Alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohols
10822593 ยท 2020-11-03
Assignee
Inventors
Cpc classification
International classification
Abstract
The present disclosure discloses an alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohols, and belongs to the technical field of bioengineering. The alcohol dehydrogenase mutant of the present disclosure has excellent catalytic activity and stereoselectivity, and may efficiently catalyze the preparation of a series of chiral diaryl alcohols in R- and S-configurations. By coupling alcohol dehydrogenase of the present disclosure to glucose dehydrogenase or formate dehydrogenase, the synthesis of chiral diaryl alcohol intermediates of various antihistamines may be achieved. Compared with the prior art, a method for preparing diaryl chiral alcohols through asymmetric catalytic reduction using the alcohol dehydrogenase of the present disclosure has the advantages of simple and convenient operation, high substrate concentration, complete reaction and high product purity, and has great industrial application prospects.
Claims
1. An alcohol dehydrogenase mutant, wherein the alcohol dehydrogenase mutant comprises an amino acid sequence having all of SEQ ID NO: 2 except for: (a) a substitution of valine for serine at position 196 of SEQ ID NO:2; (b) a substitution of glycine for serine at position 196 of SEQ ID NO:2; (c) a substitution of tryptophan for serine at position 196 of SEQ ID NO:2; (d) a substitution of proline for serine at position 196 of SEQ ID NO:2; or (e) a substitution of valine for phenylalanine at position 161 of SEQ ID NO:2 and a substitution of glycine for serine at position 196 of SEQ ID NO:2; and wherein the alcohol dehydrogenase mutant has alcohol dehydrogenase activity.
2. A method for producing chiral SE chlorophenyl)-(pyridin-2-yl)-methanol (CPMA) which comprises: combining the alcohol dehydrogenase mutant of claim 1 at a concentration of 1 to 10 kU/L with prochiral (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK) at a concentration of 10 to 500 mM, and NADP.sup.+ at a concentration of 0.1 to 1.0 mM; adding a coenzyme circulation system comprising glucose dehydrogenase at a concentration of 1 to 10 kU/L, D-glucose at a concentration of 20 to 1000 mM, and a phosphate buffer; incubating the coenzyme circulation system with the alcohol dehydrogenase mutant, CPMK, and NADP.sup.+ at 30 to 35 C. and a pH of 6 to 8 for 1 to 24 hours to produce CPMA; and extracting the CPMA by adding an organic solvent after an asymmetric reduction reaction; wherein the coenzyme circulation system further comprises: (i) phosphite and phosphite dehydrogenase (FTDH), (ii) formic acid and formate dehydrogenase (FDH), (iii) lactic acid and lactate dehydrogenase (LDH), or (iv) glycerol and glycerol dehydrogenase.
Description
BRIEF DESCRIPTION OF FIGURES
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION
(6) The present disclosure will be described in detail below by means of specific embodiments, but this does not limit the present disclosure to the scope of the described embodiments. The experimental methods without indicated specific experimental conditions in the following embodiments may be selected according to conventional methods and conditions, or according to the specification.
Example 1: Method for Measuring Activity of Alcohol Dehydrogenase and Optical Purity of Product
(7) Adopting a total reaction system of 200 L, including: 1.0 mM NADPH, 1.0 mM substrate CPMK and sodium phosphate buffer (PBS, 100 mM, pH 7.0), fully and evenly mixing, maintaining at 30 C. for 2 min, adding an appropriate amount of enzyme solution, and detecting the change in light absorption at 340 nm.
(8) The enzyme activity was calculated by the following formula:
(9) Enzyme activity (U)=EWV10.sup.3/(62201);
(10) in the formula, EW is the change in absorbance at 340 nm in 1 min; V is the volume of a reaction solution in mL; 6220 is the molar extinction coefficient of NADPH in L/(mol.Math.cm); and 1 is the optical path distance in cm. One activity unit (U) corresponds to the amount of enzyme required to catalyze the oxidation of 1 mol NADPH per minute under the above conditions.
(11) Method for determining optical purity ee:
(12)
(13) As: molar concentration of (S)-CPMA obtained by liquid chromatography; and A.sub.R:molar concentration of (R)-CPMA obtained by liquid chromatography.
