IN VITRO SELECTION FOR NUCLEIC ACID APTAMERS
20200340042 ยท 2020-10-29
Inventors
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
G01N33/5308
PHYSICS
C12N2320/13
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided herein are methods for selection of circular aptamers using a circular nucleic acid library. Also provided are circular aptamers, circular aptamer probes, biosensor systems, and the methods for their use in detecting a microorganism target, or a target molecule present on or generated from a microorganism or a virus in a test sample, including C. difficile glutamate dehydrogenase and methods for determining whether a subject has a C. difficile infection.
Claims
1. A method of identifying or producing an aptamer capable of binding to a target molecule, wherein the method comprises: a) providing a plurality of circular nucleic acid molecules, wherein the plurality of circular nucleic acid molecules comprises oligonucleotides having at least one random nucleotide domain flanked by a 5-end primer region and a 3-end primer region; b) contacting the plurality of circular nucleic acid molecules with a bare solid support; c) collecting unbound circular nucleic acid molecules; d) contacting the unbound circular nucleic acid molecules with solid support coated with the target molecule to form a complex comprising bound circular nucleic acid molecules; e) optionally washing the complex; f) eluting the bound circular nucleic acid molecules from the complex; and g) amplifying the eluted circular nucleic acid molecules by polymerase chain reaction (PCR).
2. The method of claim 1, further comprising repeating steps d) to g) for one to nineteen times, optionally for six to eleven times, with the amplified eluted circular nucleic acid molecules of g) as the unbound circular nucleic acid molecules in step d).
3. The method of claim 1, wherein providing a plurality of circular nucleic acid molecules comprises preparing a plurality of circular nucleic acid molecules by circularizing a plurality of linear nucleic acid molecules.
4. The method of claim 1, wherein the solid support comprises nitrocellulose filter disc, optionally with a pore size 0.45 or 0.22 um, or magnetic beads coated with a metal, optionally Nickel Nitrilotriacetic acid magnetic beads (NiMBs).
5. The method of claim 1, wherein step f) eluting comprises denaturing the circular nucleic acid molecules, optionally wherein the denaturing comprises heating or urea treatment, optionally 10M urea.
6. The method of claim 1, wherein the target molecule is a microorganism target, or a target molecule present on or generated from a microorganism or a virus.
7. The method of claim 6, wherein the microorganism is selected from the group consisting of a bacteria, fungi, archaea, protists, algae, plankton and planarian.
8. The method of claim 6, wherein the microorganism is a pathogenic bacterium.
9. The method of claim 8, wherein the pathogenic bacterium is selected from the group consisting of Escherichia coli O157:H7, Listeria monocytogenes, Salmonella typhimurium or Clostridium difficile.
10. The method of claim 1, wherein the target molecule is selected from the group consisting of small inorganic molecule, small organic molecule, metal ion, biomolecule, toxin, biopolymer, optionally nucleic acid, carbohydrate, lipid, peptide, protein, optionally glutamate dehydrogenase.
11. The method of claim 1, wherein the oligonucleotides include a primer region to allow for amplification and a random single stranded DNA sequence domain of about 20 to about 80 nucleotides, optionally about 40 nucleotides, and wherein the primer region comprises sequences of SEQ ID NOs: 2 or 63, and 64.
12. A circular DNA aptamer that binds to C. difficile glutamate dehydrogenase (GDH), wherein the circular DNA aptamer comprises a sequence of SEQ ID NO: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof.
13. An aptamer probe comprising the circular DNA aptamer of claim 12 and a detectable label, optionally the detectable label is a fluorescent moiety, optionally the fluorescent moiety is a fluorophore.
14. A biosensor system comprising: the circular DNA aptamer of claim 12 attached directly or indirectly to a solid support.
15. The biosensor system of claim 14, further comprising components for detecting a signal through rolling circle amplification (RCA) of the circular DNA aptamer in a test sample.
16. A method for detecting the presence of a target C. difficile glutamate dehydrogenase (GDH) in a test sample, comprising: a) contacting the test sample with a circular DNA aptamer of claim 12 to form a mixture, wherein the circular DNA aptamer is capable of binding to the target C. difficile glutamate dehydrogenase to form a complex; b) separating the complex from the mixture; and c) detecting a signal from the complex through rolling circle amplification (RCA) of the circular DNA aptamer, wherein detection of a signal indicates the presence of the target molecule in the test sample and the lack of signal indicates the absence of the target molecule.
17. A method of detecting C. difficile infection in a subject comprising: a) testing a sample from the subject for the presence of C. difficile GDH by the method of claim 16; and b) if GDH is present, further comprising testing the sample for the presence of C difficile toxins A and B, wherein the presence of GDH and the presence of toxins A and B indicate that the subject has a C. difficile infection.
18. The method of claim 17, wherein the testing for the presence of C. difficile toxins A and B is selected from the group consisting of cell cytotoxicity neutralization assay, toxin enzyme immunoassay or detection of toxin genes using PCR.
19. The method of claim 17, further comprising treating the subject for C. difficile infection if GDH and toxins are present.
20. A kit for detecting C. difficile GDH, wherein the kit comprises the circular DNA aptamer of claim 12 and instructions for use of the kit.
Description
DRAWINGS
[0037] The embodiments of the disclosure will now be described in greater detail with reference to the attached drawings in which:
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
DETAILED DESCRIPTION
[0069] Although many SELEX studies have been described for diverse targets, to the inventors' knowledge, all these experiments used linear nucleic acid libraries. A circular DNA library was used for the selection of a DNA-cleaving DNAzyme [2d], however, aptamer selection with nucleic acid libraries of circular topology has never been attempted. This disclosure herein describes the isolation of circular aptamers (simplified as captamers) directly from a circular DNA library.
[0070] There are several advantages associated with selecting captamers. First, previous studies have shown that circular DNA aptamers, produced via circularization of linear DNA aptamers, offer enhanced biological stability (as they are resistant to exonuclease degradation), making them highly desirable for applications that involve real biological samples [4]. Second, placing aptamers in a circular form creates opportunities for the design of biosensors that incorporate rolling circle amplification (RCA) as a signal amplification mechanism, as this technique involves copying a circular template by a DNA polymerase [4,5]. Although a linear aptamer can be redesigned into a captamer, additional nucleotides will have to be carefully incorporated into new constructs to minimize the impact on the activity of the aptamer imposed by the circularization [6]. Selection of DNA aptamers directly from a circular DNA library should provide optimal captamers for such applications. Importantly, selecting aptamers using circular DNA libraries offers a unique opportunity to search for aptamers with novel properties that can only be provided with the circular topology.
[0071] As shown in this disclosure, selecting aptamers from a circular DNA library can generate circular DNA aptamers with properties considerably different from the aptamers selected from a linear library.
[0072] I. Definitions
[0073] Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present disclosure herein described for which they are suitable as would be understood by a person skilled in the art.
[0074] The term aptamer as used herein refers to a short, chemically synthesized nucleic acid molecule or oligonucleotide which fold into specific three-dimensional (3D) structures that interact with a target molecule with dissociation constants in the pico- to nano-molar range. In general, aptamers may be single-stranded DNA or RNA, and may include modified nucleotides, modified backbones, for example in a peptide nucleic acid (PNA), and/or nucleotide derivatives.
[0075] The term nucleic acid aptamer and its derivatives, as used herein, are intended to refer to an aptamer comprising a nucleic acid molecule described herein, such as an unmodified DNA or RNA or modified DNA or RNA, or modified backbone nucleic acids, such as PNA, that are derived from the DNA base sequence.
[0076] The term DNA aptamer as used herein refers to an aptamer comprising DNA or comprising modified backbone nucleic acids, such as PNA, that are derived from the DNA base sequence.
[0077] Aptamers can be in linear or circular form. Circular aptamer is also known as captamer, which has circular topology. Circular nucleic acid aptamers aptamer can be produced via circularization (i.e. end-to-end ligation) of linear nucleic acid aptamers. As well, a plurality of circular nucleic acid aptamers (i.e. circular nucleic acid aptamer library or pool), for example a plurality of circular DNA aptamers, can be created from a plurality of linear DNA molecules (i.e. linear DNA library or pool) as described in Example 1C, the first step of which is circularization of linear DNA molecules. Circularization of linear nucleic acid molecules such as DNA molecules may involve, for example, a ligation template which is a nucleic acid oligonucleotide such as DNA oligonucleotide that binds the 5-end and 3-end of a linear molecule to create a duplex structure for a ligase such as T4 DNA ligase mediated ligation. The resulting pool of circular nucleic acid molecules such as DNA molecules can then be used in selection, counter-selection, and/or amplification for generating circular nucleic acid aptamers such as DNA aptamers. Circular nucleic acid aptamers such as DNA aptamers are useful in biosensors or biosensor systems that incorporate rolling circle amplification (RCA) as a signal amplification mechanism, as this technique involves copying a circular template by a polymerase such as a DNA polymerase. In an embodiment, circular DNA aptamer comprising a sequence of SEQ ID NO: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof is a RCA template. In an embodiment, circular DNA aptamer comprising a sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof is a RCA template. In an embodiment, circular DNA aptamer comprising a sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof is a RCA template. In an embodiment, circular DNA aptamer comprising a sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof is a RCA template. In an embodiment, circular DNA aptamer comprising a sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof is a RCA template.
