METHOD FOR IMPROVING FETAL HEMOGLOBIN EXPRESSION
20200339979 ยท 2020-10-29
Inventors
- Pengfei YUAN (Beijing, CN)
- Riguo FANG (Beijing, CN)
- Lingling YU (Beijing, CN)
- Penghui XIA (Beijing, CN)
- Jia WANG (Beijing, CN)
- Fucai LIANG (Beijing, CN)
Cpc classification
C12N2501/125
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K2035/124
HUMAN NECESSITIES
C12N15/87
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
C12N5/10
CHEMISTRY; METALLURGY
C12N5/0647
CHEMISTRY; METALLURGY
C12N2501/999
CHEMISTRY; METALLURGY
A61K35/28
HUMAN NECESSITIES
C12N2310/346
CHEMISTRY; METALLURGY
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
International classification
C12N15/11
CHEMISTRY; METALLURGY
A61K35/28
HUMAN NECESSITIES
C12N15/87
CHEMISTRY; METALLURGY
Abstract
Provided is a method for genetically editing an enhancer locus of hematopoietic stem cell BCL11A, comprising: disrupting the CTTCCT region of a BCL11A genome by gene editing technology. The genetically edited hematopoietic stem cells have normal cell functions and can significantly increase the expression of fetal hemoglobin, thereby being used for the treatment of thalassemia and sickle cell anemia.
Claims
1. A method for increasing the expression of fetal hemoglobin (HbF) in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence in the chromosome 2 in the hematopoietic stem cells by gene editing technology, wherein the BCL11A genomic region is located in a region from chr2:60495236 to chr2:60495271.
2. The method according to claim 1, wherein the BCL11A genomic region sequence is CTTCCT.
3. The method according to claim 1, wherein the gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology, or a CRISPR/Cas gene editing technology.
4. The method according to claim 3, wherein the gene editing technology is a CRISPR/Cas9 gene editing technology.
5. The method according to claim 1, comprising introducing an sgRNA targeting the BCL11A genomic region into the hematopoietic stem cells to edit the BCL11A genomic region.
6. The method according to claim 5, comprising introducing an sgRNA comprising a sequence selected from any one of SEQ ID NOs: 3, 4, 8 and 33-63 into the hematopoietic stem cells to edit the BCL11A genomic region.
7. The method according to claim 6, wherein an sgRNA comprising the sequence of SEQ ID NO: 4 is introduced into the hematopoietic stem cells to edit the BCL11A genomic region.
8. The method according to claim 4, wherein the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified.
9. The method according to claim 8, wherein the chemical modification is 2-O-methyl modification of the first one, two, and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA.
10. The method according to claim 4, wherein the sgRNA and the Cas9-encoding nucleotides are co-introduced into the hematopoietic stem cells.
11. The method according to claim 10, wherein the sgRNA and the Cas9-encoding nucleotides are co-introduced into the hematopoietic stem cells by electroporation.
12. The method according to claim 11, wherein the electroporation conditions are 200-600 V, 0.5 ms-2 ms.
13-18. (canceled)
19. A human hematopoietic stem cell increasing the expression of fetal hemoglobin (HbF) by genetic modification, wherein an sgRNA targeting a BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence in the chromosome 2 in the hematopoietic stem cell is introduced into said hematopoietic stem cells, wherein the BCL11A genomic region is located in a region from chr2:60495236 to chr2:60495271.
20-21 (canceled)
22. A method for preparing mature erythrocytes or precursor cells thereof being genetically modified to increase the expression of fetal hemoglobin (HbF), which comprises: (a) obtaining genetically modified hematopoietic stem cells by the method of claim 1; (b) performing hematopoietic stem cell erythroid expansion and differentiation of the genetically modified hematopoietic stem cells by using a HSPCs erythroid expansion and differentiation medium, wherein the HSPCs erythroid expansion and differentiation medium comprises a basal medium, and a composition of growth factors, and wherein the composition of growth factors comprises a stem cell growth factor (SCF), interleukin 3 (IL-3) and erythropoietin (EPO).
23. The method according to claim 22, further comprising: performing hematopoietic stem cell erythroid differentiation and enucleation by using an erythroid differentiation and enucleation medium, wherein the erythroid differentiation and enucleation medium comprises a basal medium, growth factors, and antagonists and/or inhibitors of a progesterone receptor and a glucocorticoid receptor.
24. The method according to claim 23, wherein the growth factors in the erythroid differentiation and enucleation medium comprise erythropoietin (EPO), and the antagonists and/or inhibitors of a progesterone receptor and a glucocorticoid receptor are any one, or two or more selected from the following compounds (I)-(IV): ##STR00006##
25-35. (canceled)
36. An sgRNA construct comprising an sgRNA targeting a BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495236 to chr2:60495271.
37. The construct according to claim 36, comprising a nucleotide sequence selected from any one of SEQ ID NOs: 3, 4, 8, and 33-63.
38. The construct according to claim 37, which comprises a 2-O-methyl modification and/or an internucleotide 3-thio modification.
39-41. (canceled)
42. A method for treating or preventing an anemia disease, a hemorrhagic disease, a tumor, or other diseases requiring massive blood transfusion for prevention or treatment in a subject, comprising administering the hematopoietic stem cells according to claim 19 to the subject.
43-44. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS
[0096] The present application relates to a BCL11A enhancer locus for CD34-positive hematopoietic stem cells, in particular disrupting a region of the BCL11A gene from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence, e.g., the 6-bp base sequence of CTTCCT (chr2:60495251-60495256) may eliminate the inhibition of fetal hemoglobin synthesis by BCL11A gene, thereby increasing the expression of fetal hemoglobin.
[0097] In one aspect, the present invention provides a method for increasing the expression of fetal hemoglobin (HbF) in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence in the chromosome 2 in the hematopoietic stem cells by gene editing technology, wherein the BCL11A genomic region is located in a region from chr2:60495236 to chr2:60495271. In some embodiments, wherein the BCL11A genomic region sequence is CTTCCT.
[0098] The CTTCCT sequence of the BCL11A genomic region mentioned in the present application refers to a sequence located in a region from positions 60495251-60495256 of human chromosome 2, wherein a chromosomal nucleotide position is consistent with the position in the GRCh38 standard human gene sequence. Those skilled in the art will appreciate that the positions of CTTCCT sequence may be different while referring to different human genomic sequences. In some embodiments, the disruption of a BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence includes introducing insertion and/or deletion (indel) of a nucleotide sequence into this region, for example, introducing an indel of any kind of nucleotide (e.g., selected from A, T, C, or G) and/or quantity (e.g., 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2) of nucleotides. In some embodiments, the disruption comprises replacing the original nucleotide sequence with a new nucleotide sequence, for example, replacing 1, 2, 3, 4, 5 or 6 original nucleotides of the 6 contiguous nucleotides CTTCCT with 1, 2, 3, 4, 5 or 6 new nucleotides. In some embodiments, the disruption comprises the knock-in or knock-out of a nucleotide sequence in a BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence, e.g., the knock-in or knock-out of a nucleotide sequence in the region of the 6 contiguous nucleotides CTTCCT. According to the results of gene analysis, the 6-bp base sequence of CTTCCT contains binding sites of the STAT1 and ELF1 genes.
[0099] Without being bound by any theory or hypothesis, the disruption of CTTCCT and its vicinity in the present invention, for example, the introduction of an indel into this region, may directly affect the binding of STAT1 and ELF-1 to the BCL11A enhancer, and significantly up-regulate the expression of fetal hemoglobin, as demonstrated by Enhancer 2 in an embodiment of the invention. Gene editing around the CTTCCT region, for example, the gene editing a region around 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 nucleotides upstream and/or downstream of the CTTCCT region, e.g., introducing an indel into the region may also increase the expression of fetal hemoglobin to varying degrees, see for example,
[0100] In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495236 to chr2:60495271. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-14 nucleotides upstream of the CTTCCT sequence to 0-14 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495237 to chr2:60495270. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-13 nucleotides upstream of the CTTCCT sequence to 0-13 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495238 to chr2:60495269. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-12 nucleotides upstream of the CTTCCT sequence to 0-12 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495239 to chr2:60495268. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-11 nucleotides upstream of the CTTCCT sequence to 0-11 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495240 to chr2:60495267. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-10 nucleotides upstream of the CTTCCT sequence to 0-10 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495241 to chr2:60495266. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-9 nucleotides upstream of the CTTCCT sequence to 0-9 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495242 to chr2:60495265. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-8 nucleotides upstream of the CTTCCT sequence to 0-8 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495243 to chr2:60495264. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-7 nucleotides upstream of the CTTCCT sequence to 0-7 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495244 to chr2:60495263. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-6 nucleotides upstream of the CTTCCT sequence to 0-6 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495245 to chr2:60495262. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-5 nucleotides upstream of the CTTCCT sequence to 0-5 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495246 to chr2:60495261. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-4 nucleotides upstream of the CTTCCT sequence to 0-4 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495247 to chr2:60495260. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-3 nucleotides upstream of the CTTCCT sequence to 0-3 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495248 to chr2:60495259. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-2 nucleotides upstream of the CTTCCT sequence to 0-2 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495249 to chr2:60495258. In some embodiments, the BCL11A genomic region disrupted in the present invention is a region from 0-1 nucleotide upstream of the CTTCCT sequence to 0-1 nucleotide downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495250 to chr2:60495257. In some embodiments, the BCL11A genomic region sequence disrupted in the present invention is CTTCCT, wherein the BCL11A genomic region is located in a region from chr2:60495251 to chr2:60495256.
[0101] In some embodiments, the utmost upstream of the BCL11A genomic region is located at the 15th, 14th, 13th, 12th, 11th, 10th, 9th, 8th, 7th, 6th, 5th, 4th, 3rd, 2nd, or 1st nucleotide upstream of the CTTCCT sequence, or the 1st, 2nd, or 3rd nucleotide at the 5 end of the CTTCCT sequence. In some embodiments, the utmost downstream of the BCL11A genomic region is located at the 15th, 14th, 13th, 12th, 11th, 10th, 9th, 8th, 7th, 6th, 5th, 4th, 3rd, 2nd, or 1st nucleotide downstream of the CTTCCT sequence, or the 1st, 2nd, or 3rd nucleotide at the 3 end of the CTTCCT sequence. In some embodiments, the utmost upstream of the BCL11A genomic region is located at chr2:60495253, chr2:60495252, chr2:60495251, chr2:60495250, chr2:60495249, chr2:60495248, chr2:60495247, chr2:60495246, chr2:60495245, chr2:60495244, chr2:60495243, chr2:60495242, chr2:60495241, chr2:60495240, chr2:60495239, chr2:60495238, chr2:60495237, or chr2:60495236. In some embodiments, the utmost downstream of the BCL11A genomic region is located at chr2:60495254, chr2:60495255, chr2:60495256, chr2:60495257, chr2:60495258, chr2:60495259, chr2:60495260, chr2:60495261, chr2:60495262, chr2:60495263, chr2:60495264, chr2:60495265, chr2:60495266, chr2:60495267, chr2:60495268, chr2:60495269, chr2:60495270, or chr2:60495271. The utmost upstream and utmost downstream of the BCL11A genomic region may be a combination of any one of the above utmost upstream and utmost downstream positions, and the BCL11A genomic region is not a GATAA site.
