FORMULATION OF FISH VACCINE BASED ON LIPIDIC NANOVESICLES, IN PARTICULAR, A PROTEOLIPOSOME OR COCHLEATE, WITH ACTIVITY AGAINST THE SALMONID RICKETTSIAL SYNDROME (SRS)

20200345825 ยท 2020-11-05

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to aquaculture. In particular, it relates to immunisation in fish farming. More particularly, the present invention relates to a vaccine formulation for fish, based on lipid nanovesicles with activity. Even more particularly, the present invention relates to a vaccine formulation for fish, based on lipid nanovesicles, especially a proteoliposome, with activity against salmon rickettsial syndrome (SRS)

    Claims

    1. Formulation of fish vaccine based on lipidic nanovesicles, especially, a proteoliposome or cochleate, with activity against the Salmonid Rickettsial Syndrome (SRS) CHARACTERIZED THAT it comprises proteoliposomes, membranes and cochleates in a weight ratio of 1:1:1, physiological saline solution and an adjuvant selected from the group of Montanide 760 VG, Montanide 763 AVG, Montanide ISA711, Drakeol 6VR.

    2. The formulation of vaccine of claim 1 CHARACTERIZED THAT the quantity of proteoliposome, membrane and cochleates is 20 g expressed as total protein.

    3. The formulation of vaccine of claim 1 CHARACTERIZED THAT the quantity of adjuvant is 60-70 L.

    4. The formulation of vaccine of claim 1 CHARACTERIZED THAT the quantity of sterile physiological saline solution is the sufficient quantity to reach 100 L of total formulation.

    5. Method to prepare a formulation of fish vaccine based on lipidic nanovesicles, especially, a proteoliposome and cochleates, with activity against the Salmonid Rickettsial Syndrome (SRS) CHARACTERIZED THAT it includes: a) to culture P. salmonis, harvest it by centrifugation and store it frozen; b) purify membranes and fragments of cell wall from the frozen sediment of the stage a) by resuspending the frozen sediment in a buffer solution adding pearls of zirconia/silica, to then freeze, thaw by sonication and freeze until complete 7 repetitions of the cycle freeze-thaw-freeze, then to centrifugate reserving supernatant and discarding sediment, and then centrifugate reserving sediment and discarding the supernatant, c) prepare membrane proteoliposomes from the frozen sediment of step b) resuspend the sediment in a membranes solubilisation solution, incubate with agitation, centrifugate and preserve the supernatant, then add non-polar resins able to capture detergent previously resuspended in solution and sterilised, to subsequently incubate with agitation and to add those non-polar resins again to incubate with agitation, leave to settle, preserving the supernatant, d) prepare membranes from the frozen sediment of step b) resuspend the sediment in a physiological solution or physiological saline, incubate with agitation, centrifugate preserving the supernatant, e) prepare membrane cochleates from the frozen sediment of stage b) resuspend the sediment in a solubilisation solution (TLis), incubate with agitation, centrifugate and preserve the supernatant. This supernatant is added by dropping at equal volume of formation solution, then 4 volumes of washing solution are added. Finally, the cochleates are centrifuged, discarding the supernatant and the sediment resuspended in washing solution, and f) the membranes, fragments, membranes proteoliposomes and membrane cochleates obtained in steps c) to e) are mixed with physiological saline, under agitation to an adjuvant and homogenise the mixture, to then optionally store in sealed containers.

    6. The method of claim 1 CHARACTERIZED THAT in the step b) said buffer solution is a sterile lysis buffer solution.

    7. The method of claim 6 CHARACTERIZED THAT said sterile lysis buffer solution includes disodium phosphate, sodium chloride.

    8. The method of claim 1 CHARACTERIZED THAT the ratio of buffer solution (mL) to weight of pearls (g) in the resuspension of stage b) is 25:2 per each gram of sediment obtained.

    9. The method of claim 1 CHARACTERIZED THAT in the step c) the membrane solubilization solution includes Tris-HCl, KCl and sodium deoxycholate.