[0078] The term rolling circle amplification or RCA as used herein refers to a unidirectional nucleic acid replication that can rapidly synthesize multiple copies of circular nucleic acid molecules. In an embodiment, rolling circle amplification is an isothermal enzymatic process where a short DNA or RNA primer is amplified to form a long single stranded DNA or RNA using a circular nucleic acid template and an appropriate DNA or RNA polymerase. The product of this process is a concatemer containing ten to thousands of tandem repeats that are complementary to the circular template. A method of RCA comprises: annealing a primer to a circular template where the circular template comprises a region complementary to the primer and an AC rich nucleotide region; amplifying the circular template under conditions that allow rolling circle amplification.
[0079] Rolling circle amplification conditions are known in the art. For example, rolling circle amplification occurs in the presence of a polymerase that possesses both strand displacement ability and high processivity in the presence of template, primer and nucleotides. In an embodiment, rolling circle amplification conditions comprise temperatures of from about 20 C. to about 35 C., or about 30 C., a reaction time sufficient for the generation of detectable amounts of amplicon and performing the reaction in a buffer. In an embodiment, the rolling circle amplification conditions comprise the presence of phi29-, Bst-, or Vent exo-DNA polymerase. In an embodiment, the rolling circle amplification conditions comprise the presence of phi29-DNA polymerase.
[0080] A person skilled in the art would understand that there are numerous ways to detect the presence of single stranded DNA or RNA molecules in a test sample after rolling circle amplification and includes, without limitation, radioactive, electrochemical, spectroscopic and colorimetric detection and/or quantification. For example, the generated DNA or RNA molecules can be labeled radioactively or detected by hybridizing with a complementary nucleic acid molecule, optionally coupled to a detectable labeled.
[0081] The term nucleic acid molecule and its derivatives, as used herein, are intended to include unmodified DNA or RNA or modified DNA or RNA. The nucleic acid molecules of the disclosure may contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. Modified bases include, for example, tritiated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus nucleic acid molecule, DNA molecule, and RNA molecule embrace chemically, enzymatically, or metabolically modified forms. The term polynucleotide shall have a corresponding meaning. The term oligonucleotide refers to a nucleic acid molecule having a sequence of at least about 13 nucleotides residues and up to about 220 nucleotide residues. Examples of modified nucleotides which can be used to generate the nucleic acids disclosed herein include xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, 2-propyl and other alkyl adenines, 5-halo uracil, 5-halo cytosine, 6-aza uracil, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiouracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8 amino guanine, 8-thiol guanine, 8-thiolalkyl guanines, 8-hydroxyl guanine and other 8-substituted guanines, other aza and deaza uracils, thymidines, cytosines, adenines, or guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine. Alternatively, the nucleic acid molecules can be produced biologically using an expression vector.
[0082] Another example of a modification is to include modified phosphorous or oxygen heteroatoms in the phosphate backbone, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages in the nucleic acid molecules. For example, the nucleic acid sequences may contain phosphorothioates, phosphotriesters, methyl phosphonates, and phosphorodithioates.
[0083] A further example of an analog of a nucleic acid molecule of the disclosure is a peptide nucleic acid (PNA) wherein the deoxyribose (or ribose) phosphate backbone in the DNA (or RNA), is replaced with a polyamide backbone which is similar to that found in peptides (P. E. Nielsen, et al Science 1991, 254, 1497). PNA analogs have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro. PNAs also bind stronger to a complementary DNA sequence due to the lack of charge repulsion between the PNA strand and the DNA strand. Other nucleic acid analogs may contain nucleotides containing polymer backbones, cyclic backbones, or acyclic backbones. For example, the nucleotides may have morpholino backbone structures (U.S. Pat. No. 5,034,506).
[0084] The term target or target molecule as used herein may refer to any agent, including, but not limited to, a small inorganic molecule, small organic molecule, metal ion, biomolecule, toxin, biopolymer (such as a nucleic acid, carbohydrate, lipid, peptide, protein), cell, tissue, microorganism, virus and pathogen, for which one would like to sense or detect. In an embodiment, the analyte is either isolated from a natural source or is synthetic. The analyte may be a single compound or a class of compounds, such as a class of compounds that share structural or functional features. The term analyte also includes combinations (e.g. mixtures) of compounds or agents such as, but not limited to, combinatorial libraries and samples from an organism or a natural environment. In an embodiment, the analyte comprises a microorganism target.
[0085] The term a microorganism target as used herein may be a molecule, compound or substance that is present in or on a microorganism or is generated, excreted, secreted or metabolized by a microorganism. In an embodiment, the microorganism target is present in the extracellular matrix of a microorganism. In another embodiment, the microorganism target is present in the intracellular matrix of a microorganism. In another embodiment, the microorganism target comprises a protein, a nucleic acid, a small molecule, extracellular matrix, intracellular matrix, a cell of the microorganism, or any combination thereof. In an embodiment, the microorganism target is a crude or purified extracellular matrix or a crude or purified intracellular matrix. In another embodiment, the microorganism target is specific to a particular species or strain of microorganism.
[0086] The term microorganism as used herein may refer to a microscopic organism that comprises either a single cell or a cluster of single cells including, but not limited to, bacteria, fungi, archaea, protists, algae, plankton and planarian. In an embodiment, the microorganism is a bacterium. In an embodiment, the microorganism is a pathogenic bacterium (for example, a bacterium that causes bacterial infection), such as Escherichia coli O157:H7, Listeria monocytogenes, Salmonella typhimurium or Clostridium difficile.
[0087] As used herein, test sample refers to a sample in which the presence or amount of a target or target molecule is unknown and to be determined in an assay, preferably a diagnostic test. The test sample may be a biological sample comprising cellular and non-cellular material, including, but not limited to, tissue samples, urine, blood, serum, other bodily fluids, and excrement, such as a stool (i.e. faeces) sample from a subject, or an environmental sample obtained from water, soil or air. In an embodiment, the test sample target is GDH of C. difficile.
[0088] The term treatment or treating as used herein means an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
[0089] As used herein, the term random nucleotide domain refers to a random sequence domain of, for example, about 20 to about 80 nucleotides, which is a part of a nucleic acid molecule in a random-sequence library of nucleic acid molecules for aptamer selection. In some instance, the random sequence domain is about 40 nucleotides.
[0090] In understanding the scope of the present disclosure, the term comprising and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The foregoing also applies to words having similar meanings such as the terms, including, having and their derivatives. The term consisting and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The term consisting essentially of, as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and/or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and/or steps.
[0091] Terms of degree such as substantially, about and approximately as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least 5% of the modified term if this deviation would not negate the meaning of the word it modifies.
[0092] As used in this disclosure, the singular forms a, an and the include plural references unless the content clearly dictates otherwise.
[0093] In embodiments comprising an additional or second component, such as an additional or second component, the second component as used herein is chemically different from the other components or first component. A third component is different from the other, first, and second components, and further enumerated or additional components are similarly different.
[0094] The term and/or as used herein means that the listed items are present, or used, individually or in combination. In effect, this term means that at least one of or one or more of the listed items is used or present.
[0095] The term subject as used herein includes all members of the animal kingdom including mammals such as a mouse, a rat, a dog, and a human.
[0096] II. Methods of Identifying or Producing A Circular Aptamer
[0097] In a broad aspect, herein provided is a method of identifying or producing a circular nucleic acid aptamer capable of binding to a target molecule, wherein said method comprises: [0098] a) incubating or contacting a plurality of circular nucleic acid molecules in the presence of the target molecule; [0099] b) collecting the plurality of circular nucleic acid molecules that bind to the target molecule; and [0100] c) amplifying the plurality of circular nucleic acid molecules of b) to yield a mixture of a plurality of circular nucleic acid aptamers enriched in nucleic acid sequences that are capable of binding to the target molecule.
[0101] In an embodiment, the circular nucleic acid aptamer is a circular DNA aptamer. In an embodiment, the target is immobilized. In an embodiment, the method further comprises testing for binding to the target molecule. In an embodiment, the oligonucleotides include 5-end primer region and a 3-end primer region to allow for amplification and a random single stranded DNA sequence domain of about 20 to about 80 nucleotides, optionally about 40 nucleotides. A person skilled in the art can readily recognize the appropriate sequence for the primer regions for use in Systematic Evolution of Ligands by Exponential Enrichment (SELEX). In an embodiment, the sequence for the primer regions are compatible with SELEX.
