Antigen-specific helper T-cell receptor genes
10815288 ยท 2020-10-27
Assignee
Inventors
Cpc classification
C07K16/28
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C12Q1/6881
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
C12Q1/6881
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
Abstract
The present invention pertains to polynucleotides that encode CDR3 in TCR-[alpha] and TCR-[beta] chain genes of CD4.sup.+ helper T-cells that are specific to WT1 helper peptides having an amino acid sequence represented by SEQ ID NO: 123. The present invention further pertains to the peptides encoded by said polynucleotides. The present invention further pertains to CD4.sup.+ T cells into which TCR genes that contain said polynucleotides have been introduced, the induction of WT1-specific cytotoxic T-lymphocytes (CTLs) using the CD4.sup.+ T-cells, the treatment of cancer, etc.
Claims
1. A method for the treatment of a WT1-expressing cancer in a subject, comprising introducing a CD4.sup.+ helper T-cell into the subject, wherein the CD4.sup.+ helper T cell is obtained by introducing a TCR gene into a CD4.sup.+ T cell, wherein (i) the TCR gene comprises a pair of polynucleotides chosen from: (a) SEQ ID NO: 1 and SEQ ID NO: 2; (b) SEQ ID NO: 3 and SEQ ID NO: 4; (c) SEQ ID NO: 5 and SEQ ID NO: 6; (d) SEQ ID NO: 3 and SEQ ID NO: 7; (e) SEQ ID NO: 8 and SEQ ID NO: 9; (f) SEQ ID NO: 10 and SEQ ID NO: 12; (g) SEQ ID NO: 11 and SEQ ID NO: 12; (h) SEQ ID NO: 13 and SEQ ID NO: 15, (i) SEQ ID NO: 14 and SEQ ID NO: 15; (j) SEQ ID NO: 16 and SEQ ID NO: 17; (k) SEQ ID NO: 18 and SEQ ID NO: 19; (l) SEQ ID NO: 20 and SEQ ID NO: 21; (m) SEQ ID NO: 22 and SEQ ID NO: 24; (n) SEQ ID NO: 23 and SEQ ID NO: 24; (o) SEQ ID NO: 25 and SEQ ID NO: 26; (p) SEQ ID NO: 27 and SEQ ID NO: 4; (q) SEQ ID NO: 28 and SEQ ID NO: 29; (r) SEQ ID NO: 30 and SEQ ID NO: 32; (s) SEQ ID NO: 31 and SEQ ID NO: 32; (t) SEQ ID NO: 33 and SEQ ID NO: 34; (u) SEQ ID NO: 35 and SEQ ID NO: 36; (v) SEQ ID NO: 37 and SEQ ID NO: 38; (w) SEQ ID NO: 39 and SEQ ID NO: 40; (x) SEQ ID NO: 41 and SEQ ID NO: 42; (y) SEQ ID NO: 43 and SEQ ID NO: 44; (z) SEQ ID NO: 45 and SEQ ID NO: 46; (aa) SEQ ID NO: 47 and SEQ ID NO: 48; (bb) SEQ ID NO: 49 and SEQ ID NO: 50; (cc) SEQ ID NO: 51 and SEQ ID NO: 52; (dd) SEQ ID NO: 53 and SEQ ID NO: 54; (ee) SEQ ID NO: 55 and SEQ ID NO: 57; (ff) SEQ ID NO: 56 and SEQ ID NO: 57; and (gg) SEQ ID NO: 58 and SEQ ID NO: 59; or (ii) the TCR gene comprises a pair of polynucleotides that are complementary to or degenerate of any of the pairs of polynucleotides listed in (i).
