Lincosamide derivatives, preparation and use thereof as antimicrobial agent
10822366 ยท 2020-11-03
Assignee
Inventors
- Jiri Janata (Psary-Dolni Jircany, CZ)
- Zdenek Kamenik (Prague, CZ)
- Stanislav Kadlcik (Ratiskovice, CZ)
- Lucie Najmanova (Prague, CZ)
- Radek Gazak (Prague-Vychod, CZ)
Cpc classification
International classification
Abstract
Lincosamides of general formula I, where R1 is selected from C2-C8 alkyl or C2-C8 alkenyl; R3 is selected from OH, O(C1-C4 alkyl), SH, S(C1-C4 alkyl) or halogen; R4 is H or C1-C3 alkyl; each of R21, R22, R23, R24, R25 is independently selected from the group consisting of H, OH, C1-C4 alkyl, C1-C4 alkenyl, C1-C4 alkynyl, halogen, O(C1-C4 alkyl), O(C1-C4 alkenyl), O(C1-C4 alkynyl), NH.sub.2, N(C1-C4 alkyl).sub.2, N(C1-C4 alkenyl).sub.2, N(C1-C4 alkynyl).sub.2; and pharmaceutically acceptable salts thereof. A method of preparation thereof, in particular a biosynthetic method using newly discovered functions of celesticetin biosynthetic proteins Ccb1 and/or Ccb2. Lincosamides of general formula I are suitable for use as antibacterial and antiprotozoal substances.
Claims
1. Lincosamides of general formula I ##STR00041## wherein R1 is selected from C2-C8 alkyl or C2-C8 alkenyl; R3 is selected from OH, O(C1-C4 alkyl), SH, S(C1-C4 alkyl) or halogen; R4 is H or C1-C3 alkyl; each of R21, R22, R23, R24, R25 is independently selected from the group consisting of H, OH, C1-C4 alkyl, C1-C4 alkenyl, C1-C4 alkynyl, halogen, O(C1-C4 alkyl), O(C1-C4 alkenyl), O(C1-C4 alkynyl), NH.sub.2, N(C1-C4 alkyl).sub.2, N(C1-C4 alkenyl).sub.2, N(C1-C4 alkynyl).sub.2; and pharmaceutically acceptable salts thereof.
2. Lincosamides according to claim 1, wherein R1 is C3-C6 alkyl.
3. Lincosamides according to claim 1, wherein R3 is OH, OCH.sub.3, OCH.sub.2CH.sub.3 or Cl.
4. Lincosamides according to claim 1, wherein R4 is H or CH.sub.3.
5. Lincosamides according to claim 1, wherein each of R21, R22, R23, R24, R25 is independently selected from the group consisting of H, OH, CH.sub.3, CH.sub.2CH.sub.3, Cl, Br, I, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2.
6. Lincosamides according to claim 1, wherein the general formula I has a configuration on chiral centers shown below: ##STR00042## wherein R1 and R3 have configurations R or S.
7. A method of preparation of compounds of general formula I according to claim 1, characterized in that it comprises a step of enzymatically catalyzed activation of R21-, R22-, R23-, R24- and R25-substituted benzoic acid derivative by coenzyme A attachment, and a step of enzymatically catalyzed esterification of a precursor of formula II ##STR00043## with the conjugate of coenzyme A and R21-, R22-, R23-, R24- and, R25-substituted benzoic acid derivative, wherein the substituents R1, R3, R4 in formula II are as defined for formula I.
8. The method according to claim 7, characterized in that for the enzymatically catalyzed activation of R21-, R22-, R23-, R24- and R25-substituted benzoic acid derivative by coenzyme A attachment, an enzymatically active protein containing a celesticetin biosynthetic protein Ccb2, or containing a Ccb2-like protein having at least 95% identity with the amino acid sequence of Ccb2 is used, and/or for the esterification of the precursor of formula II, an enzymatically active protein containing a celesticetin biosynthetic protein Ccb1, or containing a Ccb1-like protein having at least 95% identity with the amino acid sequence of Ccb1 is used.
9. The method according to claim 7, wherein the precursor of general formula II is obtained by enzymatic transformation of a precursor of general formula III ##STR00044## by action of an enzymatically active protein containing celesticetin biosynthetic protein CcbF, and/or an enzymatically active protein containing celesticetin biosynthetic protein Ccb5, and/or optionally an enzymatically active protein containing celesticetin biosynthetic protein Ccb4, or of an enzymatically active protein containing celesticetin biosynthetic protein having at least 95% identity with CcbF, and/or an enzymatically active protein containing celesticetin biosynthetic protein having at least 95% identity with Ccb5, and/or an enzymatically active protein containing celesticetin biosynthetic protein having at least 95% identity with optionally Ccb4, wherein in formula III the substituents R1, R3, R4 are as defined for formula I.
10. The method according to claim 7, wherein the enzymatically catalyzed activation of R21-, R22-, R23-, R24- and R25-substituted benzoic acid derivative by coenzyme A attachment and/or the enzymatically catalyzed esterification of a precursor of formula II with the conjugate of the R21-, R22-, R23-, R24- and R25-substituted benzoic acid derivative with coenzyme A are carried out biosynthetically using a microorganism carrying the coding sequences of celesticetin biosynthetic proteins Ccb1 and/or Ccb2, or biosynthetic proteins having at least 95% identity of the amino acid sequence with Ccb1 and/or Ccb2.