[0102] In a further aspect of the present disclosure, the inventors provide a method for identifying or producing an aptamer capable of binding to a target molecule using circular DNA molecules. Accordingly, herein provided is a method of identifying or producing an aptamer capable of binding to a target molecule, wherein the method comprises: [0103] a) providing a plurality of circular nucleic acid molecules, wherein the plurality of circular nucleic acid molecules comprises oligonucleotides having at least one random nucleotide domain flanked by a 5-end primer region and a 3-end primer region; [0104] b) contacting the plurality of circular nucleic acid molecules with a bare solid support; [0105] c) collecting unbound circular nucleic acid molecules; [0106] d) contacting the unbound circular nucleic acid molecules with a solid support coated with the target molecule to form a complex comprising bound circular nucleic acid molecules; [0107] e) optionally washing the complex; [0108] f) eluting the bound circular nucleic acid molecules from the complex; and [0109] g) amplifying the eluted circular nucleic acid molecules by polymerase chain reaction (PCR).
[0110] In an embodiment, the contacting comprises contacting in a binding buffer. In an embodiment, the method further comprises repeating steps b) to g) or d) to g) for one to nineteen times, optionally for six to eleven times, with the amplified eluted circular nucleic acid molecules of g) as the plurality of circular nucleic acid molecules in step b) or the unbound circular nucleic acid molecules of d). In an embodiment, the method further comprises repeating steps b) to g) for one to nineteen times, optionally for six to eleven times, with the amplified eluted circular nucleic acid molecules of g) as the plurality of circular nucleic acid molecules in step b). In an embodiment, the method further comprises repeating steps d) to g) for one to nineteen times, optionally for six to eleven times, with the amplified eluted circular nucleic acid molecules of g) as the unbound circular nucleic acid molecules of d). In an embodiment, step b) comprises contacting the plurality of nucleic acid molecules with a solid support coated with an off-target molecule. In an embodiment, the method further comprises repeating steps b) to g) for eleven times. In an embodiment, the oligonucleotides include a primer region to allow for amplification and a random single stranded nucleic acid sequence domain of about 20 to about 80 nucleotides, optionally about 40 nucleotides. In an embodiment, the primer region comprises sequence of SEQ ID NOs: 2 or 63, and 64. In an embodiment, the primer region comprises sequence of SEQ ID NOs: 2 and 64. In an embodiment, the primer region comprises sequence of SEQ ID NOs: 63 and 64. In an embodiment, the circular nucleic acid molecules are circular DNA molecules.
[0111] In an embodiment, the method further comprises repeating e) washing the complex for one or two times. In an embodiment, the washing comprises washing with a binding buffer. In an embodiment, the binding buffer comprises a physiological buffer. In an embodiment, the binding buffer comprises HEPES, NaCl, MgCl.sub.2, KCl and Tween-20. In a specific embodiment, the binding buffer comprises 50 mM HEPES, 150 mM NaCl, 10 mM MgCl.sub.2, 5 mM KCl and 0.02% Tween-20. In an embodiment, step f) eluting comprises denaturing the circular nucleic acid molecules, optionally wherein the denaturing comprises heating or urea treatment, optionally 10M urea.
[0112] In an embodiment, providing a plurality of circular nucleic acid molecules comprises preparing a plurality of circular nucleic acid molecules by circularizing a plurality of linear nucleic molecules. In an embodiment, the circularizing a plurality of linear nucleic acid molecules comprises template-assisted ligation. In an embodiment, the circular nucleic acid molecules are circular DNA molecules.
[0113] In an embodiment, the solid support comprises nitrocellulose filter disc or magnetic beads. In an embodiment, the nitrocellulose filter disc comprises a pore size 0.45 or 0.22 um. In an embodiment, the solid support comprises magnetic beads. In an embodiment, the solid support comprises magnetic beads coated with a metal. In an embodiment, the solid support comprises magnetic beads comprising silica, polystyrene, or agarose, coated with nickel, cobalt, copper, iron, zinc, or aluminum. In an embodiment, the magnetic beads comprises silica, polystyrene, or agarose. In an embodiment, the metal comprises nickel, cobalt, copper, iron, zinc, or aluminum. In an embodiment, the solid support comprises Nickel Nitrilotriacetic acid magnetic beads (NiMBs).
[0114] In an embodiment, the target molecule is a cell, tissue, microorganism, virus and pathogen. In an embodiment, the target molecule is a microorganism target or a target molecule present on or generated from a microorganism or a virus. In an embodiment, target molecule is a virus. In an embodiment, the target molecule is a pathogen. In an embodiment, the target molecule is a microorganism. In an embodiment, the microorganism is selected from the group consisting of a bacteria, fungi, archaea, protists, algae, plankton and planarian. In an embodiment, the microorganism is a pathogenic bacterium. In an embodiment, the pathogenic bacterium is selected from the group consisting of Escherichia coli O157:H7, Listeria monocytogenes, Salmonella typhimurium or Clostridium difficile.
[0115] In an embodiment, the target molecule is selected from the group consisting of small inorganic molecule, small organic molecule, metal ion, biomolecule, toxin, biopolymer, optionally nucleic acid, carbohydrate, lipid, peptide, protein, optionally glutamate dehydrogenase.
[0116] III. Aptamers, Probes and Biosensor Systems of the Disclosure
[0117] The term GDH or glutamate dehydrogenase as used herein refers to GDH from any source or organism. In an embodiment, the GDH is C. difficile GDH having a protein sequence as set out in Genbank Accession No. AAA62756.1 (SEQ ID NO: 18).
[0118] Accordingly, the disclosure provides a circular DNA aptamer that interacts with and binds to GDH through structural recognition. In an embodiment, the development of an aptamer that binds GDH is produced through Systematic Evolution of Ligands by EXponential enrichment (SELEX) technology.
[0119] The inventors identified in the screening circular DNA aptamers that bind to GDH, namely capt-2 (SEQ ID: 6) and capt-4 (SEQ ID NO: 7), which have the random sequence domain of SEQ ID NO: 14 and SEQ ID NO: 16, respectively. In an embodiment, the circular aptamer that binds to C. difficile GDH comprises or consists of a sequence of SEQ ID NOS: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof. In an embodiment, the circular aptamer that binds to C. difficile GDH comprises or consists of a sequence of SEQ ID NO: 6 or 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular aptamer that binds to C. difficile GDH comprises or consists of a sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof. In an embodiment, the circular aptamer that binds to C. difficile GDH comprises or consists of a sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular aptamer that binds to C. difficile GDH comprises or consists of a sequence of SEQ ID NO: 7 or 16, or a functional fragment or modified derivative thereof. In an embodiment, the aptamer that binds to C. difficile GDH comprises or consists of a sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof. In an embodiment, the aptamer that binds to C. difficile GDH comprises or consists of a sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof. The term functional fragment as used herein refers to the ability of the fragment to act as an aptamer to bind to GDH and change conformation upon the binding. The circular DNA aptamer sequence of SEQ ID NO: 16 can have additional surrounding sequence at the 5 and 3 ends (see Table 4). In an embodiment, the aptamer that binds to C. difficile GDH comprises a sequence of SEQ ID NO: 16, further comprises a sequence of any one of SEQ ID NO: 21-41 at the 5 end, and a sequence of any one of SEQ ID NO: 42-62 at the 3 end.
[0120] The term aptamer probe as used herein refers to an aptamer coupled to a detectable label.
[0121] In another aspect, herein provided is an aptamer probe that comprises an aptamer disclosed herein and a detectable label. In one embodiment, the detectable label comprises a fluorescent, a colorimetric or other optical probe or electrochemical moiety. In a particular embodiment, the detectable label is a fluorescent moiety, optionally a fluorophore. The fluorophore may be any fluorophore, such as a chemical fluorophore, for example, one selected from fluorescein, rhodamine, coumarin, cyanine or derivatives thereof. In one embodiment, the detectable label is FAM or Cy5. The selection of the fluorophore is based upon one or more parameters including, but not limited to, (i) maximum excitation and emission wavelength, (ii) extinction coefficient, (iii) quantum yield, (iv) lifetime, (v) stokes shift, (vi) polarity of the fluorophore and (vii) size.
[0122] In an embodiment, the circular DNA aptamer probe comprises or consists of the sequence of SEQ ID NOS: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer probe comprises or consists of the sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer probe comprises or consists of the sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer probe comprises or consists of the sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer probe comprises or consists of the sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof.
[0123] In another aspect, herein provided is a biosensor system comprising: [0124] a) a circular DNA aptamer attached directly or indirectly to a solid support, [0125] wherein the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof.
[0126] In an embodiment, the circular DNA aptamer indirectly via GDH attached to the solid support. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof.
[0127] In an embodiment, the biosensor system further comprises components for detecting a signal through rolling circle amplification (RCA) of the circular DNA aptamer in a test sample. In an embodiment, the components for RCA comprise a DNA polymerase. In an embodiment, the components for RCA comprise phi29-, Bst-, or Vent exo-DNA polymerase. In an embodiment, the components for RCA comprise phi29-DNA polymerase. In an embodiment, detection of a signal through RCA indicates the presence of the target molecule. In an embodiment, the lack of detection of a signal through RCA indicates the absence of the target molecule. In an embodiment, circular DNA aptamer further comprises a detectable label. In an embodiment, the circular DNA aptamer is capable of binding to the target molecule to form an aptamer-target molecule complex.
