METHOD AND BIOMARKER FOR DETECTION OR DIAGNOSIS OF MYOCARDIAL INFARCTION
20230042448 · 2023-02-09
Inventors
Cpc classification
C12Q1/6883
CHEMISTRY; METALLURGY
C12Q2600/112
CHEMISTRY; METALLURGY
International classification
Abstract
The disclosure provides a method for or the early diagnosis, prognosis and differentiation of myocardial infarction (MI). The method comprises performing genetic analysis on gut microbiota. The disclosure also provides a biomarker and kit for the early diagnosis, prognosis, recurrence and differentiation of MI.
Claims
1. A method for early detecting or diagnosing the likelihood of myocardial infarction (MI), predicting prognosis or treatment outcome, and/or differentiating MI in a subject, wherein the method comprises: obtaining a sample comprising gut microbiota of the subject; performing genetic analysis on the gut microbiota; and determining the likelihood of MI as an indicator of detection or diagnosis of MI or prediction of prognosis or treatment outcome of MI if: (i) decreased abundance of gut microbial genera Bacteroidetes, and/or Bifidobacterium; (ii) increased abundance of gut microbial genera Streptococcus, Clostridium and/or Butyricimonas; (iii) increased abundance ratio of gut microbial genera Firmicutes/Bacteroidetes; and/or (iv) increased complexity and diversity of gut microbial genera; in the sample is found when compared to a normal control.
2. The method according to claim 1, wherein the sample comprises a tissue of the gut or a fecal sample.
3. The method according to claim 1, wherein the method further comprises analyzing 16S rRNA of the metagenome of the gut microbiota.
4. The method according to claim 1, wherein the determination of (i) comprises determining the abundance of the gut microbial bacteria Bifidobacterium adolescentis and/or Bifidobacterium ruminantium.
5. The method according to claim 1, wherein the determination of (ii) comprises determining the abundance of the gut microbial bacteria Butyricimonas virosa, Clostridium asparagiforme, Streptococcus parasanguinis and/or Streptococcus salivarius.
6. The method according to claim 1, wherein the determination of (i), (ii), (iii) and/or (iv) comprises analyzing V3-V4 region of the 16S rRNA of the metagenome of the gut microbiota.
7. The method according to claim 1, wherein the determination of (i), (ii), (iii) and/or (iv) comprises performing next generation sequencing of 16S rRNA of the metagenome of the gut microbiota.
8. The method according to claim 1, wherein the determination of (i), (ii), (iii) and/or (iv) comprises performing next generation sequenceing of 16S rRNA of the metagenome of the gut microbiota, shotgun metagenomic sequencing the gut microbiota, linear discriminant analysis (LDA) on the gut microbiota, or effect size (LEfSe) analysis on the gut microbiota.
9. The method according to claim 1, wherein the determination of (iv) comprises performing alpha or beta diversity calculating for determining the complexity and diversity of the gut microbiota.
10. The method according to claim 1, wherein the normal control is obtained by: obtaining a group of control samples comprising gut microbiota of a group of normal subjects; and performing genetic analysis on the gut microbiota of the group of normal subjects, wherein the genetic analysis on the gut microbiota of the group of normal subjects is the same as that of the subject.
11. The method according to claim 1, wherein the MI is ST-elevation myocardial infarction (STEMI).
12. A biomarker for the early diagnosis, prognosis and differentiation of myocardial infarction in a subject, wherein the biomarker is selected from one or more gut microbial genera Bacteroidetes, Bifidobacterium, Streptococcus, Clostridium, Butyricimonas, Firmicutes and Bacteroidetes.
13. The biomarker according to claim 12, which is selected from the group consisting of: a combination of gut microbial genera Bacteroidetes, and/or Bifidobacterium; a combination of gut microbial genera Streptococcus, Clostridium and/or Butyricimonas; and a combination of gut microbial genera Firmicutes and Bacteroidetes.