11. The method according to claim 10, wherein the microorganism further carries coding sequences of celesticetin biosynthetic proteins Ccb5, CcbF, and optionally Ccb4, or biosynthetic proteins having at least 95% identity with Ccb5, CcbF, and optionally Ccb4, and the method starts from the precursor of formula III.
12. The method according to claim 11, wherein the microorganism further carries also coding sequences of the lincomycin and/or celesticetin biosynthetic proteins, needed in combination for biosynthesis of the precursor of formula III in a cell.
13. The method according to claim 10, wherein the biosynthetically obtained compound of general formula I is further synthetically modified, by chlorination in position 7 of the sugar residue to form a compound of formula I with R3=Cl.
14. A method of inhibiting or killing microbes, comprising the step of administering a therapeutically effective amount of a lincosamide of general formula I according to claim 1 to a subject in need of such treatment.
15. A method of inhibiting or killing of bacterial or unicellular eukaryotic parasitic microorganisms, comprising the step of administering a therapeutically effective amount of a lincosamide of general formula I according to claim 1 to a subject in need of such treatment.
16. The method according to claim 15, wherein the bacterial and unicellular eukaryotic parasitic microorganisms are selected from Gram-positive bacteria, parasites of the phylum Apicomplexa comprising target organelles apicoplasts, and organisms of genus Plasmodium, Toxoplasma, Babesia, Theileria and Coccidia.
17. Lincosamides according to claim 2, wherein R1 is selected from propyl, butyl, pentyl, hexyl.
18. Lincosamides according to claim 6, wherein the chiral center bearing the group R1 has the configuration R.
19. Lincosamides according to claim 6, wherein the chiral center bering the group R3 has the configuration R, when R3=OH, OCH3, OCH2CH3, and configuration S, when R3=halogen.
20. The method according to claim 10, wherein the microorganism is a microorganism of the class Actinobacteria.
21. The method according to claim 10, wherein the microorganism is a microorganism of the genus Streptomyces.
Description
EXAMPLES OF CARRYING OUT THE INVENTION
Example 1: Preparation of a Precursor of Formula III Wherein R1 is C3 Alkyl, R3 is OH, R4 is H or CH.SUB.3
(1) Cultivation of Streptomycetes in Liquid Medium
(2) The culture of the bacterial strain Streptomyces lincolnensis lmblH (construction of this strain of S. lincolnensis ATCC 25466 was previously describedJanata, J., et al. (2008) PLoS One, 2015, 10, e0118850) was prepared by inoculating spores from a culture dish with MS agar to 50 mL of YEME (Kieser, T., et al (2000) Practical Streptomyces Genetics, Norwich, UK, p. 613) medium without sucrose and incubated in 500 mL flat bottom flasks at 28 C. for 120 h. The culture medium was then separated by centrifugation (4000g, 20 C., 15 min) and the supernatant was used to isolate the lincosamide precursors of formula III in a preferred combination of substituents (R1 is C3 alkyl, R3 is OH, R4 is H or CH.sub.3).
(3) Isolation of Lincosamide Precursors of Formula III
(4) Culture medium supernatant was purified using Oasis HLB 6 cc extraction columns (Waters, USA): The supernatant (50 mL) was loaded onto a column preconditioned and equilibrated by methanol (5 mL) and water (5 mL) and a portion of the sample matrix was washed with water (5 mL). Fractions containing lincosamide precursors were eluted with methanol (15 mL), evaporated to dryness and reconstituted in 200 l of methanol. The obtained extract was reconstituted in 2 mL of methanol and dispensed into a high performance liquid chromatograph (HPLC, Waters, USA) equipped with a gradient pump 600, an autosampler 717 and UV detector 2487 at 194 nm. Data was processed using Empower 2 software (Waters, USA). Lincosamide precursors were separated on a Luna C18 chromatographic column (25015 mm, particle size 5 m, Phenomenex, USA) using a two-phase mobile phase, A and B, wherein 0.1% aqueous formic acid (v/v) is used as phase A and methanol as phase B. Chromatographic analyzes using a linear gradient program at a flow rate of 3 mL min.sup.1 (min/% B): 0/5, 31/27.5 with subsequent column washing (100% B, 9 min) and equilibration before further analysis (5% B, 9 min). Fractions containing lincosamide precursors were evaporated to dryness, reconstituted in methanol and subjected to further HPLC separation on an XTerra Prep RP18 chromatographic column (1507.8 mm, particle size 5.0 m, Waters, USA) using an isocratic elution program at a flow rate of 1.5 mL min.sup.1 with 1 mM ammonium formate (pH 9.0): acetonitrile (90:10 v/v) as the mobile phase. Lincosamide precursors isolated in this way were further used for in vitro enzymatic reactions.