    10. The method of claim 1 CHARACTERIZED THAT in the step c), each incubation is conducted at 18-25 C.

    11. The method of claim 1 CHARACTERIZED THAT the ratio of supernatant volume (mL) to non-polar resins volume (mL) in the first resuspension of the step c) is 10:1.

    12. The method of claim 1 CHARACTERIZED IN THAT the ratio of supernatant volume (mL) to non-polar resins volume (mL) at the end of the step c) is 10:5.

    13. The method of claim 1 CHARACTERIZED THAT the ratio of physiological solution or physiological saline (mL) to weight of membrane (g) in step d) is 10:1.

    14. The method of claim 1 CHARACTERIZED THAT in the stage f), the ratio of membrane proteoliposomes, membrane and membrane cochleates to physiological saline is 20 g of total protein to 30-40 L of sterile physiological saline.

    15. The method of claim 1 CHARACTERIZED THAT in the step f), the ratio of volume of the mixture of membrane proteoliposome, membrane, membrane cochleates and physiological saline to adjuvants is 30:70 (it could be 40:60).

    16. The method of claim 1 CHARACTERIZED THAT the steps from b) to e) further comprises to verify sterility and concentration of total proteins.

    17. The method of claim 1 CHARACTERIZED THAT in the step f) the adjuvant is Seppic 760 VG.

    18. The method of claim 1 CHARACTERIZED THAT in the step e) the ratio of the mixture proteoliposome, membrane, cochleate and saline to the adjuvant is 3:7 or 4:6.

    19. The method of claim 1 CHARACTERIZED THAT the step f) further comprises to store the formulation of vaccine.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0024] FIGS. 1A and 1B Shows transmission electron microscopy (TEM) of proteoliposomes plus membranes (A) and cochleates along with proteoliposomes and membranes (B), formulated from Piscirickettsia salmonis.

    [0025] FIG. 2 Shows the IgM levels in vaccinated and non-vaccinated animals. The averages and standard deviations obtained in each sampling point of the experiment are shown by means of the indirect ELISA technique, both for the vaccinated and for the control group (Placebo). The * represents the sample with significant difference.

    [0026] FIG. 3 Shows the results of gene expression, obtained by real-time PCR using the comparative method Ct. Gene expression of genes TRB-I, MHC-I, CD8-a, TNF-, MHC-II and INF- was determined as representative genes to measure cellular response. The expression was standardised using the ELF-I gene as control gene. The graph represents the averages and standard deviation obtained from 5 animals analysed from each group.

    [0027] FIGS. 4A-4C. Show the safety of the vaccines at the end of the evaluation period (300 UTA after the second dose). In this case Vaccine 1 corresponds to the one composed of proteoliposomes, membrane and cochleates in an adjuvant of water in polymer emulsion (Montanide ISA 760 VG), and the Vaccine 2 corresponds to the same antigens in an adjuvant of water in oil emulsion (Montanide ISA 763 AVG). FIG. 4A: Comparison of fish weight between groups (without significant differences), FIG. 4B: Speiberg index of the formulations, all the adherences in the vaccinated groups were under grade 2, FIG. 4C: visceral melanosis index for vaccinated groups was 1, no parietal melanosis was recorded in any group. (figures should be provided with Spanish text).

    [0028] FIGS. 5A and 5B. Evaluation of vaccines efficacy. Vaccine 1 (adjuvant Seppic Montanide ISA 760 VG) and vaccine 2 (Adjuvant Seppic Montanide ISA 763 AVG) are able to reduce the percent of mortality, but vaccine 1 is more effective in the protection (Wilcoxon, ** P<0.0001).

    [0029] FIG. 6 Shows an estimation of the relative percent survival at the moment when the control group reaches 60% of mortality (RPS60), for fish challenged by intraperitoneal injection. There are 2 formulations of vaccine using an aqueous adjuvant (vaccine 1 or I as defined in the FIG. 4) and an oil adjuvant (vaccine 2 or II as defined in the FIG. 4). Specifically, the control group reaches 62.8% mortality, vaccine 1 reaches 20.8% mortality and vaccine 2 reaches 35% mortality. The RPS60 of vaccine 1 is 66.9 and for vaccine 2 is 44.3.

