Protein expression systems

Abstract

The invention is based on an expression enhancer sequence derived from the RNA-2 genome segment of a bipartite RNA virus, in which a target initiation site in the RNA-2 genome segment has been mutated. Deletion of appropriate start codons upstream of the main RNA2 translation initiation can greatly increase in foreign protein accumulation without the need for viral replication. Also provided are methods, vectors and systems, including the hyper-translatable Cowpea Mosaic Virus (CPMV-HT) based protein expression system.

Claims

1. A method for expressing a protein heterologous to Cowpea Mosaic Virus (CPMV) in a plant comprising: introducing a gene expression construct into a plant cell of the plant, said gene expression construct comprising from 5 to 3: (i) an enhancer sequence comprising a nucleic acid sequence comprising a mutated sequence of SEQ ID NO:1 starting with nucleotide 1 of SEQ ID NO:1 and up to target initiation site at positions 161-163, wherein the mutated sequence of SEQ ID NO:1 consists essentially of mutations at the initiation site of positions 115-117 and at the target initiation site at positions 161-163, and wherein neither of the two mutated initiation sites functions as a translational initiation site, and (ii) a coding sequence for the heterologous protein; wherein mutations at the initiation site of positions 115-117 and at the target initiation site at positions 161-163 comprise deletion, insertion, substitution or removal of the target initiation site, wherein the coding sequence is operably linked to a functional translation initiation site and is after the mutated target initiation site, wherein the heterologous protein is expressed in the plant, and wherein the expression of the heterologous protein is enhanced in comparison with expression of the heterologous protein from a construct comprising the unmutated nucleic acid sequence of SEQ ID NO:1 having a functional target initiation site at positions 161-163 and having a functional initiation site at positions 115-117.

2. The method of claim 1, wherein the codon of positions 115-117 of SEQ ID NO:1 is GUG.

3. The method of claim 2, further comprising introducing into the plant cell a heterologous suppressor of gene silencing.

4. The method of claim 3, further comprising harvesting the heterologous protein.

5. The method of claim 4 further comprising preparing an extract of the heterologous protein.

6. The method of claim 1, further comprising introducing into the plant cell a heterologous suppressor of gene silencing.

7. The method of claim 6, further comprising harvesting the heterologous protein.

8. The method of claim 7 further comprising preparing an extract of the heterologous protein.

9. The method of claim 1, further comprising harvesting the heterologous protein.

10. The method of claim 9 further comprising preparing an extract of the heterologous protein.

11. A gene expression construct comprising from 5 to 3: (i) an enhancer sequence comprising a nucleic acid sequence comprising a mutated sequence of SEQ ID NO:1 starting with nucleotide 1 of SEQ ID NO:1 and up to target initiation site at positions 161-163, wherein the mutated sequence of SEQ ID NO:1 consists essentially of mutations at the initiation site of positions 115-117 and at the target initiation site at positions 161-163, and wherein neither of the two mutated initiation sites functions as a translational initiation site, (ii) a coding sequence for a protein heterologous to CPMV, and wherein the coding sequence is operably linked to a functional translation initiation site and is after the mutated target initiation site, wherein the heterologous protein is expressed in a plant, and wherein the expression of the heterologous protein is enhanced in comparison with expression of the heterologous protein from a construct comprising the unmutated nucleic acid sequence of SEQ ID NO:1 having a functional target initiation site at positions 161-163 and having a functional initiation site at positions 115-117.

12. The gene expression construct of claim 11, wherein the codon of positions 115-117 of SEQ ID NO:1 is GUG.

13. The method of any one of claims 1, 6, 9, 7, 10, or 8, wherein the target initiation site is deleted.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a schematic diagram of CPMV expression vectors 00, 10, 01 and 11. In 00 expression vectors the initiation sites at positions 115 and 161 are intact. In 10 expression vectors the initiation site at positions 115 has been mutated but the initiation site at position 161 is intact. In 01 expression vectors the initiation site at positions 161 has been mutated but the initiation site at position 115 is intact. In 11 expression vectors the initiation sites at positions 115 and 161 are both mutated. CPMV expression vectors 00, 10, 01 and 11 also comprise an initiation site at either position 512 (FSC2-152), 513 (FSC2-513) or 514 (FSC2-514). Bars are used to indicate the initiation sites from which protein expression is expressed to occur.

(2) FIG. 2 shows the level of soluble green fluorescent protein (GFP) expressed in plants transfected with the CPMV expression vectors schematically illustrated in FIG. 1. In expression vectors FSC2-512, FSC2-513 and FSC2-514, the gene encoding GFP was inserted after the initiation codon at position 512, 513 and 514, respectively. The lanes of the SDS-PAGE gels are marked 00, 10, 01 and 11, depending on which of the initiation sites in the CPMV vector, at positions 115 and 161, are intact or mutated. The lane marked 500 ng shows the position of a band corresponding to 500 ng of GFP protein and thus indicates the expected position of GFP protein expressed from the CPMV expression vectors. The left hand lane of each SDS-PAGE gel shows the position of protein size markers.

(3) FIG. 3 shows the level of GFP expression in Nicotiana benthamiana leaves transfected with the same CPMV expression vectors used in the experiment illustrated in FIG. 2. The pale regions at the tips of the leaves correspond to regions of GFP expression. Mutations made in order to inactivate the initiation sites at positions 115 and/or 161 in expression vectors 10, 01 and 11 are also indicated.

(4) FIG. 4 shows a comparison of Del-RNA-2 (expression vector 00 [FSC2-512] in FIG. 1) and HT (expression vector 01 [FSC2-512] in FIG. 1) for transient expression of green fluorescent protein (GFP), Discosoma red fluorescent protein (DsRed), and the hepatitis B core antigen (HBcAg). delRNA-2 or HT clones for each protein were infiltrated with the silencing suppressor P19. (A) Tissue 7 days after infiltration with delRNA-2 constructs becomes necrotic when DsRed or HBcAg is expressed whereas this is not the case for HT driven expression. In fact, tissue expressing DsRed by HT looks visibly red under day light conditions. (B) Coomassie-stained SDS-PAGE analysis of protein expression. The prominent bands corresponding to recombinant proteins as indicated were confirmed by western blotting. 1-marker, 2-uninfiltrated tissue, 3-delRNA-2 construct, 4-HT construct, 5-commercial standard where available. Crude extracts from approximately 5 mg of infiltrated tissue were loaded per lane as was 2 g of GFP standard and 2 g of HBcAg standard. No standard for DsRed was available at the time.

(5) FIG. 5 shows an initial comparison of Del-RNA-2 (expression vector 00 [FSC2-512] in FIG. 1) and HT (expression vector 01 [FSC2-512] in FIG. 1) for transient expression of the human anti-Human Immunodeficiency Virus antibody 2G12. The IgG Heavy chain was either in natural form (HL) or ER-retained (HEL) and infiltrated with the light chain and P19. (A) Expression of 2G12-HEL by del-RNA-2 leads to necrosis of infiltrated tissue whereas this does not occur for HT expression. (B) SDS-PAGE analysis of crude extracts of tissue infiltrated with the antibody heavy chains (delRNA-2 or HT) plus P19. For each sample crude extract from 5 mg of infiltrated tissue was loaded as was 1 g of standard human IgG. A band corresponding to 2G12 is easily visible after coomassie staining. (C) Accumulation of antibody 2G12 after 5 days was measured by capture to protein A and surface plasmon resonance spectroscopy and represents the concentration following extraction in 2 volumes of buffer (PBS, 5 mM EDTA). Therefore, we can derive fresh weight concentrations approaching 150 mg/kg (for HT HEL) without any optimisation of plant incubation or extraction. Three samples were measured for each treatment.

(6) FIG. 6 shows an electron micrograph of assembled HBcAg particles, which were expressed using the HT (expression vector 01 [FSC2-512] in FIG. 1) expression system described herein. The assembled HBcAg particles appear as hollow spheres, about 30 nm in diameter. The sap containing the HBcAg particles was not concentrated before the electron micrograph was taken, although unwanted salts were removed. Therefore, the electron micrograph represents the concentration of HBcAg particles in the sap.

(7) FIG. 7 shows the vector pM81-FSC1.

(8) FIG. 8 shows the vector pM81-FSC2.

(9) FIG. 9 shows a schematic representation of the construction of pEAQ. (A) Starting pBINPLUS-based plasmid with extraneous sequence shown in grey. (B) PCR products containing essential elements of the binary vector. (C) Intermediate plasmid following 3-part ligation of end-tailored PCR products. (D) Final plasmid following amplification and subsequent ligation of two fragments from the intermediate.

(10) FIG. 10 shows a schematic representation of the T-DNAs of the main pEAQ derivatives. The T-DNAs contain either or both of the P19 and NPTII cassettes as indicated leaving possible cloning into restriction sites as indicated.

(11) FIG. 11 shows expression levels of GFP generated by pEAQ vectors compared to its parent plasmid pBB-FSC2-512-HT. Tissue was analysed 6 days after infiltration with P19 and the vector indicated except for pEAQexpress, which was infiltrated alone at the standard OD, or at a two-fold dilution. (A) Leaves visualised under UV light, (B) coomassie-stained 12% SDS-PAGE, and (C) spectrofluorometric analysis.

(12) FIG. 12 shows the ability of P19(R43W) to enhance GFP expression compared to wild type P19. Tissue was analysed 6 days after infiltration with pEAQselectK at two-fold dilution (selK-P19), pEAQselectK and P19 (selK), pEAQspecialK (spK), pEAQspecialK at two-fold dilution (spK 1:2), pEAQspecialKm (spKm), pEAQspecialKm at two-fold dilution (spKm 1:2), pEAQexpress (ex), and pEAQexpress at two-fold dilution (ex 1:2). (A) Leaves visualised under UV light and (B) spectrofluorometric analysis.

(13) FIG. 13 shows expression of the full size IgG, 2G12, with a single pEAQ plasmid. (A Schematic representation of the two pEAQexpress-derived plasmids constructed to express 2G12. (B) Infiltration scheme indicating dilutions and their respective ODs for each plasmid combination, and the concentration of protein extracts made after infiltrations at each OD (SD). (C) Coomassie-stained 12-4% SDS-PAGE analysis and (D) immunological detection of 2G12 heavy (y) and (E) immunological detection of 2G12 Fab region (Fab) chain 8 days after infiltration. M, marker with sizes indicated; C, control extract; Std, CHO-produced 2G12. For coomassie-staining, protein from the equivalent of 3 mg of infiltrated tissue is loaded in each lane with 1 g of CHO2G12 and for western blotting the equivalent of 0.75 mg of tissue in each lane with 250 ng of CHO2G12. Estimated assembly/degradation products are indicated.

(14) FIG. 14 shows the cloning and expression of GFP from pEAQ-HT in native and his-tagged variants. (A) Schematic representation of the pEAQ-HT T-DNA with polylinker detail. (B) Spectrofluorometric analysis of GFP expression. spK=pEAQspecialK-GFP-HT, GFP, HisGFP, and GFPHis=pEAQ-HT clones. (C) 12% SDS-PAGE and western analysis of GFP expression. C=control extract.

(15) FIG. 15 shows a nucleic construct of the present invention which is suitable for use in insect cells as part of a baculovirus vector.

(16) FIG. 16A-16B shows expression cassette used and mutations to the 5 leader sequence of CPMV RNA-2. (A) Schematic representation of the expression cassette from the cloning vector pM81-FSC2, with detail surrounding the AUG at position 512 showing the +4 and 3 Kozak consensus positions underlined. (B) Schematic diagram of the mutations made to the 5 leader (from nucleotides 1-512 in A). The positions of 5 AUGs are indicated and the GFP sequence is shown as gray.

(17) FIG. 17A-17C shows effect of the AUG 115 (A115G) and AUG 161 (U162C) mutations on GFP expression 5 d postinfiltration in N. benthamiana leaves. (A) GFP fluorescence as seen under UV light. (B) Coomassie-stained SDS-PAGE gel of approximately 25 g of protein per lane extracted from infiltrated tissue. M, Marker with sizes indicated; (C) control extract; wt, wild type; Std, 1 g of recombinant GFP. C, GFP accumulation in infiltrated tissue measured by spectrofluorometry. Values represent averages from three extracts SD.

(18) FIG. 18 shows analysis of RNA accumulation from the wild-type (wt) and mutant 5 leader sequences either in the absence or presence of P19. Values indicate the average proportion of transcripts relative to the wild-type leader from three extracts SE.

(19) FIG. 19A-19D shows expression of DsRed and HBcAg cloned downstream of wild-type (wt) and HT (U162C) 5 leaders. (A) Leaves 6 d postinfiltration expressing HBcAg and DsRed downstream of either the wild-type or the HT 5 leader. Scale bar, 2.5 cm. (B) Coomassie-stained SDS-PAGE gel of approximately 25 g of protein per lane extracted from tissue infiltrated with constructs as indicated. M, Marker with sizes indicated; (C) control extract. C, Immunological detection of DsRed (top) or HBcAg (bottom) expression using either the wild-type or the HT 5 leader. (D) Transmission electron microscopy of crude extracts of HT-HBcAg following buffer exchange and negative staining with 2% uranyl acetate. Scale bar, 250 nm.

(20) FIG. 20A-20C shows expression of the human anti-HIV IgG using wild-type (wt) and HT leaders. (A) Leaves 6-d post-infiltration expressing 2G12, with (HEL) or without (HL) ER retention of the heavy chain, downstream of either the wild-type or the HT 5 leader. Scale bar, 2.5 cm. (B) Coomassie-stained nonreducing SDS-PAGE gel of approximately 12.5 g of protein per lane extracted from tissue infiltrated with constructs as indicated. M, Marker with sizes indicated; (C) control extract; Std, 1 g of human IgG. C, 2G12 accumulation in extracts of 2G12 and HT-2G12 infiltrated tissue measured by SPR using a protein-A-coated surface. Values repre-sent averages from three extracts SD.

EXAMPLES

Example 1

(21) 1.1 Methods

(22) Creation of Expression Vector FSC2 and its Derivatives

(23) A useful cloning vector for the expression of foreign proteins from a pBinP-1-GFP-based plasmid (Caizares et al., 2006) was created by excising the complete sequence of RNA-2 flanked by the Cauliflower mosaic virus (CaMV) 35S promoter and nopaline synthase (nos) terminator from pBinP-S2NT (Liu and Lomonossoff, 2002) and inserting it into mutagenesis plasmid pM81 W (Liu and Lomonossoff, 2006) as an AscI/PacI fragment. The resulting plasmid, pM81W-S2NT, was subjected to a single round of mutagenesis which simultaneously introduced four changes (see method in Liu and Lomonossoff, 2006) to give pM81B-S2NT-1. The mutagenesis removed two BspHI sites from the vector backbone and introduced a BspHI site (T/CATGA) around AUG 512 and a StuI site (AGG/CCT) after UAA 3299, the termination codon for the RNA-2-encoded polyprotein. Subsequently, the BamHI/AscI fragment was excised from pBinP-NS-1 (Liu et al., 2005) and ligated into similarly digested pM81B-S2NT-1, yielding pM81-FSC-1. This vector allows the whole of the RNA-2 ORF downstream of AUG 512 to be excised by digestion with BspHI and StuI and replaced with any sequence with BspHI and StuI (blunt)-compatible ends. The use of the BspHI site is important as it preserves the AUG at 512 and this initiator is used to drive translation of the inserted gene. To express the foreign gene in plants, the pM81-FSC-1-derived plasmid is digested with AscI and Pad and the fragment containing the expression cassette including the foreign sequences transferred to similarly digested pBINPLUS and the resulting plasmids are finally transformed into A. tumefaciens.