Example 2: Preparation of a Precursor of Formula II Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3., R4=H or CH.SUB.3
(5) Heterologous Production and Purification of CcbF, Ccb1, Ccb2, Ccb4 and Ccb5
(6) The CcbF (GenBank ADB92565), Ccb1 (GenBank ADB92559), Ccb2 (GenBank ADB92576), Ccb4 (GenBank ADB92578) and Ccb5 (GenBank ADB92579) proteins for the production of new lincosamide compounds were produced heterologously in E. coli cells. The ccbF, ccb1, ccb2, ccb4 and ccb5 genes were PCR amplified using the primers of Table 1 from the genomic DNA of the celesticetin producing strain Streptomyces caelestis ATCC 15084. The PCR products were treated with the restriction enzymes (according to Table 1) and inserted into the pET28b (Novagen) vectors for ccb1, ccb4 or ccb5, or pET42b (Novagen) for ccbF or ccb2. The Ccb1, Ccb4 and Ccb5 proteins were thus produced with a N-terminal histidine tag, and the CcbF and Ccb2 proteins were produced with the C-terminal histidine tag. E. coli BL21 (DE3) strain carrying the GroES and GroEL chaperonins expression construct was used to produce the proteins. For all recombinant proteins, overproduction was induced by isopropyl -D-1-thiogalactopyranoside (0.4 mM) at a culture OD (600 nm) of 0.6-0.8. After induction, the culture was incubated at 17 C. at 200 rpm for 20 h. The culture was then centrifuged (4000g, 20 min, 4 C.) and the sediment was used to prepare the crude extract by ultrasonic homogenization in buffer I (20 mM TRIS pH 8, 100 mM NaCl, 10% glycerol, and 20 mM imidazole). The homogenate was then centrifuged at 9000g, 25 min, 4 C. The proteins were purified from the crude extract using a 1 mL HiTrap Ni.sup.2+ column according to the manufacturer's protocol (GE Healthcare). The protein Ccb2 was eluted with buffer II (20 mM TRIS pH 8, 100 mM NaCl, 10% glycerol, and 100 mM imidazole), Ccb4 and Ccb5 proteins were eluted with buffer III (20 mM TRIS pH 8, 100 mM NaCl, 10% glycerol, and 200 mM imidazole) and the CcbF and Ccb1 proteins were eluted with buffer IV (20 mM TRIS pH 8, 100 mM NaCl, 10% glycerol, and 250 mM imidazole). Imidazole was removed from the purified protein solution using Amicon centrifuge tubes (Millipore) and buffer V (20 mM TRIS pH 8, 100 mM NaCl, 10% glycerol). All of the proteins thus prepared were stable without loss of activity at 4 C. for at least one week; the CcbF, Ccb1, Ccb2, and Ccb5 proteins were also stable for at least one month at 80 C.
(7) TABLE-US-00002 TABLE1 PrimersusedforamplificationoftheS.caelestisgenes.Restrictionsitesfortheinsertioninto thevectorareunderlinedandfollowingrestrictionenzymeswereusedforDNAprocessing:NdeIfor CATATGsequence,XhoIforCTCGAG,EcoRIforGAATTCandNheIforGCTAGC: Gene PrimerI PrimerII ccbF CCGCATATGTCCGACTTAGCTGCCG CCGCTCGAGGCGGGGCTGCCAGGCG ccb1 CTGCATATGCATCTTGATCCAACCAC ATAGAATTCTCATCGGTGGTCGTCGC ccb2 AACCCCATATGAAGCGACGTGGCATGG AACCCCTCGAGTAAGGTCATGAACTCCGCACG ccb4 CTACATATGAAGACGCCCGGTACATC CTAGAATTCTCAGCACGGAGTGGCCT ccb5 ATAGCTAGCGCGACCGTCCCCGCC CTGGAATTCTCATGAGTCCGCGCGCC
In Vitro Enzymatic Preparation of Lincosamide Precursors of Formula II
(8) Reaction mixture 1 contained: 20 M CcbF, 20 M Ccb5, 200 M lincosamide precursor of formula III wherein R1 is C3 alkyl, R3 is OH, R4 is H or CH.sub.3, 200 M pyridoxal-5-phosphate, 100 mM Tris pH 7.5. In the case of the preparation of precursors of formula II wherein R3=OCH.sub.3, the reaction mixture additionally contained 20 M Ccb4 and 4 mM S-adenosylmethionine. Reaction mixture 1 was incubated at 30 C. for 2 h.
Example 3: In Vitro Enzymatic Preparation of New Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R24 are H and R25 is OH
(9) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM salicylic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Then, reaction mixture 2 was mixed in a ratio of 1:1 with reaction mixture 1 (preparation according to Example 2) containing the lincosamide precursor of formula II, and incubated at 30 C. for further 2 hours.
(10) Isolation of New Lincosamide Compounds of Formula I from the Enzymatic Reaction Mixture
(11) Proteins were precipitated from the reaction mixture with 98% formic acid (30 L per 1 mL sample) and the mixture was centrifuged (13500 rpm, 5 min). The supernatant was extracted with Oasis HLB 6 cc columns according to the protocol described above in the section of Isolation of lincosamide precursors. The extract was further subjected to HPLC separation as defined in the above paragraph Isolation of lincosamide precursors. New lincosamide compounds were separated on a Luna C18 chromatographic column (25015 mm, particle size 5 m, Phenomenex, USA) using a two-phase mobile phase, A and B, wherein 0.1% aqueous formic acid (v/v) was used as the phase A and acetonitrile was used as the phase B. Chromatographic analyses were performed using a linear gradient program at a flow rate of 3 mL min (min/% B): 0/30, 40/65, followed by column washing (100% B, 9 min) and equilibration before further analysis (30% B, 9 min).
(12) Antibacterial Activity Tests
(13) Filtration paper discs (geometric diameter 5 mm) saturated with 5 nmol of tested novel lincosamide compounds were placed on LB agar plates (tryptone 10 g, yeast extract 5 g, NaCl 10 g, supplemented with distilled water to 1000 mL, pH 7.5; agar 15 g) continuously covered with culture of the lincomycin sensitive test strain Kocuria rhizophila. The plates were incubated at 37 C. for 20 h.
(14) Minimum inhibitory concentrations were determined using the previously published method (European Committee for Antimicrobial Susceptibility Testing (EUCAST), Clin Microbiol Infect (2003), 9 (8), ix-xv). 5 L suspension (McFarland scale 0.5) of K. rhizophila bacterial culture was inoculated into 1 mL of LB medium containing test substances of the desired concentration (a concentration range of 25-1600 nM was tested). The cultures were incubated for 24 h at 37 C.