    DETAILED DESCRIPTION OF THE INVENTION

    [0030] This invention discloses a formulation of vaccine based on lipidic nanovesicles, specially, proteoliposomes, with immunopotentiator activity against SRS. The composition could be for intraperitoneal injection. The formulation of vaccine generates specific cellular immunity in fish.

    [0031] In particular, the measurements include the levels of antibodies (IgM) and the gene expression of TRB-I, MHC-I, CD8-, TNF-, MHC-II and INF- by ELISA, the safety of the vaccine and its efficacy and survival percent after the challenge.

    [0032] The vaccine includes liposomes, bacterial membranes and fragments of cell wall of P. salmonis which have been purified from a culture previously prepared from this bacteria that then is centrifuged to obtain a sediment which is subsequently subjected to stages of freezing and thawing by sonication, in repeated steps.

    [0033] In the purification stage, the frozen sediment of the microorganism is thawed and resuspended in a buffer solution adding also pearls of Zirconia/Silica 0.1 mm preferable BioSpec to then be subject to repeated freezing and thawing by sonication until reach 7 thawings by sonication, to be later centrifuged, the sediment is discarded and the supernatant is preserved to be again centrifuged, preferable vigorous centrifugation, discarding this time the supernatant and preserving the sediment.

    [0034] In the procedure of this invention, first the membrane liposomes are prepared by resuspending the sediment of the bacterial culture at pH 7.4, in a sterile solution for its solubilisation, where the sterile solution includes preferable Tris-HCl, KCl and Sodium Deoxycholate. Then, the resulting solution is incubated overnight under agitation and then it is centrifugated. The supernatant is recovered, and non-polar resins capable of capturing the detergent are added, preferable Bio-Beads. Previously, the resins have been resuspended in a solution of Tris-HCl and KCl at pH 7.4 and sterilised by autoclave. The supernatant with the non-polar resins are incubated under agitation, the non-polar resins are decanted, and the supernatant is extracted and transferred to a sterile tube.

    [0035] Regarding the membrane, this is prepared by resuspending the sediment of the bacterial culture in saline solution/physiological saline, then it is incubated with agitation and centrifugated to preserve the supernatant.

    [0036] The formulation of vaccine is prepared by mixing the membrane liposomes and the membranes so that the quantity of antigen for the required dose considers 10 g of total protein present in the membrane liposomes and 10 g of total protein present in the membrane plus sterile saline to complete 30 L per dose. Then, the antigen diluted in physiological saline is added to the adjuvant, gently agitating under sterile conditions. The mixture is homogenized and then stored in sealed containers to be refrigerated until its use.

    [0037] The following are specific examples of preparation and testing, without limiting the scope of the invention.

    [0038] The vaccine tested in rainbow trout (Oncorhynchus mykiss) challenged with P. salmonis and healthy non-immunised, showed to have a good relative percent survival at the end of the study (RPS) and a good relative percent survival when the control group reaches 60% of mortality (RPS60).

    Example 1: Preparation of Proteoliposomes, Bacterial Membranes and Cochleates

    [0039] Growth of P. salmonis:

    [0040] The strain of P. salmonis grew in flasks with agitation in a commercial liquid medium Grace's (Gibco), L-15 (Hyclone) or SFX-insect (Hyclone trademark).

    [0041] The growth was made for 14 days, with a temperature of 18 C. and constant agitation. After the growing time, the bacteria were harvested by centrifugation, storing the sediment at 80 C.