[0102] In some embodiments, the BCL11A genomic region of the invention is selected from the sequences with 1-36 (e.g., about 1-4, 1-6, 1-8, 1-10, 1-15, 1-20, 1-25, or 1-30) contiguous nucleotides of SEQ ID NO: 31 or SEQ ID NO: 32 as shown below, and the BCL11A genomic region is not a GATAA site:
TABLE-US-00001 (anucleotidesequencefromchr2:60495236to chr2:60495271) SEQIDNO:31 atcagaggccaaacccttcctggagcctgtgataaa (acomplementarysequenceofthenucleotide sequencefromchr2:60495236tochr2:60495271) SEQIDNO:32 tttatcacaggctccaggaagggtttggcctctgat
[0103] Accordingly, in one aspect, the present invention relates to a method for increasing the expression of fetal hemoglobin (HbF) in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region of 6 consecutive bases CTTCCT (chr2:60495251-60495256) in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The invention also relates to a method for increasing the expression of fetal hemoglobin (HbF) in human hematopoietic stem cells, comprising: disrupting a region around 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 nucleotides upstream and/or downstream of the 6 consecutive bases CTTCCT region in the chromosome 2 in the hematopoietic stern cells by gene editing technology.
[0104] In some embodiments, wherein the gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology, or a CRISPR/Cas gene editing technology. In some embodiments, the gene editing technology is a CRISPR/Cas9 gene editing technology.
[0105] In some embodiments, the method comprises introducing an sgRNA targeting the BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence (e.g., an sgRNA comprising CTTCC or a sequence complementary to CTTCC) into the hematopoietic stem cells to achieve editing of the BCL11A genome, wherein the BCL11A genomic region is located in a region from chr2:60495236 to chr2:60495271. In some embodiments, the method comprises introducing an sgRNA comprising a sequence selected from any one of SEQ ID NOs: 3, 4, 8 and 33-63 into the hematopoietic stem cells to achieve editing of the BCL11A genome.
[0106] The present invention provides an sgRNA (such as a chemically modified sgRNA) required for gene editing of the hematopoietic stem cells, comprising the sgRNA targeting the BCL11A genomic region from 0-15 nucleotides upstream from the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence, wherein the BCL11A genomic region is located in a region from chr2:60495236 to chr2:60495271, for example, comprising CTTCC or a nucleotide sequence complementary to CTTCC, and further, comprising a nucleotide sequence selected from any one of SEQ ID NOs: 3, 4, 8 and 33-63.
[0107] The present invention also provides a method for gene editing of the hematopoietic stem cells of patients with thalassemia and sickle cell anemia.
[0108] The present invention also provides hematopoietic stem cells, mature erythrocytes, or precursor cells of the mature erythrocytes which are genetically modified to disrupt any one of the BCL11A genomic regions according to the present invention. In some embodiments, the disrupted BCL11A genomic region in the hematopoietic stem cells, mature erythrocytes, or precursor cells of the mature erythrocytes comprises any one of the sequences listed in
[0109] One object of the present invention is to efficiently modify the gene of CD.sup.34+ hematopoietic stem cells by CRISPR/Cas gene editing technology. For example, CD34-positive hematopoietic stem cells may be obtained from umbilical cord blood or bone marrow, then gene editing is performed by introducing Cas9 and a given sgRNA into the hematopoietic stem cells under optimized electroporation conditions, and the genetically edited hematopoietic stem cells are transplanted into experimental animals for the evaluation of the ability of the hematopoietic stem cells to reconstitute the hematopoietic system. The sgRNA may be designed for targeting BCL11A enhancers, such as targeting BCL11A (+58) locus, by a variety of design software, such as the CRISPR RGEN TOOLS software. In some embodiments, the designed sgRNA is chemically modified, such as a 2-O-methyl modification and an internucleotide 3-thio modification at the three bases of its 5-end and 3-end. High efficient sgRNA may be obtained by testing the combinations of Cas9 mRNA and different sgRNAs. In some embodiments, the hematopoietic stem cells are obtained by clinical grade magnetic column sorting, and the Cas9 protein encoding nucleotides and the chemically modified sgRNA for gene editing are obtained by in vitro transcription assays. The genetically modified hematopoietic stem cells are differentiated into erythroid lineage, and the erythropoiesis rate is detected. For example, the genetically modified hematopoietic stem cells may be transplanted into NPG mice irradiated by irradiator for the evaluate of the ability to reconstitute rebuilding the hematopoietic system; alternatively, the CD34-positive hematopoietic stem cells of patients may be separated for the evaluation of gene editing efficiency, the ability of erythroid differentiation, the expression of -globin and fetal hemoglobin.
[0110] Firstly, the present invention provides a method for improving the expression of fetal hemoglobin (HbF), comprising: performing gene editing of an enhancer locus of BCL11A in the hematopoietic stem cells by a CRISPR/Cas9 gene editing technology. The editing process designs an sgRNA targeting the enhancer locus sequence of BCL11A in hematopoietic stem cells. The enhancer loci of BCL11A are named as loci +62, +58, and +55, according to their distances (numbers of kilobase) from the transcription start site. It is reported that the erythroid enhancer of BCL11A gene negatively regulates the expression of fetal hemoglobin (HbF), wherein the region containing the positions with a distance of 55 kb (kb represents 1000 bases), 58 kb, and 62 kb from the transcription start site is a key regulatory region. Although researchers have studied the loci +55, +58, and +62, the length of gene sequences before and after the above three loci are all above 1000 bp, with a total of about 6000 bp, and thus it is unknown to those skilled in the art which specific region may be edited to achieve the desired editing effect, even for locus +58, the efficiency of gene editing varies greatly (see: Bauer, DE et al. An erythroid enhancer of BCL11A subject to genetic variation decided fetal hemoglobin level. Science. 342, 253-257 (2013), and Canver M C, et al., BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature. 2015, Nov. 12; 527 (7577):192-7). Therefore, the first problem for a person skilled in the art is to find a specific area which is critical to the efficiency of gene editing.
[0111] With intensive research the inventors of the present application find that the efficiency of gene editing is greatly affected by a 150-bp base sequence at locus +58 (located in a region from positions 60495197 to 60495346 on human chromosome 2, abbreviated herein as chr2:60495197-60495346, the sequence is, for example, as shown in SEQ ID NO: 2), wherein the most critical region is the 6-bp base sequence region of CTTCCT. Through the disruption of this region, the expression of fetal hemoglobin may be increased significantly and efficiently. The disruption of the BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence, such as around a region upstream and/or downstream of the CTTCCT sequence 1-15, 1-14, 1-13 1-12, 1-1-1, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 nucleotides, can also increase the expression of fetal hemoglobin to varying degrees.
[0112] All the sgRNAs provided in the invention may be used to efficiently realize gene editing of the hematopoietic stem cells derived from a normal donor and a patient suffering from anemia, wherein the candidate sgRNAs with relatively higher efficiency may significantly increase the expression of fetal hemoglobin. It was reported in literatures that, through designing sgRNAs libraries for loci +55, +58, and +62, and screening with cell models by using CRISPR/Cas9, a sequence targeting GATAA at locus +58 is find to be a key regulatory sequence, i.e., an sgRNA comprising the GATAA sequence is most effective in increasing fetal hemoglobin. However, it is worth noting that the region around +58k anchored by the sgRNA being discovered in the present invention is different from the critical base site of GATAA disclosed in the prior art.
[0113] The inventors of the present invention found that the sequence CTTCCT in the BCL11A genomic region (the position pointed by the arrows in
[0114] Those skilled in the art can understand that after acquiring a high-efficient gene editing region, a person skilled in the art can use any gene editing method, such as zinc finger nuclease-based gene editing technology, TALEN gene editing technology, and CRISPR/Cas (such as CRISPR/Cas9) gene editing technology, and other gene editing methods found in the future, to perform gene editing of the acquired high-efficiency gene editing region, optimize the gene editing conditions, and achieve efficient gene editing. Thus, the invention encompasses any technical solutions for performing gene editing with a BCL11A gene targeting sequence selected from SEQ ID NOs: 3-25 and 33-63 and identified by the present invention through any available gene editing method. In some preferred embodiments, the invention relates to a technical solution for achieving efficient gene editing by the CRISPR/Cas9 gene editing technology.
[0115] As used herein, CRISPR/Cas is a gene editing technology including, but not limited to, a variety of naturally occurring or artificially designed CRISPR/Cas systems, such as the CRISPR/Cas9 system. The naturally occurring CRISPR/Cas system is an adaptive immune defense formed in bacteria and archaea during long-term evolution, and is used to fight against the invading viruses and foreign DNAs. For example, the mechanism of CRISPR/Cas9 is the fact that crRNA (CRISPR-derived RNA) binds to tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA/crRNA complex, which directs the nuclease Cas9 protein to cleave the double-stranded DNA at a target site in a sequence matching with the crRNA. However, a single guide RNA (sgRNA) with the guiding ability may be formed by transformation with artificially designed tracrRNA and the crRNA, the sgRNA is able to guide Cas9 to perform site-directed cleavage of DNA. As an RNA-guided dsDNA-binding protein, the Cas9 effector nuclease is capable of co-localizing RNA, DNA and proteins, thereby providing tremendous potential to be engineered. The CRISPR/Cas system may use Cas proteins of type I, II, or III. In some embodiments of the invention, the method uses Cas9. Other suitable CRISPR/Cas systems include, but are not limited to, the systems and methods described in WO2013176772, WO2014065596, WO2014018423, and U.S. Pat. No. 8,697,359.
[0116] In another aspect, the invention relates to a series of sgRNA molecules of the invention which can achieve efficient gene editing.
[0117] In the present invention, an sgRNA and a gRNA may be used interchangeably as a single guide RNA, synthetic guide RNA or a guide RNA. The sgRNA of the invention comprises a guide sequence targeting a sequence of interest. In a preferred embodiment, the sgRNA of the invention further comprises a tracr sequence and a tracr chaperone sequence.
[0118] A guide sequence in the present invention may be a sequence of about 17-20 bp with specified targeting site, and may be used interchangeably with a leader sequence or a spacer. In the context of the formation of a CRISPR complex, a target sequence is, for example, a sequence that a guide sequence is designed to be complementary thereto, wherein hybridization between a target sequence and the guide sequence promotes the formation of a CRISPR complex, and the hybridization requires that the target sequence is sufficiently complementary to the guide sequence or leader sequence, as long as it can cause hybridization and promote the formation of the CRISPR complex, while it is not necessary to be completely complementary.