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DESCRIPTION OF EMBODIMENTS
(21) The present invention is based on the determination of the polynucleotides encoding -chain containing CDR3 (hereinafter referred as CDR3 polynucleotide) and the polynucleotides encoding -chain containing CDR3 (hereinafter referred as CDR3 polynucleotide) of TCR of CD4.sup.+ helper T-cell clones specific to a WT1 helper peptide. Thus, in one aspect, the present invention provides CDR3 polynucleotides having nucleotide sequences shown in
(22) Preferably, from the viewpoint of expression of receptor function, an CDR3 polynucleotide and a CDR3 polynucleotide contained in each clone are contained in one TCR. That is, it is preferable that an CDR3 polynucleotide and a CDR3 polynucleotide corresponding to each clone form a pair as shown in
(23) A polynucleotide having a nucleotide sequence complementary to a CDR3 polynucleotide or a CDR3 polynucleotide is also included in a CDR3 polynucleotide or a CDR3 polynucleotide. In addition, a degenerate sequence of a CDR3 polynucleotide or a CDR3 polynucleotide is also included in a CDR3 polynucleotide or a CDR3 polynucleotide so long as it encodes the peptide shown in
(24) A polynucleotide having a nucleotide sequence identity of 70% or more, for example 75% or more, 80% or more, 85% or more, or 90% or more, for example 92% or more, 94% or more, 96% or more, or 98% or more, to that of a CDR3 polynucleotide, is also included in a CDR3 polynucleotide. A polynucleotide having a nucleotide sequence identity of 70% or more, for example 75% or more, 80% or more, 85% or more, or 90% or more, for example 92% or more, 94% or more, 96% or more, or 98% or more, to that of a CDR3 polynucleotide, is also included in a CDR3 polynucleotide.
(25) A polynucleotide having a nucleotide sequence hybridizing to a nucleotide sequence of a CDR3 polynucleotide under a stringent condition is also included in a CDR3 polynucleotide. A polynucleotide having a nucleotide sequence hybridizing to a nucleotide sequence of a CDR3 polynucleotide under a stringent condition is also included in a CDR3 polynucleotide.
(26) Examples of stringent hybridization conditions include a condition where hybridization is performed in a solution containing 5SSC, 7% (w/v) SDS, 100 kg/ml denatured salmon sperm DNA and 5Denhardt' solution at 48-52 C., and then washing is performed in 0.1SSC, 0.5SSC, 1SSC or 2SSC; or a condition where hybridization is performed in a solution containing 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide and 200 g/ml denatured salmon sperm DNA at 42 C., and then washing is performed in a solution containing 15 mM NaCl, 1.5 mM trisodium citrate and 0.1% SDS.
(27) In another aspect, the present invention provides peptides encoded by CDR3 polynucleotides and CDR3 polynucleotides (referred as CDR3 peptide and CDR3 peptide, respectively). These peptides have the amino acid sequences shown in
(28) In the present specification, an amino acid sequence of a peptide is expressed by conventional one-letter system or three-letter system.
(29) A peptide encoded by variants of a CDR3 polynucleotide or a CDR3 polynucleotide is also included in CDR3 peptide or CDR3 peptide. A peptide having an amino acid sequence identity of 70% or more, for example 75% or more, 80% or more, 85% or more, or 90% or more, for example 92% or more, or 94% or more, to that of a CDR3 peptide, is also included in a CDR3 peptide. A peptide having an amino acid sequence identity of 70% or more, for example 75% or more, 80% or more, 85% or more, or 90% or more, for example 92% or more, or 94% or more, to that of a CDR3 peptide, is also included in a CDR3 peptide. In addition, a peptide having an amino acid sequence of a CDR3 peptide in which one to several (for example, one, two, three, four or five) amino acids are substituted, deleted or added is also included in a CDR3 peptide; and a peptide having an amino acid sequence of a CDR3 peptide in which one to several (for example, one, two, three, four or five) amino acids are substituted, deleted or added is also included in a CDR3 peptide. It is noted that these variant peptides has similar properties to those of the original CDR3 peptides or CDR3 peptides.
(30) These polynucleotides and polypeptides can be prepared using chemical methods and/or biological methods well-known in the art.
(31) In the present invention, the WT1 helper peptide is a peptide having an amino acid sequence shown in SEQ ID NO: 123 (Lys Arg Tyr Phe Lys Leu Ser His Leu Gln Met His Ser Arg Lys His) or a variant amino acid sequence thereof (These peptides are referred as WT1.sub.332 peptide). WT1.sub.332 peptide may have a partial sequence or a variant sequence of WT1 polypeptide. A peptide consisting of an amino acid sequence shown in SEQ ID NO: 123 or a variant sequence thereof is an example of such a peptide.
(32) It is known that WT1.sub.332 peptide has an ability to bind to a HLA-DRB1*15:01 molecule, a HLA-DPB1*09:01 molecule, HLA-DPB1*05:01 molecule, HLA-DRB1*04:05 molecule or a HLA-DRB1*15:02 molecule.