Example 2: Construction of Alcohol Dehydrogenase Mutant Gene and Recombinant Expression Transformant
(14) A whole plasmid PCR method was used for site-directed mutagenesis on amino acid residues at positions 161 and 196 to construct an iterative combination mutant. The primer design was as follows (all described in the 5-3 direction, and the underline represents the mutation site):
(15) TABLE-US-00001 M1(usingpET28a-KpADHrecombinantplasmidasa template): S196V-F: ACTATCCACCCAGTTTTCGTT; (SEQIDNo.3) S196V-R: TCCGAAAACGAAAACTGGGTG; (SEQIDNo.4) M2(usingpET28a-KpADHrecombinantplasmidasa template): S196W-F: ACTATCCACCCATGGTTCGTT; (SEQIDNo.5) S196W-R: TCCGAAAACGAACCATGGGTG; (SEQIDNo.6) M3(usingpET28a-KpADHrecombinantplasmidasa template): S196P-F: ACTATCCACCCACCTTTCGTT; (SEQIDNo.7) S196P-R: TCCGAAAACGAAAGGTGGGTG; (SEQIDNo.8) M4(usingpET28a-KpADHrecombinantplasmidasa template): S196G-F: ACTATCCACCCAGGTTTCGTT; (SEQIDNo.9) S196G-R: TCCGAAAACGAAACCTGGGTG; (SEQIDNo.10) M5(usingM4recombinantplasmidasatemplate): F161V-F: TATGAAAATGTCGTTACTGCT; (SEQIDNo.11) F161V-R: ACAATAAGCAGTAACGACATT. (SEQIDNo.12)
(16) A PCR reaction system was: a PCR reaction system (50 L) including KOD enzyme (2.5 U/mL) 1.0 L, template (5-50 ng) 1.0 L, dNTP 4.0 L, 10 reaction buffer 5.0 L, forward primer 1.0 L, reverse primer 1.0 L, and the rest of ddH2O to make the reaction system 50 L in total.
(17) A PCR amplification procedure was: (1) denaturation at 94 C. for 3 min, (2) denaturation at 94 C. for 30 sec, (3) annealing at 54 C. for 30 sec, (4) extension at 72 C. for 150 sec, repeating steps (2) to (4) for 10-15 cycles, finally extension at 72 C. for 10 min, and storing a PCR amplification product at 4 C.
(18) After PCR, Dpnl restriction enzyme was added into a reaction mixture and incubated at 37 C. for 1 h, 10 L digested PCR reaction solution was transferred into 50 L E. coli BL21 (DE3) competent cells through CaCl.sub.2 thermal transformation, and the cells were used to uniformly coat an LB agar plate containing 50 g/mL kanamycin sulfate for inversion culture at 37 C. for 12 h.
Example 3: Expression and Purification of Alcohol Dehydrogenase and Mutant Thereof
(19) Recombinant Escherichia coli carrying a stereoselective improvement mutant was inoculated into an LB medium containing kanamycin sulfate (50 g/mL) at a transfer amount of 2% for shake cultivation at 37 C. and 200 rpm, 0.2 mM isopropyl--D-thiogalactofuranoside (IPTG) was added for induction at 25 C. when the absorbance OD.sub.600 of the medium reached 0.8, after 8 hours of induction, a strain for efficient expression of a recombinant alcohol dehydrogenase mutant was obtained through 10 minutes of centrifugation at 8000 rpm, and the collected strain was suspended in a potassium phosphate buffer (100 mM, pH 6.0) for ultrasonication.
(20) A column used for purification was a nickel affinity column HisTrap FF crude, and purification was achieved through affinity chromatography using a histidine tag on recombinant protein. The nickel column was equilibrated with a solution A first, a crude enzyme solution was loaded, a penetrating peak was further eluted off using the solution A, and after equilibrium, a solution B (20 mM sodium phosphate, 500 mM NaCl, and 1000 mM imidazole, pH 7.4) was used for gradient elution to elute off the recombinant protein bound to the nickel column, so as to obtain the recombinant alcohol dehydrogenase mutant. The purified protein was subjected to activity measurement (CPMK as substrate, and NADPH as coenzyme) and SDS-PAGE analysis. After purification of the nickel column, a single band was displayed at around 45 kDa, and the amount of impure protein was small, indicating that the column purification effect was good. The purified alcohol dehydrogenase protein was then replaced into a Tris-HCl (100 mM, pH 7.0) buffer using a Hi Trap Desalting column (GE Healthcare).