[0119] Complementary means a guide sequence or leader sequence may hybridize to a target nucleotide sequence (herein the present invention, a target nucleotide sequence of BCL11A genome in the hematopoietic stem cells) according to the nucleotide pairing principle found by Watson and Crick. Those skilled in the art will appreciate that a guide sequence may hybridize to a target nucleotide sequence as long as it is sufficiently complementary to the target nucleotide sequence, and complete (100% of) complementation between them is not necessary. In some embodiments, the degree of complementarity between the guide sequence and its corresponding target sequence may be about or greater than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, when optimal alignment is performed by using an appropriate alignment algorithm. The optimal alignment may be determined by using any suitable algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, the Burrows-Wheeler Transform based algorithm, and the like.
[0120] Typically, in the context of an endogenous CRISPR system, the formation of a CRISPR complex (including the hybridization of a guide sequence to a target sequence, and then complexing with one or more Cas proteins) results in the cleavage of one or two strands in or near the target sequence (e.g., within the range of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs from the target sequence). Without wishing to be bound by theory, the tracr sequence may comprise all or a portion of a wild-type tracr sequence (for example, about or greater than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85 or more nucleotides of the wild-type tracr sequence), or a tracr sequence consisting of the above may also form part of a CRISPR complex, for example, by hybridizing along at least a portion of a tracr sequence to all or a portion of the tracr chaperone sequence which is operably linked to the guide sequence.
[0121] In some embodiments, the tracr sequence is sufficiently complementary to the tracr chaperone sequence to hybridize and participate in the formation of a CRISPR complex. Similar to the case of hybridizing a target sequence to a guide sequence or a leader sequence, complete complementation is not necessary as long as it is sufficient to perform its function. In some embodiments, in the case of optimal alignment, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% complementarity along the length of the tracr chaperone sequence.
[0122] In the present application, the sgRNA sequence targeting the BCL11A genomic region comprises an sgRNA complementary to at least 17, preferably 18, preferably 19, or preferably 20 contiguous nucleotides of the BCL11A genomic region. In some embodiments, a sequence targeting the BCL11A locus of the hematopoietic stem cells is represented by SEQ ID NO: 31 or 32, and an sgRNA is designed for the base region represented by SEQ ID NO: 31 or 32, the sgRNA sequence is required to be complementary to a sequence of at least 17, preferably 18, preferably 19, or preferably 20 contiguous nucleotides of SEQ ID NO: 31 or 32.
[0123] Specifically, the following table lists the sgRNA sequences targeting the BCL11A genomic region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotides downstream of the CTTCCT sequence.
TABLE-US-00002 SEQIDNO: sgRNAsequences 3 cacaggctccaggaagggtt 4 atcagaggccaaacccttcc 8 tttatcacaggctccaggaa 33 tcagaggccaaacccttcct 34 cagaggccaaacccttcctg 35 agaggccaaacccttcctgg 36 gaggccaaacccttcctgga 37 aggccaaacccttcctggag 38 ggccaaacccttcctggagc 39 gccaaacccttcctggagcc 40 ccaaacccttcctggagcct 41 caaacccttcctggagcctg 42 aaacccttcctggagcctgt 43 aacccttcctggagcctgtg 44 acccttcctggagcctgtga 45 cccttcctggagcctgtgat 46 ccttcctggagcctgtgata 47 cttcctggagcctgtgataa 48 ttcctggagcctgtgataaa 49 ttatcacaggctccaggaag 50 tatcacaggctccaggaagg 51 atcacaggctccaggaaggg 52 tcacaggctccaggaagggt 53 acaggctccaggaagggttt 54 caggctccaggaagggtttg 55 aggctccaggaagggtttgg 56 ggctccaggaagggtttggc 57 gctccaggaagggtttggcc 58 ctccaggaagggtttggcct 59 tccaggaagggtttggcctc 60 ccaggaagggtttggcctct 61 caggaagggtttggcctctg 62 aggaagggtttggcctctga 63 ggaagggtttggcctctgat
[0124] In some embodiments, the present invention provides a method for increasing the expression of fetal hemoglobin (HbF) in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from chr2:60495236 to chr2:60495255, particularly position 60495238 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology, or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a leader sequence of the sgRNA comprising SEQ ID NO: 4. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 4 into the hematopoietic stem cells to achieve editing of the BCL11A genome, preferably co-introducing the sgRNA and Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably, co-introducing the sgRNA and Cas9-coding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two, and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the present invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL genome from chr2:60495236 to chr2:60495255, particularly position 60495238 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, it relates to erythrocytes obtained by culturing the hematopoietic stem cells through in vitro differentiation, and a medical preparation containing the same.
[0125] In some embodiments, the present invention provides a method for increasing the expression of fetal hemoglobin (HbF) in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from chr2:60495247 to chr2:60495266, particularly position 60495263 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology, or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a leader sequence of the sgRNA comprising SEQ ID NO: 3. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 3 into the hematopoietic stem cells to achieve editing of the BCL11A genome, preferably co-introducing the sgRNA and Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably, co-introducing the sgRNA and Cas9-coding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two, and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the present invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from chr2:60495247 to chr2:60495266, particularly position 60495263 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, it relates to erythrocytes obtained by culturing the hematopoietic stem cells through in vitro differentiation, and a medical preparation containing the same.
[0126] In some embodiments, the present invention provides a method for increasing the expression of fetal hemoglobin (HbF) in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from chr2:60495252 to chr2:60495271, particularly position 60495268 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology, or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a leader sequence of the sgRNA comprising SEQ ID NO: 8. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 8 into the hematopoietic stem cells to achieve editing of the BCL11A genome, preferably co-introducing the sgRNA and Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably, co-introducing the sgRNA and Cas9-coding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two, and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the present invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from chr2:60495252 to chr2:60495271, particularly position 60495268 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, it relates to erythrocytes obtained by culturing the hematopoietic stem cells through in vitro differentiation, and a medical preparation containing the same.
[0127] In some embodiments, the inventors designed 23 sgRNAs targeting the BCL11A enhancer. The following table lists the positions of the genomic sequences on human chromosome 2 which are targeted by all the 23 sgRNAs, as well as the Cas9 cleavage sites triggered by each sgRNA.
TABLE-US-00003 Positions on the human Names genomic sequence Cleavage sites BCL11A enhancer-7 chr2:60495203-60495222 chr2:60495219 BCL11A enhancer-8 chr2:60495208-60495227 chr2:60495224 BCL11A enhancer-9 chr2:60495217-60495236 chr2:60495233 BCL11A enhancer-10 chr2:60495218-60495237 chr2:60495234 BCL11A enhancer-11 chr2:60495219-60495238 chr2:60495235 BCL11A enhancer-14 chr2:60495221-60495240 chr2:60495223 BCL11A enhancer-12 chr2:60495222-60495241 chr2:60495238 BCL11A enhancer-13 chr2:60495223-60495242 chr2:60495239 BCL11A enhancer-15 chr2:60495228-60495247 chr2:60495244 BCL11A enhancer-16 chr2:60495229-60495248 chr2:60495245 BCL11A enhancer-17 chr2:60495230-60495249 chr2:60495246 BCL11A enhancer-18 chr2:60495231-60495250 chr2:60495247 BCL11A enhancer-19 chr2:60495234-60495253 chr2:60495250 BCL11A enhancer-20 chr2:60495235-60495254 chr2:60495251 BCL11A enhancer-2 chr2:60495236-60495255 chr2:60495238 BCL11A enhancer-1 chr2:60495247-60495266 chr2:60495263 BCL11A enhancer-6 chr2:60495252-60495271 chr2:60495268 BCL11A enhancer-5 chr2:60495253-60495272 chr2:60495269 BCL11A enhancer-4 chr2:60495257-60495276 chr2:60495273 BCL11A enhancer-3 chr2:60495264-60495283 chr2:60495280 BCL11A enhancer-22 chr2:60495299-60495318 chr2:60495301 BCL11A enhancer-23 chr2:60495319-60495338 chr2:60495335 BCL11A enhancer-21 chr2:60495320-60495339 chr2:60495336
[0128] Analysis of the cleavage sites of the above 23 sgRNAs reveals that, the Cas9 cleavage sites triggered by these sgRNAs are concentrated in the genomic region from chr2:60495219 to chr2:60495336 in the BCL11A gene. And the efficiency produced by the sgRNA targeting a region from 0-15 nucleotides upstream of the CTTCCT sequence to 0-15 nucleotide regions downstream of the CTTCCT sequence (e.g., the CTTCCT) is the best, and the off-target effect of said sgRNA is relatively smaller, i.e., the sgRNA may be used for efficient gene editing.
[0129] Further, in the present invention, the sgRNAs designed by the inventors can efficiently produce Indels, and a preferred sgRNA of the present invention is selected from any one of SEQ ID NOs: 3, 4, 8, and 33-63.
[0130] A particular embodiment of the invention further comprises a composition containing said sgRNA, comprising any one of the above mentioned sgRNAs according to the invention or the vector thereof
[0131] In general, the guide sequence in an sgRNA is any polynucleotide sequence sufficiently complementary to a target polynucleotide sequence and capable of hybridizing to the target sequence, thereby guiding the sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, when optimal alignment is performed by using an appropriate alignment algorithm, the degree of complementarity between the guide sequence and its corresponding target sequence is about or greater than about 80%, 85%, 90%, 95%, 97.5%, 99% or more. Optimal alignment may be determined by using any suitable algorithm for aligning sequences, non-limiting examples of the algorithms include: the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, the Burrows-Wheeler Transform based algorithm (e.g., Burrows Wheeler Aligner), ClustalW, Clustai X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, the length of the guide sequence may be about or greater than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or more nucleotides. In some embodiments, the length of the guide sequence is less than about 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 12 or fewer nucleotides. The ability of the guide sequence to direct sequence-specific binding of the CRISPR complex to the target sequence may be assessed by any suitable assay. For example, a host cell having a corresponding target sequence may be provided with the components of a CRISPR system (including the guide sequences to be tested) capable of forming a CRISPR complex, for example, it may be performed by transfection with a vector encoding the components of the CRISPR sequences, followed by evaluation of preferential cleavages within the target sequence (e.g., determined by Surveyor as described herein). Similarly, the cleavage of a target polynucleotide sequence may be assessed in a test tube by providing a target sequence and the components of a CRISPR complex (containing a guide sequence to be tested, and a control guide sequence different from the guide sequence), and then comparing the binding or cleavage rate of the tested guide sequence and the control guide sequence on the target sequence. The above assay and evaluation can also be carried out by using other detection methods known to those skilled in the art.
[0132] In the present invention, the sgRNAs used in performing gene editing are preferably chemically modified. chemically modified sgRNA refers to an sgRNA modified with a specific chemical group, for example, 2-O-methyl modification and/or an internucleotide 3-thio modification at the 5 end and 3 end three bases.
