288 embedded image 212 >300.sup.b SN-I-285 embedded image 102 >300.sup.b SN-II-14 0embedded image 57.2 >300.sup.b SN-II-50 embedded image 4.6 >300.sup.b SN-II-59 embedded image 23.4 >300.sup.b 298b2 embedded image 138.3 >300.sup.b 298C9 embedded image 26.8 >300.sup.b 298C10 embedded image 98.3 >300.sup.b 298D5 embedded image 120.7 >300.sup.b 298F7 embedded image 30.4 >300.sup.b 298G5 embedded image 92.3 >300.sup.b 298G6 embedded image 105.6 >300.sup.b 298G7 0embedded image 104.8 >300.sup.b SN-II-81Cl embedded image 9.6 >300.sup.b SN-II-81F embedded image 56.4 >300.sup.b SN-II-105 embedded image 5.5 346.7 SN-II-106 embedded image 14.0 29.0 SN-II-107 embedded image 16.6 45.9 .sup.aDetermined by S. mutans biofilm inhibition assay. .sup.bNo inhibition up to 300 M.

(120) TABLE-US-00003 TABLE 3 Biofilm and Growth Inhibitory activity of compounds Growth Biofilm Inhibition Inhibition Code Structure MIC.sub.50 (M) IC.sub.50 (M).sup.a SN-II-113 embedded image >300.sup.b 213.2 7 SN-II-32 embedded image 327 24 250.0 16 RZ-1-90 embedded image >300.sup.b 356.2 14 LC-I-206 embedded image >300.sup.b 320.5 21 LC-I-203 0embedded image >300.sup.b 40.6 3 LC-I-197 embedded image 37.1 6 8.4 1 LC-I-205 embedded image >300.sup.b 8.3 1 SN-II-115 embedded image 152.9 21 132.7 24 SN-II-118 embedded image 262.9 14 280.2 35 SN-II-110 embedded image 156.6 13 10.2 2 SN-II-78 embedded image NI 200.3 10 SN-II-92 embedded image 63.1 4 19.8 2 LC-I-203 embedded image NI 40.6 3 LC-I-197 embedded image 37.1 6 8.4 1 LC-I-205 0embedded image NI 8.3 1 SN-II-115 embedded image 152.9 21 132.7 24 SN-II-110 embedded image 156.6 13 10.2 2 Okanin (natural) embedded image 534 17 64 7 RZ-1-86 embedded image 468.9 16 32 5 SN-II-24-B6 embedded image 230.6 12 101 3 SN-II-49C embedded image 782 96 77 8 AP-I-240 embedded image 15.3 3 10.1 1 SN-II-79 embedded image 30.0 1 65.9 1 PBF embedded image 262.5 21.0 135.4 5.6 PAY 00embedded image NI 74.5 9.8 PAC 01embedded image 274.2 45.8 61.2 2.3 Piceatannol (natural) 02embedded image 564 38 52 6 Resveratrol (natural) 03embedded image 546 16 82 4 .sup.aDetermined by S. mutans biofilm inhibition assay. .sup.bNo inhibition up to 300 M. NI = No inhibition up to 400 M.

(121) TABLE-US-00004 TABLE 4 Biofilm and Growth Inhibitory activity of stilbenes NSC Biofilm Growth Entry Code Structure IC.sub.50 (M) MIC.sub.50 (M).sup.a Selectivity 1 NA 04embedded image NI NI NA 2 NA 05embedded image NI NI NA 3 403525 06embedded image NI NI NA 4 4184 07embedded image 344 17 854 58 2.4 5 78326 08embedded image 104 7 179 23 1.7 6 43312 09embedded image 477 51 546 25 1.1 7 NA 0embedded image 102.2 4 546.4 15.9 5.3 8 365798 embedded image 52 6 564 37.8 10.8 9 381864 embedded image 122 11 137 6 1.1 10 70861 embedded image 518 85 1724 53 3.3 11 123262 embedded image 104 6 >400 4.0 12 43321 embedded image 106 11 134 11 1.2 13 16952974 embedded image NI NI NA .sup.aAverage of at least 5 measurements; NI No inhibition; NA Not available.

(122) Table 5 lists the IC.sub.50 for S. mutans biofilm inhibition as well as percent inhibition of Gtfs at a 10 M concentration of selected compounds from Table 1. A well-established zymographic assay was used to determine enzymatic activity of Gtfs (Mattos-Graner et al. (2004) J. Clin. Microbiol. 42, 2752). In brief, overnight S. mutans UA159 cultures were diluted 1:100 in fresh 5 mL THB with 50 L of selective compounds at a series of concentrations. Treated bacteria were grown to OD470 of 1.0, and spun down by centrifugation at 4 C., and culture supernatants were collected and filtered through a 0.22-m-pore-size filter membrane to remove residual bacterial cells and dialyzed at 4 C. against 0.02 M sodium phosphate buffer (pH 6.8), with 10 M phenylmethylsulfonyl fluoride (PMSF), followed by a second dialysis against 0.2 mM sodium phosphate containing 10 M PMSF. After dialysis, 4 mL of samples were concentrated to 40 L by 100K Amicon Ultra-4 centrifugal filter (Merck Millipore Ltd.). For electrophoresis and zymographic analysis, 10 L of each concentrated culture supernatant was applied to 8% SDS-PAGE in duplicate. One gel was used for protein staining with Coomassie blue dye, while the other one was subjected to zymographic assay as described (Mattos-Graner et al. (2004) J. Clin. Microbiol. 42, 2752). The resultant white opaque glucan bands were visualized against a black background.

(123) TABLE-US-00005 TABLE 5 Biofilm and Gtf inhibitory activities of selected compounds % Biofilm Inhibition of Inhibition GTFs at Code Structure Notebook IC.sub.50 (M).sup.a 10 M.sup.b 3A embedded image SN-I-204 16.7 30.3 3D embedded image SN-I-209 >500.sup.c NI.sup.d 3I embedded image SN-I-199 15.3 36.6 3L 0embedded image SN-I-210 >500.sup.c NI.sup.d 3M embedded image SN-I-216 10.2 42.2 3N embedded image SN-I-222 89.3 30.1 3O embedded image SN-I-217 9.6 54.8 .sup.aDetermined by S. mutans biofilm inhibition assay. .sup.bDetermined by S. mutans GTF zymogram assay. .sup.cNo inhibition up to 500 M. .sup.dNo inhibition up to 10 M.

Example 2: Structure-Based Discovery of Small Molecule Inhibitors of Cariogenic Virulence

(124) Streptococcus mutans employs a key virulence factor, three glucosyltransferase (GtfBCD) enzymes to establish cariogenic biofilms. Therefore, the inhibition of GtfBCD would provide anti-virulence therapeutics. Here a small molecule library of 500,000 small molecule compounds was screened in silico against the available crystal structure of the GtfC catalytic domain. Based on the predicted binding affinities and drug-like properties, small molecules were selected and evaluated for their ability to reduce S. mutans biofilms, as well as inhibit the activity of Gtfs. The most potent inhibitor was further characterized for Gtf binding using OctetRed instrument, which yielded low micromolar K.sub.D against GtfB and nanomolar K.sub.D against GtfC, demonstrating selectivity towards GtfC. Additionally, the lead compound did not affect the overall growth of S. mutans and commensal oral bacteria, and selectively inhibit the biofilm formation by S. mutans, indicative of its selectivity and non-bactericidal nature. The lead compound also effectively reduced cariogenicity in vivo in a rat model of dental caries. An analog that docked poorly in the GtfC catalytic domain failed to inhibit the activity of Gtfs and S. mutans biofilms, signifying the specificity of the lead compound. This report illustrates the validity and potential of structure-based design of anti-S. mutans virulence inhibitors.

(125) Though the oral cavity harbors over 700 different bacterial species, Streptococcus mutans initiates the cariogenic process and remains as the key etiological agent. Using key matrix producing enzymes, glucosyltransferases (Gtfs), S. mutans produces sticky glucosyl glucan polymers, which facilitate the attachment of the bacteria to the tooth surface. The glucans is a major component of the biofilm matrix that shields the microbial community from host defenses, mechanical and oxidative stresses, and orchestrates the formation of cariogenic biofilms. Furthermore, copious amounts of lactic acid are produced as a byproduct of bacterial consumption of dietary sugars within the mature biofilm community, which ultimately leads to demineralization of the tooth surface, ensuing cariogenesis.

(126) Current practices to prevent dental caries remove oral bacteria non-discriminatively through chemical and physical means such as mouthwash and tooth brushing (Lingstrom, P., van Houte, J. & Kashket, S. Food starches and dental caries. Critical reviews in oral biology and medicine: an official publication of the American Association of Oral Biologists 11, 366-380 (2000)). Since the biofilm assembly renders bacteria to become more resistant to antibiotics and other manipulations, these traditional approaches have had only limited success. Additionally, existing mouthwashes are often associated with adverse side effects because the use of broad-spectrum antimicrobials are often detrimental to beneficial commensal species. Selectively targeting cariogenic pathogens such as S. mutans has been explored previously, however it was found that the antimicrobial peptide also alters the overall microbiota (Guo, L. et al. Precision-guided antimicrobial peptide as a targeted modulator of human microbial ecology. Proceedings of the National Academy of Sciences of the United States of America 112, 7569-7574, (2015). Increasing understanding of bacterial virulence mechanisms provides new opportunities to target and interfere with crucial virulence factors such as Gtfs. This approach has the added advantages of not only being selective, but may also help to preserve the natural microbial flora of the mouth, which may avoid to exert the strong pressure to promote the development of antibiotic resistance, overcoming a major public health issue in the antibiotic era. It is well established that glucans produced by S. mutans Gtfs contribute significantly to the cariogenicity of dental biofilms. Therefore, the inhibition of the Gtf activity and the consequential glucan synthesis would impair the S. mutans virulence, which could offer an alternative strategy to prevent and treat biofilm-related diseases.

(127) S. mutans harbors three Gtfs: GtfB, GtfC, and GtfD. While GtfB synthesizes predominantly insoluble glucans, GtfD only produces water-soluble glucans, and GtfC can synthesize both soluble and insoluble glucans. All Gtfs are composed of three functional regions: the N-terminal variable junction region, the C-terminal glucan-binding region, and the highly conserved catalytic region in the middle, which is essential for the glucan synthesis. The crystal structural of GtfC from S. mutans has been determined (Ito, K. et al. Crystal Structure of Glucansucrase from the Dental Caries Pathogen Streptococcus mutans. J Mol Biol 408, 177-186 (2011), which provides key molecular insights for the design and development of novel Gtf inhibitors.

(128) Polyphenolic compounds that include catechins, flavonoids, proanthocyanidin oligomers (Duarte, S. et al. Inhibitory effects of cranberry polyphenols on formation and acidogenicity of Streptococcus mutans biofilms. FEMS Microbiology Letters 257, 50-56 (2006); Percival, R. S., Devine, D. A., Duggal, M. S., Chartron, S. & Marsh, P. D. The effect of cocoa polyphenols on the growth, metabolism, and biofilm formation by Streptococcus mutans and Streptococcus sanguinis. European journal of oral sciences 114, 343-348, doi:10.1111/j.1600-0722.2006.00386.x (2006); Duarte, S. et al. Inhibitory effects of cranberry polyphenols on formation and acidogenicity of Streptococcus mutans biofilms. FEMS Microbiol Lett 257, 50-56, doi:10.1111/j.1574-6968.2006.00147.x (2006); Ferrazzano, G. F., Amato, I., Ingenito, A., De Natale, A. & Pollio, A. Anti-cariogenic effects of polyphenols from plant stimulant beverages (cocoa, coffee, tea). Fitoterapia 80, 255-262, doi:10.1016/j.fitote.2009.04.006 (2009); Stauder, M. et al. Inhibitory activity by barley coffee components towards Streptococcus mutans biofilm. Current microbiology 61, 417-421, doi:10.1007/s00284-010-9630-5 (2010); Sendamangalam, V., Choi, O. K., Kim, D. & Seo, Y. The anti-biofouling effect of polyphenols against Streptococcus mutans. Biofouling 27, 13-19, doi:10.1080/08927014.2010.535897 (2011); Dong, L. et al. Effects of sub-minimum inhibitory concentrations of antimicrobial agents on Streptococcus mutans biofilm formation. International journal of antimicrobial agents 39, 390-395, doi:10.1016/j.ijantimicag.2012.01.009 (2012); Nijampatnam, B., Casals, L., Zheng, R., Wu, H. & Velu, S. E. Hydroxychalcone inhibitors of Streptococcus mutans glucosyl transferases and biofilms as potential anticaries agents. Bioorganic & medicinal chemistry letters 26, 3508-3513, doi:10.1016/j.bmcl.2016.06.033 (2016)), and other plant-derived analogs (Newbrun, E., Hoover, C. I. & Walker, G. J. Inhibition by acarbose, nojirimycin and 1-deoxynojirimycin of glucosyltransferase produced by oral streptococci. Arch Oral Biol 28, 531-536 (1983); Nijampatnam, B., Nadkarni, D. H., Wu, H. & Velu, S. E. Antibacterial and Antibiofilm Activities of Makaluvamine Analogs. Microorganisms 2, 128-139, doi:10.3390/microorganisms2030128 (2014)) and synthetic small molecules (Ren, Z. et al. Molecule Targeting Glucosyltransferase Inhibits Streptococcus mutans Biofilm Formation and Virulence. Antimicrobial agents and chemotherapy 60, 126-135, doi:10.1128/aac.00919-15 (2015)) have been studied extensively for years and were found to display modest anti-biofilm activities through modulating the expression of Gtfs of S. mutans. However, the selectivity of these bioactive compounds remains to be determined and the potency is not satisfactory for the biofilm inhibition.

(129) In the present study, novel inhibitors of S. mutans Gtfs were developed through in silico screening of commercial compound libraries against the active site of the catalytic domain from the S. mutans GtfC. A lead compound targeting Gtfs was identified, synthesized, and shown to have the ability to bind to Gtfs and inhibit S. mutans biofilm formation selectively in vitro. Furthermore, the lead compound possesses anti-virulence properties in vivo.