(24) To improve the ease of cloning, expand the choice of applicable restriction enzymes, and to investigate the effect of reading frame on foreign gene expression, the whole RNA-2 ORF was replaced with a short polylinker. A combination of oligonucleotide insertion and site-directed mutagenesis resulted in pM81-FSC-2, which allows cloning with NruI (TCG/CGA) and either Xhol (C/TCGAG) or StuI. The terminal adenine of the NruI site lies at position 512 thereby preserving the AUG found here. The modifications altered nucleotides immediately 5 to the AUG at 512, however, a good context was maintained. Cloning GFP into pM81-FSC-2 such that its translation was initiated from an AUG at 512, 513, 514, or 515 gave the pM81-FSC-1 derived constructs pM81-FSC2-512, pM81-FSC2-513, pM81-FSC2-514, and pM81-FSC2-515. These pM81-based plasmids are the cloning vectors containing the expression cassettes which were then transferred into the binary vector to produce the expression vectors FSC2-512, FSC2-513 and FSC2-514 used in the Experiments shown in FIGS. 2 and 3. Differences between the sequence of the wt RNA-2 genome segment of CPMV and the pM81-FSC1 and pM81-FSC2 vectors are shown in Table 4.

(25) Nucleotides altered in the vectors compared with the wt CPMV sequence are shown as capital letters.

(26) Agrobacteria-mediated transient transformation following mobilisation into pBINPLUS (as outlined above for pM81-FSC-1) showed that lower protein levels are obtained when frame continuity between AUG 161 and the downstream AUG is not maintained. There was a significant decrease in the amount of GFP translated from the +1 and +2 positions relative to AUGs 161 and 512, whereas translation from the +3 position (that is, from 515 and back in frame) was as efficient as translation from an AUG at 512. To show that this was not due to weakened contexts of the AUGs at 513 and (to a lesser extent) 514, FSC2-515+ was created to initiate from +3 position but with the same poor context as FSC2-513. Expression from FSC2-515+ was as high as that achieved from FSC2-512 or 515, indicating that inferior context does not explain the reduction in expression from FSC2-513 and 514.

(27) Given that the known mechanisms by which translation can escape the first-AUG rule are not known to require frame continuity, it is intriguing that efficient translation from a deleted RNA-2-based vector depends on frame continuity between AUG 161 and the downstream AUG. In order to understand, and hopefully overcome this phenomenon, a series of mutants were created with modifications to the 5 sequence of RNA-2. Complement pairs of oligonucleotides (see Table 3) were used in the site-directed mutagenesis of pM81-FSC2-512, 513, and 514. The mutations removed either AUG 115 (the start codon for the uORF), AUG 161 (without changing the amino acid sequence of the uORF), or both of these upstream initiation sites. Double mutations were made by mutagenizing the A115G mutants with the U162C oligos (Table 3).

(28) Transient expression from these mutant transcripts was carried out as described for previous pM81-FSC-2 constructs. Analysis of expression of GFP from these mutants using coomassie-stained SDS-PAGE (FIG. 2) or UV light to visualise whole leaves (FIG. 3) shows a strong increase in expression in the absence of the AUG at 161. Furthermore, the removal of AUG 161 alone or both AUGs 115 and 161 alleviates the dependence on frame continuity between AUG 161 and the downstream AUG. In contrast, removal of just AUG 115 appears to enhance this dependency as well as generally inhibit translation. In conclusion, the uORF appears to function to down-regulate translation from AUG 161, which is both generally inhibitory and confers dependence on frame continuity.

(29) Electron Microscopy of Sap Containing HBcAg Particles

(30) The sap used for the electron micrograph of the assembled HBcAg particles shown in FIG. 6 was prepared as follows. Leaf tissue was extracted in 2 volumes of Tris/NaCl buffer and exchanged for TE without concentration on a 100 kDa MWCO column. The final concentration of HBcAg was approximately 0.2 mg/ml as judged by comparison to standard on a coomassie stained SDS-PAGE gel.

(31) 1.2 Results

(32) (1) Effect of Altering Relative Phases of the Initiation Sites at Position 161 (AUG161) and 512 (AUG512).

(33) To achieve this extra nucleotides were inserted immediately upstream of AUG512 (FSC2-512) to move the AUG to position 513, 514 and 515 (FSC2-513, FSC2-514 and FSC2-515) (FIG. 1). Putting AUG512 out-of-phase with AUG 161 (FSC2-513 and FSC2-514) gave less GFP expression as judged by fluorescence (FIG. 3) and Coomassie-stained gels (FIG. 2). Restoring the phase (FSC2-515) brought expression back to levels seen with the natural situation (FSC2-512). The conclusion is that when AUG161 is present, initiation at a downstream AUG is most efficient when it is in-phase with the AUG at position 161.

(34) (2) Removal of the Initiation Site at Position 115 (AUG115) Coupled with Altering Relative Phases of the Initiation Sites at Position 161 (AUG161) and 512 (AUG512).

(35) Removal of AUG115 has little or no effect when GFP expression is driven from AUG512 i.e. when this second AUG is in phase with AUG161 (see lanes labelled 10 in FIGS. 2 and 3). However, deletion of AUG115 when the second AUG is out-of-phase with AUG161 (513, 514) results in virtually no GFP expression (see lanes labelled 10 in FIGS. 2 and 3). Conclusion: AUG115 is somehow involved in the ability of ribosomes to by-pass AUG161 and reach AUG512. However, this requires the downstream AUG to be in the correct phase.

(36) (3) Effect of Removal of the Initiation Site at Position 161 (AUG161)

(37) The effect of this mutation is incredibly dramatic with GFP expression levels reaching 20-30 times the amount found when AUG161 is present (see lanes labelled 01 in FIGS. 2 and 3). Furthermore, it no longer appears to matter which phase AUG512 is in, though in the absence of AUG161, the idea of phase does not mean much. In addition the presence or absence of AUG115 makes no difference (see lanes labelled 11 in FIGS. 2 and 3).

(38) When using the delRNA-2 (expression vector 00 [FSC2-512] in FIG. 1) constructs for DsRed and HBcAg expression, within 5 days infiltrated patches have lost turgor pressure and become chlorotic (pale). By 7 days the tissue appears grey and is completely dead. When using HT (expression vector 01 [FSC2-512] in FIG. 1), the tissue remains turgid after 7 days and the only sign of stress is slight chlorosis of HBcAg expressing tissue. When the heavy chain of the 2G12 IgG is expressed by delRNA-2 and retained in the ER, chlorosis is evident after 7 days, whereas for HT this is not observed. The level of necrosis seen in plants when using HT to express a heterologous protein is thus much lower, despite the higher level of heterologous protein expression achieved, than when using delRNA-2 to express the heterologous protein.

(39) Discussion

(40) Very high levels of foreign gene expression can be expressed from the deRNA-2 constructs by deleting AUG161. At present, using GFP, we estimate the levels as 25-30% of total soluble protein (TSP) or approximately 1 gram expressed protein per Kg leaves. This is a tremendous level and the approach we use is extremely simple. The fact that we no longer need to preserve a reading frame means that user-friendly vectors with polylinkers can be produced.

Example 2

(41) 2.1 Background

(42) As described in Example 1, to investigate the features necessary for the 5 untranslated region (UTR) of CPMC RNA-2 necessary for efficient expression, the present inventors addressed the role of two AUG codons found within the 5 leader sequence upstream of the main initiation start site. The inventors demonstrated that deletion of an in-frame start codon (161) upstream of the main translation initiation site (512) led to a massive increase in foreign protein accumulation.

(43) Using this system the inventors have shown that by 6 d postinfiltration, a number of unrelated proteins, including a full-size IgG and a self-assembling virus-like particle, were expressed to >10% and 20% of total extractable protein, respectively. Thus, this system provides an ideal vehicle for high-level expression that does not rely on viral replication of transcripts.

(44) This new system (as exemplified by expression vector 01 [FSC-512] in FIG. 1) has been called CPMV-HT for hyper-translatable Cow Pea Mosaic Virus protein expression system.

(45) The HT-CPMV system shows dramatic increases in protein levels and thus is an excellent method for the rapid, high-level expression of foreign proteins in plants.

(46) A growing array of binary vectors has been developed for plant transformation over the past 25 years (Hellens et al., 2000b; Veluthambi et al., 2003; Lee and Gelvin, 2008). The main aim of these developments has thus far focused on improving stable integration by, for example, expanding the host range for Agrobacteria (Hiei et al., 1994), the creation of a series of vectors that allow a choice of selectable markers, expression cassettes and fusion proteins (exemplified by the pCAMBIA range of open source binary vectors, or by developing systems for minimising extraneous DNA integration and marker-free transformation (for example pCLEAN; Thole et al., 2007).

(47) Binary vectors have also been engineered to replicate at low copy numbers to reduce the frequency of multiple integration events of the same transgene, as this can lead to gene silencing (Johansen and Carrington, 2001).

(48) However, for transient expression, ensuring efficient integration into the host nucleus and the presence of marker for in planta selection are not strictly required. Furthermore, upon agro-infiltration each cell is flooded with T-DNA molecules, which are thought to be transcriptionally competent in the nucleus even without genome integration (Janssen and Gardner, 1989; Narasimhulu et al., 1996). This suggests that transient expression could benefit from higher copy number binary plasmids.

(49) Another area of improvement of binary vectors has been the reduction in size of the vector backbone. Two prominent examples that continue to demonstrate the benefits of smaller plasmids are pPZP (Hajdukiewicz et al., 1994) and pGREEN (Helens et al., 2000a). In addition to improving the efficiency of cloning procedures and bacterial transformation, these vectors have provided templates for expression systems that rely on multiple cassettes present on a single T-DNA (Tzfira et al., 2005; Thole et al., 2007).

(50) The present example discloses non-obvious refinements of this vector which facilitates its practical use by permitting the cloning to be done in a single step, rather than requiring subcloning of expression cassettes between the cloning vector (e.g. pM81-FSC2) and expression systems (e.g. PBINPLUS). More specifically, the results herein show it was possible to drastically reduce the size of pBINPLUS without compromising performance in terms of replication and TDNA transfer. Furthermore, elements of the CPMV-HT system have been incorporated into the resulting vector in a modular fashion such that multiple proteins can be expressed from a single T-DNA. These improvements have led to the creation of a versatile, high-level expression vector that allows efficient direct cloning of foreign genes.

(51) 2.2 Materials and Methods

(52) pBD-FSC2-512-U162C (HT), contains the FSC2-512-U162C cassette (see Example 1) inserted into the PacI/AscI sites of pBINPLUS (van Engelen et al., 1995). The essential segments of this plasmid (see below) were amplified with the high fidelity polymerase, PHUSION (New England Biolabs) using oligonucleotides encoding unique restriction enzyme sites for re-ligation (Table 1). The T-DNA region was amplified with a sense primer homologous to sequence upstream of a unique Ahdl site (pBD-LB-F) and an antisense primer that included an ApaI site (pBD-RB-ApaI-R). A region including the ColE1 origin of replication, the NPTIII gene, and the TrfA locus was amplified with a sense primer that included an ApaI site (pBD-ColE1-ApaI-F), and an antisense primer that included a Spel site (pBD-TrfA-Spel-R). The RK2 origin of replication (OriV) was amplified with a sense primer that included a Spel site (pBD-oriVSpel-F) and an antisense primer that included an Ahdl site (pBD-oriV-Ahdl-R). Following purification, the products were digested according to the unique restriction sites encoded at their termini and mixed for a three-point ligation. This resulted in the plasmid pEAQbeta, for which the ligation junctions were verified by sequencing. A deletion of approximately 1.2 kb from the T-DNA which had removed a portion of the nos terminator of the CPMV-GFP-HT cassette was detected. Therefore, a portion of the terminator including the right border from pBD-FSC2-GFP-HT was re-amplified with primers pMini>pMicroBIN-F2 and pBD-RB-ApaI-R, as was the pEAQbeta backbone, including the right border, using primers pBD-ColE1-ApaI-F and pMini>pMicroBIN-R (Table 1). The purified products were digested with ApaI and FseI and ligated to give pEAQ (FIG. 9).

(53) The P19 gene flanked by 35S promoter and 35S terminator was amplified from pBIN61-P19 (Voinnet et al., 2003) using either 35SP19-PacI-F and 35SP19-AscIR, or 35SP19-FseI-F and 35S-P19-FseI-R as primers (Table 1). The NPTII gene flanked by the nos promoter and terminator was amplified from pBD-FSC2-GFPHT using primers pBD-NPTII-FseI-F and pBD-NPTII-FseI-R (Table 1). Following A-tailing, the amplified cassettes were ligated into pGEM-T easy (Promega). The P19 cassette excised from pGEM-T easy with FseI was ligated into FseI-digested pEAQ-GFP-HT to give pEAQexpress-GFP-HT. The NPTII cassette excised with FseI was ligated into FseI-digested pEAQ-GFP-HT in both directions to give pEAQselectK-GFP-HT and pEAQselectK(rev)-GFP-HT. The NPTII cassette was also excised with PacI/AscI and ligated into the AsiSI/MluI sites of pEAQselectK-GFP-HT to give pEAQspecialK-GFP-HT. The P19 in pGEM-T was subjected to site-directed mutagenesis by the QUICKCHANGE method (Stratagene) to effect the conversion of Arginine43 to a tryptophan residue using primers P19-R43W-F and P19-R43W-R. The mutant P19 cassette was released with PacI/AscI digest and inserted into the AsiSI/MluI sites of pEAQselectK-GFP-HT to give pEAQspecialKm-GFP-HT.