[0128] In an embodiment, the solid support comprises nitrocellulose filter disc or magnetic beads. In an embodiment, the nitrocellulose filter disc comprises a pore size 0.45 or 0.22 um. In an embodiment, the solid support comprises magnetic beads. In an embodiment, the solid support comprises magnetic beads coated with a metal. In an embodiment, the solid support comprises magnetic beads comprising silica, polystyrene, or agarose, coated with nickel, cobalt, copper, iron, zinc, or aluminum. In an embodiment, the magnetic beads comprises silica, polystyrene, or agarose. In an embodiment, the metal comprises nickel, cobalt, copper, iron, zinc, or aluminum. In an embodiment, the solid support comprises Nickel Nitrilotriacetic acid magnetic beads (NiMBs).
[0129] In an embodiment, the circular DNA aptamer is an aptamer probe. The aptamer probes disclosed herein are also useful as part of a typical signaling structure-switching nucleic acid aptamer (FQDNA) biosensor system.
[0130] The term structure-switching nucleic acid aptamers or reporter nucleic acid aptamers as used herein refers to aptamer-based reporters that function by switching structures from a DNA/DNA or RNA/RNA complex to a DNA/target or RNA/target complex.
[0131] This general assay design is based on the change in conformation from a DNA/DNA duplex to a DNA/target complex. In this assay, an oligonucleotide is generated that contains an aptamer flanked by a primer region. A fluorophore-labeled oligonucleotide (FDNA) hybridizes to the primer region, while the quencher-labeled oligonucleotide (QDNA) hybridizes to the aptamer region. In the absence of target, this DNA/DNA duplex will be weakly fluorescent as a result of the close proximity of the quencher and fluorophore. Upon introduction of target, the aptamer forms a DNA/target complex, displacing the QDNA and producing a large increase in fluorescence intensity. The magnitude of signal generation is dependent upon the concentration of target added.
[0132] Accordingly, there is provided in the disclosure a biosensor system comprising an aptamer probe disclosed herein in association with a quencher-oligonucleotide that quenches the detectable label; wherein the aptamer changes conformation upon binding GDH and results in release from the quencher such that the label is able to be detected. In some embodiments, the quencher-oligonucleotide is a DNA that hybridizes with the aptamer probe in the absence of GDH.
[0133] In an embodiment, the quencher molecule is selected from dimethylaminoazobenzenesulfonic acid (dabcyl) and fluorescence resonance energy transfer (FRET or blackhole) quenchers and derivatives thereof.
[0134] In yet another aspect of the disclosure, a structure-switching signaling aptamer-based biosensor system for real-time, sensitive and selective detection of GDH is disclosed. Accordingly, the present disclosure provides a biosensor system comprising an aptamer probe disclosed herein associated with a quencher molecule; wherein the aptamer changes conformation upon binding to GDH and results in displacement of the quencher from the aptamer probe.
[0135] A quencher molecule is a substance with no native fluorescence and that absorbs the excitation energy from a fluorophore and dissipates the energy as heat, with no emission of fluorescence. Thus, when the fluorophore and quencher are close in proximity, the fluorophore's emission is suppressed.
[0136] Also provided herein is another biosensor system comprising: [0137] a) a circular DNA aptamer probe; and [0138] b) a nanomaterial; [0139] wherein the circular DNA aptamer probe is adsorbed on the nanomaterial; [0140] wherein the circular DNA aptamer changes conformation upon binding GDH and results in desorption from the nanomaterial; and [0141] wherein the circular DNA aptamer probe comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof.
[0142] In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof.
[0143] In an embodiment, the nanomaterial acts as a quencher molecule. In an embodiment, the nanomaterial may be any nanomaterial that is able to have nonspecific DNA binding affinity and allow target-induced binding, such as reduced graphene oxide (RGO) or metal particles, such as gold or platinum particles.
[0144] In an embodiment, the nanomaterial is reduced graphene oxide (RGO). In some embodiments, reduced graphene oxide is produced by reducing an aqueous solution of graphene oxide, prepared, for example as described in M. Liu, et al. ACS Nano 2012, 6, 3142-3151, with a reducing agent, such as ascorbic acid and ammonia, followed by heating, for example to about 80 C. to about 100 C. for about 3 to about 10 minutes. Cooling this solution to room temperature provides a stably dispersed RGO solution.
[0145] In an embodiment, the biosensor system is comprised of a fluorometric circular DNA aptamer probe adsorbed to the surface of reduced graphene oxide (RGO), wherein conformational changes in the circular DNA aptamer probe induced by binding to GDH result in desorption of the circular DNA aptamer probe from the RGO, to provide RGO and a GDH-aptamer probe complex that is detectable fluorometrically. In an embodiment, conformational changes in the circular DNA aptamer or circular DNA aptamer probe induced by binding to GDH result in a RCA reaction. In an embodiment, the RCA reaction produces an amplified signal. In an embodiment, the biosensor system further comprises components for detecting a signal through rolling circle amplification (RCA) of the circular DNA aptamer or circular DNA aptamer probe in a test sample. In an embodiment, the components for RCA comprise a DNA polymerase. In an embodiment, the components for RCA comprise phi29-, Bst-, or Vent exo-DNA polymerase. In an embodiment, the components for RCA comprise phi29-DNA polymerase.
[0146] In an embodiment, the nanomaterial, such as RGO is blocked with a blocking agent to avoid non-specific binding. In an embodiment, the blocking is bovine serum albumin, milk or milk proteins. In an embodiment, the blocking agent is bovine serum albumin (BSA), optionally at a concentration of 0.05 to 1%.
[0147] IV. Methods of Detection and Kits of the Disclosure
[0148] Also provided herein is a method for detecting the presence of C. difficile glutamate dehydrogenase in a test sample, comprising contacting said sample with an aptamer disclosed herein, an aptamer probe disclosed herein or a biosensor system disclosed herein under conditions for a binding-induced conformational change in the aptamer to occur, and detecting a signal, wherein the aptamer, the aptamer probe or the biosensor system comprises a circular DNA aptamer, wherein the circular DNA aptamer comprises a sequence of SEQ ID NO: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof, and wherein detection of a signal indicates the presence of C. difficile GDH in the test sample and lack of signal indicates that C. difficile GDH is not present. In an embodiment, the circular DNA aptamer comprises a sequence of SEQ ID NO: 6 or 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a sequence of SEQ ID NO: 7 or 16, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof.
[0149] In an embodiment, the test sample is a biological sample from a subject suspected of having a C. difficile infection. In one embodiment, the biological sample is a sample of excrement, for example, stool, from the subject.
[0150] In another aspect, the disclosure provides a method for detecting the presence of a target C. difficile glutamate dehydrogenase in a test sample, comprising: [0151] a) contacting the test sample with a circular DNA aptamer to form a mixture, wherein the circular DNA aptamer is capable of binding to the target C. difficile glutamate dehydrogenase to form a complex; [0152] b) separating the complex from the mixture; and c) detecting a signal from the complex through rolling circle amplification (RCA) of the circular DNA aptamer, [0153] wherein detection of a signal indicates the presence of the target molecule in the test sample and the lack of signal indicates the absence of the target molecule, and [0154] wherein the circular aptamer comprises a circular DNA aptamer comprising the sequence of SEQ ID NO: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof.
[0155] In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof.
[0156] In an embodiment, the circular DNA aptamer is a circular DNA aptamer probe. In an embodiment, the circular DNA aptamer is attached directly or indirectly to a solid support. In an embodiment, the circular DNA aptamer indirectly via GDH attached to the solid support. In an embodiment, the method comprises separating the complex from the solid support. In an embodiment, the solid support comprises nitrocellulose filter disc or magnetic beads. In an embodiment, the solid support comprises magnetic beads. In an embodiment, the solid support comprises magnetic beads coated with a metal. In an embodiment, the nitrocellulose filter disc comprises a pore size 0.45 or 0.22 um. In an embodiment, the solid support comprises magnetic beads coated with a metal. In an embodiment, the solid support comprises magnetic beads comprising silica, polystyrene, or agarose, coated with nickel, cobalt, copper, iron, zinc, or aluminum. In an embodiment, the magnetic beads comprises silica, polystyrene, or agarose. In an embodiment, the metal comprises nickel, cobalt, copper, iron, zinc, or aluminum. In an embodiment, the solid support comprises Nickel
[0157] Nitrilotriacetic acid magnetic beads (NiMBs). In an embodiment, the denaturing comprises heating or urea treatment, optionally 10M urea. In an embodiment, the aptamer probe comprises an aptamer and a detectable label. In an embodiment, the test sample is a blood sample, a urine sample, a saliva sample, or a stool sample. In an embodiment, the test sample is a stool sample.
[0158] The disclosure provides herein a method of RCA comprising: [0159] annealing a primer to a circular template; [0160] wherein the circular template comprises a region complementary to the primer; and [0161] amplifying the circular template under conditions that allow rolling circle amplification, [0162] wherein the circular template comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof.
[0163] In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof.
[0164] In an embodiment, the method of RCA further comprises subjecting the product of the amplification to restriction digestion. In an embodiment, upon restriction enzyme digestion of the product, the concatemer is separated into individual monomer amplicons, which can then optionally be detected or quantified. A person skilled in the art would understand that any restriction recognition sites would be compatible.