(33) A variant sequence of the amino acid sequence shown in SEQ ID NO: 123 as above mentioned refers to an amino acid sequence shown in SEQ ID NO: 123 in which one to several (for example, one, two, three, four or five) amino acids are substituted, deleted or added. Or, a variant sequence of the amino acid sequence shown in SEQ ID NO: 123 as above mentioned refers to an amino acid sequence having an identity of 70% or more, for example 75% or more, 80% or more, 85% or more, or 90% or more, to the amino acid sequence shown in SEQ ID NO: 123. Preferably, a peptide having the amino acid sequence shown in SEQ ID NO: 123 or a variant sequence thereof has a length of 25 amino acids or less. A peptide having a variant sequence of the amino acid sequence shown in SEQ ID NO: 123 has similar properties to those of the peptide having the amino acid sequence shown in SEQ ID NO: 123.
(34) In a further aspect, the present invention relates to a TCR gene containing a CDR3 polynucleotide and a CDR3 polynucleotide belonging to any pair shown in
(35) In a further aspect, the present invention relates to a CD4.sup.+ helper T-cell (referred as TCR gene introduced CD4.sup.+ helper T-cell) obtained by introducing a TCR gene containing a CDR3 polynucleotide and a CDR3 polynucleotide belonging to any pair shown in
(36) A skilled person in the art can easily introduce a TCR gene containing a CDR3 polynucleotide and a CDR3 polynucleotide belonging to any one of pairs shown in
(37) Therefore, in a further aspect, the present invention provides a vector containing a TCR gene containing a CDR3 polynucleotide and a CDR3 polynucleotide belonging to any pair shown in
(38) Introduction of a TCR gene may be done by inserting a -chain gene containing a CDR3 polynucleotide and a 1-chain gene containing a CDR3 polynucleotide into individual vectors, and introducing these vectors into a CD4.sup.+ T-cell.
(39) Examples of CD4.sup.+ T-cells into which a TCR gene containing a CDR3 polynucleotide and a CDR3 polynucleotide is introduced include CD4.sup.+ T-cells derived from a HLA-DRB1*15:01-positive subject, a HLA-DPB1*09:01-positive subject, a HLA-DPB1*05:01-positive subject, a HLA-DRB1*04:05-positive subject or a HLA-DRB1*15:02-positive subject, but not limited to them. In addition, CD4.sup.+ T-cells may be derived from a subject having a cancer, may be derived from a subject having no cancer (a healthy subject), or may be derived from a donor for bone marrow transplantation.
(40) In further aspect, the present invention also relates to a WT1.sub.332-specific CD4.sup.+ helper T-cell comprising a TCR gene containing a CDR3 polynucleotide and a CDR3 polynucleotide belonging to any pair shown in
(41) Induction of a WT1-specific CTL can be enhanced using a TCR gene-introduced CD4.sup.+ helper T-cell. Particularly, induction of WT-specific CTL can be enhanced by co-culturing a TCR gene-introduced CD4.sup.+ helper T-cell and a peripheral mononuclear cell. Therefore, in further aspect, the present invention provides a method for enhancing the induction of a WT1-specific CTL, comprising co-culturing a TCR gene-introduced CD4.sup.+ helper T-cell and a peripheral mononuclear cell. In another aspect, the present invention relates to a WT1-specific CTL obtainable by said method.
(42) Methods and conditions for co-culturing a TCR gene-introduced CD4.sup.+ helper T-cell and a peripheral mononuclear cell are well known in the art. Such methods can be performed either in vivo or in vitro. One kind of a TCR gene-introduced CD4.sup.+ helper T-cell may be used for enhancing the induction of a WT1-specific CTL. However, preferably two or more kinds of TCR gene-introduced CD4.sup.+ helper T-cells are used.
(43) Examples of peripheral mononuclear cells used in the method for enhancing the induction of WT1-specific CTLs of the present invention include peripheral mononuclear cells derived from a HLA-DRB1*15:01-positive subject, a HLA-DPB1*09:01-positive subject, a HLA-DPB1*05:01-positive subject, a HLA-DRB1*04:05-positive subject or a HLA-DRB1*15:02-positive subject, but not limited to them. Preferably, the peripheral mononuclear cells and the CD4.sup.+ T-cells are those which have been obtained from a subject in which a cancer should be treated or prevented.