    [0042] Purification of Membranes and fragments of cell wall:

    [0043] The purification of the membranes was made using the following stages: [0044] a) The frozen sediment of the microorganism was thawed. [0045] b) It was resuspended in 25 mL of sterile lysis buffer solution (Disodium Phosphate, Sodium Chloride; sterilised by filtration), 2 grams of pearls of Zirconia/Silica 0.1 mm (BioSpec) were added for each gram of sediment obtained. [0046] c) Then it was frozen at 80 C. [0047] d) It was thawed by sonication at 400 W with Hielscher Ultrasonic Processor UP400S sonicator. [0048] c) Then, it was frozen again. [0049] f) The steps from d) and e) were repeated, to complete several repetitions, preferable 7 steps of sonication. [0050] g) It was centrifugated at 200 g for 5 minutes, reserving the supernatant and discarding the sediment. [0051] h) The supernatant was centrifuged again, but now at maximum power reserving the sediment (pellet of membranes) and discarding the supernatant.

    [0052] Preparation of Membranes Proteoliposomes:

    [0053] The preparation was performed following these steps: [0054] a) The sediment was resuspended in solubilisation of membranes solution (Tris-HCl, KCl and Sodium Deoxycholate at pH 7.4 previously filtered). [0055] b) It was incubated with agitation of 100 rpm at 18-25 C. overnight. [0056] c) It was centrifuged at 500 g for 5 minutes and the supernatant was transferred to a new container. [0057] d) For each 10 mL of supernatant obtained, 1 mL of non-polar resins capable to capture the detergent were added (specifically Bio-Beads (BioRad, catalogue number 152-3920)), previously resuspended in solution Tris-HCl and KCl pH 7.4; and sterilised by autoclave. [0058] e) It was incubated for 90 minutes at 18-25 C. with agitation of 100 rpm. [0059] f) Sterile Bio-Beads were added again in a proportion of 5 mL effective of Bio-Beads per each 10 mL obtained in the point c). [0060] g) It was incubated for 90 minutes at 18-25 C. with agitation of 100 rpm. [0061] h) Bio-Beads were left for decantation and the supernatant was extracted with syringe and transferred to a sterile tube.

    [0062] Preparation of the Membrane:

    [0063] The preparation was performed following these steps: [0064] a) The sediment was resuspended in physiological saline solution in proportion 10 mL of physiological saline per each gram of membrane. [0065] b) It was incubated at 25 C. with agitation of 200 rpm for 72 hours. [0066] c) It was centrifugated at 500 g for 5 minutes and the supernatant was transferred to a new container.

    [0067] Preparation of Membrane Cochleates: [0068] a) The membrane sediment was solubilised with TLis in proportion of 2 mL of TLis per each gram of sediment. [0069] b) These solubilised membranes were incubated at 18 C. with agitation of 150 rpm for a total of 20 hours. [0070] c) The solubilisation was centrifuged at 500 g for 5 minutes and 20 C. [0071] d) The volume of the supernatant was measured by transferring it to a new tube. [0072] e) The solubilised membrane was added by a constant dripping with a flow of 0.5 mL/min to a sterile beaker with 1 volume of formation solution with constant agitation with a magneto. [0073] f) After the dripping, the agitation continued for 30 extra minutes. [0074] g) The cochleates solution was transferred to a sterile bottle and 4 volumes of drip washing solution were added. [0075] h) After the dripping, the agitation continued for 30 extra minutes. [0076] i) The complete solution was centrifugated at 2000 g for 30 minutes at 20 C. [0077] j) The supernatant was discarded, and the sediment resuspended in 0.5 volumes of washing solution.

    [0078] Preparation and Bottling of the Vaccine:

    [0079] The preparation was performed following these steps: [0080] a) The quantity of antigen for the required doses was calculated considering 20 g of total protein of equal parts of membrane, proteoliposomes and cochleates per each dose, 30-40 L were completed with sterile saline. [0081] b) The necessary quantity of adjuvant was placed in a beaker with bane rod considering 60-70 L per dose (100 L total) and agitated at 1000 rpm for 10 seconds, under sterile conditions. [0082] c) The quantity of antigen needed diluted in sterile physiological saline from the point a) was added to the adjuvant, without stopping the agitation. [0083] d) It was agitated slowly at 1000 rpm for 10 seconds and then at maximum power of 2121 g for 15 minutes making sure that all the mixture is homogenized. [0084] e) Then it was filled in flasks of polypropylene of high density. [0085] f) The flasks were sealed with rubber stoppers and stored in refrigeration until the release from quality control.