(15) TABLE-US-00003 TABLE 2 Results of biological activity testing Minimum Disc diffusion test: inhibitory size of inhibition concentration Tested compound zones [mm] [nM] Celesticetin 19 1600 Lincomycin 24 400 Compound of formula I, 28 100 wherein R1 = propyl, R21-R24 = H, R25 = OH, R3 = OCH.sub.3, R4 = CH.sub.3 Compound of formula I, 29 100 wherein R1 = propyl, R21-R24 = H, R25 = OH, R3 = OH, R4 = CH.sub.3
Analysis by Liquid Chromatography with Mass Spectroscopy Detection (LC-MS Analysis)
(16) In total four lincosamides were prepared: compounds 1-4 with the following structures and LC-MS parameters listed in Table 3.
(17) ##STR00008##
(18) TABLE-US-00004 TABLE 3 Results of LC-MS analysis of the compounds 1-4 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 1 7.10 571.2690 571.2703 373.23; 126.13 2 6.25 557.2533 557.2543 359.22; 126.13 3 7.00 557.2533 557.2532 359.22; 112.11 4 6.30 543.2376 543.2358 345.20
(19) LC-MS analyses were performed on an Ultra High Performance Liquid Chromatograph Acquity UPLC coupled to an LCT premier XE mass spectrometer and a time-of-flight analyzer (Waters, USA). A sample of 5 l was injected on an Acquity UPLC BEH C18 chromatographic column (50 mm2.1 mm, particle size 1.7 m, Waters, USA) which was kept at 40 C. The sample was eluted from the column with two-phase mobile phase, aqueous solution of 0.1% formic acid (v/v) was used as the component A, and acetonitrile was used as the component B. The following linear gradient program (min/% B) 0/5, 1.5/5, 12.5/58 was used for separation at a flow rate of 0.4 mL min.sup.1. The analysis included column washing (1.5 min, 100% B) and equilibration before further analysis (1.5 min, 5% B). The mass spectrometer was set to W mode with the following parameters: capillary voltage, +2800 V; cone voltage, +40 V; flow rate of desolvation gas (nitrogen), 800 Lh.sup.1; desolvation gas temperature, 350 C.; ion block temperature, 120 C.; cone gas flow rate, 50 Lh.sup.1; scan time, 0.15 sec; delay between scans, 0.01 s. The mass accuracy below 5 ppm was maintained with the reference compound leucine-enkephaline (2 ng L.sup.1, 5 L min.sup.1). Source fragmentation (collision initiated dissociationCID) was induced by increasing aperture I to +50 V. Data were processed using MassLynx V4.1 software (Waters, USA).
Example 4: In Vitro Enzymatic Preparation of Novel Lincosamides of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R25 are H
(20) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM benzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (preparation according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. Novel lincosamide with incorporated benzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(21) Results of LC-MS Analysis
(22) In total four lincosamides were prepared: compounds 5-8 with the following structures and LC-MS parameters listed in Table 4.
(23) ##STR00009##
(24) TABLE-US-00005 TABLE 4 Results of LC-MS analysis of the compounds 5-8 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 5 6.85 555.2741 555.2743 373.23; 126.13 6 6.00 541.2584 541.2578 359.22; 126.13 7 7.00 541.2584 541.2584 359.22; 112.11 8 6.10 527.2427 527.2424 345.20
(25) LC-MS analyses were performed according to the procedure described in Example 3.
Example 5: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R24 are H, R25 is NH.SUB.2
(26) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM anthranilic (2-aminobenzoic) acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated anthranilic (2-aminobenzoic) acid was isolated from the reaction mixture according to the procedure of Example 3.
(27) LC-MS Analysis
(28) In total four lincosamides were prepared: compounds 9-12 with the following structures and LC-MS parameters listed in Table 5.
(29) ##STR00010##
(30) TABLE-US-00006 TABLE 5 Results of LC-MS analysis of the compounds 9-12 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 9 6.50 570.2850 570.2842 373.23; 126.13 10 5.70 556.2393 556.2703 359.22; 126.13 11 6.50 556.2393 556.2709 359.22; 112.11 12 5.40 542.2536 542.2548 345.20; 112.11
(31) LC-MS analyses were performed according to the procedure described in Example 3.
Example 6: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OCH.SUB.3 .or OH (R Configuration), R4=H or CH.SUB.3., R21-R24 are H, R25 is CH.SUB.3
(32) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2-methylbenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2-methylbenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(33) LC-MS Analysis
(34) In total four lincosamides were prepared: compounds 13-16 with the following structures and LC-MS parameters listed in Table 6.
(35) ##STR00011##
(36) TABLE-US-00007 TABLE 6 Results of LC-MS analysis of the compounds 13-15 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 13 9.00 569.2897 569.2917 373.23; 126.13 14 7.60 555.2740 555.2742 359.22; 126.13 15 8.00 555.2740 555.2714 359.22 16 5.75 541.2583 541.2570 345.20; 112.11
(37) LC-MS analyses were performed according to the procedure described in Example 3.
Example 7: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R24 are H, R25 is Cl
(38) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2-chlorobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (preparation according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2-chlorobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(39) LC-MS Analysis
(40) In total, four lincosamides were prepared: compounds 17-20 with the following structures and LC-MS parameters listed in Table 7.