(54) Oligonucleotides encoding the sense and antisense strands of a short polylinker (Table 1) were annealed leaving the downstream half of an NruI site at the 5end and an overhang matching that of Xhol at the 3 end. The annealed oligos were ligated with NruI/Xhol digested pM81-FSC2-A115G-U162C (see above) to give pM81-FSC2-POW. The NruI site was removed from the P19 cassette in pGEM-T by site-directed mutagenesis (QUICKCHANGE; Stratagene) with the primers P19-NruI-F and P19-NruI-R, and was re-inserted into the AsiSI/MluI sites of pEAQselectK-GFP-HT to give pEAQspecialKNruI-GFP-HT which showed no reduction in expression compared to pEAQspecialK-GFP-HT (data not shown). The PacI/AscI fragment from pM81-FSC2-POW was then released and inserted into similarly digested pEAQspecialKNruI-GFP-HT thereby replacing the GFP HT expression cassette and yielding pEAQ-HT. GFP was amplified from pBD-FSC2-GFP-HT with a set of four primers (Table 1) in three combinations for insertion into pEAQ-HT: GFP-Age-F and GFP-Xhol-R; GFP-Age-F and GFP-Xmal-R; and GFP-Xmal-F and GFP-Xhol-R. Purified PCR products were digested with the enzymes specified in their primers and inserted into appropriately digested pEAQ-HT to give pEAQ-HT-GFP, pEAQ-HT-GFPHis, and pEAQ-HT-HisGFP.

(55) TABLE-US-00001 TABLE1 Oligonucleotidesusedforamplification andmutagenesis.Restrictionenzymesites, orpartsthereof,areshowninlowercase, andmutationsunderlinedinbold. SEQ IDNO: Oligo Sequence Function 14 pBD-LB-F GCCACTCAGCTTCCTCA Senseprimerfor GCGGCTTT amplificationoftheregion 6338-12085ofpBD-FSC2-GFP-HT 15 pBD-RB- TATTAgggcccCCGGCGC Antisenseprimerfor ApaI-R CAGATCTGGGGAACCCT amplificationoftheregion GTGG 6338-12085ofpBD-FSC2- GFP-HTwithApaIsite 16 pBD-ColEI- GACTTAgggcccGTCCATT Senseprimerfor ApaI-F TCCGCGCAGACGATGA amplificationoftheregion CGTCACT 1704-5155ofpBD-FSC2- GFP-HTwithApaIsite 17 pBD-TrfA- GCATTAactagtCGCTGGC Antisenseprimerfor SpeI-R TGCTGAACCCCCAGCC amplificationoftheregion GGAACTGACC 1704-5155ofpBD-FSC2- GFP-HTwithSpeIsite 18 pBD-oriV- GTAGCactagtGTACATCA Senseprimerfor SpeI-F CCGACGAGCAAGGC amplificationoftheregion 14373-670ofpBD-FSC2- GFP-HTwithSpeIsite 19 pBD-oriV- CAGTAgacaggctgtcTCGC Antisenseprimerfor AhdI-R GGCCGAGGGGCGCAGCCC amplificationoftheregion 14373-670ofpBD-FSC2- GFP-HTwithAhdIsite 20 pMini>pMicr ggccggccacgcgtTATCTGC Senseprimerfor oBIN-F2 AGAgcgatcgcGAATTGTG amplificationoftheregion AGCGGATAACAATTTCA 2969-85ofpEAQbetawith CACAGGAAACAGCTATGACC FesI-MluI-AsiSIsites 21 pMini>pMicr gcgatcgcTCTGCAGATAac Antisenseprimerfor oBIN-R gcgtggccggccCTCACTGG amplificationoftheregion TGAAAAGAAAAACCACC 2969-85ofpEAQbetawith CCAGTACATTAAAAACGTCC AsiSI-MluI-FesIsites 22 35SP19- ttaattaaGAATTCGAGCTC Senseprimerfor PacI-F GGTACCCCCCTACTCC amplificationofthe35S- P19cassettewithPacIsite 23 35SP19- ggcgcgccATCTTTTATCTT Antisenseprimerfor AscI-R TAGAGTTAAGAACTCTTTCG amplificationofthe35S- P19cassettewithAscIsite 24 35SP19- ggccggccGAATTCGAGCT Senseprimerfor FseI-F CGGTACCCCC amplificationofthe35S- P19cassettewithFseIsite 25 35SP19- ggccggccATCTTTTATCTT Antisenseprimerfor FseI-R TAGAGTTAAG amplificationofthe35S- P19cassettewithFseIsite 26 pBD-NPTII- ggccggccTACAGTATGAG Senseprimerfor FseI-F CGGAGAATTAAGGGAGTCACG amplificationoftheNPTII cassettefrompBD-FSC2- GFP-HTwithFseIsite 27 pBD-NPTII- ggccggccTACAGTCCCGA Antisenseprimerfor FseI-R TCTAGTAACATAGATGA amplificationoftheNPTII CACCGCGC cassettefrompBD-FSC2- GFP-HTwithFseIsite 28 P19-R43W-F CGAGTTGGACTGAGTG Senseprimerfor GTGGCTACATAACGATG mutagenesisofarginine43 AG ofP19toatryptophan residue 29 P19-R43W-R CTCATCGTTATGTAGCC Antisenseprimerfor ACCACTCAGTCCAACTCG mutagenesisofarginine43 ofP19toatryptophan residue 30 P19-NruI-F CCGTTTCTGGAGGGTCT Senseprimerforthesilent CGAACTCTTCAGCATC mutagenesisoftheNruI restrictionsitewithinP19 31 P19-NruI-R GATGCTGAAGAGTTCGA Antisenseprimerforthe GACCCTCCAGAAACGG silentmutagenesisofthe NruIrestrictionsitewithin P19 32 POW-F cgaccggtATGCATCACCA Senseoligoforpolylinker, TCACCATCATcccgggCAT POW CACCATCACCATCACTAGc 33 POW-R tcgagCTAGTGATGGTGA Senseoligoforpolylinker, TGGTGATGcccgggATGA POW TGGTGATGGTGATGCAT accggttcg 34 GFP-AgeI-F atcggaccggtatgactagcaaag Senseoligofor gagaagaac amplificationofGFPwith AgeIsite 35 GFP-XmaI-F atccgacccgggactagcaaagg Senseoligofor agaagaacttttcac amplificationofGFPwith XmaIsiteandnostart codon 36 GFP-XmaI-R atccgacccgggtttgtatagttcat Antisenseoligofor ccatgcc amplificationofGFPwith XmaIsiteandno terminationcodon 37 GFP-XhoI-R cgatcctcgagttatttgtatagtt Antisenseoligofor catccatgcc amplificationofGFPwith XhoIsite
2.3 Results
2.3.1 pBINPLUS Contains at Least 7.4 kb of Extraneous Sequence

(56) Expression from CPMV-HT enables the production of extremely high levels of recombinant proteins. Nevertheless it was desired to further improve the system and its use for transient transformation.

(57) The first area of improvement relates to the fact that small plasmids are more efficient than larger ones in ligation reactions and bacterial transformation procedures. Comparisons with the structures of smaller binary vectors indicated that pBINPLUS likely contains significant amounts of extraneous sequence. Four elements of pBINPLUS were determined to be essential for proper function as a binary vector: the T-DNA, the RK2 (OriV) broad host range replication origin, the NPTIII gene conferring resistance to kanamycin (Trieu-Cuot and Courvalin, 1983), and TrfA from RK2 that promotes replication (FIG. 9). Bioinformatic analysis of the remaining backbone sections show them to be artefacts of the construction of pBIN19, which relied on the presence of appropriate restriction sites within parent plasmids (Bevan, 1984). These observations are confirmed by a report on the complete sequencing of pBIN19 (Frisch et al., 1995). pBINPLUS includes the non-essential ColE1 replication origin for higher copy number in E. coli. Approximately 2.6 kb of superfluous DNA can be found within the T-DNA. This includes the NPTII selectable marker for plant transformation that is not required for transient expression. Overall, the total amount of extraneous sequence within pBINPLUS appears to be in excess of 7.2 kb.

(58) 2.3.2 pEAQ Series Construction

(59) In order to monitor the effects on expression resulting from modifications to vector, we chose to start with the pBINPLUS-derived plasmid, pBD-FSC2-512-U162C(HT). Three regions, consisting of the T-DNA, the RK2 (OriV) replication origin, and a segment containing the ColE1 origin, NPTIII, and TrfA, were amplified by PCR from pBD-FSC2-GFP-HT. Ligation of these three fragments resulted in the plasmid pEAQbeta (FIG. 9), which is 4584 bp smaller than its parent plasmid. A further round of PCR amplification of pEAQbeta removed 2639 bp of non-essential sequence from the T-DNA region and inserted three unique restriction sites, AsiSI, MluI, and FseI. AsiSI/MluI digestion is compatible with the insertion of PacI/AscI fragments, and is therefore, extremely useful for cloning multiple cassettes from all previous CPMV cloning vectors. FseI provides a unique 8-base recognition site useful for interchanging different selection markers or silencing suppressor cassettes. The resulting pEAQGFP-HT plasmid is less than half the size of pBINPLUS and without the CPMVHT expression cassette would be only 5137 bp, making it one of the smallest known binary vectors (FIG. 9). The entire pEAQ plasmid was sequenced and it was discovered that the RK2 origin of replication was in the reverse orientation to that previously reported (Frisch et al., 1995) and is therefore indicated in the correct orientation in pEAQ-GFP-HT.

(60) pEAQ-GFP-HT was used as a starting point for the inclusion of various additional features into the T-DNA (FIG. 10). The NPTII cassette from pBINPLUS was re-inserted into the FseI site of pEAQ in both the forward and reverse orientations relative to the GFP-HT cassette to give pEAQselectK-GFP-HT and pEAQselectK(rev)-GFP-HT. The 35S-P19 cassette was inserted into the FseI site to give pEAQexpress-GFP-HT. Finally, the 35S-P19 cassette was inserted into the Mlu/AsiSI sites of pEAQselectK-GFP-HT to give pEAQspecialK-GFP-HT. Thus, a series of small binary vectors for easy and quick transient expression were constructed.

(61) 2.3.3 Reduction in Size does not Compromise Transient Expression from pEAQ

(62) Agro-infiltration of the pEAQ series of vectors shows that the large reduction in size does not significantly compromise expression levels in transient assays. Coinfiltration of pEAQ-GFP-HT, and pEAQselectK(rev)-GFP-HT with P19 provided by pBIN61-P19, resulted in levels of expression not significantly different to the co-infiltration of pBD-FSC2-512-HT and P19. This can be seen under UV illumination (FIG. 11A), SDS-PAGE (FIG. 11), and spectrofluorescence measurements of GFP in protein extracts (FIG. 11C). Interestingly, the orientation of the NPTII cassette within the T-DNA appears to affect expression level. pEAQselectK shows a marked improvement compared to the otherwise identical pEAQselectK(rev), which results in a reduction in GFP accumulation.

(63) Theoretically, the incorporation of a suppressor of silencing cassette into pEAQ should not affect its ability to improve transient expression level from a foreign gene to be expressed from the same T-DNA. Indeed, the infiltration of pEAQexpress-GFP-HT alone also resulted in expression levels similar to, or better than, pBD-FSC2-GFP-HT

(64) (FIG. 7.3). Furthermore, to test the efficiency of pEAQexpress, the Agrobacterium culture was diluted two-fold, such that the final optical density (OD) was that of each individual culture of the coinfiltrations.

(65) As expected, this resulted in similarly high expression levels and demonstrates that incorporating both the gene of interest and the suppressor of silencing onto the same T-DNA allows the use of half the amount of Agrobacteria (FIG. 11). Therefore, CPMV-HT may be used to express high levels of foreign protein when all components are present on the same T-DNA.

(66) 2.3.4 Mutant P19 can Suppress Silencing of a Transgene in a Transient Assay

(67) In order to take advantage of the increase in expression afforded by the forward orientation of the NPTII cassette within the T-DNA, the P19 cassette was inserted between the AsiSI and MluI sites in pEAQselectK-GFP-HT to give pEAQspecialK-GFP-HT (FIG. 10). The presence of P19 on the same T-DNA as the sequence of GFP results in similar levels of expression to pEAQselectK-GFPHT co-infiltrated with P19 (FIG. 12). This is more than the expression generated by pEAQexpress-GFP-HT, and appears to be due to the presence of the NPTII cassette (FIG. 12). On the other hand, the lower expression from pEAQexpress could be due to the different position and orientation of the P19 cassette within the T-DNA. Nevertheless, as with pEAQexpress, pEAQspecialK vectors give high-level expression with Agrobacteria suspensions at half the final OD of that used when two cultures must be co-infiltrated.

(68) Combining the foreign gene expression cassette with a P19 cassette and a selectable marker makes it possible to test the performance of CPMV-HT in transgenic plants. However, the constitutive expression of suppressors of silencing like P19 can result in severe phenotypes due to their interference with endogenous gene silencing associated with developmental processes (Silhavy and Burgyan, 2004). A recently characterised mutation of P19 (R43W) has been proposed to have a reduced activity towards endogenous gene silencing and therefore may be a better candidate for the suppression of transgene silencing in stable transformants (Scholthof, 2007). To investigate the feasibility of stable transformation with the CPMV-HT system, both wt and the mutant P19 were inserted into the T-DNA of pEAQselectK-GFP-HT to assay the variants transiently. As shown by, UV illumination of infiltrated leaves, SDS-PAGE of protein extracts, and spectrofluorometric measurements of GFP levels, the mutant P19 in pEAQspecialKm is approximately half as effective in improving foreign gene expression as the wt P19 in pEAQspecialK (FIG. 12). This represents the first study on the effect of the R43W mutation in P19 on the ability to suppress silencing of a transgene.

Example 3

(69) High Level IgG Expression from a Single Plasmid

(70) In order to take advantage of the modular nature of the pEAQ series, CPMV-HT expression cassettes containing the ER-retained heavy chain (HE) and light chain (L) of the human anti-HIV IgG, 2G12 were inserted into the PacI/AscI and AsiSI/MluI sites of pEAQexpress. To determine whether the site of insertion influences expression levels, the L and HE chains were inserted into both positions yielding pEAQex-2G12HEL and pEAQex-2G12LHE (FIG. 13A). Infiltration of N. benthamiana with single Agrobacterium cultures containing the above plasmids resulted in the formation of fully assembled 2G12 antibodies identical in size to 2G12 produced by mixing three Agrobacterium cultures which each expressed the individual components, L, HE and P19 (FIG. 13C). The protein loaded in each lane represents 1/30 of the extract obtained from 90 mg of infiltrated tissue or 1/333 of the protein potentially obtainable from 1 g of tissue. The maximum amount of assembled IgG produced from the 3-strain mixture corresponds to 1 g of CHO-produced 2G12 on the coomassie-stained non-reduced SDS-PAGE gel. This suggests an expression level of 2G12 in excess of 325 mg/kg of fresh weight tissue, which is in agreement with the SPR-measured concentrations. The use of pEAQex-2G12HEL appears to surpass this already high-level of antibody accumulation.