[0165] In another embodiment, the method of RCA further comprises c) detecting the product of the RCA. Methods for detection of products of RCA are known in the art. For example, a nucleotide probe that is complementary to a portion of the concatemer can be labeled and incubated with the product under stringent conditions to allow for hybridization and subsequent detection of the label. Detection includes qualitative and quantitative detection.
[0166] In another aspect, the disclosure provides a method for detecting the presence of a target C. difficile glutamate dehydrogenase in a test sample, comprising: [0167] contacting the test sample with a synthetic target C. difficile glutamate dehydrogenase-coated solid support coupled with a circular DNA aptamer to form a complex, [0168] wherein the circular DNA aptamer is capable of binding to native form of the target C. difficile glutamate dehydrogenase; [0169] wherein the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, 7, 14, or 16, or a functional fragment or modified derivative thereof; and [0170] wherein the circular DNA aptamer has lower or equivalent affinity for the synthetic target C. difficile glutamate dehydrogenase compared to the native form of the target C. difficile glutamate dehydrogenase present in a test sample.
[0171] In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 6, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 7, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 14, or a functional fragment or modified derivative thereof. In an embodiment, the circular DNA aptamer comprises a circular DNA aptamer comprising a sequence of SEQ ID NO: 16, or a functional fragment or modified derivative thereof.
[0172] The phrase contacting the sample or contacting the test sample, or a derivative thereof refers to incubating the sample, which has been processed, with the aptamer or aptamer probe, which allows any GDH in the sample to bind to the aptamer and induce a conformational change in the aptamer or aptamer probe. In the biosensor system comprising an aptamer or an aptamer probe disclosed herein, the aptamer-GDH or aptamer probe-GDH is then desorbed from the nanomaterial and the fluorescent signal can be detected.
[0173] Detection of the signal can be performed using any available method, including, for example, colorimetric, electrochemical and/or spectroscopic methods, depending on the label on the aptamer. The detection can simply be detection of the direct product formed, for example, by reaction or interaction of the aptamer with GDH, if the product being formed possesses a color (or any signal, such as a fluorescent signal) that is intense enough to be detected and that is distinct from the color (or signal) of any of the starting reagents. In some embodiments, detection of the signal comprises rolling circle amplification (RCA) of a circular aptamer. In some embodiments, the detection means is not a separate component of the biosensor system, but is instead formed during the assay and therefore is an inherent part of the biosensor system. In a further embodiment, the detection means comprises a separate entity that reacts or interacts with the direct product formed by reaction of, for example, the aptamer and the GDH, the reaction with the separate entity resulting in a distinct detectable signal.
[0174] The initial GDH screening test can be used in clinical diagnosis of CDI. Accordingly, further provided herein is a method of detecting C. difficile infection in a subject comprising testing a sample from the subject for the presence of C. difficile GDH by the method disclosed herein; and if GDH is present, further comprising testing the sample for the presence of C. difficile toxins A and B (with a protein sequence as set out in Genbank Accession No. CAA63564.1 (SEQ ID NO: 19) and CAA63562.1 (SEQ ID NO: 20), respectively); wherein the presence of GDH and the presence of toxins indicates that the subject has a C. difficile infection. In an embodiment, testing for the presence of C. difficile toxins comprises a cell cytotoxicity neutralization assay, a toxin enzyme immunoassay or detection of toxin genes using PCR.
[0175] In another embodiment, the method further comprises treating the subject for C. difficile infection if GDH and toxins are present. Also provided is use of a medicament to treat a subject that has been identified as having a C. difficile infection by the method disclosed herein. In an embodiment, treatment of C. difficile or a medicament for treatment of C. difficile comprises antibiotics such as metronidazole, vancomycin or fidaxomicin.
[0176] Even further provided herein is a kit for detecting C. difficile glutamate dehydrogenase, wherein the kit comprises an aptamer disclosed herein, an aptamer probe disclosed herein and/or a biosensor system disclosed herein and instructions for use of the kit. In an embodiment, the kit further comprises components of RCA described herein. In an embodiment, the kit further comprise a synthetic GDH. In an embodiment, the kit further comprises a blocking agent for non-specific binding to a solid support, such as bovine serum albumin (BSA), milk or milk proteins. In an embodiment, the blocking agent is BSA, optionally at a concentration of 0.05 to 1%.
EXAMPLES
[0177] The following non-limiting examples are illustrative of the present disclosure:
Example 1
Selection of Captamer for Glutamate Dehydrogenase (GDH) From Clostridium difficile.
Experiment Section
Example 1A
Oligonucleotides and Other Materials
[0178] All DNA oligonucleotides (Table 2) were obtained from Integrated DNA Technologies (IDT), and purified by standard 10% denaturing (8 M urea) polyacrylamide gel electrophoresis (dPAGE). T4 DNA ligase, phi29 DNA polymerase, T4 polynucleotide kinase (PNK) and deoxyribonucleoside 5-triphosphates (dNTPs) were purchased from Thermo Scientific (Ottawa, ON, Canada). Thermus thermophilus DNA polymerase was obtained from Biotools. Recombinant (his-tagged) glutamate dehydrogenase (rGDH, isoelectric point of 5.60 and molecular weight of 46,000 Da; expressed and purified from E. coli cells), native GDH (nGDH), TcdA and TcdB were obtained from Pro-Lab Diagnostics (Toronto, ON, Canada). Ni-NTA magnetic agarose beads were obtained from QIAGEN. [-.sup.32P]deoxy-GTP and [.sup.32P]-ATP were acquired from Perkin Elmer (Woodbridge, ON, Canada). All other chemicals were purchased from Sigma-Aldrich (Oakville, ON, Canada) and used without further purification.
Example 1B
Instruments
[0179] The autoradiogram and fluorescent images of gels were obtained using a Typhoon 9200 variable mode imager (GE Healthcare) and analyzed using Image Quant software (Molecular Dynamics). Time-dependent fluorescence emission measurements were performed using a BioRad CFX96 qPCR system and Genie II portable fluorimeter platform.
Example 1C
In Vitro Selection of Captamers
[0180] Library preparation. The DNA library DL1 (SEQ ID NO: 1) was chemically synthesized and purified by 10% dPAGE. Purified DL1 was replicated using a previously described protocol [10]. Briefly, 1 nM of purified DL1 was amplified by PCR for 5 cycles with a biotinylated primer (32-fold amplification). Following the amplification, single-stranded DNA was prepared using streptavidin modified agarose beads and elution with an alkaline solution. .sup.rd of the thus prepared DNA pool (15 nmoles) was used for preparing the required circular DNA library (cirDNA) through template-assisted ligation as previously described [14]. Briefly, DL1 was first phosphorylated as follows: a reaction mixture (100 L) was made to contain 3 M linear oligonucleotide, 10 U PNK (U: unit), 1 PNK buffer A (50 mM Tris-HCl, pH 7.6 at 25 C., 10 mM MgCl.sub.2, 5 mM DTT, 0.1 mM spermidine), and 1 mM ATP. The mixture was incubated at 37 C. for 1 h, followed by heating at 90 C. for 10 min. Equimolar DNA ligation template (LT1 (SEQ ID NO: 5)) was then added, heated at 90 C. for 60 s and cooled to room temperature (RT) for 20 min. Then, 15 L of 10T4 DNA ligase buffer (400 mM Tris-HCl, 100 mM MgCl.sub.12, 100 mM DTT, 5 mM ATP, pH 7.8 at 25 C.) and 20 U of T4 DNA ligase were added (total volume 150 L). This mixture was incubated at RT for 2 h before heating at 90 C. for 10 min to deactivate the ligase. The ligated cDNAs were concentrated by standard ethanol precipitation and purified by 10% dPAGE.
[0181] The SELEX procedure was performed according to reported method with modifications [9a]. In the first round, the cirDNA library (10 nmol), which was denatured at 90 C. for 10 min and then cooled on ice for 15 min, was incubated with bead-bound rGDH (138 pmol) with rotation for 30 min at room temperature in 500 L of 1 binding buffer (pH 7.2) containing 50 mM HEPES, 150 mM NaCl, 10 mM MgCl.sub.2, 5 mM KCl and 0.02% Tween-20. The tube was then applied to a magnet (Qiagen), the supernatant was removed, and the beads were washed three times with 1 binding buffer (500 L). rGDH and bound aptamers were eluted with 300 L of elution buffer (1 binding buffer containing 500 mM imidazole) at 90 C. for 15 min with gentle shaking. After recovery by ethanol precipitation, the cirDNA was amplified by standard PCR with FP1 (SEQ ID NO: 2) and RP1 (SEQ ID NO: 3). Thermal cycles were typically performed as follows: 94 C. for 30 s; 16 cycles of 94 C. for 30 s, 50 C. for 45 s and 72 C. for 40 s; 72 C. for 5 min. A small aliquote of the PCR product (1%) was taken as an input in PCR2 with the use of FP1 (SEQ ID NO: 2) and RP2 (SEQ ID NO: 4; which contained internal C3 spacer) under the same reaction conditions. The purpose of the second PCR was to make the nonaptamer-coding DNA strand 12 nucleotides longer than the coding strand. The amplified DNA was then separated and purified by 10% dPAGE. The concentration of rGDH was kept at 138 pmol for rounds 1-6 and then reduced to 46 pmol for rounds 7-12. The DNA pool from round 12 was used for deep sequencing using an Illumina Miseq system at the Farncombe Metagenomics Facility, McMaster University (Hamilton, ON, Canada).