[0133] The chemically modified sgRNA adopted by the present inventors is considered to have the following two advantages. First, since sgRNA is a single-strand RNA, its half-life is very short, and it will degrade rapidly after entering the cell (not more than 12 hrs), while at least 48 hrs is needed for Cas9 protein to bind sgRNA and perform gene editing. Therefore, a chemically modified sgRNA is used for stable expression after entering the cell, and after binding to the Cas9 protein it can efficiently edit the genome to generate Indels. Secondly, an unmodified sgRNA has poor ability to penetrate cell membranes and cannot effectively enter cells or tissues to perform corresponding functions, while the ability of a chemically modified sgRNA to penetrate cell membranes is generally enhanced. Chemical modification methods commonly used in the art may be employed in the present invention, as long as the stability of the sgRNA may be improved (prolonged half-life) and the ability to enter the cell membrane may be enhanced. In addition to the specific chemical modifications used in the examples, other modification methods are also included, for example, those chemical modification methods reported in the following literatures: Deleavey G F., Damha M J.; Designing chemically modified oligonucleotides for targeted gene silencing. Chem Biol. 2012, Aug. 24; 19(8): 937-954, and Hendel et al.; Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. Nat Biotechnol., 2015 September; 33(9): 985-989.
[0134] In some embodiments, the sgRNA and/or Cas9-encoding nucleotides (e.g., mRNA) are introduced into the hematopoietic stem cells by electroporation, e.g., under the electroporation conditions such as 250-360 V, 0.5-1 ms; 250-300 V, 0.5-1 ms; 250 V, 1 ms; 250 V 2ms; 300V, 0.5 ms; 300V, 1 ms; 360V, 0.5 ms; or 360V, 1 ms. In some embodiments, the sgRNA and Cas9-encoding nucleotides are co-introduced into the hematopoietic stem cells by electroporation. In some embodiments, the sgRNA is introduced into the hematopoietic stem cells expressing Cas9 by electroporation.
[0135] In some embodiments, the Cas9-encoding nucleotides is an mRNA, such as an mRNA comprising an ARCA cap. In some embodiments, the Cas9-encoding nucleotides are included in a viral vector, such as a lentiviral vector. In some embodiments, the Cas9-encoding nucleotides comprise the sequence represented by SEQ ID NO:26. In some embodiments, the sgRNA and the Cas9-encoding nucleotides are included in the same vector.
[0136] The present invention relates to hematopoietic stem cells obtained by the genetic modification method according to the present invention, the precursor cells at different differentiation stages before mature erythrocytes and being obtained by differentiation culture of the genetically modified hematopoietic stem cells, and the mature erythrocytes obtained by differentiation culture of the genetically modified hematopoietic stem cells.
[0137] The present invention relates to a pharmaceutical composition obtained by the method according to the present invention, the composition comprises the hematopoietic stem cells obtained by the genetic modification method of the present invention, or the precursor cells at different differentiation stages before mature erythrocytes and being obtained by differentiation culture of the genetically modified hematopoietic stem cells, or the mature erythrocytes obtained by differentiation culture of the genetically modified hematopoietic stem cells.
[0138] The pharmaceutical composition according to the present invention may be administered to a subject in need thereof by a route conventionally used for administering a medical preparation containing cellular components, e.g., by an intravenous infusion route. The dosage of administration may be specifically determined depending on the condition of the subject and the general health conditions.
[0139] In some aspects, the invention provides methods of delivering an sgRNA of the invention and/or Cas9-encoding nucleotides to hematopoietic stem cells. In some embodiments, in this delivery the construct may be introduced into the hematopoietic stem cells or other host cells by using conventional viral based and non-viral based gene transferring methods. Non-viral delivery systems include DNA plasmids, RNA (such as the vector transcripts described herein), naked nucleic acids, and liposomes. Viral vector delivery systems include DNA and RNA viruses having a free or integrated genome for the delivery to a cell. In some embodiments, the inventors introduce the genes encoding Cas9 and the sgRNA into the hematopoietic stem cells by electroporation to perform gene editing of a specific sequence of the BCL11A genomic region in the hematopoietic stem cells. After repeated experiments, the inventors found that the gene editing efficiency for co-introducing Cas9-coding nucleotides and the sgRNA into the hematopoietic stem cells by electroporation under the conditions of 200-600 V, 0.5-2 ms is significantly higher than that under other electroporation conditions.
[0140] In some embodiments, the chemically modified sgRNA and the Cas9-encoding gene are co-introduced into the CD34+ hematopoietic stem cells by electroporation, resulting in a high gene editing efficiency (indicated as Indels %). The data in the examples shows that, if the Cas9 mRNA is co-introduced together with a chemically unmodified sgRNA by electroporation, the Indels efficiency is only 2.7%, and it is much lower than that obtained by introducing a chemically modified sgRNA by electroporation (the efficiency is at least 10% or above).
[0141] As used herein, the full name of Indel is an insertion/deletion, i.e., an insertion and deletion mutation.
[0142] As used herein, hematopoietic stem cells (hematopoietic stem and progenitor cells, HSPCs) are the most primitive hematopoietic cells for generating various blood cells. Their main characteristics are the strong proliferation potential, multi-directional differentiation ability and self-renewal ability. Therefore, they not only differentiates into and supplements various blood cells, but also maintains the characteristics and quantity of stem cells through self-renewal. Hematopoietic stem cells have different differentiation degrees and proliferation abilities, and are heterogeneous. Pluripotent hematopoietic stem cells are the most primitive, they firstly differentiate into committed pluripotent hematopoietic stem cells, such as myeloid hematopoietic stem cells capable of producing granulocytic, erythroid, mononuclear cells and megakaryocyte-platelet linenages, and lymphoid stem cells capable of producing B and T lymphocytes. These two types of stem cells maintain the basic characteristics of hematopoietic stem cells, but they are slightly differentiated, and respectively responsible for producing the myeloid components and the lymphocytes, so they are called as committed pluripotent hematopoietic stem cells. They further differentiate into hematopoietic progenitor cells, which are also primitive blood cells, but have lost many of the basic features of hematopoietic stem cells, e.g., losing the ability of multi-directional differentiation, and they can only differentiate into one cell line or two closely related cell lines; they lose the ability of repeated self-renewal, and their quantity is supplemented by the proliferation and differentiation of hematopoietic stem cells; and the proliferation potential is limited and they can only divide several times. According to the number of blood cell lines that may be differentiated from the hematopoietic progenitor cells, they may be divided into unipotent hematopoietic progenitor cells (differentiating into only one blood cell line) and oligopotent hematopoietic progenitor cells (differentiating into two or three blood cell lines). The term hematopoietic stem cells according to the present invention encompasses pluripotent hematopoietic stem cells, committed pluripotent hematopoietic stem cells, and hematopoietic progenitor cells, and it is a generic term for all hematopoietic stem cells having different heterogeneities.
[0143] In a specific embodiment of the present invention, the hematopoietic stem cells (HSPCs) used in the present invention for gene editing may be derived from bone marrow, umbilical cord blood, or peripheral blood mononuclear cells (PBMCs).
[0144] As used herein, CRISPR RGEN is the name of a website developed by the research team of Korean scientist Jin-Soo Kim specifically for designing sgRNA at www.rgenome.net/about/.
[0145] As used herein, TIDE is the name of a tool website for analyzing Indels efficiency at tide-calculator.nki.nl.
[0146] As used herein, CD34, CD45RA, CD3, CD4, CD8, CD33, CD19, CD56, CD71, and CD235a are membrane protein markers of blood system cells.
[0147] As used herein, BCL11A is a transcription factor first discovered in mice as a binding site for retroviruses, it was named Evi9 and was later found in the human genome locating at locus 2p13 of the short arm in the chromosome 2, and it is mainly expressed in the germinal center of B lymphocytes.
[0148] As used herein, HBB/HBG are different subtypes of hemoglobin. Hemoglobin is a protein responsible for carrying oxygen in higher organisms. Hemoglobin consists of four chains, two a chains and two chains, each of them has a cyclic heme containing an iron atom. Oxygen is bound to the iron atom and transported by erythrocytes for using by the body.
[0149] Further, the present invention relates to hematopoietic stem cells obtained by gene editing of a specific sequence of BCL11A in the hematopoietic stem cells by CRISPR/Cas9 gene editing technology through the method of the present invention described above. Furthermore, preparations comprising the hematopoietic stem cells are also encompassed in the scope of the invention.
[0150] The hematopoietic stem cells or the preparations thereof according to the present invention may be used to treat a disease selected from the group consisting of: an anemia disease, a blood loss disease, a tumor, or other disease requiring massive blood transfusion for treatment. In particular, it may be used to treat thalassemia or sickle cell anemia.
[0151] Further, the present invention relates to an erythrocyte obtained by in vitro differentiation culture (as described below) of the genetically modified hematopoietic stem cells according to the present invention.
[0152] Further, the present invention relates to precursor cells at different stages of differentiation from hematopoietic stem cells to mature erythrocytes, which are obtained by treating the genetically modified hematopoietic stem cells of the present invention by the following erythroid expansion and differentiation steps for the hematopoietic stem cells:
[0153] wherein the above in vitro differentiation culture comprises: a hematopoietic stem cell erythroid expansion and differentiation step; and a hematopoietic stem cell erythroid differentiation and enucleation step; and
[0154] in the erythroid expansion and differentiation step, the hematopoietic stem cells are cultured by using a HSPCs erythroid expansion and differentiation medium; and
[0155] in the erythroid differentiation and enucleation step, a erythroid differentiation and enucleation medium is used.
[0156] In some embodiments, the HSPCs erythroid expansion and differentiation medium comprises: a basal medium, and a composition of growth factors, wherein the composition of growth factors comprises a stem cell growth factor (SCF), interleukin 3 (IL-3) and erythropoietin (EPO).
[0157] In some embodiments, the erythroid differentiation and enucleation medium comprises a basal medium, growth factors, and antagonists and/or inhibitors of a progesterone receptor and a glucocorticoid receptor.
[0158] When the genetically modified hematopoietic stem cells are cultured by the above method, the hematopoietic stem cells may be differentiated into mature erythrocytes by two steps, compared with the prior art, only 14 days are needed for the in vitro differentiation culture according to the present invention, and the time period is shorter and greatly shortened as compared with a time period of more than 21 days needed in the prior art.
[0159] In some embodiments, the growth factors comprise erythropoietin (EPO), and the antagonists and/or inhibitors of a progesterone receptor and a glucocorticoid receptor are any one, or two or more selected from the following compounds (I)-(IV):
##STR00002##
[0160] In some embodiments, the HSPCs erythroid expansion and differentiation medium comprises a basal medium, such as STEMSPAN SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), X-VIVO 15, alpha-MEM, RPMI 1640, and DF12 and the like. As for the growth factors, e.g., if STEMSPAN SFEM II is used as the basal medium, additional growth factors including 50-200 ng/ml SCF, 10-100 ng/ml IL-3, 1-10 U/ml EPO are needed to add into the medium, wherein the unit of U is defined as: the amount of protein that can convert 1 mol of substrate in 1 min under specific conditions, i.e., 1 IU=1 mol/min, at present, the letter I of IU (international unit) is often omitted in most clinical laboratories at home and abroad, and it is abbreviated as U. Erythropoietin (EPO) is a glycoprotein mainly secreted by the kidney in response to hypoxia or anemia, and in this embodiment, it promotes the differentiation of hematopoietic stem cells, and usually the time period of its effect is about 7 days.