(71) An advantage of pEAQ-derived vectors is that each component of a multi-chain protein such as an IgG can automatically be delivered to each infected cell. Therefore, high expression levels should be maintained at higher dilutions of Agrobacteria suspensions than if multiple cultures have to be used. To test if this is the case in practice, cultures that were initially resuspended to OD 1.2, and mixed where necessary, were subjected to two serial three-fold dilutions (FIG. 13B). This resulted in final ODs of each individual culture in the three-culture mix being 0.4, 0.13, and 0.04. Single cultures harbouring the pEAQexpress constructs were infiltrated at ODs of 1.2, 0.4, and 0.13. When three separate cultures were used, the level of assembled 2G12 decreases markedly on serial dilution. In contrast, 2G12 expression from pEAQex-2G12HEL and pEAQex-2G12LHE, was maintained at a consistently high level, with any reduction on dilution being very modest (FIG. 13C-E). The lack of sensitivity to dilution confirms the improved efficiency afforded by placing all three expression cassettes on the same T-DNA. Interestingly, the amount of total protein extracted from the infiltrated tissue was almost halved when the OD of the infiltrate was reduced from 1.2 to 0.4. This suggests that a significant fraction of the protein in extracts from tissue in which the higher OD suspension has been infiltrated can consist of Agrobacteria-derived protein or plant proteins produced in response to the higher concentrations of Agrobacteria.

(72) Inspection of FIG. 13C suggests that the relative position of a cassette within the T-DNA can affect the expression levels. The overall expression from pEAQex-2G12LHE was slightly lower than from pEAQex-2G12HEL. This was confirmed by western blotting of the non-reduced samples, which also indicated some differences in the abundance of degradation products and unincorporated immunoglobulin chains (FIG. 13C-E). Tissue infiltrated with pEAQex-2G12LHE appears to lack a heavy chain-specific degradation product of approximately 70 to 80 kDa (FIG. 13D). Also, there appears to be much less of the HL2 assembly intermediate, as well as more free light chain (FIG. 13E). Since, the heavy chain is known to be limiting in 2G12 assembly in plants (Markus Sack, pers. comm., RWTH, Aachen, Germany), which is confirmed by the lack of discernable free heavy chain in all samples, these results indicate that pEAQex-2G12LHE produces less heavy chain than pEAQex-2G12HEL. This could be due to reduced expression from the CPMV-HT cassette closer to the left border of the T-DNA.

(73) In other experiments (data not shown) the CPMV-HT system has also been successfully used in the transient format in N. benthamiana to express: Bluetongue Virus (serotype 10) VP2, VP3, VP5, VP7 and NS1. Rotavirus NSP5. Calmodulin from Medicago truncatula (which was subsequently purified). The difficult-to-express ectodomain of human Fc gamma receptor 1 (CD64)which has been purified and shown to be functional in antibody binding studies. The CPMV Small (S) and Large (L) coat proteins were co-expressed and shown to assemble into virus-like particles (data not shown)

Example 4

(74) Direct Cloning into a CPMV-HT Expression Vector

(75) Although combining elements of the system on to a single plasmid, the vectors described hereinbefore still required a two-step cloning procedure to introduce a sequence to be expressed into the binary plasmid. The present example provides a binary plasmid into which a gene of interest could be directly inserted. The plasmid incorporates a polylinker that not only permits direct insertion into the pEAQ-based plasmid, but also permits the fusion of a C- or N-terminal histidine tag if desired (pEAQ-HT; FIG. 14A). The polylinker was first inserted as annealed oligonucleotides into pM81-FSC2-512(A115G)(U162C) giving pM81-FSC-POW. This construct can still be used for the standard two-step cloning procedure for the generation pEAQ-based constructs for the expression of multiple polypeptides. Furthermore, use of the double mutated 5 leader may enable even higher expression levels to be obtained than is possible with the single mutation. The CPMV-HT cassette was then transferred into pEAQspecialK via the PacI/AscI sites to give pEAQ-HT. Insertion of GFP into all three positions within the polylinker of pEAQ-HT resulted in an un-tagged GFP, and 5 (HisGFP) and 3 (GFPHis) His-tag fusions.

(76) As expected, untagged GFP was expressed to a level even higher than that obtained with pEAQspecialK-GFP-HT and in excess of 1.6 g/kg FW tissue (FIG. 14B). This is likely due to the fact that the CPMV 5 leader of pEAQ-HT contains the extra mutation which removes AUG 115 which, when removed in addition to AUG 161, further enhances expression.

(77) The presence of the His-tag as detected by western blotting confirmed the correct fusion at both the N- and C-terminus of the amino acid residues encoded by the polylinker. All three GFP variants were detectable with anti-GFP antibodies whereas only HisGFP and GFPHis were detectable with anti-His antibodies (FIG. 14C), and the presence of the His-tag reduced the mobility of the GFP band in SDS-PAGE by the expected amount. The tag also reduced the amount of GFP detected by the analysis of fluorescence (FIG. 14B). This effect was more pronounced for N-terminal His tag. The intensity of the coomassie-stained bands suggests that this represents a reduction in tagged GFP accumulation (FIG. 14C), rather than interference with the fluorogenic properties of GFP. Nevertheless, the levels of the His-tagged proteins were still very high yielding in excess of 0.6 and 1.0 g of GFP per kg FW tissue.

Discussion of Examples 2-4

(78) To improve the ease of use and performance of the CPMV-HT expression system, a modular set of vectors has been created for easy and quick plant expression.

(79) Removing more than half of the plasmid backbone from the binary vector, pBINPLUS, and some of the T-DNA region not essential for transient expression resulted in one of the smallest binary Ti plasmids known with no compromise on expression levels.

(80) A similar proportion of the backbone had previously been removed from pBIN19 without a loss of performance (Xiang et al., 1999). However, pBINPLUS possesses two significant improvements over pBIN19 (van Engelen et al., 1995); an increased copy number in E. coli owing to the addition of the ColE1 origin of replication and a reoriented T-DNA ensuring the gene of interest is further from the left border that can suffer extensive deletions in planta (Rossi et al., 1996). While the smaller size of pEAQ plamids had no noticeable effect on their copy number, they give greatly improved yields during cloning procedures using commercial plasmids extraction kits as these are most efficient for plasmids below 10 kb (data not shown).

(81) The modular nature of the pEAQ binary vector adds functionality to CPMV-HT expression by allowing any silencing suppressor and/or marker gene, if required, to be co-expressed with one or two CPMV-HT cassettes. For example, insertion of a second HT cassette containing a heterologous sequence into the AsiSI/MluI sites of pEAQexpress-GFP-HT would allow tracking of expression with GFP fluorescence.

(82) Furthermore, the flexibility of the vectors simplifies the system for transient expression by only requiring the infiltration of a single Agrobacterium construct, and improves efficiency by reducing the amount of infiltrate required in proportion to the number of expression cassettes present within the T-DNA. With P19 occupying the FseI site, the presence of two cloning sites for accepting HT cassettes from cloning vectors (such as pM81-FSC2-U162C) also allows even more efficient expression of multi-subunit proteins such as full-size antibodies.

(83) The effect of P19 on enhancing expression levels of transgenes is well characterised (Voinnet et al., 2003). However, this study presents the first demonstration of its effectiveness when co-delivered to each cell on the same TDNA. A previous study has reported the co-delivery of P19 from a separate TDNA within the same Agrobacterium as the transgene-containing T-DNA (Hellens et al., 2005). However, there was no effect of P19 until 6 days after infiltration, suggesting inefficient transfer of T-DNA. The present study also demonstrates the first use of the R43W mutant P19 to enhance the expression of a transgene. The finding that the mutant was about half as effective in enhancing the expression of GFP as wt P19 agrees with its known reduction in activity, which compromises both the infectivity of TBSV (Chu et al., 2000), and the ability of the protein to bind the smaller class (21-22 nts) of short interfering RNAs (Omarov et al., 2006). However, it is possible that this feature potentially makes the R43W mutant more suitable for applications involving stable transformation. The micro RNAs associated with development are also in the smaller size class (Vaucheret, 2006; Zhang et al., 2006) and, therefore, developmental processes may not be as severely affected by the presence of the mutant P19 as they would by the wt version (Scholthof, 2007). Furthermore, the mutant may provide a way of controlling the transient expression of potentially cytotoxic foreign proteins.

(84) The expression of 2G12 from a single plasmid represents the highest reported yield of an antibody from plant tissue infiltrated with a single Agrobacterium culture. Apart from using 3 Agrobacterium cultures for CPMV-HT expression, the only way of achieving similar levels with another system involved the infiltration of 6 separate cultures and a virus vector approach (Giritch et al., 2006). Furthermore, the use of a single plasmid affords a reduction in the amount of bacteria needed to ensure co-delivery of multiple expression cassettes, which would provide a significant cost saving at industrial production levels. The infiltration process is also physically easier to carry out with more dilute cultures due to less clogging of the intercellular spaces of leaf tissue. In addition, the dilution to a total OD of 0.4 reduced the amount of infiltration-derived protein contaminants. Analysis of nine separate infiltrations at each OD showed a reduction in the protein concentrations of the extracts from 2.70.2 to 1.50.1 mg/ml when the OD of the cultures was reduced from 1.2 to 0.4. Since the use of pEAQexpress generates as much 2G12 at OD 0.4 as the three-culture system does at an infiltrate OD of 1.2, the recombinant target protein must be purified from only half the amount of contaminating protein using pEAQexpress. This provides a very useful and unexpected advantage for downstream processing. Expression of 2G12 from pEAQexpress also indicates an effect of position of an expression cassette within the T-DNA of pEAQ vectors on the level of expression obtained. The increase in free light chain accumulation from pEAQex-2G12LHE suggests that less heavy chain is expressed with this construct, which appears to result in less assembled antibody. This could be due to the arrangement of expression cassettes on the T-DNA. Alternatively, a proportion of the T-DNAs are susceptible to nucleolytic degradation at the left border (Rossi et al., 1996). The reinsertion of the NPTII cassette within the T-DNA appeared to have a marked effect on expression depending on its orientation. During cloning manipulations it became apparent that pEAQselectK-GFP-HT reached a plasmid copy number in E. coli of approximately 1.5 times that of pEAQselectK(rev)-GFP-HT (determined from yield measurements of three separate plasmid preparations performed with the QIAprep kit, QIAGEN). This loosely correlates to the difference in expression levels observed between the two vectors. It is not known what contributes to the increased copy number, or indeed whether the difference also exists when the plasmids are transferred to Agrobacteria. However, these observations suggest that plasmid copy number may be an important for efficient Agrobacterium mediated transient expression. In this respect, the use of the RK2 origin (oriV in FIG. 9) by pBIN19 and its derivatives makes it a good choice for transient expression as RK2 plasmids are known to accumulate to 7 to 10 copies in Agrobacterium (Veluthambi et al., 1987). This is similar to the pVS1 origin utilised by pPZP and about 2-5 times higher than is generated by the pSa origin (Lee and Gelvin, 2008), which is present in the widely used pGREEN binary vector (Helens et al., 2000). Plasmids containing replication origins that yield higher copy numbers such as pRi-based plasmids (Lee and Gelvin, 2008) may be even better suited to transient expression.

(85) To make high-level expression with pEAQ vectors easily accessible for labs with no previous experience with CPMV-based expression or indeed, plant-based expression in general, a direct cloning version of pEAQ was created. This was achieved by inserting a polylinker between the 5 leader and 3 UTRs of a CPMVHT expression cassette, which was the positioned on a T-DNA which also contained P19 and NPTII cassettes. The NPTII cassette was included because its presence appeared to appreciably enhance expression (see above). The polylinker also encodes two sets of 6 Histidine residues to allow the fusion of N- or C terminal His-tags to facilitate protein purification. The resulting constructs also benefit from the second mutation in the 5 leader which enhances expression relative to HT.

(86) These enhanced expression cassettes may also be sub-cloned from the cloning vector pM81-FSC-POW into any pEAQ plasmid. The use of pEAQHT led to increased GFP expression compared with pEAQspecialK, which contains just the single mutation (U162C). Furthermore, the polylinker design also allowed the expression of His-tagged variants using a one step cloning procedure. The modular binary vectors presented here are specifically designed for, but not restricted to, use with CPMV-HT expression. Extremely high-level expression has been coupled with improved cloning efficiency and ease of use. The system provides the most effective and straightforward method for transient expression of value-added proteins in plants without the complications of viral amplification. It allows milligram quantities of recombinant protein within two weeks of sequence identification in any molecular biology lab with access to plant growth facilities. Therefore, it is anticipated that it will provide an extremely valuable tool in both academic and industrial settings.

Example 5

(87) Stable Integration with pEAQ Plasmids and Transgenic Plants

(88) Although the pEAQ vector series was designed with transient expression in mind, the reinsertion of the NPTII cassette into the T-DNA to provides a selectable marker for genome integration. This potentially allows these smaller and more useful binary vectors to be used for stable plant and plant cell culture transformation. When used to transform N. benthamiana leaf discs, pEAQ vectors containing the NPTII cassette within the T-DNA were able to induce callus formation under selection with the same efficiency as pBINPLUS-based constructs. Furthermore, GFP expression was detectable in these tissues under UV light (data not shown). This demonstrates that multi-cassette T-DNA molecules from pEAQ vectors can stably integrate into the plant genome and drive the expression of foreign genes.

(89) Fluorescent plants have also been regenerated. The leaves of the primary transformants (To) were fluorescent under uv light indicating high levels of GFP expression. The seed from the self-fertilised To plants were viable, and the resulting Ti seedlings harbouring the transgene are also fluoresecent (results not shown).

Example 6

(90) Use of the CPMV-Based HT System with Baculovirus Vectors

(91) FIG. 15 shows a construct suitable for utilising the CPMV-based HT system with baculovirus vectors in insect cells. Under control of the p10 promoter, the HyperTrans CPMV RNA-2 UTRs also enhance the expression of GFP in insect cells using the Baculovirus expression system. An approximately 5-fold enhancement of fluorescence levels in baculovirus-infected sf21 cells, as measured by flow cytometry, was obtained in comparison to a construct without the CPMV-HT cassette.