(44) In the co-cultivation, it is preferable that WT1.sub.332 peptide and/or other WT1 peptides co-exist. Examples of other WT1 peptides include those which have ability to bind to a HLA-DRB*15:01 molecule, a HLA-DPB1*09:01 molecule, a HLA-DPB1*05:01 molecule, a HLA-DRB1*04:05 molecule or a HLA-DRB1*15:02 molecule, but not limited to them.
(45) If necessary, the WT1-specific CTLs obtained by the method mentioned above may be further cultured to make the cell numbers increase, and then administrated to a subject, in order to treat or prevent a cancer in the subject. In such a treatment or prevention of a cancer, it is preferable to co-administrate WT1.sub.332 peptide and/or other WT1 peptides. By the action of the WT1-specific CTL, CTLs specific to other cancer antigens can also be induced.
(46) A TCR gene-introduced CD4.sup.+ helper T-cell can damage cancer cells expressing WT1. Therefore, in further aspect, the present invention is a method for the treatment or prevention of a cancer in a subject, comprising introducing a TCR gene-introduced CD4.sup.+ helper T-cell into the subject.
(47) In further aspect, the present invention provides a pharmaceutical composition comprising a TCR gene-introduced CD4.sup.+ helper T-cell for the treatment or prevention of a cancer, a use of a TCR gene-introduced CD4.sup.+ helper T-cell for the manufacture of a medicament for the treatment or prevention of a cancer, and a use of a TCR gene-introduced CD4.sup.+ helper T-cell for the treatment or prevention of a cancer.
(48) As used herein, treatment of a cancer refers not only to the treatment of a cancer such as the inhibition of progress of a cancer, the reduction of a cancer and the destruction of a cancer, but also to the prevention of recurrence of a cancer.
(49) Examples of subjects in which a cancer is treated or prevented include a HLA-DRB1*15:01-positive subject, a HLA-DPB1*09:01-positive subject, a HLA-DPB1*05:01-positive subject, a HLA-DRB1*04:05-positive subject or a HLA-DRB1*15:02-positive subject, but not limited to them. The above subject is not limited to a cancer patient, and may be a person not having a cancer (including a healthy person), or may be a donor for bone marrow transplantation.
(50) Embodiments of the method for the treatment or prevention, the pharmaceutical composition, and the use as mentioned above are described below. However, the embodiments are not limited to those. First, CD4.sup.+ T-cells are taken from a peripheral blood of a cancer patient who needs a treatment, and a TCR gene containing a CDR3 polynucleotide and a CDR3 polynucleotide is introduced into the CD4.sup.+ T-cells to obtain TCR gene-introduced CD4.sup.+ helper T-cells. The TCR gene-introduced CD4.sup.+ helper T-cells thus obtained are administered to the cancer patient. Before the administration, the TCR gene-introduced CD4.sup.+ helper T-cells can be cultured and proliferated under appropriate conditions to obtain a sufficient number of cells, and then they can be administered to the cancer patient.
(51) Either one kind of TCR gene-introduced CD4.sup.+ helper T-cell or two or more kinds of TCR gene-introduced CD4.sup.+ helper T-cells may be administered. From the viewpoint of improvement of treatment or prevention effect, it is preferable that two or more kinds of TCR gene-introduced CD4.sup.+ helper T-cells are administered to a subject.
(52) In case that TCR gene-introduced CD4.sup.+ helper T-cells are administered to a subject, a physician can appropriately decide conditions such as the number of cells to be administered, the frequency of the administration, the interval of the administration. For example, TCR gene-introduced CD4.sup.+ helper T-cells may be administered only once, or administered separately several times. Typically, in case of an adult subject, the number of the TCR gene-introduced CD4.sup.+ helper T-cells per dose is in a range between about 10.sup.9 and about 10.sup.11, but not limited these numbers.
(53) In the treatment or prevention method, the pharmaceutical composition and the use described above, it is preferable that WT1.sub.332 peptide and/or other WT1 peptides are co-administered. A physician can appropriately decide amount and frequency of administration of WT1.sub.332 peptide and/or other WT1 peptides. In addition, other anti-cancer therapies or preventions may be combined.