(130) Structure-based virtual screening to identify small-molecule compounds that target Gtfs and inhibit biofilm formation. Taking advantage of the available crystal structure of the GtfC catalytic domain complexed with acarbose, a structure-based in silico screening of 500,000 drug-like compounds was conducted using the FlexX/LeadIT software. The top ranked small molecules, as calculated using the binding energy scores in the FlexX software, were considered based on their binding pose, potential interactions with key residues, and ease of synthesis. Due to the abundance of polar residues in the GtfC active site, several of the top scored docking scaffolds contain aromatic rings, nitro groups, and polar functional groups such as amides and heteroatoms such as sulfur, etc. A total of 90 compounds with diverse scaffolds which vary in their functional groups, hydrophobicity, and H-bond accepting/donating capacity were then purchased and subjected to in vitro biofilm assays using cariogenic S. mutans. Seven potent low micromolar inhibitors were identified (FIG. 2A). Two of these compounds (#G16 and #G43) were the most potent, as they inhibited more than 85% of S. mutans biofilms at 12.5 M (FIG. 2B). Compounds #G16 and #G43 share several functional groups including a nitro group, heterocyclic rings, and polar carbonyl functional property.

(131) Inhibition of Gtfs by lead compounds. Zymographic enzymatic assay was used to determine whether the lead compounds inhibited the activity of Gtfs that are responsible for the production of glucans and biofilm formation. Supernatants containing Gtf proteins prepared from S. mutans bacterial cultures were subjected to SDS-PAGE analysis and zymographic assay. Treatment of the SDS-PAGE gels with lead compounds #G16 and #G43 in a zymographic assay revealed that both #G16 and #G43 drastically reduced the glucan production of the Gtfs, #G43 was more potent (FIG. 3A, bottom panels). The same amount of the protein sample was used as controls and visualized by protein staining (FIG. 3A, top panels). The lead compounds were also tested against individual Gtfs using supernatant proteins harvested from cultures of various double mutants. Compound #G43 consistently inhibited the activity of both GtfB and GtfC (FIGS. 3B and 3C), ImageJ analysis of the intensities suggest 80% inhibition of both enzymes, while compound #G16 had a smaller effect on the activity of GtfB (65% inhibition) and GtfC (72% inhibition) (FIG. 3C). Overall #G43 is more potent than #G16 in inhibiting Gtfs.

(132) Binding kinetics of #G43 lead compound determined by OctetRed Analysis. Zymograhic assays suggest that the lead compound #43 inhibited the activity of both GtfB and GtfC. To determine if the inhibition is attributed by the binding of the lead compound to the enzymes, the OctetRed96 system was used to characterize protein-small molecule binding kinetics. The his-tagged catalytic domains of GtfB and GtC were immobilized separately onto an anti-penta-HIS (HIS1K) biosensor which consists of high affinity, high specificity penta-his antibody pre-immobilized on a fiber optic biosensor. This sensor was then exposed to varying concentrations of #G43. Assay data fit to a 1:1 binding model with a fixed maximum response, which produced a K.sub.D value of 3.7 M for GtfB. The K.sub.D value for GtfC was more potent at 46.9 nM (FIGS. 4A and 4B). These data suggest that the lead compound is selective toward GtfC, the protein used in the in-silico analysis. It should be noted that the catalytic domain of GtfC is less soluble compared to that of GtfB's, which may be responsible for the inherent higher off rate of the his-tag from the sensor, leading to a weaker association curve when compared to GtfB. Nevertheless, consistent nanomolar K.sub.D values were obtained from independent experiments.

(133) Expression of gtfs was not significantly affected by compound #043. The effect of this potent small molecule on the gene expression of gtfs was also examined. The relative expression level of gtfs was evaluated by real time RT-PCR. Compared to the DMSO treated group, expression of gtfs were marginally down-regulated after the treatment with compound #G43 at different concentrations. However, no significant difference was observed between the treated and untreated groups, suggesting that compound #G43 inhibited Gtfs via binding to the targets rather than altered expression of its targeting genes, gtfs (FIG. 5). The most potent compound is not bactericidal and did not inhibit the growth of commensal streptococcal species, and other oral bacteria.

(134) To determine the selectivity of the lead compound toward S. mutans biofilm formation versus bacterial growth, effects of the compound on bacterial growth and viability was evaluated. No significant difference in S. mutans cell viability was observed between the control group and #G43 treated groups up to 200 M (FIG. 6A), suggesting that the compound is not bactericidal towards S. mutans. This compound was also evaluated for its ability to inhibit two oral commensal streptococci: S. sanguinis and S. gordonii as the goal was to develop non-bactericidal and species-selective agents. The compound did not have any effect on bacterial growth (FIG. 6B) of both streptococcal species. In addition, we evaluate effects of the compound on other oral bacteria including Aggregatibacter actinomycetemcomitans VT1169, a Gram-negative, facultative anaerobe, and Actinomyces naeslundii T14VJ1, a gram-positive, facultative anaerobe (FIG. 6C). At 200 M, the compound had no significant inhibition of Aggregatibacter actinomycetemcomitans. Slight inhibition (>20%) was observed of Actinomyces naeslundii growth at 200 M, suggesting the selectivity towards S. mutans.

(135) #G43 did not inhibit the biofilm formation by commensal streptococci but inhibit S. mutans in the dual species biofilms. To determine the selectivity of the lead compound toward S. mutans biofilm formation over the biofilms of other species, effects of the compound was evaluated on the biofilm formation by two oral commensal bacteria: S. sanguinis and S. gordonii. No significant difference in S. sanguinis biofilm formation was observed between the control group and #G43 treated groups up to 200 M (FIG. 7A). A slight increase in the biofilm formation by S. gordonii was observed when treated with the lead compound. Further, experiments using a dual species model was conducted using S. mutans with either S. sanguinis (FIG. 7B), or S. gordonii (FIG. 7C). A reduction in the overall biofilm formation was observed with the treatment of our compound. Moreover, the lead compound shifted the bacterial composition ratio of commensal streptococcus to S. mutans from untreated 1:4 to either 4:1 for S. sanguinis, or 3:2 for S. gordonii (FIGS. 7D-7E). FIG. 7F shows tabular results. The increase in commensal bacteria by the treatment again suggests that the lead selectively affected S. mutans biofilm.

(136) Docking analysis, the facile synthesis of #G43 and its inactive analog to establish that the ortho primary benzamide moiety is crucial for its potency. To explore the underlying mechanism of #G43's bioactivity, the compound was docked into the active site of GtfC to elucidate plausible interactions. The top docking pose of #G43 within the GtfC active site revealed several key interactions. The nitro group on the benzothiophene ring interacts with Arg540, the amide linker is within close proximity of Gln592, and pi-pi stacking interactions are observed between Trp517 and the benzene ring. Of particular importance is the interaction of the primary ortho amide group on the benzene ring with Glu515, Asp477, and Asp588. While the mechanism of the glucan formation is not fully understood, Glu515, Asp477, and Asp588 are assumed to function as a nucleophile, a general acid/base catalyst, and a stabilizer of the glucosyl intermediate, respectively (Ito, K. et al. Crystal Structure of Glucansucrase from the Dental Caries Pathogen Streptococcus mutans. J Mol Biol 408, 177-186 (2011)). Thus, we hypothesized that this functional ortho amide group is crucial for the binding of the compound to the protein.

(137) In order to test this, an analog (#G43-D) with a 3D structure (FIG. 8A) that does not contain the primary amide group was designed and subjected it to docking analysis, as a theoretical design. This scaffold failed to produce a good docking score in FlexX (greater than 25 kJ/mol) and yielded a weak binding pose (FIG. 8B). Due to the absence of the primary amide group, the scaffold takes on a different orientation and possesses poor interactions with the active site. The lead compound was re-synthesized in one step using commercially available reagents, anthranlinamide and 5-nitro-1-benzothiophene-2-carboxylic acid, in an excellent yield and fully characterized (described below). We also synthesized the inactive analog (#G43-D) in one step by replacing the anthranilinamide with aniline in the EDAC coupling synthesis. Zymographic analysis consistently showed that the lead compound #G43 drastically reduced the glucan bands, especially of those produced by GtfC. However the designed inactive compound #G43-D significantly reduced the ability to inhibit the glucan production (FIG. 8D). Additionally, in vitro biofilm assay and fluorescence microscopy revealed that the analog #G43-D did not inhibit S. mutans biofilms at concentrations up to 200 M (FIG. 8E). Binding studies of this analog against GtfB yielded a K.sub.D value of 68 M, compared to a K.sub.D value of 3.7 M by the active analog. This data demonstrates that not only is the inhibition of biofilms by selectively targeting Gtfs plausible, but the inclusion of the primary ortho amide group is crucial to maintain potent anti-biofilm activity. Further structure and activity relationship studies are ongoing to improve the potency of #G43.

(138) #G43 reduced S. mutans virulence in vivo. To evaluate in vivo efficacy of the lead compound #G43, we tested the compound using a rat model of dental caries (Michalek, S. M., McGhee, J. R., Shiota, T. & Devenyns, D. Virulence of Streptococcus mutans: cariogenicity of S. mutans in adult gnotobiotic rats. Infection and Immunity 15, 466-471 (1977)) (FIG. 9). All rats from the two experimental groups were colonized with S. mutans. The bacterial colonization appears to be reduced in #G43 treated rats, however the reduction did not reach the statistically significant difference when compared with the control group. The buccal, sulcal, and proximal surface caries scores of the treated animals were significantly reduced. These data suggest that the lead small molecule selectively targets virulence factors, Gtfs and Gtf-mediated biofilm formation, rather than a simple inhibition of bacterial growth. Furthermore, the #G43 treated rats did not lose weight over the course of the study in comparison with the control group, suggesting that the compound is not toxic.

(139) Dental caries is a multifactorial disease, in which S. mutans and other cariogenic species interact with dietary sugars to promote virulence. The current marketed therapies for dental caries and other infectious diseases are non-selective and broad spectrum in nature, which compromises the benefit of commensal bacteria in the oral flora. Thus, we have conducted this study to develop novel small molecule inhibitors selective for key virulence factors of S. mutans. As Gtfs are crucial for the biofilm formation and the cariogenicity of S. mutans, we conducted an in silico screening of 500,000 drug-like small molecule compounds targeting GtfC and identified top scored scaffolds for in vitro biofilm assays. Seven potent biofilm inhibitors emerged from this study, the lead compound #G43 was further characterized and shown to have anti-biofilm activity through the binding to GtfBC and the inhibition of the activity of GtfBC. The lead compound drastically reduced bacterial virulence in the rat model of dental caries.

(140) In addition, the protein-small molecule binding kinetic analysis of #G43 and GtfBC revealed the lead compound has strong selectivity; it has low micromolar affinity for GtfB and more potent nanomolar affinity for GtfC. Furthermore, compound #G43 selectively inhibited S. mutans biofilms in single-species and dual-species biofilm. As the catalytic domain of GtfB and GtfC shares 96% similarity at amino acid sequence level, the selectivity by the compound is remarkable. Since the crystal structure of GtfC/acarbose complex was used for screening and identification of potent lead compounds, this result further demonstrates the validity of this structure-based drug design approach for precision drug discovery. Numerous studies have claimed the identification of natural and synthetic small molecules that inhibit the biofilm formation of S. mutans through affecting the gene expression of a variety of biofilm regulatory genes including gtfs (Subramenium, G. A., Vijayakumar, K. & Pandian, S. K. Limonene inhibits streptococcal biofilm formation by targeting surface-associated virulence factors. Journal of medical microbiology 64, 879-890, doi:10.1099/jmm.0.000105 (2015); Koo, H. et al. Influence of apigenin on gtf gene expression in Streptococcus mutans UA159. Antimicrobial agents and chemotherapy 50, 542-546, doi:10.1128/aac.50.2.542-546.2006 (2006); Branco-de-Almeida, L. S. et al. Effects of 7-epiclusianone on Streptococcus mutans and caries development in rats. Planta medica 77, 40-45, doi:10.1055/s-0030-1250121 (2011); Vahid-Dastjerdi, E., Monadi, E., Khalighi, H. R. & Torshabi, M. Down-Regulation of Glycosyl Transferase Genes in Streptococcus Mutans by Punica granatum L. Flower and Rhus coriaria L. Fruit Water Extracts. Iranian journal of pharmaceutical research; IJPR 15, 513-519 (2016)). Many compounds may have indirect effects on the expression of gfs as they can target different signaling and metabolic pathways. None has been shown to have a direct effect on the activity of Gtfs.

(141) Further investigation through docking analysis of this lead compound identified critical interactions of the ortho primary amide group of the compound with key active site residues of GtfC. An analog that does not contain this functional group lost the ability to inhibit the activity of Gtfs and in vitro biofilm formation, demonstrating that these effects are directly related and that the inclusion of the primary ortho amide group is crucial to maintaining potent anti-biofilm activity.

(142) The lead compound contains a nitro group, and typically, nitro groups are not amenable for development of drugs due to the potential of hazardous production of the nitroanion radical, nitroso intermediate, and N-hydroxy derivative (Boelsterli, U. A., Ho, H. K., Zhou, S. & Leow, K. Y. Bioactivation and hepatotoxicity of nitroaromatic drugs. Current drug metabolism 7, 715-727 (2006)). However, this is a concern only for systemic drugs and not for topical applications we intend to carry out. Nevertheless, efforts are underway to optimize the activity and explore the removal of such predicted groups. Further, we were encouraged to find that #G43 did not affect the survival rates of S. mutans and two commensal streptococcal species up to 200 M, and did not significantly affect other common oral bacteria such as Actinomeyes naeslundii and Aggregatibacter actinomycetemcomitans. The non-toxic feature of #G43 was also evident in the rodent caries models as no weight loss was observed in rats.

(143) A recent study also reported the development of a Gtf inhibitor through a similar approach. The observed potency of our lead compound #G43 is slightly better than the previously reported scaffold (Ren, Z. et al. Molecule Targeting Glucosyltransferase Inhibits Streptococcus mutans Biofilm Formation and Virulence. Antimicrobial agents and chemotherapy 60, 126-135, doi:10.1128/aac.00919-15 (2015)). Further #G43 drastically inhibited cariogenicity in vivo, but did not significantly inhibit S. mutans colonization. This is interesting finding as the compound effectively inhibited the biofilm formation by S. mutans in vitro. It is possible that the sampling method skewed our results toward the total numbers of S. mutans recovered from the oral cavity rather than only the biofilm bacteria. In addition, in vivo inhibition of S. mutans glucan production may not be sufficient to inhibit in vivo biofilm formation thus bacterial colonization. This would be a desirable outcome as we can inhibit virulence but minimally affect bacterial colonization and demonstrate a virulence-selective therapeutic approach. Moreover, in contrast to the reported compound, #G43 did not significantly affect the expression of Gtfs. This study also demonstrated that the lead compound selectively binds to GtfC and GtfB, suggesting the impact on the activity of GtfBC by the direct interaction rather than through downregulation of gene expression of gtfBC.

(144) In conclusion, using structure-based design, a unique low micromolar biofilm inhibitor that targets S. mutans Gtfs through binding to key virulence factors, Gtfs, was developed. The compound is drug-like, non-bactericidal, easy to synthesize, and exhibits very potent efficacy in vivo.