Example 4: Kinetic and Stereoselective Analysis of Alcohol Dehydrogenase Mutant
(21) The activity of KpADH at different substrate concentrations and coenzyme concentrations was determined, and a double reciprocal curve was made based on the reciprocal of activity and substrate concentration to calculate kinetic parameters.
(22) It can be seen from Table 1 that the k.sub.cat/K.sub.m of KpADH to CPMK was 28.9 s.sup.1.Math.mM.sup.1, the reduction product configuration was R configuration, and the ee value was 82.5%. The stereoselectivity of (R)-CPMA synthesized by mutants M1, M2 and M3 was increased to 95% or above, and the ee values of the products were 98.7%, 97.7% and 95.2% respectively. Mutant M4 showed a reduced stereoselectivity, the reduction product configuration was also R configuration, and the ee value of the product was 22.4%. Mutant M5 showed an inverted stereoselectivity, the reduction product was in the S configuration, and the ee value of the product was 75.4%.
(23) TABLE-US-00002 TABLE 1 Kinetic parameters and stereoselectivity of alcohol dehydrogenase mutant Vmax Kcat/Km Km (mol .Math. Kcat (s.sup.1 .Math. ee Config. Enzyme (mM) min.sup.1 .Math. mg.sup.1) (s.sup.1) mM.sup.1) (%) (R/S) KpADH 0.410 17.9 11.8 28.9 82.5 R M1 0.72 21.3 17.0 23.6 98.7 R M2 0.702 21.3 14.2 20.3 97.7 R M3 0.604 22.3 14.8 24.6 95.2 R M4 0.730 26.5 17.6 24.1 22.3 R M5 0.69 17.69 11.79 17.09 75.4 S
Example 5: Substrate Specificity Analysis of Alcohol Dehydrogenase Mutant
(24) The reduction of prochiral carbonyl compounds by the alcohol dehydrogenase mutant obtained in Embodiment 2 was studied, and the studied prochiral carbonyl compounds include (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK), phenyl-(pyridin-2-yl)-methanone, (4-chlorophenyl)-(phenyl)-methanone, (4-fluorophenyl)-(phenyl)-methanone, (4-brormophenyl)-(phenyl)-methanone and (4-methoxyphenyl)-(phenyl)-methanone. It can be seen from Table 2 that for the substrate CPMK, the reduction products of M1, M2 and M3 were all in the R-configuration, and the ee values of the products were all higher than 95%; for the substrate phenyl-pyridin-2-yl-ketone, only the ee value of the reduction product of M3 was 95% or above, and the configuration of the reduction product of M5 was opposite to that of the female parent, with the value of 75.5%. For the substrate (4-bromophenyl)-(pyridin-2-yl)-methanone, the ee value of the catalytic product of M1 was 99% or above, and the ee value of the catalytic product of M2 was also high, which was 95.5%; and for (4-fluorophenyl)-(pyridin-2-yl)-methanone and (4-methoxyphenyl)-(phenyl)-methanone, the ee value of each catalytic product of M5 was 95% or above, and the configuration was identical to that of the female parent.
(25) TABLE-US-00003 TABLE 2 Substrate specificity of alcohol dehydrogenase mutant Substrate WT M1 M2 M3 M4 M5
Example 6: Preparation of (R)-CPMA with High Optical Purity Through Asymmetric Reduction of CPMK by Alcohol Dehydrogenase Mutant
(26) A 20 mL biocatalytic system was established: 100 mM potassium phosphate buffer (pH 7.0), and the alcohol dehydrogenase mutant M1 obtained in Embodiment 2 as well as wild KpADH 10 g/L, CPMK 100 mM, 200 mM and 500 mM were added (substrate added in batches). The reaction was performed at 30 C. and 200 rpm for 12 h with a constant pH of 7.5. The conversion rate analysis results during the reaction are shown in Table 3 and Table 4. It can be seen that both the wild type dehydrogenase and the mutant M1 may asymmetrically reduce 100 mM and 200 mM CPMK. When the CPMK concentration was 200 mM, the wild type KpADH and the mutant M1 required 12 h and 24 h respectively to achieve a conversion rate close to 99.9%. The final reduction product of the wild type KpADH was (R)-CPMA, and the ee value was 82%; and the final reduction product of the mutant M1 was also (R)-CPMA, and the ee value was 99.7%. The obtained crude products of (R)-CPMA were redissolved in ethanol, and corresponding pure products of (R)-CPMA were added as seed crystals to recrystallize at 4 C. to finally obtain products with optical purity greater than 99.9% ee.