(54) The method for the treatment or prevention, the pharmaceutical composition, and the use described above can be applied to various kinds of cancers, but not limited to, for example, hematologic malignancies, such as acute myelocytic leukemia, acute lymphocytic leukemia, malignant lymphoma, multiple myeloma, chronic myelocytic leukemia, myelodysplastic syndrome, and recurrence after the hematopoietic stem cell transplantation of the same type; solid cancers, such as tongue cancer, gingival cancer, mouth floor cancer, pharyngeal cancer, larynx cancer, salivary gland cancer, and thyroid cancer; thoracic cancers, such as breast cancer, lung cancer, and thymic cancer; gastrointestinal cancers, such as colon cancer, small intestine cancer, gastric cancer, pancreatic cancer, liver cancer, bile duct cancer, gastrointestinal endocrine tumor, and gastrointestinal carcinoid; cancers of urinary and genital tract, such as renal cancer, urothelial cancer, germinoma, Wilms' tumor, prostate cancer, uterine body cancer, cervical cancer, uterine sarcoma, and ovarian malignancy; musculoskeletal malignancies, such as primary malignancy of bone (e.g., osteosarcoma and Ewing's sarcoma) and soft tissue sarcoma; and other cancers, such as skin cancer, neuroblastoma, malignant glioma (glioblastoma), primary malignant lymphoma of the central nervous system, medulloblastoma, and PNET.
(55) The CDR3 regions are the most diverse portions and are the most responsible parts for the specificity of antigen recognition. Thus, the sequences of the CDR3 polynucleotides, the CDR3 polynucleotides, the CDR3 peptides, and the CDR3 peptides of the present invention are considered peculiar to the CD4.sup.+ helper T-cells specific to WT1.sub.332 peptide. Therefore, in case that a polynucleotide encoding a CDR region of a -chain and a -chain, or a peptide corresponding to the CDR region have the sequence of the polynucleotide or the peptide of the present invention, the CD4.sup.+ helper T-cell is considered to be specific to WT1.sub.332 peptide.
(56) For example, (i) a DNA chip comprising one or more kinds of CDR3 polynucleotides, (ii) a DNA chip comprising one or more kinds of CDR3 polynucleotides, or (iii) a DNA chip comprising both one or more kinds of CDR3 polynucleotides and one or more kinds of CDR3 polynucleotides can be used to measure the frequency of CD4.sup.+ helper T-cells specific to WT1.sub.332 peptide in a sample. Particularly, a sample is prepared by lysing cells in a specimen obtained from a subject and extracting nucleic acids, and the sample is contacted with the DNA chip.
(57) For example, in case that a sample is contacted with the chip (i), and hybridization is found at any position, the same sample is contacted with the chip (ii) to confirm whether hybridization is found or not. Then, in case that any hybridization in the chip (i) and any hybridization in the chip (ii) occur with any CDR3 polynucleotide and any CDR3 polynucleotide which constitute any pair shown in
(58) A DNA chip may be in any form such as a microchip and a microarray. These chips can be prepared by a well-known method. For example, CDR3 polynucleotides and CDR3 polynucleotides can be immobilized on a glass substrate by a well-known method. It is preferable that a label which can indicate presence or absence of hybridization and amount of the hybridization is attached to DNAs in a sample or DNA sequences on a chip.
(59) Not only a DNA chip but also techniques such as southern blotting, northern blotting, colony hybridization can be used to measure frequency of CD4.sup.+ helper T-cells specific to WT1.sub.332 peptide in a sample.
(60) In addition, a CDR3 peptide and a CDR3 peptide can be used to obtain an antibody to a CD4.sup.+ helper T-cell specific to WT1.sub.332 peptide. A CD4.sup.+ helper T-cell specific to WT1.sub.332 peptide can be detected using such an antibody. A receptor of a CD4.sup.+ helper T-cell specific to WT1.sub.332 peptide can also be stimulated using such an antibody. Such stimulation can be done either in vivo or in vitro.
(61) A chip comprising CDR3 peptides, a chip comprising CDR3 peptides, or a chip comprising both CDR3 peptides and CDR3 peptides can also be used to detect an antibody to a CD4.sup.+ helper T-cell specific to WT1.sub.332 peptide.
(62) A chip comprising these peptides can be prepared using a well-known method. It is preferable to add a label which can determine presence or absence of a specific binding to peptides in a sample or peptides on a chip.
(63) A chip comprising antibodies to CDR3 peptides and/or CDR3 peptides can also be used to determine kind and amount of CDR3 peptides and/or CDR3 peptides in a sample, or to determine kind and amount of CD4.sup.+ helper T-cells specific to WT1.sub.332 peptide in a sample.