    Example 2

    [0086] Growth of Piscirickettsia salmonis Strain LF89

    [0087] The strain of P. salmonis grew in flasks with agitation in a commercial liquid medium Grace's (Gibco), L-15 (Hyclone) or SFX-insect (Hyclone trademark).

    [0088] The growth was made for 14 days, with a temperature of 18 C. and constant agitation. After the growing period, the bacteria were harvested by centrifugation, storing the sediment at 80 C.

    [0089] Bacterial Harvest

    [0090] Once the growing period was completed, bacteria were harvested by centrifugation at 3.500 g during 20 minutes at 4 C. The bacterial sediment obtained is stored at 80 C. until its use.

    [0091] Purification of Membranes and Fragments of Cell Wall:

    [0092] The purification of the membranes was made using the following steps: [0093] i) The frozen sediment of the microorganism was thawed. [0094] j) It was resuspended in 25 mL of sterile lysis buffer solution (Disodium Phosphate, Sodium Chloride; sterilised by filtration), 2 grams of pearls of Zirconia/Silica 0.1 mm (BioSpec) were added for each gram of sediment obtained. [0095] k) Then it was frozen at 80 C. [0096] l) It was thawed by sonication at 400 W with Hielscher Ultrasonic Processor UP400S sonicator. [0097] m) Then it was frozen again. [0098] n) The steps from d) and e) were repeated, to complete several repetitions, preferable 7 steps of sonication. [0099] o) It was centrfugated at 200 g for 5 minutes, reserving the supernatant and discarding the sediment. [0100] p) The supernatant was centrifuged again, but now at maximum power reserving the sediment (pellet of membranes) and discarding the supernatant.

    [0101] Preparation of the Membrane Proteoliposomes:

    [0102] The preparation was performed following these steps: [0103] i) The sediment was resuspended in solubilisation of membranes solution (Tris-HCl, KCl and Sodium Deoxycholate at pH 7.4 previously filtered). [0104] j) It was incubated with agitation of 100 rpm at 18-25 C. overnight. [0105] k) It was centrifuged at 500 g for 5 minutes and the supernatant was transferred to a new container. [0106] l) For each 10 mL of supernatant obtained, 1 mL of non-polar resins capable to capture the detergent were added (specifically Bio-Beads (BioRad, catalogue number 152-3920)), previously resuspended in solution Tris-HCl and KCl pH 7.4; and sterilised by autoclave. [0107] m) It was incubated for 90 minutes at 18-25 C. with agitation of 100 rpm. [0108] n) Sterile Bio-Beads were added again in a proportion of 5 mL effective of Bio-Beads per each 10 mL obtained in the point c). [0109] o) It was incubated for 90 minutes at 18-25 C. with agitation of 100 rpm. [0110] p) Bio-Beads were left for decantation and the supernatant was extracted with syringe and transferred to a sterile tube.

    [0111] Preparation of the Membrane:

    [0112] For the preparation of membrane, the following these steps were performed: [0113] k) The sediment was resuspended in physiological saline solution in proportion 10 mL of physiological saline per each gram of membrane. [0114] l) It was incubated at 25 C. with agitation of 200 rpm for 72 horas. [0115] m) It was centrifugated at 500 g for 5 minutes and the supernatant was transferred to a new container.