(27) TABLE-US-00004 TABLE 3 Asymmetric reduction of CPMK catalyzed by wild type alcohol dehydrogenase KpADH Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 47.76 25.6 11.7 2 77.9 36.9 20.1 3 87.1 50.5 44.8 4 96.5 62.8 59.6 6 98.7 85.3 80.2 8 99.6 97.4 93.2 12 >99.9 99.4 95.6 24 >99.9 99.7 99.2
(28) TABLE-US-00005 TABLE 4 Asymmetric reduction of CPMK catalyzed by alcohol dehydrogenase mutant M1 Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 35.6 29.1 18.8 2 64.6 36.4 24.1 3 79.4 42.8 30.6 4 90.2 80.6 55.3 6 98.2 89.7 76.9 8 99.2 94.2 87.6 12 99.4 97.4 92.2 24 99.6 99.2 99.5
Example 7: Preparation of (R)-4-Fluorophenyl-Phenylmethanol with High Optical Purity Through Asymmetric Reduction of CPMK by Alcohol Dehydrogenase Mutant
(29) A 20 mL biocatalytic system was established: 100 mM potassium phosphate buffer (pH 7.0), and 10 g/L alcohol dehydrogenase mutant M4 cells obtained in Embodiment 2 and (4-fluorophenyl)-phenyl-methanone 50 mM were added. The reaction was performed at 30 C. and 200 rpm for 24 h with a constant pH of 7.5. The conversion rate analysis results during the reaction are shown in Table 5. When the substrate concentration was 50 mM, the alcohol dehydrogenase mutant M4 may achieve a substrate conversion rate of 99% or above within 24 h, and the reduction products were all (R)-4-fluorophenyl-phenylmethanol, wherein the ee value of the wild type KpADH reduction product was only 25.3%, and the ee value of the mutant M4 reduction product may reach 99.5%. The obtained crude products of (R)-4-fluorophenyl-phenylmethanol were redissolved in ethanol, and corresponding pure products were added as seed crystals to recrystallize at 4 C. to finally obtain products with optical purity greater than 99.9% ee.
(30) TABLE-US-00006 TABLE 5 Asymmetric reduction of 50 mM (4-fluorophenyl)-phenyl- methanone catalyzed by alcohol dehydrogenase mutant M4 Conversion rate (%) Reaction time (h) WT M4 1 15.6 10.1 2 34.6 26.4 3 49.4 32.8 4 60.2 51.6 6 88.2 72.7 8 94.2 84.2 12 98.4 92.4 24 99.6 99.4
Example 8: Preparation of (R)-(4-methoxyphenyl)-(phenyl)-methanone with High Optical Purity Through Asymmetric Reduction of CPMK by Alcohol Dehydrogenase Mutant
(31) A 20 mL biocatalytic system was established: 100 mM potassium phosphate buffer (pH 7.0), and 10 g/L alcohol dehydrogenase mutant M4 cells obtained in Embodiment 2 and (4-methoxyphenyl)-(phenyl)-methanone were added. The reaction was performed at 30 C. and 200 rpm for 24 h with a constant pH of 7.5. The conversion rate analysis results during the reaction are shown in Table 6. When the substrate concentration was 50 mM, the alcohol dehydrogenase mutant M4 may achieve a substrate conversion rate of 99% or above within 24 h, and the reduction products were all (R)-4-methoxyphenyl-phenylmethanol, wherein the ee value of the wild type KpADH reduction product was only 15.1%, and the ee value of the mutant M4 reduction product may reach 99.7%. The obtained crude products of (R)-4-methoxyphenyl-phenylmethanol were redissolved in ethanol, and the corresponding pure products were added as seed crystals to recrystallize at 4 C. to finally obtain products with optical purity greater than 99.9% ee.
(32) TABLE-US-00007 TABLE 6 Asymmetric reduction of CPMK catalyzed by alcohol dehydrogenase mutant M5 Conversion rate (%) Reaction time (h) WT M5 1 23.6 12.4 2 34.2 23.3 3 44.9 39.4 4 64.6 50.7 6 79.2 68.9 8 90.4 79.2 12 96.3 93.4 24 99.8 99.6