14. A kit for the early diagnosis, prognosis, recurrence and differentiation of myocardial infarction in a subject, wherein the kit comprises a detecting molecule for detecting the biomarker according to claim 12.
15. The kit according to claim 14, wherein the detecting molecule is for analyzing 16S rRNA of the metagenome of the gut microbiota.
16. The kit according to claim 14, wherein the kit further comprises a group of control samples comprising gut microbiota of a group of normal subjects.
17. A method for treating and/or ameliorating myocardial infarction in a subject, wherein the method comprises colonizing Bifidobacterium adolescentis, Butyricimonas virosa and/or Streptococcus parasanguinis in the gut of the subject.
18. The method according to claim 17, which further comprises colonizing a butyrate-producing bacterium in the gut.
19. The method according to claim 18, wherein the butyrate-producing bacterium is selected from the group consisting of Anaerotruncus colihominis, Bacteroides caccae, Bacteroides thetaiotaomicron, Clostridium symbiosum, Collinsella aerofaciens, Coprococcus comes, Providencia stuartii and Ruminococcus torques.
20. The method according to claim 17, wherein the method is for improving cardiac function, improving preservation of cardiac mechanical properties, and/or decreasing average infarct size.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
DETAILED DESCRIPTION OF THE INVENTION
[0073] The present invention can be more readily understood by reference to the following detailed description of various embodiments of the invention, the examples, and the chemical drawings and tables with their relevant descriptions. It is to be understood that unless otherwise specifically indicated by the claims, the invention is not limited to specific preparation methods, carriers or formulations, or to particular modes of formulating the compounds of the invention into products or compositions intended for topical, oral or parenteral administration, because as one of ordinary skill in the relevant arts is well aware, such things can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0074] As utilized in accordance with the present disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meaning:
[0075] As used herein, the use of “or” means “and/or” unless stated otherwise. In the context of a multiple dependent claim, the use of “or” refers back to more than one preceding independent or dependent claim in the alternative only.
[0076] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular.
[0077] The term “diagnosis” as used herein refers to methods by which the skilled artisan can estimate and/or determine the probability (“a likelihood”) of whether or not a patient is suffering from a given disease or condition. In the case of the present disclosure, “diagnosis” includes using the results of an assay, most preferably a biomarker of the present disclosure, optionally together with other clinical characteristics, to arrive at a diagnosis (that is, the occurrence or nonoccurrence) of MI for the subject from which a sample was obtained and assayed. That such a diagnosis is “determined” is not meant to imply that the diagnosis is 100% accurate. Many biomarkers are indicative of multiple conditions. The skilled clinician does not use biomarker results in an informational vacuum, but rather uses test results together with other clinical indicia to arrive at a diagnosis. Thus, a measured biomarker level on one side of a predetermined diagnostic threshold indicates a greater likelihood of the occurrence of disease in the subject relative to a measured level on the other side of the predetermined diagnostic threshold.
[0078] The term “early diagnosis” is used herein denotes the screening or testing of individuals to identify a condition before symptoms of the disease or condition appear, for example in healthy individuals, or before the condition is diagnosed or able to be diagnosed using current diagnostic methods.
[0079] Similarly, a prognostic risk signals a probability (“a likelihood”) that a given course or outcome will occur. A level or a change in the level of a prognostic indicator, which in turn is associated with an increased probability of morbidity (e.g., worsening renal function, future ARF, or death) is referred to as being “indicative of an increased likelihood” of an adverse outcome in a patient.
[0080] The term “subject” as used herein denotes any animal, preferably a mammal, and more preferably a human. Examples of subjects include humans, non-human primates, rodents, guinea pigs, rabbits, sheep, pigs, goats, cows, horses, dogs and cats. According to an embodiment of the present disclosure, the subject is suspected of having MI.
[0081] As used herein, the term “sample” refers to a sample obtained from a human or animal subject, preferably, of which metagenomics of gut microorganisms is to be detected. In some embodiments of the disclosure, the sample comprises a tissue of the gut.