(41) ##STR00012##
(42) TABLE-US-00008 TABLE 7 Results of LC-MS analysis of the compounds 17-20 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 17 8.63 589.2351 589.2335 373.23; 126.13 18 7.25 575.2194 575.2183 359.22; 126.13 19 6.50 575.2194 575.2169 359.22 20 5.52 561.2037 561.2045 345.20
(43) LC-MS analyses were performed according to the procedure described in Example 3.
Example 8: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R24 are H, R25 is Br
(44) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2-bromobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2-bromobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(45) LC-MS Analysis
(46) In total, four lincosamides were prepared: compounds 21-24 with the following structures and LC-MS parameters listed in Table 8.
(47) ##STR00013##
(48) TABLE-US-00009 TABLE 8 Results of LC-MS analysis of the compounds 21-24 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 21 8.75 635.1826 635.1833 373.24; 126.13 22 7.50 621.1669 621.1666 359.22; 126.13 23 6.63 621.1669 621.1635 359.22 24 5.63 607.1511 607.1506 345.21
(49) LC-MS analyses were performed according to the procedure described in Example 3.
Example 9: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R24 are H, R25 is I
(50) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2-iodobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2-iodobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(51) LC-MS Analysis
(52) In total, four lincosamides were prepared: compounds 25-28 with the following structures and LC-MS parameters listed in Table 9.
(53) ##STR00014##
(54) TABLE-US-00010 TABLE 9 Results of LC-MS analysis of the compounds 25-28 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 25 9.13 681.1707 681.1691 373.24; 126.13 26 7.88 667.1550 667.1524 359.22 27 7.00 667.1550 667.1500 359.22 28 5.87 653.1393 653.1382 345.20
(55) LC-MS analyses were performed according to the procedure described in Example 3.
Example 10: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R24 are H, R25 is OCH.SUB.3
(56) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2-methoxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2-methoxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(57) LC-MS Analysis
(58) In total, four lincosamides were prepared: compounds 29-32 with the following structures and LC-MS parameters listed in Table 10.
(59) ##STR00015##
(60) TABLE-US-00011 TABLE 10 Results of LC-MS analysis of the compounds 29-32 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 29 7.52 585.2846 585.2855 373.24; 126.13 30 6.36 571.2689 571.2693 359.22 31 5.83 571.2689 571.2694 359.22 32 4.80 557.2532 557.2521 345.20
(61) LC-MS analyses were performed according to the procedure described in Example 3.
Example 11: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R23, R25 are H, R24 is OH
(62) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 3-hydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 3-hydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(63) LC-MS Analysis
(64) In total, four lincosamides were prepared: compounds 33-36 with the following structures and LC-MS parameters listed in Table 11.
(65) ##STR00016##
(66) TABLE-US-00012 TABLE 11 Results of LC-MS analysis of the compounds 33-36 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 33 5.85 571.2690 571.2688 373.24; 126.13 34 5.09 557.2533 557.2531 359.22; 126.13 35 5.92 557.2533 557.2538 359.22 36 5.07 543.2376 543.2355 345.20
(67) LC-MS analyses were performed according to the procedure described in Example 3.
Example 12: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R23, R25 are H, R24 is NH.SUB.2
(68) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 3-aminobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 3-aminobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(69) LC-MS Analysis
(70) In total, four lincosamides were prepared: compounds 37-40 with the following structures and LC-MS parameters listed in Table 12.
(71) ##STR00017##
(72) TABLE-US-00013 TABLE 12 Results of LC-MS analysis of the compounds 37-40 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 37 5.35 570.2850 570.2839 373.24; 126.13 38 4.08 556.2393 556.2684 359.20; 126.12 39 5.35 556.2393 556.2696 359.22; 112.11 40 4.13 542.2536 542.2541 345.20
(73) LC-MS analyses were performed according to the procedure described in Example 3.
Example 13: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21-R23, R25 are H, R24 is Cl
(74) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 3-chlorobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 3-chlorobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(75) LC-MS Analysis
(76) In total, four lincosamides were prepared: compounds 41-44 with the following structures and LC-MS parameters listed in Table 13.
(77) ##STR00018##
(78) TABLE-US-00014 TABLE 13 Results of LC-MS analysis of the compounds 41-44 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 41 7.20 589.2351 589.2365 373.24; 126.13 42 6.77 575.2194 575.2185 359.22; 126.13 43 7.53 575.2194 575.2209 359.21 44 6.55 561.2037 561.2030 345.21
(79) LC-MS analyses were performed according to the procedure described in Example 3.
Example 14: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R24, R25 are H, R23 is OH
(80) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 4-hydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 4-hydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(81) LC-MS Analysis
(82) In total, four lincosamides were prepared: compounds 45-48 with the following structures and LC-MS parameters listed in Table 14.
(83) ##STR00019##
(84) TABLE-US-00015 TABLE 14 Results of LC-MS analysis of the compounds 45-48 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 45 5.76 571.2690 571.2706 373.23; 126.13 46 4.91 557.2533 557.2551 359.22; 126.13 47 5.74 557.2533 557.2540 359.21; 112.11 48 4.97 543.2376 543.2467 345.20
(85) LC-MS analyses were performed according to the procedure described in Example 3.
Example 15: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R24, R25 are H, R23 is NH.SUB.2
(86) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 4-aminobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 4-aminobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(87) LC-MS Analysis
(88) In total, four lincosamides were prepared: compounds 49-52 with the following structures and LC-MS parameters listed in Table 15.