    [0116] Preparation of Membrane Cochleates: [0117] n) The membrane sediment was solubilised with TUs in proportion of 2 mL of TLis per each gram of sediment. [0118] o) These solubilised membranes were incubated at 18 C. with agitation of 150 rpm for a total of 20 hours. [0119] p) The solubilisation was centrifuged at 500 g for 5 minutes and 20 C. [0120] q) The volume of the supernatant was measured by transferring it to a new tube. [0121] r) The solubilised membrane was added by a constant dripping with a flow of 0.5 mL/min to a sterile beaker with 1 volume of formation solution with constant agitation with a magneto. [0122] s) After the dripping, the agitation continued for 30 extra minutes. [0123] t) The cochleates solution was transferred to a sterile bottle and 4 volumes of drip washing solution were added. [0124] u) After the dripping, the agitation continued for 30 extra minutes. [0125] v) The complete solution was centrifugated at 2000 g for 30 minutes at 20 C. [0126] w) The supernatant was discarded, and the sediment resuspended in 0.5 volumes of washing solution.

    [0127] Preparation and Bottling of the Vaccine:

    [0128] For the preparation of membrane, the following these steps were performed: [0129] g) The quantity of antigen for the required doses was calculated considering 20 g of total protein of equal parts of membrane, proteoliposomes and cochleates per each dose, 30-40 L were completed with sterile saline. [0130] h) The necessary quantity of adjuvant was placed in a beaker with bane rod considering 60-70 L per dose (100 L total) and agitated at 1000 rpm for 10 seconds, under sterile conditions. [0131] i) The quantity of antigen needed diluted in sterile physiological saline from the point a) was added to the adjuvant, without stopping the agitation. [0132] j) This is agitated slowly at 1000 rpm for 10 seconds and then at maximum power of 2121 g for 15 minutes making sure that all the mixture is homogenized. [0133] k) Then was filled in flasks of polypropylene of high density. [0134] l) The flasks were sealed with rubber stoppers and stored in refrigeration until the release from quality control.

    Example 3: Experimental Design and Samples

    [0135] Rainbow trout (Oncorhynchus mykiss) clinically healthy and with an average weight of 40 g were maintained in a tank, with a recirculation system of fresh water and acclimatised in a controlled environment (Temperature 10 to 12 C., oxygen saturation 100-105%) during 2 weeks in 3 tanks with 400 fish each one (1000 L tanks with a density of 9 kg/m.sup.3). After the acclimatisation period, fish of every tank were vaccinated intraperitonially (0.1 mL): Tank 1: vaccine 1 as defined for FIG. 4, tank 2: vaccine 2 as defined for FIG. 4 and tank 3: control (saline solution), 300 thermal units (UTA) after the vaccination fish received a second dose.

    [0136] 300 UTA after the second dose 120 fish (40 per group) were transferred to common tanks of 720 L with a density of 27 kg/m.sup.3. This experimental design was also performed in triplicate.

    [0137] All groups were challenged by intraperitoneal injection with 0.1 mL of Piscirickettsia salmonis (10.sup.4 TCID.sub.50/fish). The mortality was recorded daily until day 30 post challenge and confirmed by real time PCR assays. Serum, kidneys, and spleen were sampled from 3 fish of each group at different times (T1 pre-vaccination, T2 post-vaccination, T3 post-revaccination, T4 post-challenge) for the evaluation of antibodies increase and genes expression related with cellular response.

    [0138] Evaluation of Immunological Response

    [0139] Antibody Response to the Vaccine

    [0140] Plates of 96 wells (Nunc Maxisorp, Roskilde, Denmark) were activated with 2 g of P. salmonis. The plates were blocked with 1% BSA and then incubated with the serums in a dilution 1:50 at 4 C. Later, they were incubated with the monoclonal secondary antibody of mice anti-salmon (dilution 1:500) IgM isotype IgG1 (BiosChile, IGSA, Chile) for 1 hour. Serums of fish experimentally infected with P. salmonis and from healthy individuals non-immunised were used as positive and negative control, respectively.

    [0141] b.Cellular Response to the Vaccine

    [0142] RNA was extracted from samples of anterior kidney and spleen, using Trizol (Thermo Fisher Scientific). For the reverse transcription, 1 g de RNA was used, according to the manufacturer's instructions (ImProm-II, Reverse Transcription, Promega).