[0082] As used herein, the term “gut microbiota” refers to the collection of bacteria, yeast, fungi, viruses, protozoans, and the like colonizing the GI tract.
[0083] As used herein, the term “genetic analysis” is the analysis of a collection of genetic material (genomes) from a mixed community of organisms.
[0084] The phrase “increased complexity” when used herein means increase of the complexity based on taxonomic classification of the gut microbial genera in the gut microbiota of the sample, and/or increased complexity based on the proportional number of gut microbial genera by classification in the gut microbiota of the sample, which may be generally calculated from the amount of 16S rRNA with sequences specific to a particular genus, species, or strain normalized against the total number of sequences in the sample.
[0085] As used herein, the term “abundance” refers to the relative representation of a species in a particular ecosystem. It is usually measured as the number or level of individuals.
[0086] As used herein, the term “diversity” refers to the variability among the gut microbiota and the ecological complexes of which they are part; this includes diversity within species, between species and of ecosystems.
[0087] As used herein, the term “normal control” refers to the profile of gut microbiota of a control population wherein members do not have MI.
[0088] The terms “treatment,” “treating,” and “treat” generally refer to obtaining a desired pharmacological and/or physiological effect. The effect may be preventive in terms of completely or partially preventing a disease, disorder, or symptom thereof, and may be therapeutic in terms of a partial or complete cure for a disease, disorder, and/or symptoms attributed thereto. “Treatment” used herein covers any treatment of a disease in a mammal, preferably a human, and includes (1) suppressing development of a disease, disorder, or symptom thereof in a subject or (2) relieving or ameliorating the disease, disorder, or symptom thereof in a subject.
[0089] As used herein, the term “colonization” refers to the colonization of an environment, e.g., the gut, intestine or colon, by a microbe, e.g., a bacterium, such that the viable population of that microbe continues over time. A stably colonizing population will generally remain substantially static once colonization is complete, e.g., logarithmically transformed colony forming units associated with the gut will remain in the same quartile after the initial period of colonization when followed within the lifespan of the gut epithelial cells.
[0090] An astounding number and diversity of microbes are present at any given moment throughout our bodies. Through co-evolution, these microbes and their animal hosts have developed a mutualistic relationship in which their biological interaction has become essential for survival. Recent studies have shown that gut microbiota can influence the composition, migration and function of various immune cell subpopulations. With different members of the gut microbiota capable of affecting host immune homeostasis in different ways, the heterogeneity of this community may be the basis of individual differences in host immune response (Thaiss C A et al., Nature. 2016; 535:65-74; Honda K and Littman D R. Nature. 2016; 535:75-84).
[0091] As an important immune modulator, gut microbiota may have an impact on the efficiency of repair after MI. A recent study has shown strong evidence that gut microbiota play an essential role in effective cardiac repair, and that this may be through the production of specific SCFAs that can modulate the immune system and therefore the inflammatory microenvironment after MI (Tang T W H, et al., Circulation. 2019; 139:647-659). Given the integral role of the immune system during wound repair, gut microbiota have been implicated in the repair of a variety of tissues such as the gastrointestinal tract (Maloy K J and Powrie F. Nature. 2011; 474:298-306) and liver (Cornell R P et al., Hepatology. 1990; 11:916-22), as well as surfaces exposed to the external environment such as skin (Zhang M et al., Microb Ecol. 2015; 69:415-21). Interestingly, recent reports have highlighted a relationship between gut microbiota and severity of myocardial infarction, which remains the leading cause of mortality across all industrialized nations with 1 million Americans estimated to suffer a new or recurrent MI each year (Benjamin E J et al., Circulation. 2017;135:e146-e603). ST-elevation myocardial infarction (STEMI) is a cause of the acute myocardial infarction (AMI), and the recurrence rate and death risk of STEMI remain high (Yeh R W et al., N Engl J Med. 2010; 362:2155-65; Bradley S M et al., JAMA Netw Open. 2019;2:e187348). However, the exact role that gut microbiota play and the mechanisms behind their involvement in effective endogenous cardiac repair after MI remain unclear and have yet to be discovered.