(145) Structure-Based 3D Database Search. The crystal structure of the complex of GtfC and acarbose (PDB code: 3AIC) was used for in silico screening. The GtfC active site was prepared by selecting residues and cofactors (water and MES) within 6.5 of acarbose and then a pharmacophore that consists of Asp588 (H-acceptor) and Gln960 (H-donor) was generated. The reliability of the FlexX/LeadIT package was assessed by virtually generating a 3D structure of acarbose using VEGA-Z, and then by docking the structure into the prepared GtfC active site. This resulting docking generated a comparable binding mode to the experimental data. A large library of about 500,000 small molecules obtained in 3D mol2 format from the free-access ZTNC database was used for the in silico screening. Docking runs were performed with a maximum allowed number of 2000 poses for each compound. The produced binding energies were ranked according to the highest scoring conformation. Compounds with binding energies better than 20 kJ/mol were selected for further investigation. The structures of top scoring compounds were examined for their bindings inside the GtfC pocket, drug-like properties based on Lipinski's rules, and for synthetic feasibility.

(146) Bacterial strains, culture conditions, and chemicals. Bacterial strains, including S. mutans UA159 and various Gtf mutants as described below, S. sanguinis SK36, and S. gordonii were grown statically at 37 C. with 5% C.sub.102 in Todd-Hewitt (TH) broth or on THB agar plate, or in chemically defined biofilm medium supplemented with 1% sucrose (Loo, C., Corliss, D. & Ganeshkumar, N. Streptococcus gordonii biofilm formation: identification of genes that code for biofilm phenotypes. J Bacteriol 182, 1374-1382 (2000)). Aggregatibacter actinomycetemcomitans VT1169 and Actinomyces naeslundii T14VJ1 were grown in Tryptic soy broth with yeast extract (TYE). Small molecule candidates were purchased from either ChemBridge Corporation or Enamine Ltd in USA. Stock solutions were prepared in dimethyl sulfoxide at 10 mM and arrayed in a 96-well format for biological screening.

(147) S. mutans biofilm formation and inhibition assays. Biofilm assays using 96-well flat-bottom polystyrene microtiter plates were performed to evaluate S. mutans biofilm formation at various conditions of small molecule inhibitors as described (Liu, C., Worthington, R. J., Melander, C. & Wu, H. A new small molecule specifically inhibits the cariogenic bacterium Streptococcus mutans in multispecies biofilms. Antimicrobial agents and chemotherapy 55, 2679-2687 (2011); Zhang, Q. et al. New small-molecule inhibitors of dihydrofolate reductase inhibit Streptococcus mutans. International journal of antimicrobial agents 46, 174-182, doi:10.1016/j.ijantimicag.2015.03.015 (2015)). Each assay was replicated three times. Minimum biofilm inhibitory concentration (MBIC) of compounds was determined by serial dilutions. The most active compounds identified from the tested candidates were selected for further examination.

(148) Construction of S. mutans Gtfs mutants. GtfB, GtfC single mutant, and GtfBC double mutant in which gtf was replaced with a kanamycin resistance cassette, aphA3 (encoding an aminoglycoside phosphotransferase), were gifts from Dr. Robert Burne's Laboratory, University of Florida, Gainesville, Fla. The GtfD mutant was constructed by an overlapping PCR ligation strategy using an erythromycin resistance cassette isolated from the IFDC2 cassette (Xie, Z., Okinaga, T., Qi, F., Zhang, Z. & Merritt, J. Cloning-independent and counterselectable markerless mutagenesis system in Streptococcus mutans. Appl Environ Microbiol 77, 8025-8033 (2011)). In brief, a 1-kb DNA fragment upstream of gtfD was PCR amplified with a primer pair of GtfD-UpF1 and GtfD-UpR-ldh, while a 1-kb DNA fragment downstream of gtfD was PCR amplified with a primer pair of GtfD-DnF-erm and GtfD-DnR1. The erythromycin cassette was PCR amplified with a primer pair of ldhF and ermR. With a primer pair of GtfD-UpF and GtfD-DnR, the overlapping PCR was used to amplify the three fragments that contain overlapping regions (primers listed below). The resulting 2.8-kb gtfD/erm amplicon was transformed into S. mutans UA159, and transformants were selected on THB plates containing erythromycin after 48 h incubation. The GtfBD and GtfCD double mutants were constructed by transformation of the GtfB and GtfC single mutant with the gtfD/erm amplicon and followed by the selection of kanamycin- and erythromycin-resistant colonies. The in-frame insertion of erm in the place of gtfD for each mutant allele was verified by DNA sequencing analyses. The mutants were further validated by the production of respective Gtf.

(149) Inhibition of the activity of Gtfs determined by zymographic assays. Well established zymographic assay was used to determine enzymatic activity of Gtfs. In brief, overnight S. mutans UA159 cultures were diluted 1:100 in fresh 5 mL THB. Bacteria were grown to OD.sub.470 of 1.0, and spun down by centrifugation at 4 C. and culture supernatants were collected and filtered through a 0.22-m-pore-size filter membrane to remove residual bacterial cells and dialyzed at 4 C. against 0.02 M sodium phosphate buffer (pH 6.8), with 10 M phenylmethylsulfonyl fluoride (PMSF), followed by a second dialysis against 0.2 mM sodium phosphate containing 10 M PMSF. After dialysis, 4 mL of samples were concentrated to 40 L by 100K Amicon Ultra-4 centrifugal filter (Merk Millipore Ltd.). For electrophoresis and zymographic analysis, 10 L of each concentrated culture supernatant was applied to 8% SDS-PAGE in duplicate. One gel was used for protein staining with Coomassie blue dye, while the other one was subjected to zymographic assay. For zymogram analysis, following electrophoretic separation, gels were washed twice for 15 min each with renaturing buffer containing 2.5% Triton X-100. Gels were then incubated for 18 h at 37 C. with 0.2 M sodium phosphate buffer (pH 6.5) containing 0.2% dextran T70, 5% sucrose, and varying concentrations of the small molecule inhibitors. The reactions were stopped by washing gels with distilled water at 4 C. for 10 min, and digital images of the resultant white opaque glucan bands were visualized against a black background and captured using a digital camera.

(150) Expression and purification of GtfB and GtfC catalytic domains. The DNA fragment coding for either GtfB catalytic (residues 268 aa-1074 aa) or GtfC-catalytic (residues 295 aa-1103 aa) was PCR amplified with primer sets of GtfB-BamH1-F and GtfB-Xho1-R, GtfC-BamH1-F and GtfC-Xhol1-R respectively using S. mutans genomic DNA as a template. Each amplified fragment was cloned into pET-sumo vector respectively and transformed in Escherichia coli BL21(DE3). The recombinant strain grown to OD.sub.600=0.8 in LB medium was induced with 0.1 mM IPTG at 18 C. overnight. Cell lysates prepared form the overnight grown E. coli cells were subjected to protein purification using HiTrap Column (Ni.sup.2+ affinity) followed by gel filtration experiments as described (Zhu, F. et al. Structural and functional analysis of a new subfamily of glycosyltransferases required for glycosylation of serine-rich streptococcal adhesins. The Journal of biological chemistry 286, 27048-27057, doi:10.1074/jbc.M110.208629 (2011); Zhang, H. et al. The highly conserved domain of unknown function 1792 has a distinct glycosyltransferase fold. Nature communications 5, 4339, doi:10.1038/ncomms5339 (2014)).

(151) Octet Red analysis. Octet full kinetic binding analysis was performed for binding of #G43 to GtfB and GtfC. The rate constant, KD, was determined using the Octet Red96 system (ForteBio, Menlo Park, Calif.). Phosphate buffer with 3.5% (w/v) DMSO was used. The proteins were captured on dip-and-read Anti-Penta-HIS (HIS1K) Biosensor. These consist of high affinity, high specificity Penta-His antibody from Qiagen pre-immobilized on a fiber optic biosensor. The binding of #G43 at 3-fold serial dilutions in phosphate buffer from 200, 66.6, 22.2, 7.4, 2.5 to 0 M was assessed. The ForteBio Octet analysis software (ForteBio, Menlo Park, Calif.) was used to generate the sensorgram and the accuracy of the analysis.

(152) Cell viability of S. mutans, S. gordonii, S. sanguinis, Aggregatibacter actinomycetemcomitans and Actinomyces. Effects of lead small molecules on cell viability were examined as described (Liu, C., Worthington, R. J., Melander, C. & Wu, H. A new small molecule specifically inhibits the cariogenic bacterium Streptococcus mutans in multispecies biofilms. Antimicrobial agents and chemotherapy 55, 2679-2687 (2011)). The number of colony-forming units (CFU) per milliliter of each sample treated with selected compounds at different concentrations was enumerated after incubation for 24 h at 37 C. and compared to the values obtained from the DMSO control group. Overnight broth cultures were transferred by 1:50 dilutions into fresh THB medium and were allowed to grow until mid-exponential phase (OD.sub.470 nm 0.6) before transfer to 96-well plates containing desired concentration of the compound. After 16 h incubation, bacterial growth was measured at OD.sub.470, and normalized to the DMSO control (100%).

(153) Growth of commensal and dual-species biofilms. Overnight broth cultures were transferred by 1:50 dilutions into fresh THB medium and were allowed to grow until mid-exponential phase (OD470 nm=0.6) before transfer to 96-well plates. For mono-species biofilms, 1:100 dilution of the individual cultures was added to the 96-well plate containing the desired concentration of compound or DMSO. After incubation for 16 h, the biofilms were gently washed with PBS in triplicate and the biofilms were quantified with crystal violet staining. For dual-species biofilms, 1:100 dilution of S. mutans was used and 1:10 dilution of the commensal species (S. sanguinius or S. gordonii) was used as inoculum to seed the 96-well plate containing the desired concentration of compound or DMSO. After incubation for 16 h, the biofilms were scratched off with a sterile spatula and suspended in 100 L of PBS, the biofilm samples were vortexed. To determine the total number of viable bacterial cells (colony forming units, CFU), 100 l from dispersed, 16 h biofilms were serially diluted in potassium phosphate buffer and plated in duplicate on BAP. The commensal species could be differentiated from S. mutans due to their characteristic green rings.

(154) Rat model of dental caries. S. mutans in vivo colonization and virulence were evaluated using a rat model of dental caries as previously described (Crowley, P. J., Brady, L. J., Michalek, S. M. & Bleiweis, A. S. Virulence of a spaP Mutant of Streptococcus mutans in a Gnotobiotic Rat Model. Infection and Immunity 67, 1201-1206 (1999)). Fischer 344 rats were bred and maintained in trexler isolators. Rat pups were removed from isolators at 20 days of age and randomly assigned into two groups of 6 animals with or without treatment of the potent inhibitor #G43. Rats were then infected with S. mutans UA159 for three consecutive days and provided a caries-promoting Teklad Diet 305 containing 5% sucrose (Harlan Laboratories, Inc., Indianapolis, IN.) and sterile drinking water ad libitum. One group of rats was then treated with vehicle control while another group was topically treated with the lead compound at 100 M twice daily for 4 weeks beginning 10 days post infection. Following each treatment, drinking water was withheld for 60 min. Animals were weighed at weaning and at the termination of the experiment. The animals were euthanized, their mandibles excised for microbiological analysis of plaque samples on MS agar plates and BAP and for scoring of caries by the method of Keyes (Keyes, P. H. Dental caries in the molar teeth of rats. II. A method for diagnosing and scoring several types of lesions simultaneously. Journal of dental research 37, 1088-1099 (1958)). All experimental protocols were approved by University of Alabama at Birmingham Institutional Animal Care and Use Committee. The methods were carried out in accordance with the relevant guidelines and regulations.

(155) The analysis of the in vitro experimental data was performed by ANOVA and Student's t test using SPSS 11.0 software (SPSS Inc., Chicago, IL.). Statistical significance in mean caries scores, colony-forming units (CFU) per mandible and body weights between two groups of rats was determined by one-way ANOVA with the Tukey-Kramer multiple comparison test using the InStat program (Graphpad Software). Differences were considered to be significant when a value of P0.05 was obtained.

(156) Primers used in this stud include the following, listed in 5 to 3 order.

(157) TABLE-US-00006 gtfD-UpF1 (SEQIDNO:1) TTAGCATGATTGGGGCTGC gtfD-UpR-1dh (SEQIDNO:2) TTGTTCATGTAATCACTCCTTCGATAACATATACGTTACAAAC gtfD-DnF-erm (SEQIDNO:3) GGTATACTACTGACAGCTTCCACTGACATAGCTTAACGTG gtfD-DnR1 (SEQIDNO:4) GACAAACATACCTTAGACGC ldhF (SEQIDNO:5) AAGGAGTGATTACATGAACAA ermR (SEQIDNO:6) GAAGCTGTCAGTAGTATACC
Used for Real-Time RT-PCR

(158) TABLE-US-00007 16srRNA-UpF (SEQIDNO:7) CCTACGGGAGGCAGCAGTAG 16srRNA-DnR (SEQIDNO:8) CAACAGAGCTTTACGATCCGAAA gtfB-UpF (SEQIDNO:9) CATACAGTAACGACAATCAGTAGCTCTA gtfB-DnR (SEQIDNO:10) GTACGAACTTTGCCGTTATTGTCATA gtfC-UpF (SEQIDNO:11) GCCACGGAACAAGCAGTTCTGTAA gtfC-DnR (SEQIDNO:12) TAATACCAATTATTTCCTAAGCTAA gtfD-UpF2 (SEQIDNO:13) CACAGGCAAAAGCTGAATTAACA gtfD-DnR2 (SEQIDNO:14) GAATGGCCGCTAAGTCAACAG

(159) Reactions were monitored with thin layer chromatography (TLC), which was done on silica gel plates with fluorescent indicator (Whatmann, silica gel, UV254, 25 m plates). The TLC spots were observed under UV light with the wavelengths 254 nm and 365 nm. Melting points were determined on a Mel-Temp II melting point apparatus and were uncorrected. Proton nuclear magnetic resonance (.sup.1HNMR) and carbon nuclear magnetic resonance (.sup.13CNMR) spectra were recorded on Bruker DPX 300 spectrometers using TMS or appropriate solvent signals as internal standard. The values of chemical shift are given in parts per million (ppm) relative to tetramethylsilane and coupling constants (J) in Hz. Mass spectra were recorded on an Applied Biosystems 4000 Q Trap instrument. Anhydrous solvents used for reactions were purchased in Sure-Seal bottles from Aldrich Chemical Company. Other reagents were purchased from Aldrich, Lancaster or Acros chemical companies and used as received.