Example 1D
Pull-Down Assay
[0182] 100 L of 1 binding buffer containing 100 nM -[.sup.32P]-labeled captamer candidates was first denatured at 90 C. for 10 min, followed by incubation at RT for 20 min. The pull-down assays were conducted in a total volume of 300 L of 1 binding buffer containing 50 L of bead-bound rGDH (final concentration 50 nM) and 100 L of 100 nM captamer candidates for 30 min with gentle rotation. In parallel, negative controls consisting of the captamers incubated with uncoated beads were included. Following three washing steps, proteins and bound aptamers were eluted with 30 L of elution buffer (20 mM Tris-HCl, 500 mM imidazole, pH 7.5) by shaking at 90 C. for 10 min. The resultant mixtures were then analyzed by 10% dPAGE, and quantified by Image Quant software. For determination of the dissociation constants (K.sub.d), 100 L of 2 M -[.sup.32P]-labeled aptamers was first denatured in 1 binding buffer at 90 C. for 10 min, followed by incubation at RT for 20 min. Pull-down assays were conducted in a total volume of 300 L of 1 binding buffer containing 10 L of bead-bound rGDH (final concentration 9.2 nM) and 100 L of aptamers with serial dilutions for 30 min with gentle rotation. Following washing steps, the bound DNA was then analyzed by 10% dPAGE. The apparent dissociation constants (K.sub.d) of each aptamer candidate were obtained by fitting the fractional bound DNA to the total aptamer concentration using a one-site binding model.
Example 1E
Dot Blotting Assay
[0183] A total of 2 L of rGDH (2.3 g/uL) was spotted onto a nitrocellulose membrane (Millipore HF180) and was allowed to dry at RT for 10 min. Then, the membrane was blocked with 10 L of 1% BSA in 1 binding buffer for 20 min. After washed once with 20 L of 1 binding buffer, 10 L of 100 nM -[.sup.32p]-labeled Apt-2 or Apt-4 were added and incubated for 20 min. The paper plate was placed in a trough containing 2 mL of washing buffer for 5 min, nitrogen-dried, and exposed to a phosphor-imaging screen.
Example 1F
Filter Binding Assay
[0184] Serially diluted nGDH were first incubated with 10 nM [.sup.32P]-labeled Capt-4 in 20 L of 1 binding buffer containing 1% BSA for 30 min. The mixtures were then spotted onto wax-printed 96-microzone paper plates (Whatman Grade 1 chromatography paper), which will pass through the filter by capillary force. After washing with 1 binding buffer three times (20 L each time), the paper was dried at RT and exposed to a phosphor-imaging screen before scanning.
Example 1G
Competitive Binding Assay
[0185] 300 L of 1 binding buffer containing 200 nM -[.sup.32P]-labeled Lapt-2 and Capt-2 or Capt-4, which had been denatured at 90 C. for 5 min and then cooled at RT, was incubated with 10 L of bead-bound rGDH (final concentration 9.2 nM) with rotation for 30 min. The tube was then applied to a magnet (Qiagen), the supernatant was removed, and the beads were washed three times with 500 L of 1 binding buffer. The bound DNA was then analyzed by 10% dPAGE. For the controls, a random DNA sequence (RDS) was used instead of Lapt-2.
Example 1H
Sandwich Assay
[0186] To facilitate the immobilization of Lapt-2 on paper, the inventors first prepared the streptavidin-biotinylated Lapt-2 conjugate according to reported method [5f]. A desired volume (5 L) of the above solution was then printed onto the nitrocellulose membrane (Millipore HF180) with a Scienion SciFlex Arrayer 10 Non-Contact Microarray Printer and allowed to dry at RT. The plates were then blocked with 20 L of 1 binding buffer containing 1% BSA. After incubating at RT for 10 min and washing once by 20 L of 1 binding buffer, 10 L of 100 nM rGDH was added and allowed to bind for 20 min. Then 10 L of 200 nM [.sup.32P]-labeled Capt-4 was added and incubated for another 20 min. The paper plate was placed in a trough containing 2 mL of washing buffer for 5 min, nitrogen-dried, and exposed to a phosphor-imaging screen.
Example 1I
Target Detection
[0187] 300 L of 1 binding buffer containing 300 nM Capt-4, which had been denatured at 90 C. for 2 min and then cooled at RT, was incubated with 10 L of bead-bound rGDH (final concentration 20 nM) with rotation for 15 min. 10 L of 1% BSA was added and incubated for 10 min. The supernatant was removed, and the beads were washed three times before being re-dispersed in 40 L of 1 binding buffer. Then 10 L of nGDH with different dilutions in pure buffer or unformed faecal specimens was added. Following 15 min incubation with gentle shaking, the supernatant was transferred to a new tube and heated at 90 C. for 2 min. To this mixture were added 10 L of 10 RCA reaction buffer (330 mM Tris acetate, 100 mM magnesium acetate, 660 mM potassium acetate, 1% (v/v) Tween-20, 10 mM DTT, pH 7.9), 5 U of phi29 DNA polymerase, 2 L of dNTPs (10 mM) and 1 L of DPI (100 M), and the resultant mixture (final volume: 100 L) was incubated at 30 C. for 30 min before being analyzed by 0.6% agarose gel electrophoresis. A similar experiment was carried out using non-target proteins (BSA, TcdA and TcdB from C. difficile) to evaluate the specificity. For the real-time monitoring of RCA at various nGDH concentrations, these reactions were monitored using a BioRad CFX96 qPCR system or Genie II portable fluorimeter platform set to a constant temperature of 30 C., and the fluorescence intensity was recorded.
Example 1J
Faecal Sample Analysis
[0188] 50 L of unformed faeces were first transferred to 100 L of Sample Diluent (Pro-Lab Diagnostics). The sample was vortexed for 30 s to thoroughly emulsify the specimen. This was followed by the addition of the above prepared bead-bound rGDH/Capt-4 mixture in 200 L of 1 binding buffer. Following 15 min incubation with gentle shaking, the supernatant was transferred to a new tube and heated at 90 C. for 5 min. To 50 L of this mixture were added 10 L of 10RCA reaction buffer (330 mM Tris acetate, 100 mM magnesium acetate, 660 mM potassium acetate, 1% (v/v) Tween-20, 10 mM DTT, pH 7.9), 5 U of phi29 DNA polymerase, 2 L of dNTPs (10 mM) and 1 L of LT1 (SEQ ID NO: 5; 100 M). These reactions (final volume: 100 L) were monitored using a Genie II portable fluorimeter platform set to a constant temperature of 30 C., and the fluorescence intensity was recorded.
Example 2
Advantages of Performing Aptamer Selection With a Circular DNA Library
[0189] To demonstrate the aforementioned advantages, the inventors carried out captamer selection targeting glutamate dehydrogenase (GDH) from Clostridium difficile (C. difficile), a proven antigen for diagnosing C. difficile infections (CDI) that cause many annual global outbreaks [7]. GDH is an excellent biomarker for diagnosing CDI because it is at fairly high levels (0.02-20 nM) in the feces of CDI patients but undetectable in the stool of healthy people [8]. In addition, because the inventors have shown a linear DNA aptamer for the same GDH [9], head-to-head comparisons of the binding to the same target by linear and circular aptamers can be conducted. For this consideration, the inventors conducted the aptamer selection with the same library used for the linear aptamer selection, which was replicated using a published protocol (see Example 1C and ref [10]).
[0190] The selection strategy included 5 key steps, as illustrated in FIG. la. The first step was the preparation of the DNA library by the end-to-end ligation (circularization) of the linear DNA pool, DL1 (SEQ ID NO: 1; which contained a 40-nucleotide random domain; see
[0191] 10.sup.15 distinct circular DNA molecules were used as the initial DNA library. 12 rounds of selection were carried out, and the fraction of the DNA bound to rGDH-NiMBs increased in each round (
[0192] Interestingly, the sequences of Capt-1, 2, 3 and 5 were also observed in the linear GDH-binding aptamer selection (which were named Anti-G6, Anti-G1, Anti-G5, Anti-G4 respectively) [9a], an unsurprising finding given that the same replicated DNA library was used for both. However, Capt-4 was a new sequence that was not observed in the previous selection. A pull-down assay was then carried out for radiolabeled versions of the top 5 sequences. In this assay, each captamer candidate was incubated with bare NiMBs or rGDH-coated NiMBs, followed by elution of the bound captamer and radioactivity analysis by dPAGE (
[0193] The inventors measured the dissociation constant (K.sub.d) for Capt-2 and Capt-4 using the same pull-down assay, along with their linear counterparts, Lapt-2 and Lapt-4 (
[0194] The striking difference seen with aptamers 2 and 4 was also evaluated via dot blotting assays with rGDH being immobilized onto nitrocellulose membranes (
[0195] Taken together, the results above highlight the added advantage of performing aptamer selection with a circular DNA library, as this can result in the discovery of aptamers that cannot be obtained from a linear library.