REFERENCES

(92) Alamillo, J. M., Monger, W., Sola, I., Garcia, B., Perrin, Y., Bestagno, M., Burrone, O. R., Plana-Duran, J., Enjuanes, L., Lomonossoff, P. G. and Garcia, J. A. (2006) Use of virus vectors for the expression in plants of active full-length and single chain anticoronavirus antibodies. Biotechnol. J. 1, 1103-1111. Brigneti, G., Voinnet, O., Li, W. X., Ji, L. H., Ding, S. W and Baulcombe, D. C. (1998) Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO Journal 17: 6739-6746. Caizares, M. C., Liu, L., Perrin, Y., Tsakiris, E. and Lomonossoff, G. P. (2006). A bipartite system for the constitutive and inducible expression of high levels of foreign proteins in plants. Plant Biotechnol. J. 4, 183-193. Gopinath, K., Wellink, J., Porta, C., Taylor, K. M., Lomonossoff, G. P. and van Kammen, A. (2000) Engineering cowpea mosaic virus RNA-2 into a vector to express heterologous proteins in plants. Virology 267: 159-173. Holness, C. L., Lomonossoff, G. P., Evans, D. and Maule, A. J. (1989). Identification of the initiation codons for translation of cowpea mosaic virus middle component RNA using site directed mutagenesis of an infectious cDNA clone. Virology 172, 311320. Liu, L. and Lomonossoff, G. P. (2002) Agroinfection as a rapid method for propagating Cowpea mosaic virus-based constructs. J. Virol. Methods 105, 343-348. Liu, L. and Lomonossoff, G. P. (2006) A site-directed mutagenesis method utilising large double-stranded DNA templates for the simultaneous introduction of multiple changes and sequential multiple rounds of mutation: Application to the study of whole viral genomes. J. Virol. Methods 137, 63-71. Liu, L., Canizares, M. C., Monger, W., Perrin, Y., Tsakiris, E., Porta, C., Shariat, N., Nicholson, L. and Lomonossoff, G. P. (2005). Cowpea mosaic virus-based systems for the production of antigens and antibodies in plants. Vaccine 23, 1788-1792. Lomonossoff, G. P. & Shanks, M. (1983). The nucleotide sequence of cowpea mosaic virus B RNA. EMBO Journal 2, 2253-2258. Mechtcheriakova, I. A., Eldarov, M. A., Nicholson, L., Shanks, M., Skryabin, K. G. and Lomonossoff, G. P. (2006) The use of viral vectors to produce hepatitis B virus core particles in plants. J. Virol. Methods 131, 10-15. Monger, W., Alamillo, J. M., Sola, I., Perrin, Y., Bestagno, M., Burrone, O R., Sabella, P., Plana-Duran, J., Enjuanes, L., Garcia, J. A. and Lomonossoff, G. P. (2006) An antibody derivative expressed from viral vectors passively immunizes pigs against transmissible gastroenteritis virus infection when supplied orally in crude plant extracts. Plant Biotechnol. J. 4, 623-631. Rohll, J. B., Holness, C. L., Lomonossoff, G. P. and Maule, A. J. (1993). 3 terminal nucleotide sequences important for the accumulation of cowpea mosaic virus M-RNA. Virology 193, 672-679. Sainsbury, F., Lavoie, P-O., D'Aoust, M-A., Vezina, L-P. and Lomonossoff, G. P. (2008). Expression of Multiple Proteins Using Full-Length and Deleted Versions of Cowpea Mosaic Virus RNA-2. Plant Biotechnology Journal, 6: 82-92. Sainsbury, F., Caizares, M. C. and Lomonossoff, G. P. (2007) Cowpea mosaic virus-based expression vectors. In: Virus Expression Vectors (Hefferon, K. ed), pp. 339-555. Kerala, India: Transworld Research Network. Sainsbury, F. and Lomonossoff, G. P. (2008). Extremely high-level and rapid transient protein production in plants without the use of viral replication. Plant Physiology 148, 1212-1218. Sainsbury, F., Liu, L. and Lomonossoff G. P. (2009) Cowpea mosaic virus-based expression of antigens and antibodies in plants. In: Methods in Molecular Biology Vol. 483: Recombinant Pharmaceutical Proteins from Plants (Faye, L. and Gomord, V. eds), pp 25-39, NY: Humana Press. van Bokhoven, H., Le Gall, O, Kasteel, D., Verver, J., Wellink, J. and van Kammen, A. (1993). Cis- and Trans-acting Elements in Cowpea Mosaic Virus RNA Replication. Virology 195, 377-386. Wellink J, Verver J, van Kammen A. (1993). Mutational analysis of AUG codons of cowpea mosaic virus M RNA. Biochimie. 75(8):741-7.

ADDITIONAL REFERENCES

(93) Lee L Y, Gelvin S B (2008) T-DNA binary vectors and systems. Plant Physiology 146: 325-332 Hajdukiewicz P, Svab Z, Maliga P (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Molecular Biology 25: 989-994 Hellens R, Mullineaux P, Klee H (2000b) A guide to Agrobacterium binary Ti vectors. Trends in Plant Science 5: 446-451 Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza-sativa L) mediated by Agrobacterium and sequence-analysis of the boundaries of the T-DNA. Plant Journal 6: 271-282 Veluthambi K, Jayaswal R K, Gelvin S B (1987) Virulence genes-a, gene-G, and gene-D mediate the double-stranded border cleavage of T-DNA from the Agrobacterium Ti plasmid. Proceedings of the National Academy of Sciences of the United States of America 84: 1881-1885 Thole V, Worland B, Snape J W, Vain P (2007) The pCLEAN dual binary vector system for Agrobacterium-Mediated plant transformation. Plant Physiology 145: 1211-1219 Johansen L K, Carrington J C (2001) Silencing on the spot. Induction and suppression of RNA silencing in the Agrobacterium-mediated transient expression system. Plant Physiology 126: 930-938 Janssen B J, Gardner R C (1989) Localized transient expression of Gus in leaf-disks following cocultivation with Agrobacterium. Plant Molecular Biology 14: 61-72 Narasimhulu S B, Deng X, Sarria R, Gelvin S B (1996) Early transcription of Agrobacterium T-DNA genes in tobacco and maize. Plant Cell 8: 873-886 Hellens R P, Edwards E A, Leyland N R, Bean S, Mullineaux P M (2000a) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Molecular Biology 42: 819-832 Tzfira T, Tian G W, Lacroix B, Vyas S, Li J X, Leitner-Dagan Y, Krichevsky A, Taylor T, Vainstein A, Citovsky V (2005) pSAT vectors: a modular series of plasmids for autofluorescent protein tagging and expression of multiple genes in plants. Plant Molecular Biology 57: 503-516 Voinnet O, Rivas S, Mestre P, Baulcombe D (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant Journal 33: 949-956 Frisch D A, Harrishaller L W, Yokubaitis N T, Thomas T L, Hardin S H, Hall T C (1995) Complete sequence of the binary vector BIN-19. Plant Molecular Biology 27: 405-409 Trieu-cuot P, Courvalin P (1983) Nucleotide-sequence of the Streptococcus-faecalis plasmid gene encoding the 35-Aminoglycoside phosphotransferase type-III. Gene 23: 331-341 Bevan M (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research 12: 8711-8721 Silhavy D, Burgyan J (2004) Effects and side-effects of viral RNA silencing suppressors on short RNAs. Trends in Plant Science 9: 76-83 Scholthof H B (2007) Heterologous expression of viral RNA interference suppressors: RISC management. Plant Physiology 145: 1110-1117 van Engelen F A, Molthoff J W, Conner A J, Nap J P, Pereira A, Stiekema W J (1995) pBINPLUSan improved plant transformation vector based on pBIN19. Transgenic Research 4: 288-290 Rossi L, Hohn B, Tinland B (1996) Integration of complete transferred DNA units is dependent on the activity of virulence E2 protein of Agrobacterium tumefaciens. Proceedings of the National Academy of Sciences of the United States of America 93: 126-130 Xiang C B, Han P, Lutziger I, Wang K, Oliver D J (1999) A mini binary vector series for plant transformation. Plant Molecular Biology 40: 711-717 Hellens R P, Allan A C, Friel E N, Bolitho K, Grafton K, Templeton M D, Karunairetnam S, Gleave A P, Laing W A (2005) Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1: 13 Chu M, Desvoyes B, Turina M, Noad R, Scholthof H B (2000) Genetic dissection of tomato bushy stunt virus p19-protein-mediated host-dependent symptom induction and systemic invasion. Virology 266: 79-87 Omarov R, Sparks K, Smith L, Zindovic J, Scholthof H B (2006) Biological relevance of a stable biochemical interaction between the tombusvirus-encoded P19 and short interfering RNAs. Journal of Virology 80: 3000-3008 Vaucheret H (2006) Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes & Development 20: 759-771 Zhang B H, Pan X P, Cobb G P, Anderson T A (2006) Plant microRNA: A small regulatory molecule with big impact. Developmental Biology 289: 3-16 Giritch A, Marillonnet S, Engler C, van Eldik G, Botterman J, Klimyuk V, Gleba Y (2006) Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors. Proceedings of the National Academy of Sciences of the United States of America 103: 14701-14706

(94) TABLE-US-00002 TABLE2 SEQIDNO:1 ThecompleteCPMVRNA-2genomesegment (nucleotides1to3481) 1 tattaaaatcttaataggttttgataaaagcgaacgtggggaaacccgaaccaaaccttc 61 ttctaaattctctctcatctctcttaaagcaaacttctctcttgtctttcttgcatgagc 121 gatcttcaacgttgtcagatcgtgcttcggcaccagtacaatgttttctttcactgaagc 181 gaaatcaaagatctctttgtggacacgtagtgcggcgccattaaataacgtgtacttgtc 241 ctattcttgtcggtgtggtcttgggaaaagaaagcttgctggaggctgctgttcagcccc 301 atacattacttgttacgattctgctgactttcggcgggtgcaatatctctacttctgctt 361 gacgaggtattgttgcctgtacttctttcttcttcttcttgctgattggttctataagaa 421 atctagtattttctttgaaacagagttttcccgtggttttcgaacttggagaaagattgt 481 taagcttctgtatattctgcccaaatttgaaatggaaagcattatgagccgtggtattcc 541 ttcaggaattttggaggaaaaagctattcagttcaaacgtgccaaagaagggaataaacc 601 cttgaaggatgagattcccaagcctgaggatatgtatgtgtctcacacttctaaatggaa 661 tgtgctcagaaaaatgagccaaaagactgtggatctttccaaagcagctgctgggatggg 721 attcatcaataagcatatgcttacgggcaacatcttggcacaaccaacaacagtcttgga 781 tattcccgtcacaaaggataaaacacttgcgatggccagtgattttattcgtaaggagaa 841 tctcaagacttctgccattcacattggagcaattgagattattatccagagctttgcttc 901 ccctgaaagtgatttgatgggaggctttttgcttgtggattctttacacactgatacagc 961 taatgctattcgtagcatttttgttgctccaatgcggggaggaagaccagtcagagtggt 1021 gaccttcccaaatacactggcacctgtatcatgtgatctgaacaatagattcaagctcat 1081 ttgctcattgccaaactgtgatattgtccagggtagccaagtagcagaagtgagtgtaaa 1141 tgttgcaggatgtgctacttccatagagaaatctcacaccccttcccaattgtatacaga 1201 ggaatttgaaaaggagggtgctgttgttgtagaatacttaggcagacagacctattgtgc 1261 tcagcctagcaatttacccacagaagaaaaacttcggtcccttaagtttgactttcatgt 1321 tgaacaaccaagtgtcctgaagttatccaattcctgcaatgcgcactttgtcaagggaga 1381 aagtttgaaatactctatttctggcaaagaagcagaaaaccatgcagttcatgctactgt 1441 ggtctctcgagaaggggcttctgcggcacccaagcaatatgatcctattttgggacgggt 1501 gctggatccacgaaatgggaatgtggcttttccacaaatggagcaaaacttgtttgccct 1561 ttctttggatgatacaagctcagttcgtggttctttgcttgacacaaaattcgcacaaac 1621 tcgagttttgttgtccaaggctatggctggtggtgatgtgttattggatgagtatctcta 1681 tgatgtggtcaatggacaagattttagagctactgtcgcttttttgcgcacccatgttat 1741 aacaggcaaaataaaggtgacagctaccaccaacatttctgacaactcgggttgttgttt 1801 gatgttggccataaatagtggtgtgaggggtaagtatagtactgatgtttatactatctg 1861 ctctcaagactccatgacgtggaacccagggtgcaaaaagaacttctcgttcacatttaa 1921 tccaaacccttgtggggattcttggtctgctgagatgataagtcgaagcagagttaggat 1981 gacagttatttgtgtttcgggatggaccttatctcctaccacagatgtgattgccaagct 2041 agactggtcaattgtcaatgagaaatgtgagcccaccatttaccacttggctgattgtca 2101 gaattggttaccccttaatcgttggatgggaaaattgacttttccccagggtgtgacaag 2161 tgaggttcgaaggatgcctctttctataggaggcggtgctggtgcgactcaagctttctt 2221 ggccaatatgcccaattcatggatatcaatgtggagatattttagaggtgaacttcactt 2281 tgaagttactaaaatgagctctccatatattaaagccactgttacatttctcatagcttt 2341 tggtaatcttagtgatgcctttggtttttatgagagttttcctcatagaattgttcaatt 2401 tgctgaggttgaggaaaaatgtactttggttttctcccaacaagagtttgtcactgcttg 2461 gtcaacacaagtaaaccccagaaccacacttgaagcagatggttgtccctacctatatgc 2521 aattattcatgatagtacaacaggtacaatctccggagattttaatcttggggtcaagct 2581 tgttggcattaaggatttttgtggtataggttctaatccgggtattgatggttcccgctt 2641 gcttggagctatagcacaaggacctgtttgtgctgaagcctcagatgtgtatagcccatg 2701 tatgatagctagcactcctcctgctccattttcagacgttacagcagtaacttttgactt 2761 aatcaacggcaaaataactcctgttggtgatgacaattggaatacgcacatttataatcc 2821 tccaattatgaatgtcttgcgtactgctgcttggaaatctggaactattcatgttcaact 2881 taatgttaggggtgctggtgtcaaaagagcagattgggatggtcaagtctttgtttacct 2941 gcgccagtccatgaaccctgaaagttatgatgcgcggacatttgtgatctcacaacctgg 3001 ttctgccatgttgaacttctcttttgatatcatagggccgaatagcggatttgaatttgc 3061 cgaaagcccatgggccaatcagaccacctggtatcttgaatgtgttgctaccaatcccag 3121 acaaatacagcaatttgaggtcaacatgcgcttcgatcctaatttcagggttgccggcaa 3181 tatcctgatgcccccatttccactgtcaacggaaactccaccgttattaaagtttaggtt 3241 tcgggatattgaacgctccaagcgtagtgttatggttggacacactgctactgctgctta 3301 actctggtttcattaaattttctttagtttgaatttactgttatttggtgtgcatttcta 3361 tgtttggtgagcggttttctgtgctcagagtgtgtttattttatgtaatttaatttcttt 3421 gtgagctcctgtttagcaggtcgtcccttcagcaaggacacaaaaagattttaattttat 3481 t
The start codons at positions 115, 161, 512 and 524 of the CPMV RNA-2 genome segment are shown in bold and underlined.