(160) Protocols used to synthesize the lead compound and its subsequent derivatives are (#G43) 5-nitro-1-benzothiophene-2-carboxylic acid (535 mg, 2.4 mmol), anthranlinamide (300 mg, 2.2 mmol), EDAC (630 mg, 2.2 mmol), and DMAP (26 mg, 0.22 mmol) were dissolved in dichloromethane (15 mL) and the mixture was let stir overnight. TLC examination using 10% MeOH in CH.sub.2Cl.sub.2 showed the completion of the reaction. The reaction mixture was diluted with CH.sub.2Cl.sub.2 (20 mL), washed with water (320 mL), brine (120 mL) and dried over sodium sulfate. Removal of the drying agent followed by the evaporation of solvent gave the crude product which was filtered and washed with dichloromethane and hexane to afford the pure product as a bright orange solid (654 mg, 80%), mp. 401-402 C.; (FIG. 10A) .sup.1H NMR (300 MHz, DMSO-d.sub.6) : 7.23 (t, 1H, J=7.6 Hz), 7.59 (t, 1H, J=7.8 Hz), 7.96-7.93 (m, 2H), 8.37-8.254 (m, 3H), 8.51 (s, 1H), 8.58 (d, 1H, J=7.8 Hz), 9.03 (d, 1H, J=2.1 Hz), 13.336 (s, 1H). (FIG. 10B).sup.13C NMR (75 MHz, DMSO-d.sub.6) : 119.1, 120.2, 120.4, 121.4, 123.23, 124.34, 125.88, 128.8, 132.71, 138.9, 139.4, 145.5, 146.1, 158.9, 171.0. M/Z=325.1[MNH.sub.3].sup.+.

(161) (#G43-D) 5-nitro-1-benzothiophene-2-carboxylic acid (535 mg, 2.4 mmol), aniline (225 mg, 2.2 mmol), EDAC (630 mg, 2.2 mmol), and DMAP (26 mg, 0.22 mmol) were dissolved in CH.sub.2Cl.sub.2 (15 mL) and the mixture was let stir overnight. TLC examination using 10% MeOH in CH.sub.2Cl.sub.2 showed the completion of the reaction. The reaction mixture was diluted with dichloromethane (20 mL), washed with water (320 mL), brine (120 mL) and dried over sodium sulfate. Removal of the drying agent gave the crude product which was filtered and washed with dichloromethane and hexane to afford the pure product as a bright orange solid (350 mg, 52%); mp. 224-226 C., (FIG. 11A) .sup.1H NMR (300 MHz, CDCl.sub.3): 13.26 (s, 1H), 8.58 (d, 1H, J=8.4 Hz), 8.49 (s, 1H), 8.10-7.93 (m, 5H), 7.62-7.48 (m, 3H), 7.19 (t, 1H J=6.9). (FIG. 11B).sup.13C-NMR (75 MHz, CDCl.sub.3): 171.60, 160.14, 140.99, 140.41, 140.17, 139.43, 133.21, 129.29, 127.24, 126.07, 125.70, 125.61, 123.44, 123.40, 120.49, 119.41. M/Z=[280.2].sup.+.

Example 3: Hydroxychalcone Inhibitors of Streptococcus mutans Glucosyl Transferases and Biofilms as Potential Anticaries Agents

(162) Streptococcus mutans has been implicated as the major etiological agent in the initiation and the development of dental caries due to its robust capacity to form tenacious biofilms. Ideal therapeutics for this disease aim to selectively inhibit the biofilm formation process while preserving the natural bacterial flora of the mouth. Several studies have demonstrated the efficacies of flavonols on S. mutans biofilms and have suggested the mechanism of action through their effect on S. mutans glucosyltransferases (Gtfs). These enzymes metabolize sucrose into water insoluble and soluble glucans, which are an integral measure of the dental caries pathogenesis. Numerous studies have shown that flavonols and polyphenols can inhibit Gtf and biofilm formation at millimolar concentrations. This study screened a group of 14 hydroxychalcones, synthetic precursors of flavonols, in an S. mutans biofilm assay. Several of these compounds emerged to be biofilm inhibitors at low micromolar concentrations. Chalcones that contained a 3-OH group on ring A exhibited selectivity for biofilm inhibition. Moreover, 6 additional analogs of the lead compound were synthesized and evaluated for their potential activity and selectivity against S. mutans biofilms. The most active compound identified from these studies had an IC.sub.50 value of 44 M against biofilm and MIC.sub.50 value of 468 M against growth displaying >10 fold selectivity inhibition towards biofilm. The lead compound displayed a dose dependent inhibition of S. mutans Gtfs. The lead compound also did not affect the growth of two commensal species (Streptococcus sanguinis and Streptococcus gordonii) at least up to 200 M, indicating that it can selectively inhibit cariogenic biofilms, while leaving commensal and/or beneficial microbes intact. Thus non-toxic compounds have the potential utility in public oral health regimes.

(163) Dental caries is a multifactorial disease evident by localized destruction of susceptible dental surfaces. S. mutans is the primary etiological agent. Through the function of its Gtfs, S. mutans metabolizes sucrose into water insoluble and soluble glucans. Three types of Gtfs are reported: GtfB, GtfC, and GtfD. Both GtfB and GtfC predominantly synthesize water-insoluble glucans whereas GtfD synthesizes water-soluble glucans. These exopolymeric glucans are an integral measure of the cariogenic biofilms that provide an extracellular matrix, shielding the bacteria from the host immune responses, mechanical stresses, and antimicrobial agents. As S. mutans accumulate, the bacterium and other cariogenic species within the biofilm undergo active sugar metabolisms and produce copious amounts of their end-product, lactic acid, leading to the dissolution of the hydroxyapatite crystal lattice of the enamel (Lenander-Lumikari, M., Loimaranta, V., Advances in dental research, 2000, 14, 40).

(164) Current preventive approaches for dental caries include tooth-brushing and the use antimicrobial mouthwashes. Unfortunately, the removal of bacterial biofilms through brushing demands frequent repetition because the tooth surfaces are rapidly re-colonized by bacteria. Furthermore, the drawback of existing antimicrobial mouthwashes lies in their lack of selectivity, affecting pathogenic species as well as commensal beneficial species, which give rise to some undesired side effects. Therefore, emerging innovative approaches of dental caries prevention need to be selective and should strive to preserve the natural bacterial flora in the mouth.

(165) S. mutans mutants defective in genes gtfB and gtfC, which express GtfB and GtfC respectively, exhibited markedly reduced levels of smooth surface caries lesion compared to the parental S. mutans (Yamashita, Y., Bowen, W. H., Burne, R. A., Kuramitsu, H. K., Infection and immunity, 1993, 61, 3811). Thus, S. mutans Gtfs are valid targets for the discovery of inhibitors of cariogenic biofilms, which will have potential applications in the treatment of dental caries.

(166) Efforts have been placed in search for S. mutans biofilm inhibitors by several research groups (Nijampatnam, B., Nadkarni, D. H., Wu, H., Velu, S. E., Microorganisms, 2014, 2, 128; Peng, X., Zhang, Y., Bai, G., Zhou, X., Wu, H., Molecular microbiology, 2015, 99, 945; Liu, C., Worthington, R. J., Melander, C., Wu, H., Antimicrobial agents and chemotherapy, 2011, 55, 2679; Zhang, Q., Nguyen, T., McMichael, M., Velu, S. E., Zou, J., Zhou, X., Wu, H., International journal of antimicrobial agents, 2015, 46, 174). Since diet is one of the key factors that define oral health, research has mainly been focused on widely consumed food products. Numerous studies have been conducted comparing the efficacies of flavonols and low-molecular-weight polyphenols found in cranberries. Flavones and flavonols were inhibitors of Gtfs; of these, a compound called apigenin (4,5,7-trihydroxyflavone, FIG. 1) was the most effective inhibitor of Gtfs (Koo, H., Hayacibara, M. F., Schobel, B. D., Cury, J. A., Rosalen, P. L., Park, Y. K., Vacca-Smith, A. M., Bowen, W. H., The Journal of antimicrobial chemotherapy, 2003, 52, 782). Flavonols and their glycosides such as myricetin and myricetin 3-rhamnoside exhibited significant but moderate effects (FIG. 1) (Koo, H., Rosalen, P. L., Cury, J. A., Park, Y. K., Bowen, W. H., Antimicrobial agents and chemotherapy, 2002, 46, 1302; Gregoire, S., Singh, A., Vorsa, N., Koo, H., Journal of applied microbiology, 2007, 103, 1960). In addition, scaffolds found in tea (Camellia sinensis) that inhibit S. mutans biofilms attract attention due to their unique polyphenol compositions and their prevalence in the human diet. Early studies were carried out on extracts containing multiple constituents however recent reports focus on effects of single defined component in vitro and in vivo (Koo, H., Duarte, S., Murata, R., Scott-Anne, K., Gregoire, S., Watson, G., Singh, A., Vorsa, N., Caries Res, 2010, 44, 116). Furthermore, these natural product compounds inhibited S. mutans biofilms at high micromolar and even millimolar concentrations.

(167) Undoubtedly, flavonols are a promising class of scaffolds for the development of anticaries therapeutics as they may selectively inhibit the formation of cariogenic biofilms. By targeting S. mutans' virulence instead of its viability, the agents developed will be non-bactericidal, preserving the natural bacterial flora of the mouth, and will also be less likely to develop resistance to therapy. Encouraged by reported findings on flavonols, we were interested to examine the effect of hydroxychalcones (FIG. 1), precursors of flavonols and isoflavonols, for their effect on S. mutans. biofilm and Gtfs. Chalcones were originally isolated from natural sources and are abundant in edible plants. Structurally, they can be defined as open-chain flavonoids in which two aromatic rings are joined by a three carbon ,-unsaturated carbonyl system. Being a minor subgroup of the flavonoid family, like other members, chalcones have been reported responsible for a variety of biological activities, including antiviral, anticancer, antimicrobial, anti-inflammatory, antioxidative, antimalarial, anti-leishmania, antinociceptive, and antiproliferative activities (Matos, M. J., Vazquez-Rodriguez, S., Uriarte, E., Santana, L., Expert opinion on therapeutic patents, 2015, 25, 351; Das, M., Manna, K., Journal of toxicology, 2016, 7651047). Hence, chalcones are considered to be a class of compounds with important therapeutic potential. There are no studies that report the antibiofilm activity of chalcones against S. mutans. This study investigated this class of compounds to identify novel selective anti-biofilm agents that can have potential applications in dental caries prevention.

(168) Although the inhibition of both GtfB and GtfC are required for the maximum reduction in biofilm formation, only the structural information of GtfC's active site is currently known. However, genes encoding these two Gtfs have a very similar amino acid composition (76% homology), and are subject to the same regulatory processes (Hamada, S., Horikoshi, T., Minami, T., Kawabata, S., Hiraoka, J., Fujiwara, T., Ooshima, T., Infection and immunity, 1991, 59, 4161). Thus, GtfC was used as a target for the drug discovery efforts. Initial docking analysis was performed using FlexX/LeadIT package against GtfC active site (resolution: 3.11 , PDB code: 3AIC) on a polyphenol database which included various scaffolds such as flavonols, chalcones, stilbenes, and other complex structures. Of these compounds, chalcones were a focus due to their properties discussed above. A total of 14 chalcones with various hydroxyl substitution patterns were obtained from National Cancer Institute (NCI) compound library and screened for their effect on S. mutans growth and its biofilm. Table 6 summarizes the results of the preliminary screen conducted at 200 M.

(169) TABLE-US-00008 TABLE 6 Biofilm and growth inhibition profiles of chalcone derivatives obtained from the NCI library. embedded image Biofilm Growth S. mutans S. mutans Compound inhibition 200 inhibition 200 Biofilm IC.sub.50 Growth IC.sub.50 No NSC code R.sup.1 R.sup.2 M (%).sup.a M (%).sup.a (M).sup.a (M).sup.a 1 73255 2-OH 4-OH 27 5 48 8 NA NA 2 73257 2-OH 3OH 84 3 86 0.5 64 4 32 0.3 3 46672 2,5-di-OH 4-OMe 87 8 76 0.9 NA NA 4 94615 2-OH 4-OH, 3-OMe 86 2 85 0.6 61 2 44 3 5 401492 2,4-di-OH H NI NI NA NA 6 636790 2,4-di-OH 2-OH NI NI NA NA 7 636810 3-OH 2-OH NI NI NA NA 8 640543 3-OH 2-OH, 3,5 di- 81 2 82 2 NA NA Cl 9 17051 3-OH 2,4-di-OH 93 1 NI 32 5 NI 10 90932 4-OH 3,4,5-tri- NI NI NA NA OMe 11 640536 4-OH, 5-OMe 2-OH 85 3 71 5 34 2 40 5 12 677786 4-OH, 3-NMe.sub.2, 4-OMe NI NI NA NA 5-NMe.sub.2 13 196539 4-OMe, 4-OMe, 3-OH 27 4 30 0.7 NA NA 5-OMe, 14 196540 4,5-OCH.sub.2O 4-OMe, 3-OH NI NI NA NA .sup.aAverage of at least 5 measurements; NI No inhibition; NA Not available.

(170) The initial screen highlighted chalcone activities ranging from almost complete inhibition of both S. mutans growth and biofilm (Compounds 2-4, 8, 11), selective inhibition of S. mutans biofilm (Compound 9), to no effect on either S. mutans growth or biofilm (Compounds 5-7, 10, 12, 14). Active compounds inhibited biofilm in the range of 27-95% at 200 M concentration. However, several of these compounds also proportionally affected the growth of S. mutans, indicating that these small molecules may not be selective biofilm inhibitors. Nonetheless, four compounds that showed promise by exhibiting greater than 80% biofilm inhibition were pursued further into serial dilutions in order to determine their bactericidal and anti-biofilm IC.sub.50 values, and to observe if any selectivity for biofilm inhibition over growth inhibition arises at lower doses. Both the growth and biofilm IC.sub.50 values remained in the low micromolar ranging from 32-64 M. While compounds 2, 4, and 11 failed to demonstrate biofilm-selective inhibition, compound 9 did elicit selectivity with biofilm IC.sub.50 value 32 M, without affecting the growth of S. mutans at 200 M concentration. Through this study, we observed several trends in the elicited biofilm and bactericidal effects in relation to chalcone structures.

(171) Chalcones that did not possess any bactericidal or anti-biofilm properties also did not have any OH groups on the ring B of the chalcone skeleton (Compound 5). Despite containing methyl protected hydroxyl groups on the ring B, compounds 10 and 12 also failed to produce any biofilm inhibition. The only analogs that do not contain free hydroxyl groups on the ring A are compounds 13 and 14, which contain methoxy and methylenedioxy groups in the 4.sup.th and 5.sup.th positions. While compound 13 was marginally active, reducing biofilm and growth by 30% at 200 M, compound 14 exhibited no anti-biofilm effects. These results suggest that the presence of hydroxyl groups on either ring of the chalcone scaffold is crucial for the inhibition of S. mutans biofilm.