(89) ##STR00020##
(90) TABLE-US-00016 TABLE 15 Results of LC-MS analysis of the compounds 49-52 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 49 6.81 570.2850 570.2847 373.23; 126.13 50 5.50 556.2393 556.2692 359.22; 126.13 51 5.77 556.2393 556.2664 359.21; 112.11 52 3.72 542.2536 542.2545 345.20
(91) LC-MS analyses were performed according to the procedure described in Example 3.
Example 16: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R24, R25 are H, R23 is CH.SUB.3
(92) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 4-methylbenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 4-methylbenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(93) LC-MS Analysis
(94) In total, four lincosamides were prepared: compounds 53-56 with the following structures and LC-MS parameters listed in Table 16.
(95) ##STR00021##
(96) TABLE-US-00017 TABLE 16 Results of LC-MS analysis of the compounds 53-56 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 53 8.80 569.2897 569.2879 373.24; 126.13 54 8.08 555.2740 555.2748 359.22; 126.13 55 6.83 555.2740 555.2725 359.22 56 5.67 541.2583 541.2572 345.20
(97) LC-MS analyses were performed according to the procedure described in Example 3.
Example 17: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R24, R25 are H, R23 is Cl
(98) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 4-chlorobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 4-chlorobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(99) LC-MS Analysis
(100) In total, four lincosamides were prepared: compounds 57-60 with the following structures and LC-MS parameters listed in Table 17.
(101) ##STR00022##
(102) TABLE-US-00018 TABLE 17 Results of LC-MS analysis of the compounds 57-60 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 57 7.52 589.2351 589.2364 373.23; 126.13 58 7.60 575.2194 575.2183 359.22 59 7.54 575.2194 575.2197 359.22; 112.11 60 6.02 561.2037 561.2037 345.20
(103) LC-MS analyses were performed according to the procedure described in Example 3.
Example 18: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R25 are OH, R22-R24 are H
(104) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2,6-dihydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2,6-dihydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(105) LC-MS Analysis
(106) In total, four lincosamides were prepared: compounds 61-64 with the following structures and LC-MS parameters listed in Table 18.
(107) ##STR00023##
(108) TABLE-US-00019 TABLE 18 Results of LC-MS analysis of the compounds 61-64 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 61 7.27 587.2639 587.2656 373.24; 126.13 62 5.90 573.2482 573.2484 359.22; 126.13 63 7.03 573.2482 573.2490 359.22 64 4.99 559.2325 559.2310 345.20
(109) LC-MS analyses were performed according to the procedure described in Example 3.
Example 19: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R24 are H, R23, R25 are OH
(110) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2,4-dihydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2,4-dihydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(111) LC-MS Analysis
(112) In total, four lincosamides were prepared: compounds 65-68 with the following structures and LC-MS parameters listed in Table 19.
(113) ##STR00024##
(114) TABLE-US-00020 TABLE 19 Results of LC-MS analysis of the compounds 65-68 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 65 7.38 587.2639 587.2648 373.24; 126.13 66 6.05 573.2482 573.2483 359.22; 126.13 67 6.35 573.2482 573.2487 359.21 68 5.11 559.2325 559.2294 345.20
(115) LC-MS analyses were performed according to the procedure described in Example 3.
Example 20: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R24 are H, R23 is NH.SUB.2., R25 is OH
(116) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 4-amino-2-hydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 4-amino-2-hydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(117) LC-MS Analysis
(118) In total, four lincosamides were prepared: compounds 69-72 with the following structures and LC-MS parameters listed in Table 20.
(119) ##STR00025##
(120) TABLE-US-00021 TABLE 20 Results of LC-MS analysis of the compounds 69-72 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 69 5.82 586.2799 586.2789 373.24; 126.13 70 4.97 572.2642 572.2646 359.22; 126.13 71 5.95 572.2642 572.2663 112.11 72 4.85 558.2485 558.2480 345.20
(121) LC-MS analyses were performed according to the procedure described in Example 3.
Example 21: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R24 are H, R23 is NH.SUB.2., R25 is Cl
(122) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 4-amino-2-chlorobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 4-amino-2-chlorobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(123) LC-MS Analysis
(124) In total, four lincosamides were prepared: compounds 73-76 with the following structures and LC-MS parameters listed in Table 21.
(125) ##STR00026##
(126) TABLE-US-00022 TABLE 21 Results of LC-MS analysis of the compounds 73-76 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 73 7.05 604.2460 604.2453 373.24; 126.13 74 5.83 590.2303 590.2281 359.22; 126.13 75 5.38 590.2303 590.2286 359.22 76 4.38 576.2146 576.2155 345.20
(127) LC-MS analyses were performed according to the procedure described in Example 3.
Example 22: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R24 are H, R23, R25 are Cl
(128) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2,4-dichlorobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2,4-dichlorobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(129) LC-MS Analysis
(130) In total, four lincosamides were prepared: compounds 77-80 with the following structures and LC-MS parameters listed in Table 22.
(131) ##STR00027##
(132) TABLE-US-00023 TABLE 22 Results of LC-MS analysis of the compounds 77-80 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 77 9.78 623.1961 623.1944 373.24; 126.13 78 8.51 609.1804 609.1783 359.22; 126.13 79 8.37 609.1804 609.1724 359.22 80 6.48 595.1647 595.1632 345.20
(133) LC-MS analyses were performed according to the procedure described in Example 3.
Example 23: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R25 are H, R23, R24 are OH
(134) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 3,4-dihydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 3,4-dihydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(135) LC-MS Analysis
(136) In total, four lincosamides were prepared: compounds 81-84 with the following structures and LC-MS parameters listed in Table 23.