(64) A chip to which these antibodies are immobilized can be prepared using a well-known method. It is preferable to add a label which can determine presence or absence of a specific binding to peptides in a sample or antibodies on a chip.
DESCRIPTION OF SEQUENCES
(65) SEQ ID NOs: 1 to 59 are nucleotide sequences encoding CDR3 contained in TCR of CD4.sup.+ helper T-cell clones.
(66) SEQ ID NOs: 60 to 118 are amino acid sequences of CDR3 contained in TCR of CD4.sup.+ helper T-cell clones.
(67) SEQ ID NO: 119 is a reverse primer for amplifying TCR chain.
(68) SEQ ID NO: 120 is a reverse primer for amplifying TCR chain.
(69) SEQ ID NO: 121 is a reverse primer for amplifying TCR chain.
(70) SEQ ID NO: 122 is a primer for determining CDR3 nucleotide sequences.
(71) SEQ ID NO: 123 is an amino acid sequence of WT1.sub.332 peptide.
(72) SEQ ID NO: 124 is an amino acid sequence of HIV peptide.
(73) SEQ ID NO: 125 is an amino acid sequence of a variant of a naturally occurring WT1 peptide.
(74) The present invention is described more particularly and more concretely by showing examples below. However, it should not be construed that examples limit the scope of the present invention.
Example 1
Example 1 Establishment of WT1.SUB.332.-Specific CD4.SUP.+ T-Cell Clones and Isolation and Sequencing of T-Cell Receptor (TCR) Genes
(75) The experimental procedures were as follows.
(76) (1) Method of Establishing WT1.sub.332-Specific CD4.sup.+ T-Cell Clones
(77) (i) Peripheral blood mononuclear cells (PBMCs) derived from a healthy subject are harvested and seeded into 24-well plates at 3106 cells/well. X-VIVO 15 medium supplemented with 10% AB serum and 40 IU/ml IL-2 is used as a medium.
(78) (ii) WT1.sub.332 peptide is added to the above i at a final concentration of 20 g/ml and the cells are cultured for 7 days.
(79) (iii) After 7 days, the cells are collected and prepared with X-VIVO 15 medium supplemented with 10% AB serum so that the cell density is 1107 cells/ml, and then, seeded by 100 L each into 96 well, round bottom plates.
(80) (iv) WT1.sub.332 peptide, BD GolgiStop (BD Bioscience) and CD28/CD49d Costimulatory Reagent (BD Bioscience) are added to X-VIVO 15 medium supplemented with 10% AB serum at final concentrations of 40 g/ml, 4 g/ml, and 4 g/ml, respectively.
(81) (v) The above iv is added by 100 L each to the above iii.
(82) (vi) Anti-human CD154-APC-labeled antibody (BD Bioscience) is added by 10 l each to the above v and the plates are incubated in 5% CO.sub.2 incubator for 6 hours at 37 C.
(83) (vii) After incubation, the cells are collected and stained with anti-human CD4-APC-H7-labeled antibody (BD Bioscience) and anti-human CD3-Pacific Blue-labeled antibody (BD Bioscience) as well as 7-AAD (eBioscience) for removing dead cells.
(84) (viii) PBMCs are harvested from 3 healthy subjects, mixed, irradiated with 30 Gy of -ray, and prepared with X-VIVO 15 medium supplemented with 10% AB serum at a final concentration of 10%, IL-2 at a final concentration of 100 IU/ml, and PHA at a final concentration of 3 g/ml so that the cell density is 1106 cells/ml. These prepared cells are seeded by 100 L each into 96 well, round bottom plates.
(85) (ix) 7-ADD-CD3.sup.+CD4.sup.+CD154.sup.+ cell fraction, i.e., a fraction containing WT1.sub.332-specific CD4.sup.+ T-cells is single-cell sorted into each well of the above viii using FACSAria cell sorter.
(86) (x) After culture for 10-14 days, the proliferated cells in each well are used as independent CD4.sup.+ T-cell clones.
(87) (2) Screening of WT1.sub.332-Specific CD4.sup.+ T-Cell Clones
(88) (i) Each CD4.sup.+ T-cell clone of the above (1)-x is prepared with X-VIVO 15 medium supplemented with 1% AB serum so that the cell density is 3105 cells/ml.