(95) TABLE-US-00003 TABLE3 Oligonucleotidesusedinthemutagenesisof the5regionofpM81-FSC-2clones SEQ ID Oligo- NO: nucleotide Sequence Mutation 2 A115G-F CTTGTCTTTCTT RemovesAUG GCGTGAGCGATC (.fwdarw.GUG)at115 TTCAACG eliminating 3 A115G-R CGTTGAAGATCG translation CTCACGCAAGAA fromuORF AGACAAG 4 U162C-F GGCACCAGTACA RemovesAUG(.fwdarw.ACG) ACGTTTTCTTTC at161eliminating ACTGAAGCG translationfromAUG 5 U162C-R CGCTTCAGTGAA 161whilemaintaining AGAAAACGTTGT aminoacidsequence ACTGGTGCC ofuORF
The mutant nucleotide of the oligonucleotides used in the mutagenesis of the 5 region of pM8l-FSC-2 clones are shown in bold

(96) TABLE-US-00004 TABLE4 SEQID CPMVwt tatattctgcccaaatttgaaatggaaagc NO:6 sequence attatgagccgtggtattcc from Table1 SEQID Mutated tatattctgcccaaatttgTCatgAaaagc NO:7 sequence attatgagccgtggtattcc inpM81- 509 FSC-1 BspH1 SEQID Mutated tatattctgcccaaattCGCGACGATCGTA NO:8 sequence CTCTCGAGGCCT inpM81- 507 FSC-2 Nru1Xho1
Nucleotide differences between the sequence of the pM81-FSC-1 and pM81-FSC-2 vectors and the CPMV wt sequence from Table 2 are shown as capital letters.

(97) TABLE-US-00005 Nucleotide Sequence of pM81-FSC-1 SEQIDNO:9 LOCUS pM81-FSC17732bpDNAcircular 10Oct.2007 FEATURES Location/Qualifiers 5UTR 342..501 /vntifkey=52 /label=CPMV\RNA2\5UTR promoter 27..341 /vntifkey=29 /label=CaMV\35S\promoter terminator 4669..4921 /vntifkey=43 /label=Nos\Terminator mat_peptide 3712..4422 /vntifkey=84 /label=GFP 3UTR 4432..4615 /vntifkey=50 /label=CPMV\RNA2\3UTR CDS complement(5944..6804) /vntifkey=4 /label=AmpR misc_feature complement(7391..7546) /vntifkey=21 /label=lacZ_a promoter complement(6846..6874) /vntifkey=30 /label=AmpR\promoter rep_origin complement(7067..7373) /vntifkey=33 /label=fl_origin rep_origin complement(5170..5789) /vntifkey=33 /label=pBR322_origin mat_peptide 502..1878 /vntifkey=84 /label=CPMV\Movement\Protein mat_peptide 1879..2999 /vntifkey=84 /label=CPMV\Lg.\Coat\Protein mat_peptide 3000..3638 /vntifkey=84 /label=CPMV\Sm.\Coat\Protein BASECOUNT 2105a1682c1770g2175t ORIGIN 1 ttaattaagaattcgagctccaccgcggaaacctcctcggattccattgcccagctatct 61 gtcactttattgagaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcg 121 ataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccc 181 cacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtgg 241 attgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaag 301 acccttcctctatataaggaagttcatttcatttggagaggtattaaaatcttaataggt 361 tttgataaaagcgaacgtggggaaacccgaaccaaaccttcttctaaactctctctcatc 421 tctcttaaagcaaacttctctcttgtctttcttgcatgagcgatcttcaacgttgtcaga 481 tcgtgcttcggcaccagtacaatgttttctttcactgaagcgaaatcaaagatctctttg 541 tggacacgtagtgcggcgccattaaataacgtgtacttgtcctattcttgtcggtgtggt 601 cttgggaaaagaaagcttgctggaggctgctgttcagccccatacattacttgttacgat 661 tctgctgactttcggcgggtgcaatatctctacttctgcttgacgaggtattgttgcctg 721 tacttctttcttcttcttcttgctgattggttctataagaaatctagtattttctttgaa 781 acagagttttcccgtggttttcgaacttggagaaagattgttaagcttctgtatattctg 841 cccaaatttgtcatgaaaagcattatgagccgtggtattccttcaggaattttggaggaa 901 aaagctattcagttcaaacgtgccaaagaagggaataaacccttgaaggatgagattccc 961 aagcctgaggatatgtatgtgtctcacacttctaaatggaatgtgctcagaaaaatgagc 1021 caaaagactgtggatctttccaaagcagctgctgggatgggattcatcaataagcatatg 1081 cttacgggcaacatcttggcacaaccaacaacagtcttggatattcccgtcacaaaggat 1141 aaaacacttgcgatggccagtgattttattcgtaaggagaatctcaagacttctgccatt 1201 cacattggagcaattgagattattatccagagctttgcttcccctgaaagtgatttgatg 1261 ggaggctttttgcttgtggattctttacacactgatacagctaatgctattcgtagcatt 1321 tttgttgctccaatgcggggaggaagaccagtcagagtggtgaccttcccaaatacactg 1381 gcacctgtattatgtgatctgaacaatagattcaagctcatttgctcattgccaaactgt 1441 gatattgtccagggtagccaagtagcagaagtgagtgtaaatgttgcaggatgtgctact 1501 tccatagagaaatctcacaccccttcccaattgtatacagaggaatttgaaaaggagggt 1561 gctgttgttgtagaatacttaggcagacagacctattgtgctcagcctagcaatttaccc 1621 acagaagaaaaacttcggtcccttaagtttgactttcatgttgaacaaccaagtgtcctg 1681 aagttatccaattcctgcaatgcgcactttgtcaagggaaaaagtttgaaatactctatt 1741 tctggcaaagaagcagaaaaccatgcagttcatgctactgtggtctctcgagaaggggct 1801 tctgcggcacccaagcaatatgatcctattttgggacgggtgctggatccacgaaatggg 1861 aatgtggcttttccacaaatggagcaaaacttgtttgccctttctttggatgatacaagc 1921 tcagttcgtggttctttgcttgacacaaaattcgcacaaactcgagttttgttgtccaag 1981 gctatggctggtggtgatgtgttattggatgagtatctctatgatgtggtcaatggacaa 2041 gattttagagctactgtcgcttttttgcgcacccatgttataacaggcaaaataaaggtg 2101 acagctaccaccaacatttctgacaactcgggttgttgtttgatgttggccataaatagt 2161 ggtgtgaggggtaagtatagtactgatgtttatactatctgctctcaagactccatgacg 2221 tggaacccagggtgcaaaaagaacttctcgttcacatttaatccaaacccttgtggggat 2281 tcttggtctgctgagatgataagtcgaagcagagttaggatgacagttatttgtgtttcg 2341 ggatggaccttatctcctaccacagatgtgattgccaagctagactggtcaattgtcaat 2401 gagaaatgtgagcccaccatttaccacttggctgattgtcagaattggttaccccttaat 2461 cgttggatgggaaaattgacttttccccagggtgtgacaagtgaggttcgaaggatgcct 2521 ctttctataggaggcggtgctggtgcgactcaagctttcttggccaatatgcccaattca 2581 tggatatcaatgtggagatattttagaggtgaacttcactttgaagttactaaaatgagc 2641 tctccatatattaaagccactgttacatttctcatagcttttggtaatcttagtgatgcc 2701 tttggtttttatgagagttttcctcatagaattgttcaatttgctgaggttgaggaaaaa 2761 tgtactttggttttctcccaacaagagtttgtcactgcttggtcaacacaagtaaacccc 2821 agaaccacacttgaagcagatggttgtccctacctatatgcaattattcatgatagtaca 2881 acaggtacaatctccggagattttatcttggggtcaagcttgttggcattaaggattttt 2941 gtggtataggttctaatccgggtattgatggttcccgcttgcttggagctatagcacaag 3001 gacctgtttgtgctgaagcctcagatgtgtatagcccatgtatgatagctagcactcctc 3061 ctgctccattttcagacgtcacagcagtaaacttttgacttaatcaacggcaaaataact 3121 cctgttggtgatgacaattggaatacgcacatttataatcctccaattatgaatgtcttg 3181 cgtactgctgcttggaaatctggaactattcatgttcaacttaatgttaggggtgctggt 3241 gtcaaaagagcagattgggatggtcaagtctttgtttacctgcgccagtccatgaaccct 3301 gaaagttatgatgcgcggacatttgtgatctcacaacctggttctgccatgttgaacttc 3361 tcttttgatatcatagggccgaatagcggatttgaatttgccgaaagcccatgggccaat 3421 cagaccacctggtatcttgaatgtgttgctaccaatcccagacaaatacagcaatttgag 3481 gtcaacatgcgcttcgatcctaatttcagggttgccggcaatatcctgatgcccccattt 3541 ccactgtcaacggaaactccaccgttattaaagtttaggtttcgggatattgaacgctcc 3601 aagcgtagtgttatggttggacacactgctactgctgcagcgcctgcaaaacagctctta 3661 aactttgacctacttaagttagcaggtgacgttgagtccaaccctgggcccagtaaagga 3721 gaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatggg 3781 cacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttaccctt 3841 aaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttc 3901 tcttatggtgttcaatgcttttcaagatacccagatcatatgaaacggcatgactttttc 3961 aagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaggatgacggg 4021 aactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgag 4081 ttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaac 4141 tataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaac 4201 ttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaa 4261 aatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaa 4321 tctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgta 4381 acagctgctgggattacacatggcatggatgaactatacaaataaaggcctttaactctg 4441 gtttcattaaattttctttagtttgaatttactgttattcggtgtgcatttctatgtttg 4501 gtgagcggttttctgtgctcagagtgtgtttattttatgtaatttaatttctttgtgagc 4561 tcctgtttagcaggtcgtcccttcagcaaggacacaaaaagattttaattttattaaaaa 4621 aaaaaaaaaaaaagaccgggaattcgatatcaagcttatcgacctgcagatcgttcaaac 4681 atttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcata 4741 taatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttattt 4801 atgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaac 4861 aaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagat 4921 ctctagagtctcaagcttggcgcgccagctgcattaatgaatcggccaacgcgcggggag 4981 aggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggt 5041 cgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacaga 5101 atcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccg 5161 taaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaa 5221 aaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtt 5281 tccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacct 5341 gtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatct 5401 cagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcc 5461 cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgactt 5521 atcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgc 5581 tacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtat 5641 ctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaa 5701 acaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaa 5761 aaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacga 5821 aaactcacgttaagggattttggttatgagattatcaaaaaggatcttcacctagatcct 5881 tttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga 5941 cagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatc 6001 catagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctgg 6061 ccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaat 6121 aaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccat 6181 ccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcg 6241 caacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttc 6301 attcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaa 6361 agcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatc 6421 actcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgctt 6481 ttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgag 6541 ttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagt 6601 gctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgag 6661 atccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcac 6721 cagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggc 6781 gacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatca 6841 gggttattgtcttatgagcggatacatatttgaatgtatttagaaaaataaacaaatagg 6901 ggttccgcgcacatttccccgaaaagtgccacctaaattgtaagcgttaatattttgtta 6961 aaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggc 7021 aaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttgg 7081 aacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctat 7141 cagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgc 7201 cgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaag 7261 ccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctg 7321 gcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgcta 7381 cagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgg 7441 gcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgg 7501 gtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagtactttggc 7561 gtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaa 7621 catacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcac 7681 attaattgcgttgcgctcactgcccgctttccagtcgggaaacctggcgcgc //

(98) TABLE-US-00006 Nucleotide Sequence of pM81-FSC-2 SEQIDNO:10 LOCUS pM81-FSC24173bpDNAcircular 10Oct.2007 FEATURES Location/Qualifiers rep_origin complement(1271..1890) /vntifkey=33 /label=pBR322_origin rep_origin complement(3168..3474) /vntifkey=33 /label=fl_origin promoter complement(2947..2975) /vntifkey=30 /label=AmpR\promoter misc_feature complement(3492..3647) /vntifkey=21 /label=lacZ_a CDS complement(2045..2905) /vntifkey=4 /label=AmpR 3UTR 533..716 /vntifkey=50 /label=CPMV\RNA2\3UTR terminator 770..1022 /vntifkey=43 /label=Nos\Terminator promoter 3859..4173 /vntifkey=29 /label=CaMV\35S\promoter 5UTR 1..160 /vntifkey=52 /label=CPMV\RNA2\5UTR misc_feature 507..532 /vntifkey=21 /label=FSC-2\MCS BASECOUNT 1090a969c982g1132t ORIGIN 1 tattaaaatcttaataggttttgataaaagcgaacgtggggaaacccgaaccaaaccttc 61 ttctaaactctctctcatctctcttaaagcaaacttctctcttgtctttcttgcatgagc 121 gatcttcaacgttgtcagatcgtgcttcggcaccagtacaatgttttctttcactgaagc 181 gaaatcaaagatctctttgtggacacgtagtgcggcgccattaaataacgtgtacttgtc 241 ctattcttgtcggtgtggtcttgggaaaagaaagcttgctggaggctgctgttcagcccc 301 atacattacttgttacgattctgctgactttcggcgggtgcaatatctctacttctgctt 361 gacgaggtattgttgcctgtacttctttcttcttcttcttgctgattggttctataagaa 421 atctagtattttctttgaaacagagttttcccgtggttttcgaacttggagaaagattgt 481 taagcttctgtatattctgcccaaattcgcgacgatcgtactctcgaggcctttaactct 541 ggtttcattaaattttctttagtttgaatttactgttattcggtgtgcatttctatgttt 601 ggtgagcggttttctgtgctcagagtgtgtttattttatgtaatttaatttctttgtgag 661 ctcctgtttagcaggtcgtcccttcagcaaggacacaaaaagattttaattttattaaaa 721 aaaaaaaaaaaaaagaccgggaattcgatatcaagcttatcgacctgcagatcgttcaaa 781 catttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcat 841 ataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatt 901 tatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaa 61 caaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactaga 1021 tctctagagtctcaagcttggcgcgccagctgcattaatgaatcggccaacgcgcgggga 1081 gaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcgg 1141 tcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacag 1201 aatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaacc 1261 gtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcaca 1321 aaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgt 1381 ttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacc 1441 tgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatc 1501 tcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagc 1561 ccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgact 1621 tatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtg 1681 ctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggta 1741 tctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggca 1801 aacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaa 1861 aaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacg 1921 aaaactcacgttaagggattttggttatgagattatcaaaaaggatcttcacctagatcc 1981 ttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctg 2041 acagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcat 2101 ccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctg 2161 gccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaa 2221 taaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctcca 2281 tccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgc 2341 gcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggctt 2401 cattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaa 2461 aagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttat 2521 cactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgct 2581 tttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccga 2641 gttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaag 2701 tgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttga 2761 gatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttca 2821 ccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataaggg 2881 cgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatc 2941 agggttattgtcttatgagcggatacatatttgaatgtatttagaaaaataaacaaatag 3001 gggttccgcgcacatttccccgaaaagtgccacctaaattgtaagcgttaatattttgtt 3061 aaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcgg 3121 caaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttg 3181 gaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtcta 3241 tcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtg 3301 ccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaa 3361 gccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgct 3421 ggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgct 3481 acagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcg 3541 ggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttg 3601 ggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagtactttgg 3661 cgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacaca 3721 acatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactca 3781 cattaattgcgttgcgctcactgcccgctttccagtcgggaaacctggccgcttaattaa 3841 gaattcgagctccaccgcggaaacctcctcggattccattgcccagctatctgtcacttt 3901 attgagaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaagga 3961 aaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacg 4021 aggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgt 4081 gatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcc 4141 tctatataaggaagttcatttcatttggagagg //

Example 7

(99) Extremely High-Level and Rapid Transient Protein Production in Plants without the Use of Viral Replication

(100) Plant-based overexpression of heterologous proteins has attracted much interest and development in recent years. To date, the most efficient vectors have been based on RNA virus-derived replicons. A system based on a disabled version of cowpea mosaic virus RNA-2 has been developed, which overcomes limitations on insert size and introduces biocontainment. This system involves positioning a gene of interest between the 5 leader sequence and 3 untranslated region (UTR) of RNA-2, thereby emulating a presumably stable mRNA for efficient translation. Thus far, the sequence of the 5 UTR has been preserved to maintain the ability of the modified RNA-2 to be replicated by RNA-1. However, high-level expression may be achieved in the absence of RNA-1-derived replication functions using Agrobacterium-mediated transient transformation. To investigate those features of the 5 UTR necessary for efficient expression, we have addressed the role of two AUG codons found within the 5 leader sequence upstream of the main initiation start site. Deletion of an in-frame start codon upstream of the main translation initiation site led to a massive increase in foreign protein accumulation. By 6 d postinfiltration, a number of unrelated proteins, including a full-size IgG and a self-assembling virus-like particle, were expressed to >10% and 20% of total extractable protein, respectively. Thus, this system provides an ideal vehicle for high-level expression that does not rely on viral replication of transcripts.