(172) Compounds 5 and 6 differ only in the 2 position of OH group in ring A, where the latter contains an OH group in place of hydrogen. Interestingly, both compounds are inactive, suggesting the OH in 2 position may not contribute to the studied bioactivities. While compound 7 also follows this pattern of activity, this effect is not observed in the case of compound 11.

(173) Furthermore, analysis of compounds 1-4 which contain an OH group at the 2.sup.nd position of ring A seemed to exhibit potent anti-biofilm and bactericidal activities. Contrary to these compounds, chalcones that bare a hydroxyl group at the 3.sup.rd position of ring A (Compounds 7-9) seemed to exhibit a range of potent and selective anti-biofilm activities. With the exception of the inactive compound 7, other compounds exhibited greater than 81% inhibition of biofilm at 200 M and presented some selectivity over growth inhibition. Strikingly, when tested at lower concentrations, the best compound that emerged from this study (9) almost exclusively inhibited S. mutans biofilm, suggesting the importance of OH group in the 3.sup.rd position in the ring A.

(174) There was only one compound that contained a mono-hydroxyl group at the 4.sup.th position of the ring A (compound 11). This compound was inactive against both S. mutans growth and biofilm. Compounds 5-6, 10-14 contain OH group at the 4, position and majority of these compounds also fared poorly in the preliminary screen asides from compound 11 which was toxic to S. mutans at low micromolar concentrations. The importance of OH group at this position remains unclear and warrants further investigation.

(175) In search of compounds that selectively target S. mutans biofilm without affecting the its growth, the best candidate to pursue further was compound 9, which has a biofilm IC.sub.50 value 32 M. No previous biological activities have been reported with regard to this synthetic polyhydroxy analog. This compound did not affect the bacterial growth at least up to a concentration of 200 M, showing that it is a selective biofilm inhibitor. While compound 11 exhibited comparable biofilm inhibition to compound 9 (IC.sub.50 value of 34 M, and 32 M respectively) compound 11 also inhibited S. mutans growth at this concentration.

(176) Thus, compound 9 was selected as the lead scaffold for the further development of the selective antibiofilm agents. In order to further establish its potency, the biofilms produced by S. mutans treated with this compound at various concentrations were imaged as shown in FIG. 12A. FIG. 12B depicts the dose-dependent inhibition of S. mutans growth and biofilm at various concentrations. Considerable selectivity can be seen, especially at higher concentrations. Finally, the effect of it on the survival rates of S. mutans, and two commensal species (S. sanguinis, S. gordonii) were used to assess the toxicity of this scaffold. At higher concentrations (200 M), approximately 10-18% inhibition is seen with all strains when compared to DMSO (FIG. 12C). It is important to note that at the biofilm IC.sub.50 value of 32 M, no significant bactericidal activity is observed. Thus, compound 9 was concluded to be a non-toxic and a biofilm-selective inhibitor.

(177) As compound 9 was obtained from the NCI library in a very a small quantity, it was not possible to ascertain its structure with NMR spectroscopic analysis. In addition, the stereochemistry of the double bond (E or Z) present in this molecule was not reported in the NCI database. Thus, both E and Z isomers of the compound 9 were synthesized and characterized. The preparation of the E isomer of 9 (9a) was achieved by the Claisen-Schmidt aldol condensation of the desired benzaldehyde (15a) and acetophenone (16a) in EtOH using aqueous NaOH as the base in 93% yield. Demethylation of the intermediate methoxy substituted compound 17a was accomplished by the treatment with BBr.sub.3 in CH.sub.2Cl.sub.2 under N.sub.2 atmosphere led to the formation of compound 9a (E isomer) in 87% yield (Scheme 1).

(178) ##STR00225##

(179) The stereospecific synthesis of the Z isomer of compound 9b was performed using a reported procedure of acid mediated aldol condensation as shown in Scheme 2. BF.sub.3.Et.sub.2O mediated condensation of 2,4-dihydroxybenzaldehyde (19) with m-hydroxyl acetophenone (20a) resulted in the Z-isomer 9b in contrast with the results obtained when using NaOH. This method was tolerant of pre-existing hydroxyl groups and thus required no protecting groups.

(180) ##STR00226##

(181) Taking compound 9 as the lead, a small collection of both E and Z isomers of a few hydroxychalcone derivatives (18b-d and 21b) with different substitutions in rings A, B were prepared using the synthetic procedures described above. Selected examples and their activities are shown in Table 7.

(182) TABLE-US-00009 TABLE 7 Biofilm and growth inhibition profiles of synthesized analogs of compound 9 embedded image Biofilm Growth IC.sub.50 IC.sub.50 No E/Z R.sup.1 R.sup.2 (M).sup.a (M).sup.a SI.sup.b 9a E 3-OH 2,4 di-OH 68 3 639 25 9.39 9b Z 3-OH 2,4 di-OH 44 5 468 16 10.6 18b E 4-OH 2,4 di-OH 162 21 1063 118 6.6 21b Z 4-OH 2,4 di-OH 77 8 782 96 10.1 18c E 2-OH 2,4,5 tri-OH 224 23 323 36 1.5 18d E/Z 4-OH 2,4,5 tri-OH 76. 6 376 6 4.9 .sup.aAverage of at least 5 measurements. .sup.bSelectivity index calculated by dividing growth IC.sub.50 value by biofilm IC.sub.50 value.

(183) E and Z isomers of the lead compound, E and Z isomers of a synthetic derivative and two other compounds that further explore the hydroxyl regiochemistry of chalcones were included. Due to the possibility of photo-isomerization of chalcones, which has been previously demonstrated to be correlated with the substituents in the aromatic rings and pH dependent (Balsera, B., Mulet, J., Fernandez-Carvajal, A., de la Torre-Martinez, R., Ferrer-Montiel, A., Hernandez-Jimenez, J. G., Estevez-Herrera, J., Borges, R., Freitas, A. E., Lopez, M. G., Garcia-Lopez, M. T., Gonzalez-Muniz, R., Perez de Vega, M. J., Valor, L. M., Svobodova, L., Sala, S., Sala, F., Criado, M., European journal of medicinal chemistry, 2014, 86, 724), all samples were tested immediately upon making them. The biofilm and growth inhibition profiles were screened using the assay protocols as described earlier. All compounds asides from compound 18c demonstrated considerable selectivity in biofilm inhibition. Compound 18c was the most toxic to planktonic cells with a selectivity index of 1.5; a result that is consistent to the observation reported earlier. Comparing the activities of the E and Z pairs (9a and 9b and 18b and 21b), the Z isomers demonstrate slightly better inhibitions of both biofilm and growth. The most active compound (9) that emerged from the NCI screen had a biofilm IC.sub.50 value of 32 M, while the synthesized cis isomer of this compound (9b) exhibited a slight decrease in activity with an IC.sub.50 value of 44 M. Corresponding E isomer (9a) also had a slightly decreased activity with an IC.sub.50 value of 68 M. Both 9a and 9b demonstrated a selectivity index of about 10 towards biofilm inhibition. The Z isomer (21b) fared slightly better at being selective compared to its E isomer when comparing compounds with a hydroxyl in the 4.sup.th position of ring A also. Compound 18d (mixture of E/Z) produced biofilm activity with moderate selectivity. Thus, the demonstrated selectivity of these compounds makes them amenable for the development of non-toxic biofilm inhibitors.

(184) In order to establish the relationship between the biofilm inhibition and the effect on Gtfs, a zymogram assay was performed on six of the active compounds and the inhibition of Gtfs was qualitatively observed on an SDS-page gel through the intensity of the glucan bands produced. Data from selected compounds is presented in FIG. 13A. Each of these compounds was added to overnight cultures at 50 M concentrations, and the Gtfs were collected from supernatants. One of the duplicate SDS-PAGE gel is Coomassie blue stained while the other is subjected to the zymogram assay, where the glucan bands produced represent Gtfs enzyme activities. GtfB and GtfD remain unresolved above the 150 kD reference ladder while a clear separation can be seen with the single band of GtfC.

(185) With regard to effects on protein level, compounds 9b, 18b, 18c and 21b showed an inhibitory effect on the production of Gtfs. Compound 18c shows the largest inhibition and this result is logical given the bactericidal effects of the compound. Mechanism by which these compounds affect the Gtf expression is unknown and warrants further investigation. With regard to Gtf enzyme inhibitory activity, several of the polyhydroxy chalcones exhibited a prominent effect. Comparing the activities of the E and Z pairs (9a, 9b and 18b, 21b), the Z isomers (9b and 21b) exhibit the best inhibitory effects, consistent with the biofilm inhibition. A decrease is observed in the bottom GtfC band, but a decrease in the upper band GtfBD is also observed, suggesting that the compound inhibited Gtfs. This is expected as GtfC and GtfB share 76% homology. Surprisingly, the E isomers 9a and 18b did not exhibit a drastic effect, suggesting that perhaps these isomers use a different pathway to illicit biofilm inhibition. Compound 18d demonstrates some weak inhibition of the GtfC band. A dose-dependent zymogram experiment of compound 9b was performed to determine if any selectivity would emerge (FIG. 13B). All Gtfs were inhibited by compound 9b dose-dependently. Thus, we conclude this compound affects the production and activity of all Gtfs.

(186) Docking analysis of the two different isomers 9a and 9b within the GtfC active site revealed slightly different binding modes (FIG. 13C), which may explain the differences observed between the inhibitions seen in the zymograms and biofilm activity. A previous report indicated that binding of acarbose to Glu515 compromised the acid/base catalyst function, while interactions with Asp477 and Asp588 blocked the acceptor glycosyl moiety, explaining the inhibitory properties shown by acarbose when bound to GtfC (Ito, K., Ito, S., Shimamura, T., Weyand, S., Kawarasaki, Y., Misaka, T., Abe, K., Kobayashi, T., Cameron, A. D., Iwata, S., Journal of molecular biology, 2011, 408, 177). While the docking analysis showed that these three residues were within proximity to the both isomers, the Z isomer, 9b showed the hydroxy groups positioned appropriately and closer to the three key residues when compared to the E isomer, 9a.

(187) A sucrose-dependent Drosophila colonization model (Peng, X., Zhang, Y., Bai, G., Zhou, X., Wu, H., Molecular microbiology, 2015, 99, 945) was used to examine the effect of both compounds 9a and 9b on S. mutans colonization in vivo. Briefly, Gfp tagged S. mutans bacteria were infected into flies along with the treatment appropriate compound at 100 M in a feeding-assay. DMSO was used as a negative control (FIG. 13D) and gtfB mutant, a known biofilm defective strain, was used as a positive control (FIG. 13D panel a). The fluorescence intensity was observed in guts of the flies fed with the Gfp tagged bacteria after 7 days of infection. A marked reduction in fluorescence was observed by both compounds 9a and 9b (FIG. 13D panels d and c), with 9b eliciting a more potent effect, producing an effect similar to that observed in the gtfB mutant (FIG. 13D panel b). This data is consistent with the zymogram and the biofilm inhibition observed previously.

(188) Thus, this study demonstrated the S. mutans antibiofilm activities of polyhydroxychalcones, and observed some trends in activities with respect to the stereochemistry of the double bond and the regiochemistry and numbers of hydroxyl groups present in the molecules. Several low micromolar biofilm inhibitors emerged. Chalcones which contained a hydroxyl group in the third position of ring A exhibited higher selectivity for biofilm over growth. The lead compounds were further evaluated for their effect on S. mutans Gtfs and their effect on commensal bacteria and found that these scaffolds have an effect of Gtf expression and activity. The relationship between the biofilm activity and Gtf inhibition was established using a zymogram assay. These results were further validated by conducting a docking analysis of Z and E isomers of one of the lead compounds. This study also demonstrated the effect of two lead compounds on S. mutans colonization in vivo.

(189) Docking protocols: The crystal structure of the complex of GtfC and acarbose (resolution: 3.11 , PDB code: 3AIC) was used for the in silico screening. The GtfC active site was prepared by selecting residues and cofactors (water and MES) within 6.5 of acarbose and then a pharmacophore that consists of Asp588 (H-acceptor) and Gln960 (H-donor) was generated. The reliability of the FlexX/LeadIT package was assessed by virtually generating a 3D structure of acarbose using VEGA-Z, and then by docking the structure into the prepared GtfC active site. This resulting docking generated a comparable binding mode to the experimental data. A library of about 1,000 small molecules obtained in 3D mol2 format from the free-access ZINC database specific to NCI compounds bearing at least one phenol group was used for the in silico screening. Docking runs were performed with a maximum allowed number of 2000 poses for each compound. The produced binding energies were ranked according to the highest scoring conformation. Compounds with binding energies better than 20 kJ/mol were selected for further investigation. The structures of top scoring compounds were examined for their bindings inside GtfC pocket, drug like properties based on Lipinski's rules, and for synthetic feasibility.

(190) Bacterial strains, culture conditions, and chemicals. Bacterial strains, including S. mutans UA159 and various Gtf mutants, S. sanguinis SK36, and S. gordonii were grown statically at 37 C. with 5% CO.sub.2 in Todd-Hewitt (TH) broth or THB agar plate, or in chemically defined biofilm medium supplemented with 1% sucrose. Chalcone small molecule candidates were obtained from NCI or synthesized in dimethyl sulfoxide at 20 mM and arrayed in a 96-well format for biological screening.

(191) S. mutans biofilm formation and inhibition assays. Biofilm assays using 96-well flat-bottom polystyrene microtiter plates were performed to evaluate S. mutans biofilm formation at various conditions as described. Each assay was replicated five times. Compounds that inhibited 50% biofilm formation were determined by serial dilutions. The most active compounds isolated from the library were selected for further examination.

(192) Inhibition of the activity of Gtfs determined by zymographic assays. A well-established zymographic assay was used to determine enzymatic activity of Gtfs (Mattos-Graner, R. O., Napimoga, M. H., Fukushima, K., Duncan, M. J., Smith, D. J., J Clin Microbiol, 2004, 42, 4586). In brief, overnight S. mutans UA159 cultures were diluted 1:100 in fresh 5 mL THB with 50 L of selective compounds at a series of concentrations. Treated bacteria were grown to OD470 of 1.0, and spun down by centrifugation at 4 C., and culture supernatants were collected and filtered through a 0.22-m-pore-size filter membrane to remove residual bacterial cells and dialyzed at 4 C. against 0.02 M sodium phosphate buffer (pH 6.8), with 10 M phenylmethylsulfonyl fluoride (PMSF), followed by a second dialysis against 0.2 mM sodium phosphate containing 10 M PMSF. After dialysis, 4 mL of samples were concentrated to 40 L by 100K Amicon Ultra-4 centrifugal filter (Merk Millipore Ltd.). For electrophoresis and zymographic analysis, 10 L of each concentrated culture supernatant was applied to 8% SDS-PAGE in duplicate. One gel was used for protein staining with Coomassie blue dye, while the other one was subjected to zymographic assay. The resultant white opaque glucan bands were visualized against a black background.