[0196] Interestingly, Capt-2 and Capt-4 recognize distinct epitopes on rGDH, a conclusion drawn from both a competitive binding assay (
[0197] That aptamers 2 and 4 recognize different epitopes was further confirmed using a dot blotting sandwich assay in which biotinylated Lapt-2 was immobilized on streptavidin-coated paper plates to capture rGDH and .sup.32P-labeled Capt-4 was used to report captured rGDH on the paper. As shown in
[0198] Inventors' selection with the linear DNA library resulted in 3 linear aptamers: Anti-G1 (which is Capt-2), Anti-G3 and Anti-G7 [9a] (see Table 2 for their sequences). The competition assay illustrated in
[0199] The inventors next applied circular aptamers for the diagnosis of CDI.
[0200] Achieving this objective requires that the circular aptamers recognize native GDH (nGDH) from C. difficile. The inventors confirmed the binding of Capt-4 to nGDH using the filter binding assay (
[0201] Human faeces are commonly used specimens in diagnosing CDI [13], and therefore, it was next examined the molecular integrity of Capt-4 and Lapt-4 in such samples. The half-life of Capt-4 was >3 h, compared to 0.4 h observed for Lapt-4 (
[0202] The inventors next designed a biosensing assay for the detection of nGDH from human faeces that takes advantage of the observation that Capt-4 shows significantly better affinity to nGDH (K.sub.d=2.8 nM) over rGDH (K.sub.d=12.3 nM). The strategy features rGDH-coated NiMBs pre-bound with Capt-4; the presence of nGDH from a test sample causes the release of Capt-4, which is then used for RCA to produce long-chain DNA molecules with repetitive sequences (
[0203] The inventors analyzed the production of RCA products in response to increasing concentrations of nGDH. The RCA products were observed by agarose gel analysis when the nGDH concentration was at 0.5 nM or higher (
[0204] The inventors also performed the analysis of nGDH spiked into human faecal samples and found that the signal responses were comparable to the results obtained with pure buffer (
Example 3
High-Affinity Circular DNA Aptamers That Specifically Recognize Glutamate Dehydrogenase (GDH) From C. difficile
[0205] The inventors undertook selection of protein-binding DNA aptamers from a circular DNA library, resulting in the isolation of two high-affinity circular DNA aptamers that specifically recognize glutamate dehydrogenase (GDH) from C. difficile, an established antigen for diagnosing C. difficile infections (CDI). One aptamer, Capt-2, has a sequence identical to an aptamer previously isolated from the same DNA library in a linear configuration and this aptamer works in both circular and linear forms. The other aptamer, Capt-4, which linear form sequence was not selected from the linear library and exhibits high affinity for GDH only in the circular form. Capt-4 and Capt-2 recognize different epitopes on GDH because they can simultaneously bind this protein.
[0206] Isolation of Capt-4 highlights the advantage of selecting aptamers from circular DNA libraries, without wishing to be bound by theory, because this approach not only can discover distinctive aptamers that do not exist in linear DNA libraries but can also produce high-affinity recognition elements with improved chemical and functional stabilities in biological media. Finally, the inventors show a sensitive diagnostic test for CDI, which takes advantage of three outstanding properties of Capt-4: high stability and functionality in human faeces, compatibility with rolling circle amplification, and higher binding affinity for native GDH from C. difficile relative to the recombinant version of GDH. This test is capable of detecting 10 M native GDH in human faeces and can correctly identify patients with active CDI.
[0207] While the present disclosure has been described with reference to examples, it is to be understood that the scope of the claims should not be limited by the embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.
[0208] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present disclosure is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.
TABLE-US-00001 TABLE 1 A comparison of K.sub.d for different aptamer constructs. Capt-2 Lapt-2 Capt-4 Lapt-4 K.sub.d (nM).sup.a 4.4 2.5 5.6 2.1 12.3 4.6 293 15 .sup.aPull-down assay was performed in 1 binding buffer (50 mM HEPES, 150 mM NaCl, 10 mM MgCl.sub.2, 5 mM KCl and 0.02% Tween-20, pH 7.2) at 25 C.
TABLE-US-00002 TABLE2 SequencesofDNAoligonucleotidesusedinthisdisclosure. Identifier NameofDNAoligonucleotide Sequence(5-3) SEQIDNO:1 DNAlibrary(DL1) CAGGTCCATCGAGTGGTAGGAN.sub.40TCGCACTGC TCCTGAACGTAC PrimersforPCR SEQIDNO:2 Forwardprimer(FP1) CAGGTCCATCGAGTGGTAGGA SEQIDNO:3 Reverseprimer(RP1) GTACGTTCAGGAGCAGTGCGA SEQIDNO:4 Reverseprimer(RP2) AAAAAAAAAAAAXGTACGTTCAGGAGCAGT GCGA;X=internalC3space SEQIDNO:5 Ligationtemplate(LT1) TCGATGGACCTGGTACGTTCAGGA SEQIDNO:6 Capt-2 CAGGTCCATCGAGTGGTAGGAGGAGGTAT (=Anti-G1inRef.3).sup.a TAGTGCCAAGCCATCTCAAACGACGTCTGA GTCGCACTGCTCCTGAACGTAC SEQIDNO:7 Capt-4 CAGGTCCATCGAGTGGTAGGACGACCCGAA TAGTGGCATATCAATGAGTGCTTGTCATCT TTCGCACTGCTCCTGAACGTAC SEQIDNO:8 Anti-G3.sup.a CAGGTCCATCGAGTGGTAGGATGCAGCGGA CAGTGTGGGACCATCGCTGCGGATGTATGA ATCGCACTGCTCCTGAACGTAC SEQIDNO:9 Anti-G7.sup.a CAGGTCCATCGAGTGGTAGGACCCAACCCA CGATGCGCAAGAGGAATGCAGCCTACCAGC ATCGCACTGCTCCTGAACGTAC SEQIDNO:10 Anti-G1T1.sup.b TAGGAGGAGGTATTTAGTGCCAAGCCATCT CAAACGACGTCTGAGTCGCACTGCTCCTG ScrambledSequences.sup.c SEQIDNO:11 ScrambledCapt-2 CGGGAGTACGCATGTATGAGACACCCACGC TATGTCCCTACTATGAGGTGGAGACTTGCT ACGTGCATCGCAGATCGGTCAA SEQIDNO:12 ScrambledCapt-4 GAAGGATTCGGACTAGGATCCGGTCCAACT ACCGGTGCCCTAATGGCATCAAAACTGCGT ACCGAGCGTGTTTATCTTTCTG .sup.aAnti-G1, Anti-G3 and Anti-G7 were near aptamers previously selected from the linear library (Ref 3). Anti-G1 was the linear form of Capt-2 in this disclosure, i.e. Anti-G1 is Lapt-2. .sup.bAnti-G1T1 is a shortened version of Anti-G1 with full activity (Ref 3). .sup.cThe scrambled sequences were generated using the following web based program: http://www.bioinformatics.org/sms2/shuffle_dna.html
TABLE-US-00003 TABLE3 High-throughputsequencingresultsfromselectionround12pools Random Multi- %of Identifier RegionID Sequenceofrandomregion(5.fwdarw.3) plicity Total SEQIDNO:13 RR-Capt- CAGCTGTCGACGCGTTACCGTGAAC 99288 30.9 1.sup.a GGAACACCGATGACG SEQIDNO:14 RR-Capt- GGAGGTATTTAGTGCCAAGCCATCT 14151 4.4 2.sup.a CAAACGACGTCTGAG SEQIDNO:15 RR-Capt- GTGTAGGGACGCAAGATGAATGCAG 13965 4.3 3.sup.a CATACCAGTCCCTAG SEQIDNO:16 RR-Capt- CGACCCGAATAGTGGCATATCAATG 11503 3.6 4 AGTGCTTGTCATCTT SEQIDNO:17 RR-Capt- TCAGTACCAGTTCCCCAGGAGAATG 10255 3.2 5.sup.a CAGATCCCCAGGTAC .sup.aCapt-1,2,3,5 were also selected from the linear library (Ref. 3 above), which were given diffrent names: Capt-1 =AntiG6; Capt-2 =Anti-G1; Capt-3 =Anti-G5; Capt-5 =Anti-G4; RR: Random Region; Each captamer sequence also contains primer regions CAGGTCCATC GAGTGGTAGGA (SEQ ID NO: 2) or CAGGTCCATC GAGTGGTA (SEQ ID NO: 63) at the 5end and TCGCACTGCT CCTGAACGTA C (SEQ ID NO:64) at 3end flanking the random region.