(137) ##STR00028##
(138) TABLE-US-00024 TABLE 23 Results of LC-MS analysis of the compounds 81-84 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 81 6.20 587.2639 587.2625 373.24; 126.13 82 5.00 573.2482 573.2493 359.22; 126.13 83 4.71 573.2482 573.2455 359.21 84 3.86 559.2325 559.2330 345.20
(139) LC-MS analyses were performed according to the procedure described in Example 3.
Example 24: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R22, R25 are H, R23, R24 are Cl
(140) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 3,4-dichlorobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 3,4-dichlorobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(141) LC-MS Analysis
(142) In total, four lincosamides were prepared: compounds 85-88 with the following structures and LC-MS parameters listed in Table 24.
(143) ##STR00029##
(144) TABLE-US-00025 TABLE 24 Results of LC-MS analysis of the compounds 85-88 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 85 10.09 623.1961 623.1955 373.24; 126.13 86 8.77 609.1804 609.1821 359.22; 126.13 87 8.35 609.1804 609.1766 359.21 88 6.77 595.1647 595.1626 345.20
(145) LC-MS analyses were performed according to the procedure described in Example 3.
Example 25: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3., R21, R23, R25 are H, R22, R24 are OH
(146) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 3,5-dihydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 3,5-dihydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(147) LC-MS Analysis
(148) In total, four lincosamides were prepared: compounds 89-92 with the following structures and LC-MS parameters listed in Table 25.
(149) ##STR00030## ##STR00031##
(150) TABLE-US-00026 TABLE 25 Results of LC-MS analysis of the compounds 89-92 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 89 5.95 587.2639 587.2632 373.24; 126.13 90 4.94 573.2482 573.2468 359.22; 126.13 91 4.40 573.2482 573.2460 359.21 92 3.48 559.2325 559.2320 345.20
Example 26: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3.; R21, R23, R25 are H; R22, R24 are Cl
(151) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 3,5-dichlorobenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 3,5-dichlorobenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(152) LC-MS Analysis
(153) In total, four lincosamides were prepared: compounds 93-96 with the following structures and LC-MS parameters listed in Table 26.
(154) ##STR00032##
(155) TABLE-US-00027 TABLE 26 Results of LC-MS analysis of the compounds 93-96 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 93 10.37 623.1961 623.1967 373.24; 126.13 94 8.87 609.1804 609.1788 359.22; 126.13 95 8.10 609.1804 609.1755 359.22 96 6.80 595.1647 595.1620 345.20
(156) LC-MS analyses were performed according to the procedure described in Example 3.
Example 27: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3.; R22, R23, R25 are H; R21, R24 are OH
(157) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 2,5-dihydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 2,5-dihydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(158) LC-MS Analysis
(159) ##STR00033##
(160) TABLE-US-00028 TABLE 27 Results of LC-MS analysis of the compounds 97-100 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 97 7.46 587.2639 587.2649 373.24; 126.13 98 6.09 573.2482 573.2463 359.22; 126.13 99 6.18 573.2482 573.2466 359.22 100 4.32 559.2325 559.2320 345.20
(161) LC-MS analyses were performed according to the procedure described in Example 3.
Example 28: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=OH or OCH.SUB.3 .(R Configuration), R4=H or CH.SUB.3.; R21, R25 are H; R22-R24 are OH
(162) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM 3,4,5-trihydroxybenzoic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed with reaction mixture 1 (prepared according to Example 2) containing the lincosamide precursor of formula II in a ratio of 1:1 and incubated at 30 C. for further 2 hours. The novel lincosamide with incorporated 3,4,5-trihydroxybenzoic acid was isolated from the reaction mixture according to the procedure of Example 3.
(163) LC-MS Analysis
(164) In total, four lincosamides were prepared: compounds 101-104 with the following structures and LC-MS parameters listed in Table 28.
(165) ##STR00034##
(166) TABLE-US-00029 TABLE 28 Results of LC-MS analysis of the compounds 101-104 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 101 4.65 603.2588 603.2582 373.24; 126.13 102 3.77 589.2431 589.2422 359.22; 126.13 103 4.76 589.2431 589.2427 359.21 104 3.08 575.2274 575.2269 345.20
(167) LC-MS analyses were performed according to the procedure described in Example 3.