[0092] Accordingly, the present disclosure provides methods for the detecting or diagnosing likelihood of myocardial infarction (MI), predicting prognosis or treatment outcome and/or differentiating MI in a subject by determining the abundance of the gut microbial genera as an indicator for the detection, diagnosis and prediction. Moreover, these gut microbial genera can be used as biomarkers of detection, diagnosis and prediction of MI.
[0093] Next-generation sequencing (NGS), such as metagenomics and metatranscriptomics, is well suited for examining the microbiota composition and predicting potential functions. This information, therefore, does not provide data on changes in the function of the microbiota, which are needed to understand how the alterations in composition impact function and if it is impacted in a physiologically meaningful way.
[0094] In another embodiments of the disclosure, the genetic analysis may involve shotgun sequencing. Shotgun sequencing is a laboratory technique for determining the sequence of a metagenome. The method involves breaking the genome into a collection of small fragments that are sequenced individually. In some embodiments, the genetic analysis may involve 16S-based sequencing. In some embodiments, the method comprises analyzing 16S rRNA of the metagenome of the gut microbiota; preferably, the method comprises analyzing V3-V4 region of the 16S rRNA of the metagenome of the gut microbiota. In one preferred embodiment of the disclosure, the method comprises performing next generation sequencing of 16S rRNA of the metagenome of the gut microbiota.
[0095] In one embodiment of the disclosure, the method comprises performing linear discriminant analysis (LDA) on the gut microbiota.
[0096] In one embodiment of the disclosure, the method comprises performing effect size (LEfSe) analysis on the gut microbiota.
[0097] According to an embodiment of the present disclosure, examples of the sample include, but are not limited to, a rectal swab sample, a fecal sample, or a urine sample from a human or an animal. The sample may also include environmental samples from which a nucleic acid of a gut microorganism may be detected, for example, samples collected from toilet bowls, towels, toilet paper, and the like, with which a human or an animal has come into contact.
[0098] In one embodiment of the disclosure, the indicator of detection or diagnosis of MI (preferably STEMI) or prediction of prognosis or treatment outcome of MI (preferably STEMI) according to the disclosure includes: (i) a decrease of abundance of gut microbial genera Bacteroidetes, and/or Bifidobacterium in gut microbiota of the subject when compared to a normal control. Accordingly, the method comprises determining the abundance of the gut microbial genera Bacteroidetes, and/or Bifidobacterium. Examples of gut microbial genera Bifidobacterium include, but are not limited to, Bifidobacterium adolescentis and Bifidobacterium ruminantium.
[0099] In one embodiment of the disclosure, the indicator of detection or diagnosis of MI (preferably STEMI) or prediction of prognosis or treatment outcome of MI (preferably STEMI) according to the disclosure includes: (ii) increased abundance of gut microbial genera Streptococcus, Clostridium and/or Butyricimonas in gut microbiota of the subject when compared to a normal control. Accordingly, the method comprises determining the abundance of the gut microbial genera Streptococcus, Clostridium and/or Butyricimonas. Examples of gut microbial genera Streptococcus include, but are not limited to, Streptococcus parasanguinis and Streptococcus salivarius. Examples of gut microbial genera Clostridium include, but are not limited to, Clostridium asparagiforme. Examples of gut microbial genera Butyricimonas include, but are not limited to, Butyricimonas virosa.
[0100] In one embodiment of the disclosure, the indicator of detection or diagnosis of MI (preferably STEMI) or prediction of prognosis or treatment outcome of MI (preferably STEMI) according to the disclosure includes: (iii) increased abundance ratio of gut microbial genera Firmicutes/Bacteroidetes in gut microbiota of the subject when compared to a normal control. Accordingly, the method comprises determining the abundance of the gut microbial genera Firmicutes and Bacteroidetes.