(193) Cell viability of S. mutans and commensal S. gordonii and S. sanguinis. Effects of lead small molecules on cell viability were examined. The number of colony-forming units (CFU) per milliliter for each compound at different concentrations was determined after incubation for 24 h at 37 C. and compared to the values obtained from the DMSO control group.

(194) Colonization of Drosophila. Infections of flies were performed as described (Chugani, S. A., Whiteley, M., Lee, K. M., D'Argenio, D., Manoil, C., Greenberg, E. P., Proceedings of the National Academy of Sciences of the United States of America, 2001, 98, 2752; Peng, X., Zhang, Y., Bai, G., Zhou, X., Wu, H., Molecular microbiology, 2015, 99, 945; Mulcahy, H., Sibley, C. D., Surette, M. G., Lewenza, S., PLoS pathogens, 2011, 7). Mid-log phase THB cultures of Gfp-tagged (green fluorescent protein) S. mutans UA159 were spun down and resuspended in a solution containing 5% sucrose and 50 M of the compound. 100 L of resuspended cells were spotted onto a sterile filter that was placed on the surface of 5 mL of solidified 5% sucrose agar in a plastic vial. The vials were allowed to dry at room temperature for 30 minutes prior to addition of flies. Male Canton S flies (1-3 days old) were treated with antibiotics for 2 days and starved for 3 hours prior to the addition to vials supplied with S. mutans (10 flies per vial). The colonization of flies by Gfp-tagged strains were analyzed by Nikon elipse 90i microscope, equipped with an Epi-fluorescence and NIS elements AR imaging system.

(195) Synthesis of chalcones using NaOH: General Procedure. A mixture of the acetophenone (1 mmol) and the aldehyde (1 mmol) was dissolved in EtOH (10 mL). An aqueous solution of NaOH (40%, 1 mL) was added to this solution at 0-5 C. The reaction mixture was allowed to attain room temperature and then stirring was continued for 12 h. TLC examination (30% ethyl acetate in hexane) indicated the completion of the reaction. The reaction mixture was then poured over crushed ice and acidified to pH 2 with 1N. HCl. The light yellow solid precipitated was filtered, washed with water, and dried. The product obtained was either purified on column chromatography (Si gel with 10% ethyl acetate in hexane) or recrystallized from EtOH.

(196) Synthesis of chalcones using BF.sub.3.OEt.sub.2: General Procedure. To a solution of the dihydroxybenzaldehyde (1 mmol) and the corresponding hydroxyacetophenone (0.5 mmol) in 1,4-dioxane (10 mL), BF.sub.3.Et.sub.2O (3 nmol) was added. The reaction mixture was stirred at room temperature for 24 h. Upon completion of the reaction as indicated by TLC (30% ethyl acetate in hexane), the precipitated solid was filtered and washed with CH.sub.2Cl.sub.2 to afford the Z-isomer of polyhydroxylchalcones.

(197) Demethylation using BBr.sub.3: General Procedure. The corresponding methoxy substituted chalcones (0.25 mmol) obtained from the previous step (1) were dissolved in dried CH.sub.2Cl.sub.2 (15 mL) and cooled down to 0 C. BBr.sub.3 (2 equiv per any potentially basic N or O) was slowly added to the reaction mixture kept under N.sub.2 atmosphere. After stirring for 24 h at room temperature, the reaction was cooled to 0 C. and quenched with a very slow addition of H.sub.2O. The resulting red solids were separated by filtration and washed with H.sub.2O and CH.sub.2Cl.sub.2. The crude product was further purified by column chromatography over Si gel using 20% MeOH in CH.sub.2Cl.sub.2 to afford the hydroxyl chalcones.

(198) Spectral data of the compounds of this study are noted below.

(199) ##STR00228##

(200) (E)-3-(2,4-Dimethoxyphenyl)-1-(3-methoxyphenyl)-2-propen-1-one (17a) yellow oil, (259 mg, 87%), purified by column. M.P=75-78 C. .sup.1H-NMR (300 MHz, CDCl.sub.3) : 3.83-3.91 (m, 9H), 5.57 (d, J=2.4 Hz, 1H), 5.63 (dd, J=8.4 Hz, J.sub.2=2.4 Hz, 1H), 6.15-6.25 (m, 1H), 6.42-6.53 (m, 1H), 6.60-6.72 (m, 4H), 7.18 (d, J=15.6 Hz, 1H). .sup.13C NMR (75 MHz, CDCl.sub.3) : 55.4 (2C), 55.5, 98.3, 105.3, 112.7, 117.0, 118.7, 120.3, 120.9, 129.3, 130.9, 140.2, 140.5, 159.7, 160.3, 163.0, 190.8. EI-MS m/z: 298.8 [M].sup.+; HRMS calculated for C.sub.18H.sub.18O.sub.4 [M+H].sup.+ 298.1211, found 298.1205.

(201) ##STR00229##

(202) (Z)-3-(2,4-Dihydroxyphenyl)-1-(3-hydroxyphenyl)-2-propen-1-one (9b) Amorphous red solid, (71.2 mg, 56%), purified by column. M.P=164-167 C., .sup.1H NMR (DMSO, 700 MHz) : 7.27 (d, J=6.0 Hz, 1H), 7.49-7.59 (m, 3H), 7.84 (d, J=3.0 Hz, 1H), 7.98 (d, J=9.0 Hz, 1H), 8.30 (d, J=6.0 Hz, 1H), 8.60 (d, 1H, J=6.0 Hz, 1H), 9.41 (d, J=9.0 Hz, 1H), 10.28 (brs, 1H), .sup.13C NMR (MeOD, 175 MHz) : 103.8, 11511.3, 121.9, 121.9, 123.9, 124.6, 131.9, 132.6, 134.7, 156.5, 160.4, 161.7, 172.1, 173.6. EI-MS m/z: 239.0 [MH.sub.2O].sup.+; HRMS calculated for C.sub.15H.sub.10O.sub.3 [MH.sub.2O].sup.+ 238.0634, found 238.0630.

(203) ##STR00230##

(204) (E)-3-(2,4-Dihydroxyphenyl)-1-(3-hydroxyphenyl)-2-propen-1-one (9a). Red solid (53 mg, 84%), purified by column. M.P=73-75 C. .sup.1H NMR (MeOD, 700 MHz) : 6.82 (dd, J.sub.1=11.9 Hz, J.sub.2=8.2 Hz, 1H), 6.90 (dd, J'.sub.2 11.7 Hz, J.sub.2=8.8 Hz, 2H), 7.10 (d, J.sub.1=9.4 Hz, 1H), 7.18 (d, J.sub.1=11.2 Hz, 1H), 7.43-7.67 (m, 1H), 7.61-7.67 (m, 1H), 7.96-8.02 (m, 2H); .sup.13C NMR (MeOD, 175 MHz) :101.0, 106.6, 115.7, 116.6, 119.6, 123.4, 128.5, 131.2, 132.2, 134.1, 146.2, 146.8, 149.8, 163.7, 191.1. EI-MS m/z: 257.1 [M].sup.+; HRMS calculated for C.sub.15H.sub.12O.sub.4 [M+H].sup.+ 256.0730, found 256.0736.

(205) ##STR00231##

(206) (E)-3-(2,4-dimethoxyphenyl)-1-(4-methoxyphenyl)prop-2-en-1-one (17b). Crystallized from MeOH as yellow crystals. (292 mg, 98%) M.P=80-82 C., .sup.1H NMR (300 MHz, CDCl.sub.3) : 3.78-3.90 (m, 9H), 6.47 (d, J=6.0 Hz, 1H), 6.53 (dd, J.sub.1=8.4, J.sub.2=2.1 Hz, 1H), 6.88-7.00 (m, 2H), 7.54 (d, J=6.9 Hz, 1H), 7.58 (s, 1H), 8.05-8.11 (m, 3H). .sup.13C NMR (CDCl.sub.3, 75 M Hz) : 55.6 (2), 55.7, 98.6, 105.5, 113.8, 117.4, 120.4, 130.8, 130.9, 131.8, 139.8, 160.4, 163.0, 163.2, 189.5. EI-MS m/z: 299.0 [M].sup.+; HRMS calculated for C.sub.8H.sub.18O.sub.4 [M+H].sup.+ 298.1202, found 298.1205.

(207) ##STR00232##

(208) (Z)-3-(2,4-Dihydroxyphenyl)-1-(4-hydroxyphenyl)-2-propen-1-one (21b). Brown solid (76.8 mg, 60%), M.P=185-187 C. .sup.1H NMR (MeOD, 700 MHz) : 7.05 (dd, J.sub.1=14.0 Hz, J.sub.2=8.8 Hz, 2H), 7.35 (dd, J.sub.1=12.1 Hz, J.sub.2=9.6 Hz, 1H), 7.43 (d, J=12.6 Hz, 1H), 8.09 (dd, J.sub.1=14.0 Hz, J.sub.2=8.8 Hz, 1H), 8.23 (dd, J.sub.1=13.9 Hz, J.sub.2=8.8 Hz, 1H), 8.35 (dd, J.sub.1=13.8 Hz, J.sub.2=8.8 Hz, 2H), 8.99 (dd, J.sub.1=13.8 Hz, J.sub.2=8.8 Hz, 1H); .sup.13C NMR (MeOD, 175 MHz) :101.8, 111.4, 116.8, 118.1, 119.3, 120.4, 132.0, 132.1, 152.5, 158.3, 166.2, 168.3, 171.9; EI-MS m/z: 238.9 [MH.sub.2O].sup.+; HRMS calculated for C.sub.15H.sub.10O.sub.3 [MH.sub.2O].sup.+238.0638, found 238.0630.

(209) ##STR00233##

(210) (E)-3-(2,4-Dihydroxyphenyl)-1-(4-hydroxyphenyl)-2-propen-1-one (18b) Amorphous red solid (50 mg, 78%), purified by column. M.P=185-188 C. .sup.1H NMR (MeOD, 700 MHz) : 7.11 (d, J=8.8 Hz, 2H), 7.41 (d, J=8.8 Hz, 1H), 7.52 (s, 1H), 8.15 (d, J=8.8 Hz, 1H), 8.32 (d, J=8.6 Hz, 1H), 8.42 (d, J=8.8 Hz, 2H), 9.07 (d, J=8.6 Hz, 2H). .sup.13C NMR (MeOD, 175 MHz) : 101.9, 110.0, 111.7, 116.8, 116.9, 118.2, 119.4, 120.4, 120.5, 132.1, 132.3, 152.6, 152.7, 158.4, 166.2, 168.2, 171.2. EI-MS m/z: 238.9 [MH.sub.2O].sup.+; HRMS calculated for C.sub.15H.sub.10O.sub.3 [MH.sub.2O].sup.+ 238.0637, found 238.0630.

(211) ##STR00234##

(212) (E)-1-(4-methoxyphenyl)-3-(2,4,5-methoxyphenyl)prop-2-en-1-one (17d) Crystallized from MeOH as yellow crystals (246.0 mg, 75%), .sup.1H NMR (CDCl.sub.3, 300 MHz) : 3.83-3.97 (m, 12H), 6.52 (s, 1H), 6.96 (d, J=8.4 Hz, 2H), 7.13 (s, 1H), 7.48 (d, J=15.6 Hz, 1H), 8.00-8.8.12 (m, 3H). .sup.13C NMR (CDCl.sub.3, 175 MHz) :56.6, 56.2, 56.6, 56.8, 97.1, 111.7, 113.9, 115.9, 120.4, 130.8, 131.8, 139.7, 143.5, 152.5, 154.7, 163.2, 189.5. EI-MS m/z: 328.8 [M].sup.+; HRMS calculated for C.sub.19H.sub.20O.sub.5 [M+H].sup.+ 328.1312, found 328.1311.

(213) ##STR00235##

(214) (E)-1-(4-hydroxyphenyl)-3-(2,4,5-trihydroxyphenyl)prop-2-en-1-one (18d) Amorphous red solid (42.8 mg, 63%), purified by column. H NMR (MeOD, 700 MHz) : 7.10 (d, J=8.1, 2H), 7.44 (s, 1H), 7.55 (s, 1H), 8.26 (d, J=7.5 Hz, 1H), 8.35 (d, J=8.3 Hz), 8.92 (d, J=6.8, 1H). .sup.13C NMR (MeOD, 175 MHz) : 102.3, 109.9, 111.6, 120.1, 120.3, 149.5, 150.2, 154.5, 160.8, 165.3, 169.3. EI-MS m/z: 289.9 [M].sup.+; HRMS calculated for C.sub.15H.sub.10O.sub.4 [MH.sub.2O].sup.+ 254.0578, found 254.0579.

(215) ##STR00236##

(216) (E)-1-(2-hydroxyphenyl)-3-(2,4,5-trimethoxyphenyl)prop-2-en-1-one (17c) Crystallized from MeOH as yellow crystals (188.9 mg, 59.1%). H NMR (CDCl.sub.3, 400 MHz) : 3.95 (s, 9H), 6.50 (s, 1H), 6.96 (d, 2H, J=32.9 Hz), 7.10 (s, 1H) 7.39-7.54 (m, 1H), 7.59 (d, 1H, J=11.6 Hz) 7.84-8.00 (m, 1H) 8.20 (d, 1H, J=11.6 Hz) 13.10 (s, 1H); .sup.13C NMR (CDCl.sub.3, 100 MHz) : 56.2, 56.4, 56.7, 96.8, 111.9, 115.3, 117.9, 118.6, 118.8, 120.4, 129.7, 136.0, 141.1, 143.4, 153.2, 155.3, 163.7, 194.2. HRMS calculated for C.sub.8H.sub.18O.sub.5 [M+H].sup.+ 314.1162, found 314.1154.

(217) ##STR00237##

(218) (E/Z)-1-(2-hydroxyphenyl)-3-(2,4,5-trihydroxyphenyl)prop-2-en-1-one (18c) Amorphous brown solid, (33.3 mg, 49%) This compound quickly isomerizes to a mixture of cis and trans isomers when in solution, and thus could not be properly characterized through NMR. EI-MS m/z: 254.8 [MH.sub.2O].sup.+; HRMS calculated for C.sub.15H.sub.12O.sub.5 [M+H].sup.+ 272.0677, found 272.0685.