TABLE-US-00004 TABLE4 SequencesurroundingSEQIDNO:16 Ter- Sequencesurrounding Identifier minus randomregion SEQIDNO:21 5 CAGGTCCATCGAGTGGTAGGA SEQIDNO:22 5 AGGTCCATCGAGTGGTAGGA SEQIDNO:23 5 GGTCCATCGAGTGGTAGGA SEQIDNO:24 5 GTCCATCGAGTGGTAGGA SEQIDNO:25 5 TCCATCGAGTGGTAGGA SEQIDNO:26 5 CCATCGAGTGGTAGGA SEQIDNO:27 5 CATCGAGTGGTAGGA SEQIDNO:28 5 ATCGAGTGGTAGGA SEQIDNO:29 5 TCGAGTGGTAGGA SEQIDNO:30 5 CGAGTGGTAGGA SEQIDNO:31 5 GAGTGGTAGGA SEQIDNO:32 5 AGTGGTAGGA SEQIDNO:33 5 GTGGTAGGA SEQIDNO:34 5 TGGTAGGA SEQIDNO:35 5 GGTAGGA SEQIDNO:36 5 GTAGGA SEQIDNO:37 5 TAGGA SEQIDNO:38 5 AGGA SEQIDNO:39 5 GGA SEQIDNO:40 5 GA SEQIDNO:41 5 A SEQIDNO:42 3 TCGCACTGCTCCTGAACGTAC SEQIDNO:43 3 TCGCACTGCTCCTGAACGTA SEQIDNO:44 3 TCGCACTGCTCCTGAACGT SEQIDNO:45 3 TCGCACTGCTCCTGAACG SEQIDNO:46 3 TCGCACTGCTCCTGAAC SEQIDNO:47 3 TCGCACTGCTCCTGAA SEQIDNO:48 3 TCGCACTGCTCCTGA SEQIDNO:49 3 TCGCACTGCTCCTG SEQIDNO:50 3 TCGCACTGCTCCT SEQIDNO:51 3 TCGCACTGCTCC SEQIDNO:52 3 TCGCACTGCTC SEQIDNO:53 3 TCGCACTGCT SEQIDNO:54 3 TCGCACTGC SEQIDNO:55 3 TCGCACTG SEQIDNO:56 3 TCGCACT SEQIDNO:57 3 TCGCAC SEQIDNO:58 3 TCGCA SEQIDNO:59 3 TCGC SEQIDNO:60 3 TCG SEQIDNO:61 3 TC SEQIDNO:62 3 T
FULL CITATIONS FOR DOCUMENTS REFERRED TO IN THE DISCLOSURE
[0209] [1] a) A. D. Ellington, J. W. Szostak, Nature 1990, 346, 818-822; b) C. Tuerk, L. Gold Science 1990, 249, 505-510; c) D. L. Robertson, G. F. Joyce, Nature 1990, 344, 467-468. [0210] [2] a) D. S. Wilson, J. W. Szostak, Annu. Rev. Biochem. 1999, 68, 611-647; b) S. M. Shamah, J. M. Healy, S. T. Cload, Acc. Chem. Res. 2008, 41, 130-138; c) M. R. Gotrik, T. A. Feagin, A. T. Csordas, M. A. Nakamoto, H. Tom Soh, Acc. Chem. Res. 2016, 49, 1903-1910; d) H. Gu, K. Furukawa, Z. Weinberg, D. F. Berenson, R. R. Breaker, J. Am. Chem. Soc. 2013, 135, 9121-9129. [0211] [3] a) J. Liu, Z. Cao, Y. Lu, Chem. Rev. 2009, 109, 1948-1998; b) W. Tan, M. J. Donovan, J. Jiang, Chem. Rev. 2013, 113, 2842-2862; c) M. Famulok, J. S. Hartig, G. Mayer, Chem. Rev. 2007, 107, 3715-3743. [0212] [4] a) P. R. Bohjanen, R. A. Colvin, M. Puttaraju, M. D. Been, M. A. Garcia-Blanco, Nucleic Acids Res. 1996, 24, 3733-3738; b) D. A. Di Giusto, G. C. King, J. Biol. Chem. 2004, 279, 46483-46489; c) X. Tang, M. Su, L. Yu, C. Lv, J. Wang, Z. Li, Nucleic Acids Res. 2010, 38, 3848-3855; d) D. A. Di Giusto, S. M. Knox, Y. Lai, G. D. Tyrelle, M. T. Aung, G. C. King, ChemBioChem 2006, 7, 535-544; e) H. Kuai, Z. Zhao, L. Mo, H. Liu, X. Hu, T. Fu, X. Zhang, W. Tan, J. Am. Chem. Soc. 2017, 139, 9128-9131; f) H. Dong, L. Han, Z. Wu, T. Zhang, J. Xie, J. Ma, J. Wang, T. Li, Y. Gao, J. Shao, P. J. Sinko, L. Jia, Chem. Mater. 2017, 29, 10312-10325. [0213] [5] a) A. Fire, S. Q. Xu, Proc. Natl. Acad. Sci. USA 1995, 92, 4641-4645; b) D. Liu, S. L. Daubendiek, M. A. Zillman, K. Ryan, E. T. Kool, J. Am. Chem. Soc. 1996, 118, 1587-1594; c) W. Zhao, M. M. Ali, M. A. Brook, Y. Li, Angew. Chem. Int. Ed. 2008, 47, 6330-6337; Angew. Chem. 2008, 120, 6428-6436; d) M. Liu, W. Zhang, Q. Zhang, J. D. Brennan, Y. Li, Angew. Chem. Int. Ed. 2015, 54, 9637-9641; Angew. Chem.2015, 127, 9773-9777; e) M. Liu, Q. Zhang, Z. Li, J. Gu, J. D. Brennan, Y. Li, Nat. Commun. 2016, 7, 12704; f) M. Liu, C. Y. Hui, Q. Zhang, J. Gu, B. Kannan, S. Jahanshahi-Anbuhi, C. D. M. Filipe, J. D. Brennan, Y. Li, Angew. Chem. Int. Ed. 2016, 55, 2709-2713; Angew. Chem. 2016, 128, 2759-2763; g) M. Liu, Q. Zhang, D. Chang, J. Gu, J. D. Brennan, Y. Li, Angew. Chem. Int. Ed. 2017, 56, 6142-6146; Angew. Chem. 2017, 22, 6238-6242. [0214] [6] a) D. A. Di Giusto, W. A. Wlassoff, J. J. Gooding, B. A. Messerle, G. C. King, Nucleic Acids Res. 2005, 33, e64; b) L. Wang, K. Tram, M. M. Ali, B. J. Salena, J. Li, Y. Li, Chem. Eur. J. 2014, 20, 2420-2424. [0215] [7] a) B. Stoddart, M. H. Wilcox, Curr. Opin. Infect. Dis. 2002, 15, 513-518; b) N. Shetty, M. W. D. Wren, P. G. Coen, J. Hosp. Infect. 2011, 77, 1-6; c) S. D. Goldenberg, M. Gumban, A. Hall, A. Patel, G. L. French, Diagn. Microbiol. Infect. Dis. 2011, 70, 417-419. [0216] [8] a) T. D. Wilkins, D. M. Lyerly, J. Clin. Microbiol. 2003, 41, 531-534; b) L. Fenner, A. F. Widmer, G. Goy, S. Rudin, R. Frei, J. Clin. Microbiol. 2008, 46, 328-330; c) J. R. Ticehurst, D. Z. Aird, L. M. Dam, A. P. Borek, J. T. Hargrove, K. C. Carroll, J. Clin. Microbiol. 2006, 44, 1145-1149; d) F. C. Tenover, E. J. Baron, L. R. Peterson, D. H. Persing, J. Mol. Diagn 2011, 13, 573-582. [0217] [9] a) M. Liu, Q. Yin, J. D. Brennan, Y. Li, Biochimie 2018, 145, 151-157; b) C. Y. Hui, M. Liu, Y. Li, J. D. Brennan, Angew. Chem. Int. Ed. 2018, 57, 4549-4553; Angew. Chem. 2018, 130, 4639-4643. [0218] [10] Y. Li, C. R. Geyer, D. Sen, Biochemistry 1996, 35, 6911-6922. [0219] [11] B. M. Anderson, C. D. Anderson, R. L. Vantassell, D. M. Lyerly, T. D. Wilkins, Arch. Biochem. Biophys. 1993, 300, 483-488. [0220] [12] a) T. Planche, A. Aghaizu, R. Holliman, P. Riley, J. Poloniecki, A. Breathnach, S. Krishna, Lancet Infect. Dis. 2008, 8, 777-784; b) D. L. McCollum, J. M. Rodriguez, Clin. Gastroenterol. Hepatol.2012, 10, 581-592. [0221] [13] M. Kawada, M. Annaka, H. Kato, S. Shibasaki, K. Hikosaka, H. Mizuno,Y. Masuda, T. Inamatsu, J. Infect. Chemother. 2011, 17, 807-811. [0222] [14] M. Liu, Q. Zhang, Z. Li, J. Gu, J. D. Brennan, Y. Li, Nat. Commun. 2016, 7, 12074.