[0161] If a basal medium other than STEMSPAN SFEM II is adopted as the basal medium, the following ingredients are needed: 100 ITS (insulin-transferrin-selenium) (wherein the final concentrations of each substance in the ITS of the medium are as follows: insulin concentration is 0.1 mg/ml; human transferrin, 0.0055 mg/ml; selenium, 6.7*10.sup.6 mg/ml) (i.e., mainly including insulin, human transferrin, and selenium); 10-50 g/ml vitamin C; 0.5-5% BSA (bovine serum albumin); growth factors, such as 50-200 ng/ml SCF, 10-100 ng/ml IL-3, and 1-10 U/ml EPO.
[0162] Furthermore, those skilled in the art will appreciate that any of the commonly used basal media may be used, for example, basal media commonly used in the art listed as follows: STEMSPAN SFEM II (purchased from STEM CELL TECHONOLOGIES); and IMDM; DF12; Knockout DMEM; RPMI 1640; Alpha MEM; DMEM, etc. available from Thermo Fisher.
[0163] Further, some other ingredients may also be added to the above medium as needed, for example, ITS (i e , mainly including insulin, human transferrin, and selenium), L-glutamine, vitamin C, and bovine serum albumin For example, ITS, 2 mM L-glutamine, 10-50 g/ml vitamin C, and 0.5-5 wt % BSA (bovine serum albumin) may be added into the IMDM medium. In addition, the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may also be added into the above DF12. The same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may be added into the Knockout DMEM; the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may also be added into the RPMI 1640; the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may also be added into the alpha MEM; the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may also be added into the DMEM. Herein, the concentrations of each substance in the ITS in various basal mediums are: insulin concentration is 0.1 mg/ml; human transferrin, 0.0055 mg/ml; and selenium, 6.710.sup.6 mg/ml. In addition, the concentrations of each component of the added ITS may also be adjusted according to actual needs. ITS may be purchased from Thermofisher, and adjusted to the appropriate final concentration for use as needed.
[0164] In one embodiment, the erythroid differentiation and enucleation medium comprises a basal medium, growth factors, and antagonists of a progesterone receptor and a glucocorticoid receptor.
[0165] In one embodiment, the hematopoietic stem cell erythroid differentiation and enucleation medium comprises a basal medium, such as STEMSPAN SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), X-VIVO 15, alpha-MEM , RPMI 1640 and DF12, etc. It also contains growth factors, for example, if STEMSPAN SFEM II is used as the basal medium, additional growth factors needed comprises: 1-10 U/ml EPO, 100-1000 g/ml human transferrin, and chemical small molecules of 0.5-10 mol/ml mifepristone.
[0166] If a basal medium other than STEMSPAN SFEM II is used, it is necessary to add, for example, ITS (insulin-transferrin-selenium) (wherein the final concentrations of each substance in the ITS in the medium are: insulin concentration is 0.1 mg/ml; human Transferrin, 0.0055 mg/ml; and selenium, 6.710.sup.6mg/ml) (i.e., mainly including insulin, human transferrin and selenium); vitamin C, 10-50 ug/ml; BSA (bovine serum albumin), 0.5-5%; growth factors, such as EPO, 1-10 U/ml; human transferrin, 100-1000 ug/ml; and chemical small molecules such as mifepristone, 0.5-10 mol/ml.
[0167] Furthermore, those skilled in the art will appreciate that any of the commonly used basal media may be used. For example, the basal media commonly used in the art listed as follows: STEMSPAN SFEM II (purchased from STEM CELL TECHONOLOGIES); IMDM; DF12; Knockout DMEM; RPMI 1640; Alpha MEM; and DMEM, etc., available from Thermo Fisher.
[0168] Further, some other ingredients also may be added to the above medium as needed, for example, ITS (i e , mainly including insulin, human transferrin, and selenium), L-glutamine, vitamin C, and bovine serum albumin may be further added. For example, ITS, plus 2 mM L-glutamine, plus 10-50 g/ml vitamin C, and 0.5-5 wt % BSA (bovine serum albumin) may be added into the IMDM medium. In addition, the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may also be added into the above DF12. The same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may be added into the Knockout DMEM; the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may also be added into the RPMI 1640; the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may also be added into the alpha MEM; the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin may also be added into the DMEM. Herein, the concentrations of each substance in the ITS in various basal mediums are: insulin concentration is 0.1 mg/ml; human transferrin, 0.0055 mg/ml; and selenium, 6.710.sup.6 mg/ml. In addition, the concentrations of each component in the added ITS may also be adjusted according to actual needs. ITS may be purchased from Thermofisher, and adjusted to the appropriate final concentration for use as needed.
[0169] Mifepristone used herein is a chemically synthesized small molecule as an antagonist of the progesterone receptor and the glucocorticoid receptor, and it has the following chemical structural formula:
##STR00003##
[0170] Other antagonists and inhibitors of a progesterone receptor and a glucocorticoid receptor may also be used in the present invention, including cyproterone acetate, geldanamycin, CORT 108297 and the like. The chemical structures are as follows:
##STR00004##
[0171] In some embodiments, the mature erythrocytes of the invention may be produced by a method comprising the following steps a)-c): a) isolating CD34-positive HSPCs from human umbilical cord blood to perform gene modification by any one of the methods described herein; b) amplifying and differentiating the genetically modified HSPCs for 5-10 days, e.g., 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, to obtain erythroid precursor cells, such as erythroblasts, nucleated erythrocytes, young erythrocytes, and reticulocytes, c) further differentiating the erythroid precursor cells for 7 days to obtain mature erythrocytes.
[0172] In some embodiments, the mature erythrocytes of the invention may be produced by a method comprising the following steps a)-d):
[0173] a) isolating CD34-positive HSPCs from human umbilical cord blood by magnetic bead sorting;
[0174] b) genetically modifying the CD34-positive HSPCs by any one of the methods described herein;
[0175] c) adding additional growth factors into serum-free medium (SFME), and after 5-10 days, e.g., 5 days, 6 days, 7 days, 8 days, 9 days, 10 day of amplification and differentiations, the HSPCs are differentiated into erythrocyte precursor cells, and the medium at this stage is named as HSPCs erythroid expansion and differentiation medium (abbreviated as HEEDM);
[0176] d) adding additional growth factors into a serum-free medium (SFME), and after 7 days of differentiation, the mature erythrocytes may be obtained, the medium at this stage is named as HSPCs erythroid differentiation and enucleation medium (abbreviated as HEDEM).
[0177] That is, for genetically edited CD34-positive hematopoietic stem cells, the mature erythrocytes may be obtained in two steps by the method of the present invention described above, and the time period of the whole process may be 10-18 days, 11-17 days, 12-16 days, 13-15 days, 10-17 days, 10-16 days, 10-15 days, or 10-14 days, such a time period is greatly shorter than the period of at least 21 days in the prior art by using three or four steps.
[0178] As described above, the present invention relates to a method for preparing mature erythrocytes or precursor cells thereof being genetically modified to increase the expression of fetal hemoglobin (HbF), which comprises: (a) obtaining the hematopoietic stem cells by the genetic modification method of the present invention; (b) performing hematopoietic stem cell erythroid expansion and differentiation of the genetically modified hematopoietic stem cells by using the above HSPCs erythroid expansion and differentiation medium.
[0179] Further, the present invention relates to a method for preparing mature erythrocytes or precursor cells thereof being genetically modified to increase the expression of fetal hemoglobin (HbF), which comprises: (a) obtaining the hematopoietic stem cells by the genetic modification method of the present invention; (b) performing hematopoietic stem cell erythroid expansion and differentiation of the genetically modified hematopoietic stem cells by using the above HSPCs erythroid expansion and differentiation medium; and (c) performing HSPCs erythroid differentiation and enucleation by using the erythroid differentiation and enucleation medium. The present invention also relates to use of the HSPCs erythroid expansion and differentiation medium and/or the erythroid differentiation and enucleation medium used in the above method for amplifying and/or differentiating the hematopoietic stem cells or the precursor cells of mature erythrocytes.
[0180] As used herein, differentiation refers to a phenomenon in which the structure or function of a cell is specialized during the process of division, proliferation, and growth thereof, that is, the characteristic and function of an organism's cells or tissues are altered to perform a function imparted to the cells or tissues. In general, it refers to the phenomenon in which a relatively simple system is divided into two or more partial systems having different properties.
[0181] As used herein, Ficoll liquid density gradient centrifugation utilizes the basic principle that the specific gravity of different components in the blood are different, and different cells may be separated in layers through low-speed density gradient centrifugation. The density of erythrocytes and granulocytes is greater than that of the stratified liquid, and when erythrocytes encounter ficoll liquid they will quickly aggregate into a string arrangement and accumulate at the bottom of the tube. Only the mononuclear cells having a density equivalent to that of the stratified liquid are enriched between the plasma layer and the stratified liquid, i.e., the white film layer; the hematopoietic stem cells are present in this layer and they may be obtained by subsequent magnetic bead sorting. In the present invention, the mononuclear cells are obtained by using commercially available lymphocyte separation tubes.
[0182] As used herein, mature erythrocytes refers to the most abundant type of cells in blood, and they have the function of carrying nutrients such as oxygen, amino acids, and carbon dioxide, and the like. Mature erythrocytes have no mitochondria and nuclei.
[0183] As used herein, interleukin 3 (IL-3) refers to a cytokine produced by activated CD4- and CD8-positive T lymphocytes, and its primary biological function is to participate in regulating the proliferation and differentiation of the hematopoietic stem cells in the bone marrow. .
[0184] As used herein, erythropoietin (EPO) refers to a growth factor produced by erythroblasts, i.e., erythroid precursor cells. In an adult, there are glycoproteins secreted by the interstitial cells surrounding the renal tubules in renal cortex and the liver. EPO can stimulate the differentiation of hematopoietic stem cells into erythrocytes.
[0185] In some embodiments, the stem cell factors (SCFs) comprise mast cell growth factor (MGF), kit ligand (KL), and steel factor (SLF).
[0186] As used herein, HSPCs erythroid expansion and differentiation medium refers to a culturing system for promoting the massive expansion of HSPCs and their further differentiation into erythroid progenitor cells. In the present invention, the medium contains two main components, a basic medium and a growth factor additive. The basal medium is a serum-free system, either STEMSPAN SFEM II (STEM CELLS TECHNOLOGY Inc.) or IMDM (Iscove's Modified Dulbecco's Medium), plus ITS (Thermofisher), L-gulutamin (Thermofisher), vitamin C, and bovine serum albumin The growth factor additive is a combination of different concentrations of IL-3, SCF, and EPO.