[0101] In one embodiment of the disclosure, the biomarker according to the disclosure includes: (iv) increased complexity and diversity in gut microbiota of the subject when compared to a normal control. Accordingly, the method comprises determining the complexity and diversity of the gut microbiota. In one preferred embodiment of the disclosure, the method comprises performing alpha or beta diversity calculation for determining the complexity and diversity of the gut microbiota. Preferably, the complexity and diversity is represented as Shannon index, Chao index or Unweight uniFrac index.
[0102] In some embodiments of the disclosure, in (i), the normal control is a level of gut microbial genera Bacteroidetes, and/or Bifidobacterium in gut microbiota of a group of normal subjects.
[0103] In some embodiments of the disclosure, in (ii), the normal control is a level of gut microbial genera Streptococcus, Clostridium and/or Butyricimonas in gut microbiota of a group of normal subjects.
[0104] In some embodiments of the disclosure, in (iii), the normal control is a ratio of the level of gut microbial genera Firmicutes/Bacteroidetes in gut microbiota of a group of normal subjects.
[0105] In some embodiments of the disclosure, in (iv), the normal control is the complexity and diversity in gut microbiota of a group of normal subjects.
[0106] In some embodiments of the disclosure, the normal control is obtained by: [0107] obtaining a group of control samples comprising gut microbiota of a group of normal subjects; and [0108] performing genetic analysis on the gut microbiota of the group of normal subjects, wherein the genetic analysis on the gut microbiota of the group of normal subjects is the same as that of the subject.
[0109] The present disclosure also provides a kit for the early diagnosis, prognosis, recurrence and differentiation of myocardial infarction in a subject, wherein the kit comprises a detecting molecule for detecting the biomarker as described herein, preferably for analyzing of the metagenome of the gut microbiota.
[0110] The detecting molecule described herein is used for detecting species and/or amounts of the biomarker. 16S rRNA, and preferably the V3-V4 region of the 16S rRNA region, is regarded as a specific region for taxonomic classification of microbes. Thus, a nucleic acid molecule, preferably an oligonucleotide molecule as a primer for specifically amplifying the 16S rRNA region, or a probe for specifically hybridizing the 16S rRNA region is applied as the detecting molecule.
[0111] The kit can further comprise several agents for performing the method for the early detecting or diagnosing likelihood of MI (preferably STEMI), predicting prognosis or treatment outcome and/or differentiating MI (preferably STEMI) as described herein. The agents may be an agent for sequencing such as an agent for next generation sequencing or an agent for shotgun metagenomic sequencing.
[0112] Preferably, for providing the normal control, the kit further comprises a group of control samples comprising gut microbiota of a group of normal subjects.
[0113] The present disclosure also provides a method for treating and/or ameliorating myocardial infarction in a subject, wherein the method comprises colonizing Bifidobacterium adolescentis (Ba), Butyricimonas virosa (By) and/or Streptococcus parasanguinis (Sp) in the gut of the subject.
[0114] In some embodiments of the disclosure, successful colonization with Ba, By and/or Sp shows improved cardiac function in a subject. Furthermore, colonization with Ba, By and/or Sp, shows positive changes in EF and FS; higher ESPVR, PRSW and dP/dt max (vs. EDV) as well as lower EDPVR, revealing improved preservation of cardiac mechanical properties. Moreover, the average infarct size is smaller in the subject with colonization with Ba, By and/or Sp. The subject with colonization with Ba, By and/or Sp also shows an increase in the plasma level of β-hydroxybutyrate. Additionally, the subject with colonization with Ba, By and/or Sp displays a longer intestine and colon. These data demonstrate the cardiac protective role of B. adolesenctis and B. virosa/S. parasangunis and also indicate the contribution of bacteria-associated ketone body metabolism in post-MI cardiac protection.