Example 29: Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C3 Alkyl, R3=Cl (S Configuration), R4=H or CH.SUB.3.; R21-R24 are H; R25 is OH
(168) ##STR00035##
(169) Preparation of novel lincosamides wherein R3=Cl starts from the lincosamides prepared in Example 3, wherein R3=OH (R configuration). These are synthetically chlorinated by the following procedure. To a suspension of N-(chloromethylene)-N-methylmethaniminium chloride (11 mmol) in dichloromethane (3.5 mL) vigorously stirred under an inert atmosphere (Ar) with cooling with an external bath containing water and ice was added portionwise over 15 min lincosamide (2 mmol) and 3-tert-butyl-4-hydroxy-5-methylphenyl sulfide (9 mg) to give the addition product. The cooling was stopped, the reaction mixture was stirred for 2 h at room temperature and then heated at 60 C. for 6 h, then for a further 4 h at 68 C. Subsequently, the reaction mixture was cooled to 0 C. and slowly added dropwise to a solution of NaOH (0.66 g) in a mixture of water and ice (6 g) cooled with an external acetone/dry ice (78 C.) external bath so that the reaction mixture temperature did not exceed 21 C. During the addition of the reaction mixture, the pH was maintained at about 6 by the addition of a further portion of aqueous NaOH. The pH of the mixture was then raised to 10.5 and stirred for 2 h, then adjusted to pH=7 and stirred overnight. The mixture was then cooled to 0 C. with ice and water, the pH was reduced to 1.5 with HCl and extracted with CH.sub.2Cl.sub.2 (55 mL). Each of the organic phases was washed with 7.5 ml of a dilute HCl solution (pH 1.5). The aqueous phases were combined, alkalized with dilute NaOH to pH=10.5 and extracted with CH.sub.2Cl.sub.2 (55 mL). Each organic phase was washed with 27.5 ml phosphate buffer (0.5 M, pH=6.2). The organic phases were combined, dried with anhydrous Na.sub.2SO.sub.4, filtered and concentrated. The resulting oil was dissolved in ethyl acetate (20 mL), evaporated on a vacuum evaporator and this operation was repeated once more. The oil was dissolved in ethyl acetate and subjected to decolorization with charcoal (50 mg) for 30 min. Subsequently, it was filtered through Celite and concentrated to an oil. Subsequently dissolved in ethyl acetate (8 mL) and absolute ethanol (2 mL) and at vigorous stirring, concentrated HCl was added to a final pH of 0.5. The resulting slurry was stirred for 1 hour at room temperature, then for 30 min at 0 C. The crystals were filtered off, washed with ethyl acetate (1 mL) and dried overnight at 80 C. under vacuum. Thus ethanol solvate of lincosamide hydrochloride of formula I was obtained wherein R3=Cl (S configuration) in a total yield of about 80%.
(170) Preparation of hydrochloride hydrate: The ethanol solvate prepared by the above process is dissolved in water, evaporated to syrup, dissolved in hot acetone, then slowly cooled to room temperature for 4 hours. Subsequent cooling of the acetone solution to 0 C. causes precipitation of the lincosamide hydrochloride hydrate crystals. These are filtered off after 30 min at 0 C. and air-dried. The yield is about 90%.
Example 30: Preparation of a Precursor of Formula III Wherein R1 is C4-C6 Alkyl, R3 is OH (R Configuration), R4 is H or CH.SUB.3
(171) The preparation is analogous to the procedure for the preparation of the precursors of formula III wherein R1=C3 alkyl as described in Example 1 except that the bacterial culture incubated in YEME medium is supplemented with 50 l 200 mM 4-butyl-L-proline (for R1=C4 alkyl) or 4-pentyl-L-proline (for R1=C5 alkyl) or 4-hexyl-L-proline (for R1=C6 alkyl). Isolation of the precursor of formula III is then carried out analogously to the procedure described in Example 1.
(172) LC-MS Analysis
(173) Two precursors, 107, 108 having the following structures and the LC-MS parameters listed in Table 29, were prepared.
(174) ##STR00036##
(175) TABLE-US-00030 TABLE 29 Results of LC-MS analysis of the compounds 107, 108 Major Pseudomolecular detected Fragmentation ion - theoretical ion in MS in source - Retention value m/z for spectrum major detected Lincosamide time (min) z = 1 (m/z) ions (m/z) 107 4.21 494.2536 494.2499 373.23, 140.14 108 5.11 508.2693 508.2666 387.25; 154.16
(176) LC-MS analyses were performed according to the procedure described in Example 3.
Example 31: Preparation of the Precursor of Formula II, Wherein R1 is C4-C6 Alkyl, R3 is OH or OCH.SUB.3 .(R Configuration), R4 is H or CH.SUB.3
(177) Reaction mixture 1 contained: 20 M CcbF, 20 M Ccb5, 200 M lincosamide precursor of formula III wherein R1 is C4-C6 alkyl, R3 is OH, R4 is H or CH.sub.3 and R5 is Hits preparation is described in Example 30, 200 M pyridoxal-5-phosphate, 100 mM Tris pH 7.5. In the case of preparing new lincosamide compounds according to formula II, wherein R3=OCH.sub.3, the reaction mixture additionally contained 20 M Ccb4 and 4 mM S-adenosylmethionine. Reaction mixture 1 was incubated at 30 C. for 2 h. Preparation of heterologous proteins is described in Example 2.
Example 32: In Vitro Enzymatic Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C4-C6 Alkyl, R3=OCH.SUB.3 .or OH (R Configuration), R4=H or CH.SUB.3., R21-R24 are H and R25 is OH
(178) Reaction mixture 2 contained: 2 M Ccb2, 2 M Ccb1, 2 mM salicylic acid, 4.5 mM adenosine triphosphate, 2 mM coenzyme A, 2 mM MgCl.sub.2, 100 mM Tris pH 7.5. Reaction mixture 2 was incubated at 30 C. for 30 min. Subsequently, reaction mixture 2 was mixed in the ratio 1:1 with reaction mixture 1 (preparation according to example 32) containing the lincosamide precursor of formula II and incubated at 30 C. for further 2 h. Lincosamide isolation was performed as described in Example 3.
(179) ##STR00037## ##STR00038##
Example 33: Preparation of Novel Lincosamide Compounds of Formula I Wherein R1=C4-C6 Alkyl, R3=Cl (S Configuration), R4=H or CH.SUB.3., R21-R24 are H and R25 is OH
(180) Preparation of novel lincosamides wherein R1=C4-C6 alkyl and R3=Cl starts from the lincosamides prepared in Example 32, wherein R3=OH (R configuration). They are synthetically chlorinated by the same chlorination procedure as described in Example 29.
(181) ##STR00039## ##STR00040##