    [0143] The reaction of real-time PCR was performed in a thermocycler in One Step Real Time PCR system (Applied Biosystems, USA). The starters and conditions used were according to the described by Brietzke et al., 2015 (1). The presence and increase of transcribed for the locus beta of the recipient of T cells (TRB-1), the major histocompatibility complex I and II (MHC-I, MHC-II), the cluster of differentiation 8.sup.a (CD8-a), the factor of tumour necrosis alpha (TNF-), Interferon gamma (IFN-) and the elongation factor 1 alpha (ELF 1-) as reference gene were evaluated. The relative expression of the mRNA was calculated using the method of CT adjusting the efficiency of the starters.

    TABLE-US-00001 TABLE1 Startersusedtoevaluatetheimmuneresponse Gen Forwardprimer5a3 Reverseprimer5to3 GeneBankno. ELF1-a ACCCTCCTCTTGGTCGTTTC TGATGACACCAACAGCAACA AF498320 IFN AAGGGCTGTGATGTGTTTCTG TGTACTGAGCGGCATTACTCC NM_001124620 TNF GGGGACAAACTGTGGACTGA GAAGTTCTTGCCCTGCTCTG AJ277604 CD8 ACACCAATGACCACAACCATAGAG GGGTCCACCTTTCCCACTTT AF178054 MHCII TGCCATGCTGATGTGCAG GTCCCTCAGCCAGGTCACT AF115533 MHCI TCCCTCCCTCAGTGTCT GGGTAGAAACCTGTAGCGTG AY523661 TRB-1 GTCTTCTGGCAAGTCAACAATGT GTAAAAGCTGACAATGCAGGTGA EU072699

    [0144] Tables 2 and 3. Efficacy of the protection of the vaccine against a challenge with P. salmonis by intraperitoneal route

    TABLE-US-00002 TABLE 2 Relative percent survival at the end of the study (RPS). Cummulative Death mortality Survival Group Tank Tank no numbers Mortality % % group numbers Survival % RPS/Tank RPS mean Control 1 39 31 79.5 83.8 8 20.5 2 39 31 79 8 20.5 3 40 37 93 3 7.5 Vaccine 1 1 40 20 50 51.7 20 50.0 37.1 38.2 2 40 20 50 20 50.0 37.1 3 40 22 55 18 45.0 40.5 Vaccine 2 1 40 30 75 72.5 10 25.0 5.8 12.8 2 40 30 75 10 25.0 8.5 3 40 27 68 13 32.5 27.0

    TABLE-US-00003 TABLE 3 Relative percent survival when the control group reaches 60% of mortality (RPS60). RPS 60 Group No Total Mortality No % Mortality Survival No Survival % Mean RPS Control 118 74 62.8 44 37.3 Vaccine 1 120 25 20.8 95 79.2 66.9 Vaccine 2 120 42 35.0 78 65.0 44.3

    [0145] When analysing the efficacy of the treatments, the percent of mortality at final time are the following: Control: 83.8%, Vaccine 1: 51.7%, Vaccine 2: 72.5% (Table 2), achieving significant differences for Vaccine 1 and 2, in relation to the control (Comparison of survival curves: Log-rank). The RPS obtained at final time were the following: Vaccine 1: 38.2%, Vaccine 2: 12.8% (Table 2).

    [0146] Additionally, the survival percent and mortality analysis at RPS60 per treatment were evaluated. The percent of mortality obtained were the following: Control: 62.8%, Vaccine 1: 20.8%, Vaccine 2: 35% and the estimated RPS60 obtained (average per tank) were: Vaccine 1: 63.7% Vaccine 2: 43.2% (Table 3). When calculating the final RPS60 per treatment the following values are obtained: Vaccine 1: 66.9%, Vaccine 2: 44.3% (Table 4).

    [0147] The results obtained indicate that the formulations are effective in the protection of vaccinated fish against the salmonid rickettsial syndrome, describing survivals close to 80% (79.2%) in challenges conducted in controlled conditions.