[0187] As used herein, HSPCs erythroid differentiation and enucleation medium refers to a medium that promotes the further expansion and differentiation of erythroid progenitor cells into enucleated erythrocytes. In the present invention, the medium comprises two main components, namely a basic medium, and additives of growth factors and chemical small molecules. The basal medium is a serum-free system, either STEMSPAN SFEM II (STEM CELLS TECHNOLOGY Inc.), or IMDM (Iscove's Modified Dulbecco's Medium), plus ITS (Thermofisher), L-gulutamin (Thermofisher), vitamin C, and bovine serum albumin Additives of growth factors and chemical small molecules include EPO, human transferrin, and the chemical small molecule of mifepristone.
[0188] In some embodiments, the hematopoietic stem cells are sorted by magnetic beads. For example, the cells are specifically labeled with super paramagnetic MACS microbeads, and after magnetic labeling, making the cells to pass through a sorting column placed in a strong and stable magnetic field. The matrix in the sorting column creates a high gradient magnetic field.
[0189] The magnetically labeled cells are retained in the column while the unlabeled cells are discharged. When the sorting column is moved out of the magnetic field, the magnetically labeled cells retained in the column may be eluted. Thus, both the labeled and unlabeled cell components may be completely obtained.
[0190] In some specific embodiments of the present invention, through utilizing the sgRNA of the present invention, the hematopoietic stem cells derived from three different umbilical cord blood are genetically modified by the genetic modification methods described herein, and efficient gene editing may be achieved with an efficiency of at least 40% or more, for example, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. For example, as for the preferred sgRNA, the average efficiency of gene editing even reaches 80%.
[0191] In some embodiments of the present invention, the hematopoietic stem cells obtained by the genetic editing method of the present invention are transplanted into a mouse. The proportion of human hCD45 expression in the mouse continuously increases after the transplantation of the genetically edited hematopoietic stem cells, as compared with that of the transplantation of the hematopoietic stem cells not being genetically modified. In peripheral blood samples, the proportion of hCD45 expression increases from 20% at week 6 to 60% at week 16; the proportion even reaches 90% in bone marrow and 70% in spleen at week 16; indicating that the genetically modified hematopoietic stem cells may be rapidly and efficiently implanted into the hematopoietic system of the mouse model, and the in vivo differentiation function of the cells is normal.
[0192] In some embodiments of the present invention, the umbilical cord blood-derived hematopoietic stem cells are modified by the gene editing method of the present invention, and then they are differentiated by using the two-step differentiation method of the present invention, that is, the HSPCs erythroid expansion and differentiation medium is used for expansion and differentiation, and then the HSPCs erythroid differentiation and enucleation medium is used for further differentiation. The detection results show that, the expression of hemoglobin (HBG) in differentiated erythrocytes is increased by 20%-90%, and even by 100% as compared with that in the original erythrocytes, that is, increased by about 1 time (2 times of the expression of the original erythrocytes); the expression of fetal hemoglobin is also increased by 20%-90%, even increased up to 100% as compared with that of the original erythrocytes, that is, about 1 times higher (2 times of the expression of the original erythrocytes); even up to 200%, that is, about 2 times higher (3 times of the original); even up to 300%, that is, about 3 times higher (4 times of the original); even up to 400%, that is, about 4 times higher (5 times of the original)); even up to 500% or more, that is, about 5 times higher or more (6 or more times of the original), and the like.
EXAMPLES
[0193] Hereinafter, the present invention will be further described with reference to the following examples. It is obvious to those skilled in the art that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention. Therefore, the essential scope of the invention is to be defined by the appended claims and their equivalents.
Example 1: Efficient Gene Editing of Umbilical Cord Blood-Derived CD34-Positive Hematopoietic Stem Cells
1-1: Testing Electroporation Conditions by Using K562 Cells
[0194] Due to the limited source of hematopoietic stem cells and the high cost of each single isolation, the cancer cell line K562 (purchased from ATCC organization, website: https://www.atcc.org) is selected as a model cell line for testing electroporation conditions in this example.
[0195] Particularly, the specific steps for implementation are described below.
[0196] The first experiments: transfecting 510.sup.5 K562 cells with 5 g of GFP mRNA (the sequence of SEQ ID NO: 1) by BTX830 electroporator under the conditions of 250 V, 1 ms; 360 V, 1 ms; 400 V, 1 ms; and 500 V, 1 ms respectively. 4 days after the electroporation, GFP expression and 7-AAD expression are determined by flow cytometry, wherein GFP represents electroporation efficiency, and 7-AAD represents the growth state, i.e. viability of the cells after electroporation.
TABLE-US-00004 sequenceinformationofGFPmRNA: SEQIDNO:1: atgagtaaaggagaagaacttttcactggagttgtcccaattcttgtt gaattagatggtgatgttaatgggcacaaattttctgtcagtggagag ggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgc actactggaaaactacctgttccatggccaacacttgtcactactttc tcttatggtgttcaatgcttttcaagatacccagatcatatgaaacgg catgactttttcaagagtgccatgcccgaaggttatgtacaggaaaga actatatttttcaaagatgacgggaactacaagacacgtgctgaagtc aagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtatt gattttaaagaagatggaaacattcttggacacaaattggaatacaac tataactcacacaatgtatacatcatggcagacaaacaaaagaatgga atcaaagttaacttcaaaattagacacaacattgaagatggaagcgtt caactagcagaccattatcaacaaaatactccaattggcgatggccct gtccttttaccagacaaccattacctgtccacacaatctgccctttcg aaagatcccaacgaaaagagagaccacatggtccttcttgagtttgta acagctgctgggattacacatggcatggatgaactatacaaatag
[0197] The second experiments: transfecting 510.sup.5 K562 cells with 5 g of the above GFP mRNA by BTX830 electroporator under the conditions of 250 V, 1 ms; 250 V, 2 ms; 300 V, 0.5 ms; 300 V, 1 ms; 360 V, 0.5 ms; and 360 V; 1 ms respectively. 4 days after the electroporation, GFP expression and 7-AAD expression are determined by flow cytometry, wherein GFP represents electroporation efficiency, and 7-AAD represents the growth state, i.e. viability of the cells after electroporation.
[0198] The third experiments: transfecting 510.sup.5 K562 cells with 5 g of the above GFP mRNA by BTX830 electroporator under the conditions of 250 V, 1 ms; 250 V, 1 ms; 300 V, 1 ms; and 300 V, 1 ms respectively. 4 days after the electroporation, GFP expression and 7-AAD expression are determined by flow cytometry, wherein GFP represents electroporation efficiency, and 7-AAD represents the growth state, i.e. viability of the cells after electroporation. The results are shown in
[0199] Among them,
[0200]
[0201] The data of these experiments shows that, under the electroporation conditions of 300V, 1 ms, the comprehensive index of electroporation efficiency and cell viability is the highest for cancer cell line K562, and they will be used as the electroporation conditions for subsequent experiments.
1-2. Transfecting the Hematopoietic Stem Cells with GFP mRNA Under the Electroporation Conditions of 300 v, 1 ms
[0202] 510.sup.5 hematopoietic stem cells (purchased from ALLCELLs Biotechnology (Shanghai) Co., Ltd., www.allcells.com) are transfected with the above GFP mRNA by electroporation under the electroporation conditions of 300V, 1 ms which produce the highest efficiency and viability in the previous step. GFP expression and 7-AAD expression are detected 4 days later. The results are shown in
[0203]
[0204]
[0205] It can be seen from the results of
1-3: Gene Editing of BCL11A Locus in the Cord Blood-Derived Hematopoietic Stem Cells by Electroporation with CRISPR/Cas9
[0206] A. Multiple sgRNAs for locus BCL11A (+58) are designed by using the CRISPR RGEN TOOLS software, and the chemically modified sgRNAs (the information shown in
TABLE-US-00005 SEQIDNO:2:the150-bpsequenceatthelocus 58KofBCL11Aenhancer: ctgccagtcctcttctaccccacccacgcccccaccctaatcagaggc caaacccttcctggagcctgtgataaaagcaactgttagcttgcacta gactagcttcaaagttgtattgaccctggtgtgttatgtctaagagta gatgcc SEQIDNO:3:referredtoasBCL11AEnhancer-1 sgRNA(sometimesabbreviatedasEnhancer-1): cacaggctccaggaagggtt SEQIDNO:4:referredtoasBCL11AEnhancer-2 sgRNA(sometimesabbreviatedasEnhancer-2): atcagaggccaaacccttcc SEQIDNO:5:referredtoasBCL11AEnhancer-3 sgRNA(sometimesabbreviatedasEnhancer-3): ctaacagttgcttttatcac SEQIDNO:6:referredtoasBCL11AEnhancer-4 sgRNA(sometimesabbreviatedasEnhancer-4): ttgcttttatcacaggctcc SEQIDNO:7:referredtoasBCL11AEnhancer-5 sgRNA(sometimesabbreviatedasEnhancer-5): ttttatcacaggctccagga SEQIDNO:8:referredtoasBCL11AEnhancer-6 sgRNA(sometimesabbreviatedasEnhancer-6): tttatcacaggctccaggaa SEQIDNO:9:referredtoasBCL11AEnhancer-7 sgRNA(sometimesabbreviatedasEnhancer-7): tgggtggggtagaagaggac SEQIDNO:10:referredtoasBCL11AEnhancer-8 sgRNA(sometimesabbreviatedasEnhancer-8): gggcgtgggtggggtagaag SEQIDNO:11:referredtoasBCL11AEnhancer-9 sgRNA(sometimesabbreviatedasEnhancer-9): ttagggtgggggcgtgggtg SEQIDNO:12:referredtoasBCL11AEnhancer-10 sgRNA(sometimesabbreviatedasEnhancer-10): attagggtgggggcgtgggt SEQIDNO:13:referredtoasBCL11AEnhancer-11 sgRNA(sometimesabbreviatedasEnhancer-11): gattagggtgggggcgtggg SEQIDNO:14:referredtoasBCL11AEnhancer-12 sgRNA(sometimesabbreviatedasEnhancer-12): tctgattagggtgggggcgt SEQIDNO:15:referredtoasBCL11AEnhancer-13 sgRNA(sometimesabbreviatedasEnhancer-13): ctctgattagggtgggggcg SEQIDNO:16:referredtoasBCL11AEnhancer-14 sgRNA(sometimesabbreviatedasEnhancer-14): cacgcccccaccctaatcag SEQIDNO:17:referredtoasBCL11AEnhancer-15 sgRNA(sometimesabbreviatedasEnhancer-15): ttggcctctgattagggtgg SEQIDNO:18:referredtoasBCL11AEnhancer-16 sgRNA(sometimesabbreviatedasEnhancer-16): tttggcctctgattagggtg SEQIDNO:19:referredtoasBCL11AEnhancer-17 sgRNA(sometimesabbreviatedasEnhancer-17): gtttggcctctgattagggt SEQIDNO:20:referredtoasBCL11AEnhancer-18 sgRNA(sometimesabbreviatedasEnhancer-18): ggtttggcctctgattaggg SEQIDNO:21:referredtoasBCL11AEnhancer-19 sgRNA(sometimesabbreviatedasEnhancer-19): aagggtttggcctctgatta SEQIDNO:22:referredtoasBCL11AEnhancer-20 sgRNA(sometimesabbreviatedasEnhancer-20): gaagggtttggcctctgatt SEQIDNO:23:referredtoasBCL11AEnhancer-21 sgRNA(sometimesabbreviatedasEnhancer-21): actcttagacataacacacc SEQIDNO:24:referredtoasBCL11AEnhancer-22 sgRNA(sometimesabbreviatedasEnhancer-22): cttcaaagttgtattgaccc SEQIDNO:25:referredtoasBCL11AEnhancer-23 sgRNA(sometimesabbreviatedasEnhancer-23): ctcttagacataacacacca
[0207] As described above, the above 23 sgRNAs are designed for the 150-bp sequence at the locus 58K of BCL11A enhancer.