[0115] In some embodiments of the disclosure, the method further comprises colonizing a butyrate-producing bacterium in the gut. Examples of the butyrate-producing bacterium include, but are not limited to, Anaerotruncus colihominis, Bacteroides caccae, Bacteroides thetaiotaomicron, Clostridium symbiosum, Collinsella aerofaciens, Coprococcus comes, Providencia stuartii and Ruminococcus torques.
[0116] In some embodiments of the disclosure, the method is for improving cardiac function, improving preservation of cardiac mechanical properties, and/or decreasing average infarct size.
[0117] The following examples are provided to aid those skilled in the art in practicing the present invention.
EXAMPLES
Materials and Methods:
[0118] Patient recruitment: The control cases and patients with confirmed ST-elevation myocardial infarction (STEMI) were recruited from National Cheng Kung University Hospital (NCKUH), China Medical University Hospital (CMUH) and Far Eastern Memorial Hospital (FEMH) (
[0119] 16S rRNA NGS: Stool DNA was purified with the innuPREP Stool DNA Kit (Analytik Jena). The V3-V4 region of the 16S rRNA gene was amplified by a specific primer set (319F: 5′-CCTACGGGNGGCWGCAG-3′, SEQ ID NO: 29, 806R: 5′-GACTACHVGGGTATCTAATCC-3′, SEQ ID NO: 30) according to the 16S Metagenomic Sequencing Library Preparation procedure (Illumina). In brief, 12.5 ng of gDNA was used for the PCR reaction carried out with KAPA HiFi HotStart ReadyMix (Roche) under the PCR condition: 95° C. for 3 minutes; 25 cycles of: 95° C. for 30 seconds, 55° C. for 30 seconds, 72° C. for 30 seconds; 72° C. for 5 minutes and hold at 4° C. The PCR products with a bright main strip around 500 bp on a 1.5% agarose gel were purified through the AMPure XP beads for the following library preparation. The 16S rRNA V3-V4 region PCR amplicon was subjected to a secondary PCR along with Nextera XT Index Kit with dual indices and Illumina sequencing adapters (Illumina). The indexed PCR product quality was assessed on the Qubit 4.0 Fluorometer (Thermo Scientific) and Qsep100™ system. Equal amount of the indexed PCR product was mixed to generate the sequencing library. Finally, the library was sequenced on an Illumina MiSeq platform and paired 200-bp reads were generated.
[0120] Sequencing analysis: After barcode removal, the PCR amplicons were assembled with FLASH (v1.2.11; http://ccb.jhu.edu/software/FLASH/) to create Raw Tags. The assembly was with minimum overlap of 10 base pairs and 0.1 error rate. The Raw Tags were then processed with QIIME 2 (version 2020.11) to create Clean Tags. Chimeric sequences were removed with UCHIME (http://www.drive5.com/usearch/manual/uchime_algo.html) to create Effective Tags for further analysis. The Effective Tags were grouped into Operational Taxonomic Units (OTUs) and classified with UPARSE algorithm RDP Classifier (v2.2; https://rdp.cme.msu.edu/). The database used includes PyNAST (v1.2), GreenGenes (gg_13_8; default), Silva (v138; 2019.12) and NCBI. Diversities of the bacterial community were analyzed with QIIME 2 (version 2020.11).