(101) The production of eukaryotic proteins for academic and industrial purposes can present significant challenges in terms of solubility and posttranslational modifications. For this reason, a number of eukaryotic protein production systems have been developed (Aricescu et al., 2006; Yin et al., 2007). Plants and plant cells possess many advantages over other eukaryotic expression hosts, such as high biomass, ease of scale-up, cost effectiveness, and low risk of contamination (Ma et al., 2003; Twyman et al., 2003). Although much work has been carried out using stably transformed plants, the significantly reduced development and production timelines make transient plant-based expression a particularly attractive option for the production of proteins of both commercial and academic interest.

(102) To date, the most efficient means of achieving high-level transient expression of foreign proteins in plants has involved the use of vectors based on RNA plant viruses (Giritch et al., 2006; Lindbo, 2007), including the bipartite comovirus Cowpea mosaic virus (CPMV; Sainsbury et al., 2007). These systems take advantage of the ability of RNA viruses to replicate to high titers within infected cells. However, virus-directed replication of RNA has a number of undesirable features, including restrictions on the size of insert that can be accommodated without affecting replication and compromised fidelity of transcripts due to the lack of proofreading by RNA-dependent RNA polymerases (Ahlquist et al., 2005; Castro et al., 2005). In addition, vectors based on full-length viral replicons, which can move throughout a plant, suffer from problems of biocontainment.

(103) To address the issue of biocontainment and to overcome the problem of insert size, we recently developed a system based on a disabled version of CPMV RNA-2 (deRNA-2; Caizares et al., 2006; Sainsbury et al., 2008b). In this approach, the majority of the coding region of RNA-2 was replaced by a gene of interest. The sequence to be expressed was fused to the AUG at position 512 of RNA-2 because sequences upstream of this site had previously been shown to be essential for replication of RNA-2 by the RNA-1-encoded replication complex (Rohll et al., 1993). In addition, it was positioned immediately upstream of the 3 untranslated region (UTR) to create a molecule that mimics RNA-2. Such constructs were shown to be capable of replication when agroinfiltrated into plants in the presence of RNA-1 and a suppressor of silencing and to direct the synthesis of substantial levels of heterologous proteins (Caizares et al., 2006). Furthermore, it was demonstrated that the system was suitable for the production of heteromeric proteins, such as full-length antibodies (Sainsbury et al., 2008a).

(104) Although the AUG at position 512 constitutes the major site of translation initiation on RNA-2 (Holness et al., 1989), the upstream sequence contains two additional AUGs at positions 115 and 161. Whereas the AUG at 115 is out of frame with that at 512 and has no known function (Wellink et al., 1993b), the AUG at position 161 is in-frame with AUG 512 and is functional as an initiation codon (Holness et al., 1989). Either deleting AUG 161 or disrupting its frame relationship with AUG 512 effectively eliminates RNA-2 replication (Holness et al., 1989; van Bokhoven et al., 1993). The need to preserve the frame relationship between AUG 161 and 512 to retain the replication ability of RNA-2-based constructs complicates the construction of vectors (Sainsbury et al., 2008b). However, whereas replication of the RNA-2-based constructs is essential to achieve high levels of expression when the mRNA is expressed from a transgene (Caizares et al., 2006), it is less important with transient expression because large quantities of mRNA accumulate in agroinfiltrated tissue. This is particularly the case if a suppressor of silencing is coinfiltrated. We have therefore examined whether the upstream AUG codons can be eliminated without unduly compromising expression levels. Unexpectedly, the results obtained showed that expression can be greatly enhanced by eliminating the AUG at position 161. This observation has been used to design a simple and effective method for the production of high levels of proteins within plants.

(105) Results

(106) Removal of Upstream AUG Codons Greatly Improves GFP Expression Levels in a Transient Assay

(107) To create a useful cloning vector, a derivative of the original deRNA-2 construct containing GFP (1-GFP; Caizares et al., 2006), called pM81-FSC2, was created. This allows easy replacement of GFP by other sequences using unique NruI and XhoI restriction sites (FIG. 16A). Use of the NruI site allows the insert to be precisely aligned with AUG 512, where translation is expected to exclusively initiate (Caizares et al., 2006). To examine the effect of the AUGs upstream of AUG 512 on GFP expression levels, mutations that removed one or both of AUG 115 and AUG 161 were introduced into pM81-FSC2 (FIG. 16B). Following transfer of the expression cassette into the binary vector pBINPLUS (van Engelen et al., 1995), the GFP constructs were agroinfiltrated into Nicotiana benthamiana leaves in the presence of the suppressor of silencing P19 (Voinnet et al., 2003) and the levels of GFP expression assessed.

(108) Examination of infiltrated tissue under UV light indicated that removal of AUG 115 alone resulted in a decrease in GFP expression to barely detectable levels (FIG. 17A, A115G). By contrast, removal of the in-frame AUG at 161 appeared to result in a dramatic increase in GFP expression levels (FIG. 17A, U162C). A similar enhancement was found when both AUGs at 115 and 161 were removed (FIG. 17A, A115G, U162C). Analysis of protein extracts by SDS-PAGE confirmed these findings and indicated that GFP accumulates to 20% to 25% of the extractable protein when AUG 161 is deleted, whether or not the AUG at 115 is present (FIG. 17B). This high-level expression was confirmed by analysis of the GFP fluorescence extracted from leaves by spectrofluorometry and corresponds to a level approaching 1.2 g/kg GFP of fresh-weight tissue (FIG. 17C). This represents at least a 10-fold increase in the levels obtained when the unmodified 5 leader was used. The spectrofluorometric analysis also revealed that the maximum level of expression, 1.6 g/kg GFP of fresh-weight tissue, is obtained when both AUG 161 and AUG 115 are eliminated.

(109) Increased Expression Levels are not Due to Increased mRNA Accumulation

(110) To determine whether the increase in protein expression observed after removal of AUG 161 is due to increased levels of mRNA as a result of the mutations in the mutated 5 leaders, quantitative reverse transcription (RT)-PCR was performed on RNA extracted from leaf tissue infiltrated with the various constructs. The levels of GFP-specific mRNA did not vary significantly with the nature of the 5 leader sequence used.

(111) This lack of variation was found whether or not a construct expressing P19 was coinfiltrated (FIG. 18). These results indicate that the enhanced levels of protein expression found when AUG 161 is deleted are not due to enhanced levels of mRNA accumulation, but rather to the mRNA molecules being hyper-translated relative to the wild-type leader. For this reason, we refer to the RNA-2 leader lacking AUG 161 as the hypertranslatable (HT) leader.

(112) The HT Leader is a General Enhancer of Protein Expression in Plants

(113) To examine whether the HT leader is generally effective at increasing expression of heterologous proteins, the Discosoma red fluorescent protein (DsRed) and the Hepatitis B core antigen (HBcAg) were each inserted downstream of either the wild-type or the HT 5 leader. When infiltrated into N. benthamiana leaves, the HT-based constructs appeared to cause less necrosis in the infiltrated patches than the wild-type equivalent (FIG. 19A). Furthermore, infiltration with the DsRed construct gives a reddish hue to the infiltrated leaf patches, suggesting high levels of accumulation of this protein. SDS-PAGE of proteins extracted from infiltrated patches showed that, for both proteins, elimination of AUG 161 led to a substantial increase in accumulation over that obtained with the wild-type leader (FIG. 19B). In each case, the identity of the expressed proteins was confirmed by western blotting (FIG. 19C). DsRed appears to accumulate to similar levels to that of GFP (approximately 25% of the extractable protein; compare FIGS. 17B and 19B). The HBcAg accumulates to approximately 1 g/kg of fresh-weight tissue as determined by ELISA using anti-HBcAg antibodies (E. Thuenemann, personal communication), which corresponds to around 20% of the extractable protein. To confirm that the expressed HBcAg was assembly competent, samples of leaf tissue were extracted in 3 volumes of Tris-NaCl buffer and subject to buffer exchange into Tris-EDTA, without concentration, using a 100-kD molecular cutoff column. Transmission electron microscopy of this crude preparation showed the presence of many virus-like particles, which we estimate comprise about 50% of the remaining total protein in the sample (FIG. 19D).

(114) One of the advantages of CPMV expression systems over those based on other viruses is their ability to simultaneously express multiple polypeptides in the same plant cell (Sainsbury et al., 2008a). To test whether this ability is retained when the HT leader is used, the heavy (H) and light (L) chains of the human anti-HIV antibody 2G12 (Buchacher et al., 1994) were inserted downstream of either the wild-type or the HT 5 leader. In both cases, the immunoglobulin chains retained their native leader peptides and two forms of the H chain were constructed, with (HE) and without (H) an endoplasmic reticulum (ER) retention motif. To obtain expression of full-size antibody, a combination of the L and either of the H chain constructs was coinfiltrated with P19 into N. benthamiana leaves (FIG. 20A). Analysis of total protein extracts by SDS-PAGE on nonreducing gels again suggested that higher levels of assembled antibody accumulation were obtained when the HT leader was used (FIG. 20B). The benefit of the HT over the wild-type leader was seen regardless of ER retention, although overall levels were higher when the antibody was retained. Quantification of IgG levels showed that the ER-retained 2G12 expressed using the HT leader (HT-HEL) accumulated to a yield in excess of 325 mg/kg of fresh-weight tissue (FIG. 20C). Furthermore, we have found that purified 2G12 produced in this way is comparable to 2G12 from other plant-based systems or from the mammalian cell-produced control in terms of antigen binding and virus neutralization in vitro (M. Sack and F. Sainsbury, unpublished data).

DISCUSSION

(115) The results presented here represent the highest reported level of plant-based protein production without the use of viral replication. We report the creation of an expression system based on a version of CPMV RNA-2 that is hypertranslatable relative to the wild-type version. By the removal of an upstream AUG that appears to inhibit translation, the system allows a variety of proteins to be produced to levels similar to that from state-of-the-art viral vectors in a matter of days, and without concomitant shortcomings of viral replication of transcripts. A recent study (Lindbo, 2007) showed 100-fold better expression for a single protein, GFP, from a tobacco mosaic virus (TMV)-based vector than when P19 was coinfiltrated with a cauliflower mosaic virus 35S promoter-driven construct. The HT constructs used in this study produced GFP levels in the same order of magnitude as the highest achieved with the TMV vector used in that study.

(116) A significant disadvantage of vectors based on monopartite viruses, such as TMV, is their inability to coexpress multiple proteins. This limitation can be overcome by using vectors based on two different viruses that exist synergistically in nature, such as TMV and Potato virus X (Pruss et al., 1997). Using this noncompeting viral vector approach, Giritch et al. (2006) expressed the separate H and L chains of a tumor-specific IgG in TMV and potato virus X-based vectors. Depending on the vector-IgG combination used, yields of assembled antibody of 0.2 to 0.5 g/kg fresh-weight tissue were reported. In the case of the CPMV-HT system, levels of assembled 2G12 in excess of 0.3 g/kg fresh-weight tissue were obtained, a level comparable with the virus-based system. However, the viral vector-based system involved the coinfiltration of six Agrobacterium cultures took 10 d to reach maximum expression, and resulted in the production of infectious virus particles from the potato virus X construct used. In contrast, the HT expression required the coinfiltration of only three cultures, an incubation of only 6 d, and is fully biocontained, with no infectious virus being produced. Furthermore, the non-competing viral vector approach is likely to be limited to the coexpression of only two proteins, unless additional noncompeting viruses can be found. In contrast, there is no obvious limit on the number of CPMV RNA-2-based constructs that can be coinfiltrated, raising the possibility of the production of multichain complexes.

(117) The question arises as to why deletion of AUG 161 enhances expression from AUG 512. Although translation does occur from AUG 161 on wild-type CPMV RNA-2, the massive increase in expression resulting from the removal of AUG 161 suggests that the presence of AUG 161 is inhibitory to overall translation. A possible mechanism for this is that the majority of ribosomes that do not initiate at AUG 161 are unable to proceed to the downstream AUG 512. If this is the case, it suggests a possible function for the short open reading frame (ORF), which begins at AUG 115 and overlaps AUG 161, in bypassing this start codon. Initiation is known to occur at AUG 115 in vitro (Wellink et al., 1993b) and a possible bypassing of AUG 161 would potentially permit efficient translation at AUG 512 following reinitiation. This hypothesis is supported by the observed reduction in expression from AUG 512 when AUG 115 is removed and AUG 161 is retained (FIG. 17). Examples of short ORFs regulating expression from the main ORF following reinitiation have been described for eukaryotic as well as virus genes (Morris and Geballe, 2000; Ryabova et al., 2006). Thus, removal of the AUG at 161 appears to free translation from inhibition imposed by the presence of this start codon. A possible reason for a deliberate reduction in translation is to allow 3 to 5 movement of the RNA-1-encoded replicase on at least some transcripts, which would require RNA relatively free of ribosomes (Gamarnik and Andino, 1998).