[0208] B. The electroporation conditions of 300 V, 1 ms are used, and the inventors synthesized Cas9 mRNA (the sequence of SEQ ID NO: 26) and the 23 chemically modified sgRNAs which are designed as described above, wherein the chemical modification of the 23 sgRNAs is 2-O-methyl modification and internucleotide 3-thio modification of the first three bases at the 5 end and the last three bases at the 3 end of the sgRNA. As shown in the formulas below, the chemically modified sgRNA is shown on the left, and unmodified sgRNA is shown on the right.
##STR00005##
[0209] The cord blood-derived CD34-positive hematopoietic stem cells (purchased from ALLCELLS Biotechnology (Shanghai) Co., Ltd., www.allcells.com) are transfected with the above 23 chemically modified sgRNAs by electroporation under the above-identified electroporation conditions, analyzing the Indels efficiency by TIDE software 4 says later. The results are shown in
[0210]
TABLE-US-00006 (SEQIDNO:29) Forwardprimer:cacctcagcagaaacaaagttatc (SEQIDNO:30) Reverseprimer:gggaagctccaaactctcaa
[0211] Cleavage site selection: in the case of Enhancer-3, 5-ctaaacagttg cttttatcac-3 (SEQ ID NO: 5), the cleavage site is at the right site of the 3 end (Cong L, et al. Science. 2013).
[0212] Sanger sequencing is performed to amplify the above fragment by using the upstream and downstream primer sequences as shown in SEQ ID NO: 29 and SEQ ID NO: 30. Based on the sequencing results,statistic analysis of the resulting Indels efficiency is performed by using TIDE software, wherein the TIDE software is an on-line software for Indels efficiency analysis. The efficiency of Indels for producing double-peak mutation may be analyzed according to the first-generation sequencing results by referring to Tide. deskgen. com.
[0213] The results show that all the 23 sgRNAs synthesized in this example may be used to successfully perform gene editing of the hematopoietic stem cells, and Indels may be effectively produced with an efficiency of at least 10%. The most efficient one of them is Enhancer-2.
TABLE-US-00007 SEQIDNO:26:thesequenceofCas9mRNA gacaagaagtacagcatcggcctggacatcggcaccaactctgtgggc tgggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaag gtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcgga gccctgctgttcgacagcggcgaaacagccgaggccacccggctgaag agaaccgccagaagaagatacaccagacggaagaaccggatctgctat ctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttc ttccacagactggaagagtccttcctggtggaagaggataagaagcac gagcggcaccccatcttcggcaacatcgtggacgaggtggcctaccac gagaagtaccccaccatctaccacctgagaaagaaactggtggacagc accgacaaggccgacctgcggctgatctatctggccctggcccacatg atcaagttccggggccacttcctgatcgagggcgacctgaaccccgac aacagcgacgtggacaagctgttcatccagctggtgcagacctacaac cagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaag gccatcctgtctgccagactgagcaagagcagacggctggaaaatctg atcgcccagctgcccggcgagaagaagaatggcctgttcggcaacctg attgccctgagcctgggcctgacccccaacttcaagagcaacttcgac ctggccgaggatgccaaactgcagctgagcaaggacacctacgacgac gacctggacaacctgctggcccagatcggcgaccagtacgccgacctg tttctggccgccaagaacctgtccgacgccatcctgctgagcgacatc ctgagagtgaacaccgagatcaccaaggcccccctgagcgcctctatg atcaagagatacgacgagcaccaccaggacctgaccctgctgaaagct ctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgac cagagcaagaacggctacgccggctacattgacggcggagccagccag gaagagttctacaagttcatcaagcccatcctggaaaagatggacggc accgaggaactgctcgtgaagctgaacagagaggacctgctgcggaag cagcggaccttcgacaacggcagcatcccccaccagatccacctggga gagctgcacgccattctgcggcggcaggaagatttttacccattcctg aaggacaaccgggaaaagatcgagaagatcctgaccttccgcatcccc tactacgtgggccctctggccaggggaaacagcagattcgcctggatg accagaaagagcgaggaaaccatcaccccctggaacttcgaggaagtg gtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaac ttcgataagaacctgcccaacgagaaggtgctgcccaagcacagcctg ctgtacgagtacttcaccgtgtataacgagctgaccaaagtgaaatac gtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaa aaggccatcgtggacctgctgttcaagaccaaccggaaagtgaccgtg aagcagctgaaagaggactacttcaagaaaatcgagtgcttcgactcc gtggaaatctccggcgtggaagatcggttcaacgcctccctgggcaca taccacgatctgctgaaaattatcaaggacaaggacttcctggacaat gaggaaaacgaggacattctggaagatatcgtgctgaccctgacactg tttgaggacagagagatgatcgaggaacggctgaaaacctatgcccac ctgttcgacgacaaagtgatgaagcagctgaagcggcggagatacacc ggctggggcaggctgagccggaagctgatcaacggcatccgggacaag cagtccggcaagacaatcctggatttcctgaagtccgacggcttcgcc aacagaaacttcatgcagctgatccacgacgacagcctgacctttaaa gaggacatccagaaagcccaggtgtccggccagggcgatagcctgcac gagcacattgccaatctggccggcagccccgccattaagaagggcatc ctgcagacagtgaaggtggtggacgagctcgtgaaagtgatgggccgg cacaagcccgagaacatcgtgatcgaaatggccagagagaaccagacc acccagaagggacagaagaacagccgcgagagaatgaagcggatcgaa gagggcatcaaagagctgggcagccagatcctgaaagaacaccccgtg gaaaacacccagctgcagaacgagaagctgtacctgtactacctgcag aatgggcgggatatgtacgtggaccaggaactggacatcaaccggctg tccgactacgatgtggaccatatcgtgcctcagagctttctgaaggac gactccatcgacaacaaggtgctgaccagaagcgacaagaaccggggc aagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaac tactggcggcagctgctgaacgccaagctgattacccagagaaagttc gacaatctgaccaaggccgagagaggcggcctgagcgaactggataag gccggcttcatcaagagacagctggtggaaacccggcagatcacaaag cacgtggcacagatcctggactcccggatgaacactaagtacgacgag aatgacaagctgatccgggaagtgaaagtgatcaccctgaagtccaag ctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgag atcaacaactaccaccacgcccacgacgcctacctgaacgccgtcgtg ggaaccgccctgatcaaaaagtaccctaagctggaaagcgagttcgtg tacggcgactacaaggtgtacgacgtgcggaagatgatcgccaagagc gagcaggaaatcggcaaggctaccgccaagtacttcttctacagcaac atcatgaactttttcaagaccgagattaccctggccaacggcgagatc cggaagcggcctctgatcgagacaaacggcgaaaccggggagatcgtg tgggataagggccgggattttgccaccgtgcggaaagtgctgagcatg ccccaagtgaatatcgtgaaaaagaccgaggtgcagacaggcggcttc agcaaagagtctatcctgcccaagaggaacagcgataagctgatcgcc agaaagaaggactgggaccctaagaagtacggcggcttcgacagcccc accgtggcctattctgtgctggtggtggccaaagtggaaaagggcaag tccaagaaactgaagagtgtgaaagagctgctggggatcaccatcatg gaaagaagcagcttcgagaagaatcccatcgactttctggaagccaag ggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtac tccctgttcgagctggaaaacggccggaagagaatgctggcctctgcc ggcgaactgcagaagggaaacgaactggccctgccctccaaatatgtg aacttcctgtacctggccagccactatgagaagctgaagggctccccc gaggataatgagcagaaacagctgtttgtggaacagcacaagcactac ctggacgagatcatcgagcagatcagcgagttctccaagagagtgatc ctggccgacgctaatctggacaaagtgctgtccgcctacaacaagcac cgggataagcccatcagagagcaggccgagaatatcatccacctgttt accctgaccaatctgggagcccctgccgccttcaagtactttgacacc accatcgaccggaagaggtacaccagcaccaaagaggtgctggacgcc accctgatccaccagagcatcaccggcctgtacgagacacggatcgac ctgtctcagctgggaggcgac sequencingprimer SEQIDNO:27 Cacctcagcagaaacaaagttatc, sequencingprimer SEQIDNO:28 gggaagctccaaactctcaa,
[0214] C. According to the above experimental results, Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5 and Enhancer-6 with relatively high gene editing efficiency are selected. The umbilical cord blood-derived hematopoietic stem cells are transfected with Cas9 mRNA and Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5 or Enhancer-6 by electroporation under the electroporation conditions of 300V, 1 ms; and the Indels efficiency is determined after 4 days, and the results are shown in
[0215] The results in
[0216] Based on this, Enhancer-2 sgRNA is used as a target in the subsequent experiments.
Example 2: In Vitro Colony-Formation of the Genetically Modified Hematopoietic Stem Cells Derived from Cord Blood
[0217] This experiment involves the detection of colony forming unit (CFU) of the genetically modified hematopoietic stem cells derived from cord blood.
[0218] The hematopoietic stem cells are transfected with Cas9 mRNA and Enhancer-2 under the electroporation conditions of 300 V, 1 ms. 800-1000 cells are resuspended in 1 ml of the mixture of H4434 (available from STEM CELLS TECHNOLOGY, Canada), IMDM (available from Thermo Fisher) and FBS (available from Thermo Fisher). The number of the formed colonies with different morphologies such as CFU-M, BFU-E, CFU-E, CFU-G, CFU-GM are observed under microscope after 14 days, and the results are shown in
[0219] According to the data shown in example 2, compared with that of the hematopoietic stem cells not being genetically modified, the in vitro differentiation function of the genetically modified cells is normal, and the cells are differentiated into colonies of different lineages of blood system.