Example 1 Recruitment of Patients with Confirmed ST-Elevation Myocardial Infarction (STEMI)
[0121] To elucidate the role of gut microbiota on the clinical outcome of myocardial infarction, the patients with ST-elevation myocardial infarction (STEMI) were recruited in collaboration with Dr. Yen-Wen Wu at Far Eastern Memorial Hospital (FEMH, Northern Taiwan), Dr. Kuan-Cheng Chang at China Medical University Hospital (CMUH, Middle Taiwan), and Yen-Wen Liu at National Cheng Kung University Hospital (NCKU, Southern Taiwan) (Table 1). The disease status of the STEMI patients was all confirmed with Electrocardiography (ECG/EKG), echocardiography and catheterization. So far, we have recruited 147 participants in total, including 70 control cases and 77 STEMI cases. Over 60% of the STEMI cases recruited were male. Moreover, the majority of the STEMI cases were recruited from Southern Taiwan; nearly 70% of the STEMI cases were recruited from CKU. Hypertension, hyperlipidemia and diabetes are all comorbidities and risks for cardiovascular diseases. From the STEMI recruitment, we observed that hyperlipidemia contributed more to the STEMI cases recruited. In addition, the body mass index (BMI) did not show any significant difference between the control and STEMI cases. Our data suggest a geographic and gender difference in the incidence of STEMI in Taiwan.
TABLE-US-00001 TABLE 1 STEMI patient recruitment. Control cases and patients with confirmed STEMI were recruited from Far Eastern Memorial Hospital (Northern Taiwan), China Medical University Hospital (Middle Taiwan), and National Cheng Kung University Hospital (Southern Taiwan). No. (%) Total (n = Control (n = STEMI (n = Characteristic 147) 70) 77) P Value Age, mean (SE), y 54.0 (1.0) 52.0 (1.4) 55.7 (1.2) 0.052 Male 115 (78.2) 43 (61.4) 72 (93.5) <0.0001 Location Northern Taiwan 26 (17.7) 7 (10.0) 19 (24.7) Middle Taiwan 48 (32.6) 42 (60.0) 6 (7.8) Southern Taiwan 73 (49.7) 21 (30.0) 42 (54.5) Comorbidities and risk factors Hypertension 46 (31.3) 24 (34.3) 23 (29.9) 0.57 Hyperlipidemia 77 (52.4) 25 (35.7) 52 (67.5) <0.0001 Diabetes 29 (19.7) 14 (20.0) 15 (19.5) 0.94 Presenting characteristics Body mass index Underweight (< 18.5) 1 (0.7) 1 (1-4) 0 (0.0) Normal (18.5 to <25) 48 (32.7) 20 (28.6) 28 (36.4) 0.35 Overweight (25 to 30) 60 (40.8) 23 (32.8) 37 (48.1) 0.15 Obese (30) 17 (11.6) 4 (5.7) 13 (16.9) 0.63
Example 2 Increment Butyrate-Producing Bacteria in Post-Cardiac Injury Gut Microbial Community
[0122] In order to investigate the relationship between gut microbiome and myocardial infarction (MI), we performed 16s V3-V4 NGS on a total of 214 stool samples from n=77 ST-elevation myocardial infarction (STEMI) patients (confirmed with both electrocardiograph and angiography) and n=70 age and BMI-matched controls (Ctrl) (
TABLE-US-00002 TABLE 2 Primer sets for bacterial validation. Forward (F) or Reverse (R) Bacteria primer Sequence (5′-3′) SEQ NO Anaerotruncus colihominis (F) CTAAAACAGAGGGCGGCGAC 1 DMA 17241 (R) CTTCGGGTGTTACCCGGACTC 2 Clostridium symbiosaum (F) AACTGGAGTGTCGGAGAGGT 3 ATCC 14940 (R) TTCATCGTTTACGGCGTGGA 4 Coprococcus comes (F) GGCGTGTAATGACGCTTTT 5 ATCC 27758 (R) AGTCTCTCCAGAGTGCCCAT 6 Ruminococcus torques (F) CGAGGTGGAGCAAATCCCAA 7 ATCC 27756 (R) ACTGACTTCGGGCGTTACTG 8 Bacteroides caccae (F) ATGGGGAAACCCATACGCC 9 ATCC 43185 (R) CCAGAGTCCTCAGCATGACC 10 Bacteroides thetaiotaomicron (F) GGGCAGTGATCTACGTGTCAAG 11 VPI-5482 (R) CTGCATCGTACCCAAAATCGTCTG 12 Providencia stuartii (F) TCCCTAGAGGAGTGGCTTCC 13 ATCC 29914 (R) CTCCCGAAGGCACTAAAGCA 14 Collinsella aerofaciens (F) CTCTCCGGAGGGAAGCGAG 15 ATCC 25986 (R) TGTCTCAGTCCCAATCTGGC 16 Bifidobacterium adolescentis (F) CCGGTGTAACGGTGGAATGT 17 ATCC 15703 (R) GACACGGAGACCGTGGAATG 18 Bifidobacterium ruminantium (F) TCCTATCAGGTAGTCGGCGG 19 (R) GCTTGCTCCCAGTCAAAAGC 20 Streptococcus parasanguinis (F) ATGGGGTGACCATCGCAAAA 21 ATCC 15912 (R) GAGTCAAAACCGTTGCGGTC 22 Streptococcus salivarius (F) GTTATGAGCTCAGGCTCGCT 23 (R) GCAGCAATTCCGCCTTCTTT 24 Butyricimonas virosa (F) AAGGATGACGAGTCATTCGATGC 25 JCM 15149 (R) CTTCACTTGTTCCGCCTCCC 26 Subdoligranulum variabile (F) GATCCGCCATCGGATGAGG 27 (R) GTGCAATATCCCCCACTGCT 28
Example 3 Machine Learning Strategy for Gut Microbiome-Driven STEMI Diagnosis
[0123] To investigate the possibility of using a gut microbial composition as a prediction tool for STEMI, we performed four types of supervised machine learning classifiers on the features of bacterial taxa using PyCaret package (Ai et al., 2017, Oncotarget 8, 9546-9556. 10.18632/oncotarget.14488) (
Example 4 STEMI Fecal Microbiome Transplantation (FMT) Deteriorates Post-Injury Cardiac Function in Germ-Free (GF) Mice
[0124] To experimentally assess the influence of the human gut microbiota on post-injury cardiac function, we transplanted human fecal samples from Ctrl and STEMIT1 into the 12-week old male C57BL/6J germ-free (GF) mice (
Example 5 Enrichment of Ketone Body Metabolism was Enriched During Post-Injury Cardiac Repair
[0125] The gut microbiomes may influence the host through bacterially-produced small molecules (Kasahara et al., 2018, Nat Microbiol 3, 1461-1471. 10.1038/s41564-018-0272-x; Yachida, et al., 2019, Nat Med 25, 968-976. 10.1038/s41591-019-0458-7). Shotgun metagenomics analysis of the Ctrl and STEMIT1 stools revealed STEMIT1-associated enrichment of bacterial genes involved in metabolism of amino acids, short chain fatty acids and the TCA cycle (
Example 6 Butyrate Supplementation Confers Better Post-MI Cardiac Function Preservation in Intact Gut Microbiota
[0126] From metabogenomic analysis, we identified an increase of butyrate-producing bacteria after cardiac injury in both humans and nonhuman primates. In order to determine the influence of butyrate on post-MI cardiac repair, we used a combination of broad spectrum antibiotics (ABX) to deplete the host microbiome, and supplemented C57BL/6J mice with butyrate via gavage beginning one day after MI and continuing for twenty days (
Example 7 Colonization of Butyrate-Producing Bacteria Ameliorates Post-MI Cardiac Injury
[0127] The shotgun metagenomics showed that bacterial genes (ACAT, HMGCS, OXCT and BDH) encoding key-step enzymes for ketone body metabolisms were enriched in the STEMI samples, and the bacteria of note include STEMIT1 associated B. adolescentis, B. virosa and S. parasanguinis (
[0128] While the present invention has been described in conjunction with specific embodiments set forth above, many alternatives thereto and modifications and variations thereof will be apparent to those of ordinary skill in the art. All such alternatives, modifications and variations are regarded as falling within the scope of the present invention.