(118) An unexpected benefit of the removal of AUG 161 was that the increase in foreign protein production was accompanied by a reduction in the amount of tissue necrosis previously observed with some constructs (FIGS. 19 and 20). Although an N-terminal fusion protein that would theoretically be produced by initiation at AUG 161 has not been detected (Caizares et al., 2006), the N-terminal sequence of such a fusion may direct the polypeptide to the nucleus (Wellink et al., 1993a) with a potential toxic effect. Any such effect would therefore be alleviated by the prevention of initiation at AUG 161.

CONCLUSION

(119) The results reported here show that it is possible to express very high levels of foreign proteins in plants without viral replication through the use of a modified version of the CPMV RNA-2 5 leader. CPMV-HT provides a quick, easy, and inexpensive eukaryotic expression system that will prove very useful for the production of large quantities of recombinant proteins. Expression levels are similar to the highest reported so far from systems relying on viral replication. In addition to the biological advantages over viral vectors, such as the absence of RNA-dependent RNA polymerases and restrictions on insert size, the use of CPMV-HT does not require a license for work with plant pathogens. Therefore, this system presents an extremely useful and accessible tool in the fields of plant biology and biotechnology.

(120) Materials and Methods

(121) Plasmid Constructs

(122) A combination of oligonucleotide insertion and site-directed mutagenesis on pM81-FSC1 (Sainsbury et al., 2008b) resulted in the production of pM81-FSC2 (FIG. 16), which allows cloning with NruI and either XhoI or StuI. The terminal adenine of the NruI site lies at position 512, thereby allowing preservation of the AUG at this position. The modifications altered nucleotides immediately 5 to the AUG at 512; however, a good context was maintained. The GFP sequence was amplified by PCR from pBinP-NS-1 (Liu et al., 2005) with primers that incorporated a 5 NruI site and a 3 XhoI site. The resulting NruI/XhoI fragment was inserted into similarly digested pM81-FSC2 to give pM81-FSC2-GFP. Complementary pairs of oligonucleotides were used in the site-directed mutagenesis of pM81-FSC2-GFP (Quickchange; Stratagene). Oligos to remove the AUG at 115 were A115G-F, 5-CTTGTCTTTCTTGCGTG-AGCGATCTTCAACG-3 and A115G-R, 5-CGTTGAAGATCGCTCACGCAA-GAAAGACAAG-3. Oligos to remove the AUG at 161, while maintaining the sequence of the putative uORF were U162C-F, 5-GGCACCAGTACAACG-TTTTCTTTCACTGAAGCG-3 and U162C-R, 5-CGCTTCAGTGAAAGAAA-ACGTTGTACTGGTGCC-3. The mutant nucleotide is underlined in bold. The double mutation was made by applying the mutagenesis of AUG 161 to the AUG 115 mutant. The pM81-FSC2-derived plasmids were digested with AscI and Pad and the fragment containing the expression cassette including the foreign sequences transferred to the similarly digested binary vector, pBINPLUS (van Engelen et al., 1995).

(123) DsRed (CLONTECH), HBcAg (Mechtcheriakova et al., 2006), and the H and L chains of 2G12 (Buchacher et al., 1994) were initially cloned into pM81-FSC1 via BspHI/StuI sites. For expression with the wild-type leader, PacI/AscI fragments were transferred into similarly digested pBINPLUS. For expression with the modified leaders, DraIII/AscI fragments containing the gene of interest, the 3 UTR, and the nos terminator were transferred into a similarly digested FSC2-GFP-U162C expression cassette within pBINPLUS.

(124) Agroinfiltration

(125) Binary plasmid constructs were maintained in Agrobacterium tumefaciens strain LBA4404 and agroinfiltration into Nicotiana benthamiana was carried out as follows. Cultures grown to stable phase in Luria-Bertani medium supplemented with the appropriate antibiotics were pelleted by centrifugation at 2,000 g and resuspended in MMA (10 mM MES, pH 5.6, 10 mM MgCl.sub.2, 100 M acetosyringone) to an OD600 of 1.2. After 2- to 4-h incubations at room temperature, CPMV-based expression constructs were coinfiltrated at a 1:1 ratio with pBIN61-P19 (Voinnet et al., 2003) and a mix of pBIN61-P19 and pBINPLUS was infiltrated as a control.

(126) Protein Extractions and Electrophoresis

(127) For the extraction of GFP, DsRed, and HBcAg infiltrated leaf tissue was homogenized in 3 volumes of protein extraction buffer (50 mM Tris-HCl, pH 7.25, 150 mM NaCl, 2 mM EDTA, 0.1% [v/v], Triton X-100). For the extraction of 2G12, infiltrated leaf tissue was homogenized in 3 volumes of phosphate-buffered saline with 5 mM EDTA, 3 mM -mercaptoethanol, 0.05% Triton X-100). Lysates were clarified by centrifugation and protein concentrations determined by the Bradford assay. The protein concentrations of extracts were consistently 2 to 2.5 mg/mL. Approximately 20 g of GFP, DsRed, and HBcAg extracts were separated on 12% NuPage gels (Invitrogen) under reducing conditions and approximately 12.5 g of 2G12 protein extract was separated by Tris-Gly SDS-PAGE under nonreducing conditions. For western blotting, separated extracts were transferred to nitrocellulose membranes and probed with Living Colors DsRed monoclonal antibody (CLONTECH) or rabbit anti-HBcAg (AbD Serotec). Anti-mouse or anti-rabbit horseradish peroxidase-conjugated secondary antibodies were used as appropriate (Amersham Bio-sciences). Signals were generated by chemiluminescence and captured on Hyperfilm (Amersham Biosciences).

(128) Plants and Photography

(129) N. benthamiana plants were grown from November to March in green-houses maintained at 23 C. to 25 C. with 16 h of supplementary light per day. Infiltrated leaves were photographed with a Nikon D1x digital camera under visible light or, for the detection of GFP, under UV illumination from a Blak-Ray B-100AP UV lamp (Blak-Ray).

(130) GFP Assay

(131) GFP fluorescence measurements were made using a protocol modified from Richards et al. (2003). Soluble protein extracts were diluted in 0.1 M Na.sub.2CO.sub.3 and loaded in triplicate onto a fluorescently neutral black 96-well plate (Costar). Recombinant GFP from CLONTECH is the same variant of GFP as was used in this study and was, therefore, used to generate standard curves in a control plant extract at the same dilution as samples. Excitation (wavelength of 395 nm) and emission (509 nm) maxima were matched to CLONTECH's GFP and read using a SPECTRAmax spectrofluorometer (Molecular Devices).

(132) Quantitative PCR

(133) RNA extractions were performed using Ambion's RNAqueous kit with the plant RNA isolation aid (Ambion) according to the manufacturer's instructions. RNA concentration and quality was determined using a NanoDrop spectrophotometer (NanoDrop Technologies). cDNA was synthesized using the ProtoScript first-strand cDNA synthesis kit (New England BioLabs). RT quantification of target transcripts relative to actin transcripts was revealed by quantitative real-time PCR as measured by a Chromo 4 continuous fluorescence detector coupled to a PTC-200 peltier thermal cycler (MJ research) using SYBR Green JumpStart Taq ready mix (Sigma). Target transcripts were detected with the primers GFP-F, 5-CTTGACTTCAGCACGTGTCTTGTAG-TTCCC-3 and GFP-R, 5-AGAGGGTGAAGGTGATGCAACATACGG-3; and actin transcripts were detected with the primers NbActin-F, 5-CAGAAA-GAGGCTACTCTTTTACCACCACGG-3 and NbActin-R, 5-GTGGTTTCAT-GAATGCCAGCAGCTTCC-3. The amplification threshold was set and C.sub.t values were calculated by OpticonMONITOR and Microsoft Excel. Triplicate leaf extracts representing infiltrated tissue from six plants were assayed and relative abundance of GFP RNA was calculated by dividing 0.5.sup.Ct-GFP by 0.5.sup.Ct-actin.

(134) 2G12 Measurements

(135) Antibody concentrations were measured by surface plasmon resonance as described previously using a BIACORE 2000 (Biacore; GE Healthcare; Rademacher et al., 2008). 2G12 accumulation was measured from triplicate leaf extracts representing infiltrated tissue from six plants.

(136) Transmission Electron Microscopy

(137) Extraction buffer was exchanged for TE (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) using a 100-kD molecular mass cutoff column and eluted in the same volume as the initial sample loaded onto the column. Droplets were placed onto carbon-coated electron microscopy grids and left to settle for 60 s. After drawing off excess liquid, grids were negatively stained by placing them upside down onto droplets of 2% uranyl acetate, then washed three times on droplets of water. Imaging was performed using a JEOL 1200 transmission electron microscope at 80 kV.

ACKNOWLEDGMENTS

(138) We would like to thank Markus Sack for help with 2G12 measurements and Kim Findlay for assistance with electron microscopy.

(139) Received Jul. 11, 2008; accepted Sep. 2, 2008; published Sep. 5, 2008.

LITERATURE CITED

(140) Ahlquist P, Schwartz M, Chen J B, Kushner D, Hao L H, Dye B T (2005) Viral and host determinants of RNA virus vector replication and expression. Vaccine 23: 1784-1787 Aricescu A R, Assenberg R, Bill R M, Busso D, Chang V T, Davis S J, Dubrovsky A, Gustafsson L, Hedfalk K, Heinemann U, et al (2006) Eukaryotic expression: developments for structural proteomics. Acta Crystallogr D Biol Crystallogr 62: 1114-1124 Buchacher A, Predl R, Strutzenberger K, Steinfellner W, Trkola A, Purtscher M, Gruber G, Tauer C, Steindl F, Jungbauer A, et al (1994) Generation of human monoclonal antibodies against HIV-1 proteins; electrofusion and Epstein-Barr virus transformation for peripheral blood lymphocyte immortalization. AIDS Res Hum Retroviruses 10: 359-369 Caizares MC, Liu L, Perrin Y, Tsakiris E, Lomonossoff G P (2006) A bipartite system for the constitutive and inducible expression of high levels of foreign proteins in plants. Plant Biotechnol J 4: 183-193 Castro C, Arnold J J, Cameron C E (2005) Incorporation fidelity of the viral RNA-dependent RNA polymerase: a kinetic, thermodynamic and structural perspective. Virus Res 107: 141-149 Gamarnik A V, Andino R (1998) Switch from translation to RNA replication in a positive-stranded RNA virus. Genes Dev 12: 2293-2304 Giritch A, Marillonnet S, Engler C, van Eldik G, Botterman J, Klimyuk V Gleba Y (2006) Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors. Proc Natl Acad Sci USA 103: 14701-14706 Holness C L, Lomonossoff G P, Evans D, Maule A J (1989) Identification of the initiation codons for translation of cowpea mosaic-virus middle component RNA using site-directed mutagenesis of an infectious cDNA clone. Virology 172: 311-320 Lindbo J A (2007) TRBO: a high-efficiency tobacco mosaic virus RNA-Based overexpression vector. Plant Physiol 145: 1232-1240 Liu L, Caizares MC, Monger W, Perrin Y, Tsakiris E, Porta C, Shariat N Nicholson L, Lomonossoff G P (2005) Cowpea mosaic virus-based systems for the production of antigens and antibodies in plants. Vaccine 23: 1788-1792 Ma J K C, Drake P M W, Christou P (2003) The production of recombinant pharmaceutical proteins in plants. Nat Rev Genet 4: 794-805 Mechtcheriakova I A, Eldarov M A, Nicholson L, Shanks M, Skryabin K G, Lomonossoff G P (2006) The use of viral vectors to produce hepatitis B virus core particles in plants. J Virol Methods 131: 10-15 Morris D R, Geballe A P (2000) Upstream open reading frames as regulators of mRNA translation. Mol Cell Biol 20: 8635-8642 Pruss G, Ge X, Shi X M, Carrington J C, Vance V (1997) Plant viral synergism: the potyviral genome encodes a broad-range pathogenicity enhancer that transactivates replication of heterologous viruses. Plant Cell 9: 859-868 Rademacher T, Sack M, Arcalis E, Stadlmann J, Balzer S, Altmann F, Quendler H, Stiegler G, Kunert R, Fischer R, et al (2008) Recombinant antibody 2G12 produced in maize endosperm efficiently neutralizes HIV-1 and contains predominantly single-GcNAc N-glycans. Plant Biotechnol J 6: 189-201 Richards H A, Halfhill M D, Millwood R J, Stewart C N Jr (2003) Quantitative GFP fluorescence as an indicator of recombinant protein synthesis in transgenic plants. Plant Cell Rep 22:117-121 Rohll J B, Holness C L, Lomonossoff G P, Maule A J (1993) 3-Terminal nucleotide sequences important for the accumulation of cowpea mosaic virus M-RNA. Virology 193: 672-679 Ryabova L A, Pooggin M M, Hohn T (2006) Translation reinitiation and leaky scanning in plant viruses. Virus Res 119: 52-62 Sainsbury F, Caizares MC, Lomonossoff G P (2007) Cowpea mosaic virus-based expression vectors. In K Hefferon, ed, Virus Expression Vectors. Transworld Research Network, Kerala, India, pp 339-555 Sainsbury F, Lavoie P O, D'Aoust M A, Vezina L P, Lomonossoff G P (2008a) Expression of multiple proteins using full-length and deleted versions of cowpea mosaic virus RNA-2. Plant Biotechnol J 6: 82-92 Sainsbury F, Liu L, Lomonossoff G P (2008b) Cowpea mosaic virus-based expression of antigens and antibodies in plants. In L Faye, V Gomord, eds, Methods in Biotechnology: Recombinant Pharmaceutical Proteins from Plants. Humana Press, NY (in press) Twyman R M, Stoger E, Schillberg S, Christou P, Fischer R (2003) Molecular farming in plants: host systems and expression technology. Trends Biotechnol 21: 570-578 van Bokhoven H, Le Gall O, Kasteel D, Verver J, Wellink J, van Kammen A B (1993) Cis- and trans-acting elements in cowpea mosaic virus RNA replication. Virology 195: 377-386 van Engelen F A, Molthoff J W, Conner A J, Nap J P, Pereira A, Stiekema W J (1995) pBINPLUS: an improved plant transformation vector based on pBIN19. Transgenic Res 4: 288-290 Voinnet O, Rivas S, Mestre P, Baulcombe D (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33: 949-956 Wellink J, van Lent J W M, Verver J, Sijen T, Goldbach R W, van Kammen A B (1993a) The cowpea mosaic virus M RNA-encoded 48-kilodalton protein is responsible for induction of tubular structures in protoplasts. J Virol 67: 3660-3664 Wellink J, Verver J, van Kammen A (1993b) Mutational analysis of AUG codons of Cowpea Mosaic Virus-M RNA. Biochimie 75: 741-747 Yin J, Li G, Ren X, Herrer G (2007) Select what you need: a comparative evaluation of the advantages and limitations of frequently used expression systems for foreign genes. J Biotechnol 127:335-347