Example 4: Inhibition of Streptococcus Mutants Biofilms by the Natural Stilbene Piceatannol Through the Inhibition of Glucosyltransferases

(219) Current approaches to eradicate dental biofilms include its mechanical removal and the use of nonspecific broad-spectrum antibiotics (Walsh, T.; Oliveira-Neto, J. M.; Moore, D., Chlorhexidine treatment for the prevention of dental caries in children and adolescents. The Cochrane database of systematic reviews 2015, (4), 8457). The removal of bacterial biofilms through brushing demands frequent repetition because the tooth surfaces are rapidly re-colonized. Similarly, antimicrobial agents in mouthwashes such as chlorhexidine and delmopinol lack selectivity, affecting both pathogenic species and commensal beneficial species, and give rise to undesired side effects such as vomiting, diarrhea, addiction, or teeth discoloration.

(220) Numerous natural products and their derivatives have been investigated for their potential to inhibit cariogenic plaque formation. These include constituents found in cranberry, plant lectins, crude extracts of Morus alba leaves, and components found in barley coffee (Koo, H.; Nino de Guzman, P.; Schobel, B. D.; Vacca Smith, A. V.; Bowen, W. H., Influence of cranberry juice on glucan-mediated processes involved in Streptococcus mutans biofilm development. Caries research 2006, 40 (1), 20-7; Thimothe, J.; Bonsi, I. A.; Padilla-Zakour, O. I.; Koo, H., Chemical characterization of red wine grape (Vitis vinifera and Vitis interspecific hybrids) and pomace phenolic extracts and their biological activity against Streptococcus mutans. Journal of agricultural and food chemistry 2007, 55 (25), 10200-7). Most of the reported studies suggests these agents to be effective against biofilm formation of S. mutans through varying degrees of the regulation of glucosyltransferases Too, H.; Nino de Guzman, P.; Schobel, B. D.; Vacca Smith, A. V.; Bowen, W. H., Influence of cranberry juice on glucan-mediated processes involved in Streptococcus mutans biofilm development. Caries research 2006, 40 (1), 20-7; Duarte, S.; Gregoire, S.; Singh, A. P.; Vorsa, N.; Schaich, K.; Bowen, W. H.; Koo, H., Inhibitory effects of cranberry polyphenols on formation and acidogenicity of Streptococcus mutans biofilms. FEMS Microbiology Letters 2006, 257 (1), 50-56). In addition, several small molecules, including anthraquinones (Pandit, S.; Song, K. Y.; Jeon, J. G., Withania somnifera attenuates acid production, acid tolerance and extracellular polysaccharide formation of Streptococcus mutans biofilms. The American journal of Chinese medicine 2014, 42 (1), 157-71), apigenin (Koo, H.; Rosalen, P. L.; Cury, J. A.; Park, Y. K.; Bowen, W. H., Effects of compounds found in propolis on Streptococcus mutans growth and on glucosyltransferase activity. Antimicrobial agents and chemotherapy 2002, 46 (5), 1302-9; Koo, H.; Hayacibara, M. F.; Schobel, B. D.; Cury, J. A.; Rosalen, P. L.; Park, Y. K.; Vacca-Smith, A. M.; Bowen, W. H., Inhibition of Streptococcus mutans biofilm accumulation and polysaccharide production by apigenin and tt-farnesol. The Journal of antimicrobial chemotherapy 2003, 52 (5), 782-9), tt-farnesol (Koo, H.; Pearson, S. K.; Scott-Anne, K.; Abranches, J.; Cury, J. A.; Rosalen, P. L.; Park, Y. K.; Marquis, R. E.; Bowen, W. H., Effects of apigenin and tt-farnesol on glucosyltransferase activity, biofilm viability and caries development in rats. Oral microbiology and immunology 2002, 17 (6), 337-43; Koo, H.; Schobel, B.; Scott-Anne, K.; Watson, G.; Bowen, W. H.; Cury, J. A.; Rosalen, P. L.; Park, Y. K., Apigenin and tt-farnesol with fluoride effects on S. mutans biofilms and dental caries. Journal of dental research 2005, 84 (11), 1016-20), chitosan (Rajabnia, R.; Ghasempour, M.; Gharekhani, S.; Gholamhoseinnia, S.; Soroorhomayoon, S., Anti-Streptococcus mutans property of a chitosan: Containing resin sealant. Journal of International Society of Preventive & Community Dentistry 2016, 6 (1), 49-53), and 7-epiclusianone (Murata, R. M.; Branco-de-Almeida, L. S.; Franco, E. M.; Yatsuda, R.; dos Santos, M. H.; de Alencar, S. M.; Koo, H.; Rosalen, P. L., Inhibition of Streptococcus mutans biofilm accumulation and development of dental caries in vivo by 7-epiclusianone and fluoride. Biofouling 2010, 26 (7), 865-72; Branco-de-Almeida, L. S.; Murata, R. M.; Franco, E. M.; dos Santos, M. H.; de Alencar, S. M.; Koo, H.; Rosalen, P. L., Effects of 7-epiclusianone on Streptococcus mutans and caries development in rats. Planta medica 2011, 77 (1), 40-5), -Mangostin (Nguyen, P. T.; Falsetta, M. L.; Hwang, G.; Gonzalez-Begne, M.; Koo, H., alpha-Mangostin disrupts the development of Streptococcus mutans biofilms and facilitates its mechanical removal. PLoS One 2014, 9 (10), 111312), myricetin (Falsetta, M. L.; Klein, M. I.; Lemos, J. A.; Silva, B. B.; Agidi, S.; Scott-Anne, K. K.; Koo, H., Novel antibiofilm chemotherapy targets exopolysaccharide synthesis and stress tolerance in Streptococcus mutans to modulate virulence expression in vivo. Antimicrobial agents and chemotherapy 2012, 56 (12), 6201-1; Kim, D.; Hwang, G.; Liu, Y.; Wang, Y.; Singh, A. P.; Vorsa, N.; Koo, H., Cranberry Flavonoids Modulate Cariogenic Properties of Mixed-Species Biofilm through Exopolysaccharides-Matrix Disruption. PLoS One 2015, 10 (12), e0145844), and honokiol (Greenberg, M.; Urnezis, P.; Tian, M., Compressed mints and chewing gum containing magnolia bark extract are effective against bacteria responsible for oral malodor. Journal of agricultural and food chemistry 2007, 55 (23), 9465-9) have been characterized and shown to have antibiofilm activity toward S. mutans. However, the majority of these compounds do not exhibit high selectivity against S. mutans biofilms. Chemical structures of a few of these natural products are given in FIG. 14.

(221) Prior studies have indicated that resveratrol inhibits glycolytic acid production and Gtf activity of S. mutans, when tested using an ethyl acetate fraction from Pediomelum cuspidatum root, which is composed of polydatin, resveratrol, anthraglycoside B, and emodin (Kwon, Y. R.; Son, K. J.; Pandit, S.; Kim, J. E.; Chang, K. W.; Jeon, J. G., Bioactivity-guided separation of anti-acidogenic substances against Streptococcus mutans UA 159 from Polygonum cuspidatum. Oral diseases 2010, 16 (2), 204-9; Pandit, S.; Kim, H. J.; Park, S. H.; Jeon, J. G., Enhancement of fluoride activity against Streptococcus mutans biofilms by a substance separated from Polygonum cuspidatum. Biofouling 2012, 28 (3), 279-87; Yim, N.; Ha do, T.; Trung, T. N.; Kim, J. P.; Lee, S.; Na, M.; Jung, H.; Kim, H. S.; Kim, Y. H.; Bae, K., The antimicrobial activity of compounds from the leaf and stem of Vitis amurensis against two oral pathogens. Bioorganic & medicinal chemistry letters 2010, 20 (3), 1165-8). There are no reports related to stilbene's possible effect on the virulence of dental biofilms.

(222) Ideal therapeutics for dental caries should be able to selectively inhibit pathogenic biofilms caused by Streptococcus mutans. The lead stilbene identified through our docking study against the catalytic domain of GtfC is a natural product known as piceatannol, which inhibited S. mutans biofilm formation in a dose-dependent manner with considerable selectivity over growth inhibition of S. mutans and commensal Streptococci. Binding kinetic analysis of piceatannol was performed using OctetRed against both GtfB and GtfC, which produced low micromolar K.sub.D values. Piceatannol inhibited S. mutans colonization in an in-vivo drosophila model and a rat model of dental caries.

(223) Structure-based virtual screening of natural polyphenols. The 3D crystal structure of GtfC in complex with acarbose has been successfully employed to develop Gtf selective inhibitors (Ito, K.; Ito, S.; Shimamura, T.; Weyand, S.; Kawarasaki, Y.; Misaka, T.; Abe, K.; Kobayashi, T.; Cameron, A. D.; Iwata, S., Crystal Structure of Glucansucrase from the Dental Caries Pathogen Streptococcus mutans. Journal of Molecular Biology 2011, 408 (2), 177-186). We thus performed in-silico docking using FlexX/LeadIT software package, on a database of compounds containing at least one phenolic group against the high resolution X-ray crystal structure of GtfC (PDB code: 3AIC). Top scoring compounds were examined for their binding interactions with key residues such as Glu515, Ala478, Tyr430, Asp959, Leu333, Gln960, Asp477, and Asp588, drug like properties based on Lipinski's rules, and synthetic feasibility.

(224) Inhibition of S. mutans biofilms by natural and synthetic stilbenes. The stilbenes obtained from the National Cancer Institute were first evaluated for their biofilm inhibitory and growth inhibitory activities using previously reported assays (Wen, Z. T.; Burne, R. A., Functional genomics approach to identifying genes required for biofilm development by Streptococcus mutans. Applied and Environmental Microbiology 2002, 68 (3), 1196-203). A range of activities were observed, with several compounds being inactive (compounds 1-3 and 13) and a few demonstrating inhibition of both S. mutans growth and biofilm at the micromolar range. Our studies have demonstrated that the stilbene scaffold alone does not possess a biological effect against S. mutans, as both the E and Z isomers were inactive (compounds 1 and 2). A significant effect is seen with the variation of substituents. Compounds 3 and 4 maintain the regiochemistry of the substituents but differ in their functional groups. While the dihydroxyl stilbene 4 has demonstrated biofilm and growth with IC.sub.50 values of 344 M and 854 M, the diamino analog 3 did not produce any activity in either growth or biofilm. Similarly, compound 5 is a diamidine compound that also has an extra hydroxyl group has demonstrated biofilm and growth with IC.sub.50 values of 104 M and 179 M.

(225) Compounds 6-9 explore the regiochemistry and substituent effect of hydroxylstilbenes. Compound 6 is the least active compound of this class, showing a high micromolar range activity. This compound also does not have any substituents on one of the rings. Compounds 7 and 8 are natural products, resveratrol and piceatannol, respectively. These compounds differ by the inclusion of one extra hydroxyl group. Previous studies have shown resveratrol to inhibit S. mutans biofilm (Kwon, Y. R.; Son, K. J.; Pandit, S.; Kim, J. E.; Chang, K. W.; Jeon, J. G., Bioactivity-guided separation of anti-acidogenic substances against Streptococcus mutans UA 159 from Polygonum cuspidatum. Oral diseases 2010, 16 (2), 204-9; Pandit, S.; Kim, H. J.; Park, S. H.; Jeon, J. G., Enhancement of fluoride activity against Streptococcus mutans biofilms by a substance separated from Polygonum cuspidatum. Biofouling 2012, 28 (3), 279-87; Ban, S. H.; Kwon, Y. R.; Pandit, S.; Lee, Y. S.; Yi, H. K.; Jeon, J. G., Effects of a bio-assay guided fraction from Polygonum cuspidatum root on the viability, acid production and glucosyltranferase of mutans streptococci. Fitoterapia 2010, 81 (1), 30-4). In comparison to that, compound 8 shows a marginally better activity towards S. mutans biofilm with a 52 M IC.sub.50 value and also demonstrates increased (11 fold) selectivity. Compound 9 is a trimethoxy, monohydroxy analog of piceatannol that maintains its regiochemistry. This scaffold demonstrated less biofilm inhibition, increased growth inhibition compared to piceatannol (8), decreasing selectivity, which suggests that the OH groups are important for the selectivity.

(226) Since the glucan synthesis pathway involves the degradation of glycosidic bond in sucrose and the formation of new glucosidic bonds between glucosyl units, we were interested in exploring the effect of attaching a glucose unit to one of the active compounds. Compound 12 is a glucoside analog of piceatannol 8, with the methylation of one of its hydroxyl groups. This compound also shows similar activity when compared to that of compound 9. However, compound 13 is a piceatannol analog that has a glucose substituent that is not attached through a glucosidic bond, and this compound is not active against biofilm and growth. Finally, compounds 10-11 are miscellaneous scaffolds that resemble a stilbene. Of these compounds, compound 11 demonstrated considerable activity against S. mutans biofilm. Overall, piceatannol (8) is the compound identified from this study that demonstrated good activity and selectivity towards S. mutans biofilm inhibition.

(227) Lead compound, piceatannol, inhibited biofilms selectively over growth. A comparison of piceatannol's ability to inhibit S. mutans biofilm with resveratrol, and E-stilbene shows our lead to be the most potent at 200 M (Table 8 and FIG. 15A). Upon further analysis of the compounds' effect on S. mutans growth, we have identified a previously studied resveratrol and a novel agent called piceatannol to demonstrate biofilm inhibitory activity with IC.sub.50 values of 102 M and 52 M respectively, with minimal bactericidal activity. Piceatannol was chosen for further analysis due to its source of existence, simplicity of structure, and ease of synthesis. Piceatannol is found in several natural sources ranging from roots of Norway spruces, seeds of the palm Aiphanes horrida and in Gnetum cleistostachyum. It is also a metabolite of resveratrol, which is found in red wine, grapes, and passion fruit.

(228) TABLE-US-00010 TABLE 8 Biofilm and growth inhibitory activities of stilbenes Biofilm Growth Entry NSC Code Structure IC.sub.50 (M) MIC.sub.50 (M).sup.a Selectivity 1 NA embedded image NI NI NA 2 NA embedded image NI NI NA 3 403525 0embedded image NI NI NA 4 4184 embedded image 344 17 854 58 2.4 5 78326 embedded image 104 7 179 23 1.7 6 43312 embedded image 477 51 546 25 1.1 7 NA embedded image 102.2 4 546.4 15.9 5.3 8 365798 embedded image 52 6 564 37.8 10.8 9 381864 embedded image 122 11 137 6 1.1 10 70861 embedded image 518 85 1724 53 3.3 11 123262 embedded image 104 6 >400 4.0 12 43321 embedded image 106 11 134 11 1.2 13 16952974 0embedded image NI NI NA .sup.aAverage of at least 5 measurements; NI No inhibition; NA Not available.