Example 3: The Reconstruction of Hematopoietic System in Mouse Model with Genetically Modified Hematopoietic Stem Cells Derived from Cord Blood
[0220] The cord blood-derived hematopoietic stem cells are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300 V, 1 ms; transplanting into an irradiated NPG immunodeficient mouse model (purchased from Beijing Vitalstar Biotechnology, Inc.). The expression of human CD45 and mouse CD45 in peripheral blood is detected 6 weeks, 8 weeks, 10 weeks, 12 weeks and 16 weeks after the transplantation, while the expression of human CD45 and mouse CD45 in bone marrow and spleen is detected 16 weeks after transplantation; and the results are shown in
[0221] The results of
[0222] Meanwhile, in mice transplanted with genetically modified cells, the expression of cell membrane proteins such as human CD3, CD4, CD8, CD33, CD19, CD56 is detected after 16 weeks, as shown in
[0223] In addition, the genetically modified cells are capable of rapidly and efficiently repopulating the hematopoietic system of a mouse model. The result shown in
Example 4: The Erythroid Differentiation of the Genetically Modified Hematopoietic Stem Cells Derived from Cord Blood and the Detection of Globin and Fetal Hemoglobin Expression
4-1. Differentiation of Erythrocytes
[0224] The cord blood-derived hematopoietic stem cells are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300 v, 1 ms, differentiating the cells by using the two-step differentiation protocol described below.
[0225] In the two-step method, firstly the HSPCs erythroid expansion and differentiation medium is used for differentiation, then the HSPCs erythroid differentiation and enucleation medium is used for differentiation.
[0226] The basal medium of the HSPCs erythroid expansion and differentiation culture medium is StemSpan SFEM II, including the growth factors of 50-200 ng/ml SCF, 10-100 ng/ml IL-3, and 1-10U EPO/ml. The culture conditions: the hematopoietic stem cells are cultured with a density of 1.010.sup.5 cells/ml in the erythroid expansion and differentiation medium for 7 days.
[0227] The basal medium of HSPCs erythroid differentiation and enucleation medium is StemSpan SFEM II including the growth factors of 1-10 U EPO, 100-1000 g/m1 human transferrin, 0.5-10 m the small molecule of mifepristone. The cells cultured in the previous step with a density of 1.010.sup.6 cells/ml are differentiated in the HSPCs erythroid differentiation and enucleation medium for 5 days.
[0228] Then, the expression of CD71 and CD235a is detected, as shown in
4-2. Detection of the Expression of Globin and Fetal Hemoglobin
[0229] mRNA of the cells differentiated from the above erythrocytes is extracted and reverse-transcribed into cDNA. The expression of BCL11A, HBB, HBG and other genes is detected by quantitative fluorescence PCR, as shown in
[0230] Fetal hemoglobin expression in cells after erythroid differentiation is detected, as shown in
Example 5: Gene Editing of the BCL11A Enhancer Locus in the Hematopoietic Stem Cells Derived from Thalassemia Patients
5-1. Isolation of the Hematopoietic Stem Cells from Peripheral Blood of Patients with Thalassemia
[0231] CD34-positive hematopoietic stem cells are obtained by conventional magnetic bead sorting. The results are shown in
5-2. Transfecting the Hematopoietic Stem Cells Derived from the Peripheral Blood of Thalassemia Patients by Electroporation
[0232] The peripheral blood-derived hematopoietic stem cells from patients with thalassemia are transfected with Cas9 mRNA and Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5, or Enhancer-6 by electroporation under the electroporation conditions of 300 V, 1 ms. Indels efficiency is detected 4 days later, as shown in
Example 6: The Erythroid Differentiation of the Genetically Modified Hematopoietic Stem Cells Derived from Peripheral Blood of Patients with Anemia and the Detection of Globin and Fetal Hemoglobin Expression
[0233] The genetically modified hematopoietic stem cells of Example 5 are subjected to erythroid differentiation in vitro as described in Example 4-1. Differentiation results are shown in FIG23. The results of the experiments show that, the erythroid differentiation efficiencies of the control group, Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5 and Enhancer-6 are similar, and the cell membrane proteins CD71 and CD235a are highly expressed.
[0234] 12 days later, mRNA of cells after erythroid differentiation is extracted and reverse-transcribed into cDNA. The expressions of BCL11A, HBB, HBG, HBA and other genes are determined by quantitative fluorescence PCR, as shown in
[0235] In addition, in order to more accurately evaluate the effects on the protein expression levels of fetal hemoglobin (HbF) and normal hemoglobin (HbA) caused by the gene editing of BCL11A enhancer locus with Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5 and Enhancer-6, in the present invention, we extract the proteins of the erythrocytes obtained 12 days after differentiation of the hematopoietic stem cells, performing HPLC assay (High Performance Liquid Chromatography), as shown in
Example 7: In Vitro Colony-Formation of Genetically Modified Hematopoietic Stem Cells Derived from Peripheral Blood of Anemia Patients
[0236] The hematopoietic stem cells derived from peripheral blood of anemia patients are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300 V, 1 ms. 500-800 cells are resuspended in 1 ml of the mixture of H4434 (available from STEM CELLS TECHNOLOGY, Canada), IMDM (available from Thermo Fisher) and FBS (available from Thermo Fisher). The number of the formed colonies with different morphologies such as CFU-M, BFU-E, CFU-E, CFU-G, CFU-GM, and GEMM are observed under microscope 14 days later. The results are shown in
[0237] The experimental data show that, compared with the hematopoietic stem cells not being genetically modified, the in vitro differentiation function of the genetically modified cells is normal, and the cells are differentiated into colonies of different lineages in blood system.
Example 8: Off-Target Effect of the Genetically Modified Hematopoietic Stem Cells Derived from Peripheral Blood of Anemia Patients
[0238] The experiment relates to a gene sequencing method, in particular to an off-target effect analysis of the genetically modified hematopoietic stem cells derived from peripheral blood of an anemia patient by the next generation sequencing (NGS) technology.
[0239] The hematopoietic stem cells from peripheral blood of anemia patients are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300 V, 1 ms. After 4 days of expansion, the genome of the cells is extracted and analyzed by next generation sequencing. 14 potential off-target sites are predicted by software, and the results are shown in
[0240] The experimental data shows that, the on-target efficiency of gene editing is 76%, and the proportion of the 14 potential off-target sites is less than 0.3%, which is equivalent to the error of the next generation sequencing per se. Therefore, in the range of the sequencing error, off-target phenomenon caused by gene editing is not detected. Thus, this gene editing scheme is safe.
[0241] As shown in the data of the above examples, as for cells derived from different sources, Enhancer-2 shows the best effect.
Example 9
[0242] The peripheral blood-derived hematopoietic stem cells of an anemia patient are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300v, 1 ms; followed by erythroid differentiation through the two-step method of the above Example 4; except in Example 9, amplifying the cells for 4 days, then differentiating them for 14 days. After 14 days, HbF staining is performed, and cells with high expression of HbF (about 10%) and low expression of HbF (about 10%) are obtained by flow cytometry sorting, and the genomes are extracted separately for the next generation sequencing analysis (deep sequencing analysis.
[0243] The steps of HbF staining are as follows: 1) collecting the cells in the culture plate, centrifuging at 600 g for 5 min, then removing the supernatant; 2) adding phosphate buffer containing 0.05% glutaraldehyde precooled at 4 C., and fixing at room temperature for 10 minutes, then centrifuging at 600 g for 5 min and removing the supernatant; 3) adding phosphate buffer containing 0.1% BSA, resuspending by pipetting, centrifuging at 600 g for 5 min and removing the supernatant; repeating three times to remove residual glutaraldehyde as much as possible; 4) adding 0.1% BSA phosphate buffer containing 0.1% Triton X-100, standing at room temperature for 4 min, centrifuging at 600 g for 5 min and removing the supernatant; 5) adding phosphate buffer containing 0.1% BSA, resuspending by pipetting, centrifuging at 600 g for 5 min and removing the supernatant; 6) adding 100 l of phosphate buffer containing 0.1% BSA, adding 5 l of HbF flow cytometry antibodies, staining at room temperature for 15 minutes; 7) adding phosphate buffer containing 0.1% BSA, centrifuging at 600 g for 5 min and removing the supernatant; 8) adding 100 l of phosphate buffer containing 0.1% BSA, resuspending by pipetting, then performing flow cytometry analysis on the computer.
[0244] After comparing the two groups of cells with high expression of HbF and low expression of HbF, the results of the analysis are shown in
[0245] According to the results of the genetic analysis, the base sequence of CTTCCT (6 bp) comprises the binding sites of the STAT1 and ELF1 genes. Among them, according to the literatures, the binding site of STAT1 is the TTCCnGGA motif (n stands for any base) (Raja, et al. Nucleic Acids Research. 2008; George, et al. Journal of Biological Chemistry. 2001; Christoph, et al. Plos one. 2010), while the binding site of ELF-1 is the TTCC motif (Steven, et al. Scientific Reports. 2015; Yuang-Taung Juang, et al. The Journal of Immunology. 2007).
[0246] Among them, STAT1 and ELF1 are key regulatory transcription factors involved in blood system development and erythrocyte development, wherein STAT1 forms a regulatory network by binding to the transcription factor BCL11A, negatively regulating erythrocyte development (Jason D Buenrostro, et al. BioRxiv.2017; Keita Kirito, et al. Blood. 1998); while in the development of the blood system, the transcription factor ELF-1 forms a complex with GATA-2, and FLI-1, activating the expression of the downstream key transcription factor GATA1 (Gemma, et al. Developmental Biology. 2006).
[0247] The experimental results of the present invention suggest that, the disruption of the binding sites of STAT1 and ELF-1 by disrupting the 6-bp base sequence of CTTCCT in the BCL11A gene prevents STAT1 and ELF-1 from binding to the BCL11A enhancer, eliminating the inhibition of fetal hemoglobin synthesis by the BCL11A gene, thereby increasing the expression of fetal hemoglobin in the blood.
INDUSTRIAL APPLICABILITY
[0248] According to the invention, the method provided herein has the following advantages: firstly, the method may be used for gene editing of the hematopoietic stem cells derived from thalassemia patients, and it completely meets the requirements for the clinical treatment of thalassemia and sickle cell anemia; secondly, by using the chemically modified sgRNA, the gene editing efficiency of the method is high, the expression of fetal hemoglobin is remarkably improved, and the cells can be used for repopulating the hematopoietic system of a mouse model; and finally, the off-target analysis shows a high degree of safety. Accordingly, the method developed in the present invention has the potential to replace the conventional hematopoietic stem cell transplantation therapy technique for curing patients with severe thalassemia and sickle cell anemia.
[0249] Although the invention has been described in detail with reference to specific features, it is obvious to those skilled in the art that this description is intended for the illustration of the preferred embodiments only, and is not intended to limit the scope of the invention. Therefore, the essential scope of the invention is defined by the appended claims and their equivalents.