(229) Docking analysis of piceatannol in the GtfC active site. Our docking model (FIG. 15D) of piceatannol shows several key interactions. This pocket docked by the compound is at the same space occupied by acarbose, a weak inhibitor of GtfC that was co-crystalized with GtfC (Ito, K.; Ito, S.; Shimamura, T.; Weyand, S.; Kawarasaki, Y.; Misaka, T.; Abe, K.; Kobayashi, T.; Cameron, A. D.; Iwata, S., Crystal Structure of Glucansucrase from the Dental Caries Pathogen Streptococcus mutans. Journal of Molecular Biology 2011, 408 (2), 177-186). The best docked structure, visualized by UCSF Chimera molecular modeling system, showed interactions of six amino acids: Asp909, Asp477, Glu515, His587, Asp480, and Trp517. It is already reported in the literature that binding of acarbose to Glu515 compromised the acid/base catalyst function, while interaction with Trp517 blocked the acceptor glycosyl moiety, explaining the inhibitory effects shown by acarbose when bound to GtfC (Ito, K.; Ito, S.; Shimamura, T.; Weyand, S.; Kawarasaki, Y.; Misaka, T.; Abe, K.; Kobayashi, T.; Cameron, A. D.; Iwata, S., Crystal Structure of Glucansucrase from the Dental Caries Pathogen Streptococcus mutans. Journal of Molecular Biology 2011, 408 (2), 177-186). The hydroxyl functional groups interact with Asp477, Asp480, and Glu515, and have interactions with Asp909 and Trp517. The binding free energy of piceatannol predicted by FlexX software was 25 kJ/mol, indicating a stable and strong binding with the protein.

(230) Binding and Inhibition of Gtfs by Piceatannol and Resveratrol. To verify the docking results the Octet system was used to evaluate binding of potent small molecule compounds to GtfB and GtfC. Recombinant His tagged GtfB and GtfC were produced, and the HIS1K Biosensor was employed to capture and quantify His tagged Gtfs for binding kinetic characterization. The kinetics of the binding of piceatannol and resveratrol with GtfB and GtfC were examined and shown in FIGS. 16A-16D. The best binding fits were observed with piceatannol, producing K.sub.D values of 14.6 M (FIG. 16A), and 1.58 M (FIG. 16B) for GtfB and GtfC, respectively. This data is consistent with the zymogram results, as the compound is more active against GtfC when compared to GtfB. Resveratrol was also subjected to the same analysis. Its K.sub.D values are 144 M and 510 M for GtfB and GtfC, respectively (FIGS. 16C and 16D). The piceatannol scaffold is more potent towards GtfB. All four experiments produced reliable R.sup.2 values and fit well in the 1:1 binding mode.

(231) In addition to quantitative analysis, a zymogram assay was performed to evaluate the inhibition of Gtf enzymatic activity qualitatively. Natural products resveratrol and piceatannol were added to the growth media initially to see if they had an effect of glucan production. The results parallel the observations seen in biofilms, as piceatannol greatly reduced glucan production when compared to the DMSO control. Resveratrol showed marginal inhibition. In order to assess a dose dependent effect, a zymogram assay was performed using same amounts of Gtf proteins in each of the lanes resolved on the SDS-PAGE gels and submerged in different concentrations of the lead compound. Our results show that apparent decrease in the bottom band where GtfC produces its glucans, a decrease in the upper band is also observed in which GtfB and GtfD are comigrated, suggesting that the compound inhibits at least two, if not all three Gtfs (FIGS. 16E and 16F). The zymogram assay on resveratrol and E-stilbene paralleled the biofilm inhibition. A higher inhibition was seen with piceatannol in comparison to resveratrol, while the inactive E-stilbene analog in the biofilm assay showed no glucan inhibition. These results suggest that the biofilm inhibition by the potent compound is directly related to the inhibition of glucan production by Gtfs.

(232) Piceatannol did not inhibit the growth of commensal streptococcal species. To evaluate the selectivity of piceatannol, its ability to affect bacterial viability in both biofilm and planktonic cells of S. mutans was examined. The viability of the biofilms and planktonic cells of S. mutans was not significantly impacted by the treatment of piceatannol. Furthermore, piceatannol was used to assess its effect on the growth of other oral commensal species (S. sanguinis and S. gordonii) at concentrations ranging from 50-400 M. At the biofilm IC.sub.50 value of 52 M, less than 10% of growth of S. mutans, S. sanguinis and S. gordonii is inhibited by piceatannol. Piceatannol inhibits S. mutans cell viability by 37% at 400 M, and has reduced toxicity to S. sanguinis and S. gordonii, decreasing cell density by 15-18% (FIG. 17A). Thus, piceatannol exhibits significant selectivity for biofilms.

(233) Piceatannol inhibited S. mutans colonization in vivo. The effect of piceatannol on S. mutans colonization in vivo was first evaluated using a sucrose-dependent drosophila colonization model (Peng, X.; Zhang, Y.; Bai, G.; Zhou, X.; Wu, H., Cyclic di-AMP mediates biofilm formation. Molecular microbiology 2015, 99 (5), 945-959). Briefly, Gfp tagged S. mutans bacteria were used to infect flies along with the treatment of piceatannol at 50 M in a feeding-assay (FIG. 17B). DMSO was used as a negative control (FIG. 17B panel B2) and gtfB mutant, a known biofilm defective strain, was used as a positive control (FIG. 17B panel B3). The intensity of the fluorescence was measured in the guts of the flies fed with the Gfp tagged bacteria after 7 days of infection. A significant decrease in fluorescence was observed when treated by piceatannol (FIG. 17B panel B4), producing an effect similar to that observed in the gtf mutant (FIG. 17B panel B3). This data suggest piceatannol inhibits S. mutans colonization in vivo.

(234) The in vivo efficacy of resveratrol and piceatannol was further evaluated using a rat model of dental caries (Michalek, S. M.; McGhee, J. R.; Navia, J. M., Virulence of Streptococcus mutans: a sensitive method for evaluating cariogenicity in young gnotobiotic rats. Infection and immunity 1975, 12 (1), 69-75; Michalek, S. M.; McGhee, J. R.; Shiota, T.; Devenyns, D., Low sucrose levels promote extensive Streptococcus mutans-induced dental caries. Infection and immunity 1977, 16 (2), 712-4). The treatment of both stilbenes produced a significant reduction in the buccal, sulcal, and proximal surface caries scores of the treated animals, with piceatannol demonstrating a greater reduction (FIG. 18A). While the bacterial colonization appeared to be reduced by the treatment with the tested stilbenes, it was not statistically significant, when compared with the control group treated with water (FIG. 18B). These data suggest that both piceatannol and resveratrol selectively inhibit virulence factors, Gtfs and Gtf-mediated biofilm formation and do not affect the bacterial growth. At the time of sacrifice and the removal of the mandible, there were no obvious differences in the oral tissue (mucosal and gingival tissues) between the treated and non-treated rats. Furthermore, because the treated rats did not lose weight over the course of the study in comparison with the control group, we believe that the natural stilbenes are safe and non-toxic.

(235) Modulation of cariogenic biofilms formed by S. mutans is a viable preventive strategy for the prevention and treatment of dental caries. Considering the selectivity of polyphenols towards inhibiting S. mutans biofilms rather than altering its cell viability, polyphenol scaffolds were explored in an effort to develop selective anti-biofilm agents. Here, the antimicrobial and antibiofilm activities of a small series of stilbenes were investigated against the cariogenic bacterium S. mutans. The identified lead compound, piceatannol exhibited anti-biofilm activity against S. mutans in the low micromolar range with a selectivity index of about 11 through the inhibition of the Gtfs, a key virulence factor of S. mutans. This compound showed marginal inhibition on the growth of S. mutans, S. sanguinus, and S. gordonii at high micromolar concentrations, suggesting its selectivity and non-toxicity. Piceatannol inhibited S. mutans induced cariogenicity in vivo. Thus, this study demonstrated a virulence-selective therapeutic approach.

(236) A co-complex crystal structure of GtfC and acarbose (PDB code: 3AIC) was utilized for the purposes of in silico docking. The active site residues were selected using the a 6.5 parameter of the crystallized ligand, acarbose and residues Asp588 (H-acceptor) and Gln960 (H-donor) were used to generate a pharmacophore. We accessed the ZINC database to obtain a small library of polyphenolic small molecules and docked them using FlexX. Binding energies less than 20 kJ/mol were selected for further investigation such as their drug like properties based on Lipinski's rules, binding interactions with key residues and for synthetic feasibility.

(237) Bacterial strains and culture conditions. THB agar plate, 5% CO.sub.2 in Todd-Hewitt (TH) broth, or in chemically defined biofilm medium supplemented with 1% sucrose were used to grow S. mutans UA159 and various Gtf mutants, S. sanguinis SK36, and S. gordonii DL1 statically at 37 C. Small molecule compounds were obtained from National Cancer Institute (NCI). 10 mM stock solutions were prepared in DMSO and arrayed in a 96-well format for biological screening.

(238) S. mutans biofilm formation and inhibition assays. A well-established protocol to study S. mutans biofilm formation in 96-well flat-bottom polystyrene microtiter plates was used, in triplicate (Mattos-Graner, R. O.; Napimoga, M. H.; Fukushima, K.; Duncan, M. J.; Smith, D. J., Comparative analysis of Gtf isozyme production and diversity in isolates of Streptococcus mutans with different biofilm growth phenotypes. Journal of clinical microbiology 2004, 42 (10), 4586-4592). The stock solutions were made up in 100% DMSO, and final concentration of DMSO used in the assays was 1%. Minimum biofilm inhibitory concentration (MBIC) of compounds was determined by serial dilutions. The most potent of these scaffolds were progressed into further evaluations.

(239) Inhibition of the activity of Gtfs determined by zymographic assays. A previously reported zymographic assay was utilized for the investigation of Gtf enzymatic activity, as described in Example 1. A 1:100 in fresh 5 mL THB with 50 L of selective compounds at a series of concentrations was used to dilute overnight S. mutans UA159 cultures and grown to OD.sub.470 of 1.0. The final concentration of DMSO used in the assays was 1%. After the centrifugation at 4 C., the supernatants were isolated and filtered through a 0.22-m-pore-size filter membrane and dialyzed at 4 C. against 0.02 M sodium phosphate buffer (pH 6.8), with 10 M phenylmethylsulfonyl fluoride (PMSF), followed by a second dialysis against 0.2 mM sodium phosphate containing 10 M PMSF. 4 mL of samples were concentrated to 40 L by 100K Amicon Ultra-4 centrifugal filter (Merck Millipore Ltd.). Next, 10 L of each concentrated culture supernatant was applied to 8% SDS-PAGE in duplicate. One gel was subjected to Coomassie blue dye for protein detection, while the other one was subjected to zymographic assay. The resultant white opaque glucan bands were visualized against a black background.

(240) Cell viability of S. mutans and commensal S. gordonii and S. sanguinis. Cell viability and the small molecules' effect on it were investigated accordingly to previous reports (Liu, C.; Worthington, R. J.; Melander, C.; Wu, H., A new small molecule specifically inhibits the cariogenic bacterium Streptococcus mutans in multispecies biofilms. Antimicrobial agents and chemotherapy 2011, 55 (6), 2679-87). DMSO served as a control group and provided a relative comparison for the number of colony-forming units (CFU) per milliliter for each compound at different concentrations was determined after incubation for 24 h at 37 C. The final concentration of DMSO used in the assays was 1%.

(241) Colonization of Drosophila. Colonization of flies was performed as described. Cultures of Gfp-tagged (green fluorescent protein) S. mutans UA159 grown to middle log phase were spun down and re-suspended in a solution containing 5% sucrose and 50 M of each compound. 100 L of re-suspended cells were aliquoted onto a sterile filter that was placed on the surface of 5 mL of solidified 5% sucrose agar in a plastic vial. Upon the drying of the vials at room temperature for 30 min, the flies were introduced to the vessels. Male Canton S flies (1-3 days old) were treated with antibiotics for 2 days and starved for 3 h before the addition to vials supplied with S. mutans (10-14 flies per vial). Nikon elipse 90i microscope, equipped with an Epi-fluorescence and NIS elements AR imaging system was used to analyze the colonization of flies by Gfp-tagged strains.

(242) Dental caries rat model. Fischer 344 rats used in this study were bred and maintained in trexler isolators. At the age of 20 days, rat pups were removed from isolators and randomly assigned into five groups. Group A consisting of 3 female+3 male rats were treated with resveratrol; Group B consisting of 3 female+3 male rats were treated with piceatannol; Group C consisting of 3 female+3 male rats were treated with water; Group D consisting of 3 female+2 male rats were not treated; Group E consisting of 2 female+3 male rats were not treated nor infected by UA159. Rats were then infected with S. mutans UA159 for three consecutive days and provided a caries-promoting Diet 305, which contains 5% sucrose (TD.80406, diet with 62% corn starch, Harlan Laboratories, Madison, Wis.) and sterile drinking water ad libitum. The rats were then treated with the stilbene, water, or not treated respective of their study group as described above at 100 M twice daily for 4 weeks beginning 10 days post infection. Drinking water was withheld for one hour after each treatment. Rats were weighed at weaning and after 45 days at the termination of the experiment. The animals were euthanized, their mandibles excised for microbiological analysis of plaque samples on MS agar plates and BAP and for scoring of caries by the method of Keyes. All experimental protocols were approved by the University of Alabama at Birmingham Institutional Animal Care and Use Committee and in accordance with the relevant guidelines and regulations.

(243) OctetRed analysis. OctetRed full kinetic binding analysis was performed for Piceatannol and Resveratrol against GtfB and GtfC. GtfC and GtfB were purified. The Octet Red96 system (ForteBio, Menlo Park, Calif.) was used to determine the rate constant, K.sub.D. Phosphate buffer with 2.5% (w/v) DMSO was used as a negative control. The dip-and-read Anti-Penta-HIS (HIS1K) Biosensor containing Penta-His antibody from Qiagen pre-immobilized on a fiber optic biosensor was used to capture the Gtf proteins with high affinity and specificity. 3-fold serial dilution treatment from 200, 66.6, 22.2, 7.4, 2.46 to 0 M was used to study the stilbenes in phosphate buffer. Sensorgrams and the accuracy of the analysis was calculated using the ForteBio OctetRed analysis software (ForteBio, Menlo Park, Calif.).

(244) The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.