(89) (ii) Autologous PBMCs pulsed with WT1.sub.332 or not pulsed with any peptides are irradiated with 30 Gy of -ray and prepared with X-VIVO 15 medium supplemented with 1% AB serum so that the cell density is 1106 cells/mi.
(90) (iii) The above (2)-i and ii are seeded by 100 L each into 96 well, round bottom plates.
(91) (iv) After culture for 2 days, 3H-thymidine is added to each well at 1 Ci/well.
(92) (v) After 18 hours, the 3H-thymidine incorporated into each CD4.sup.+ T-cell clone is measured and the CD4.sup.+ T-cell clones showing WT1.sub.332-specific proliferative response are selected. These selected clones are used as WT1.sub.332-specific CD4.sup.+ T-cell clones.
(93) (vi) The culture of the WT1.sub.332-specific CD4.sup.+ T-cell clones is performed with stimulation of the WT1.sub.332-specific CD4.sup.+ T-cell clones by co-culturing with PBMCs that were prepared by irradiating autologous PBMCs pulsed with WT1.sub.332 at a frequency of once per 1-2 weeks or so with 30 Gy of -ray.
(94) (3) Isolation of TCR genes using 5-RACE (Rapid Amplification of cDNA End) method
(95) (i) WT1.sub.332-specific CD4.sup.+ T-cell clones are cultured for 10 days or more from the last stimulation. This is to prevent contamination with T-cells contained in autologous PBMCs that are used for the stimulation.
(96) (ii) The WT1.sub.332-specific CD4.sup.+ T-cell clones are pelleted, TRIzol reagent (Invitrogen) is added thereto, and RNA is extracted according to its manual.
(97) (iii) cDNAs are synthesized from the RNA extracted in the above (3)-ii using SMARTer RACE cDNA Amplification Kit (Clontech).
(98) (iv) TCR -chain and -chain genes are amplified by using the cDNAs synthesized in the above (3)-iii as templates. In regard to used primers, UPM primer included in MARTer RACE cDNA Amplification Kit was used as a forward primer and the following TCR-specific primers were used as reverse primers:
(99) C3UTR-primer: 5-CAC AGG CTG TCT TAC AAT CTT GCA GAT C-3 (SEQ ID No: 119)
(100) C1-3UTR-primer: 5-CTC CAC TTC CAG GGC TGC CTT CA-3 (SEQ ID No: 120)
(101) C2-3UTR-primer: 5-TGA CCT GGG ATG GTT TTG GAG CTA-3 (SEQ ID No: 121).
(102) (v) The amplification of the TCR genes was performed using KOD FX available from ToYoBo under conditions of 94 C., 3 min.fwdarw.(98 C., 10 sec.fwdarw.68 C., 1 min)35 cycles.
(103) (vi) The size of PCR products are confirmed using agarose gel electrophoresis and bands of near 1 kbp are cut from gel and purified.
(104) (vii) After adenines are added to the PCR products purified in the above (3)-vi using Taq polymerase, the resultants are ligated into pCR 2.1 vectors.
(105) (viii) HST02 competent cells are transformed with the above (3)-vii, plasmids are purified from single colonies, and then, sequenced.
(106) (ix) The sequence analysis is performed using the International Immunogenetics Information System (www.imgt.org/IMGT_vquest/vquest?livret=0&Option=humanTcR) and each TCR gene is identified.
(107) With regard to the above (3) isolation of TCR genes using 5-RACE (Rapid Amplification of cDNA End) method, the detailed experimental procedure is shown below.
(108) (3-1) RNA Extraction
(109) RNA extraction from T-cell clones was performed using TRIzol Reagent (Invitrogen). As for T-cell clones used, the clones cultured without antigen-stimulation in the presence of IL-2 over 3 weeks were prepared for the purpose of preventing contamination with feeder cells.
(110) (3-2) Cloning of full-length TCR (T-cell receptor) cDNA using 5-RACE (Rapid Amplification of cDNA Ends) method
(111) For cloning of TCR /, SMARTer RACE cDNA Amplification Kit (Clontech) was used. Firstly, 5-RACE reaction was performed according to its manual, and thereby 1st strand cDNA was synthesized. Then, in order to obtain full-length TCR -chain and -chain cDNAs, PCR reaction was performed by using reverse primers specific to each of 3UTRs (Untlansrated Regions) and universal primer (UPM) which is included in the kit and using the synthesized 1st strand cDNA as a template. The used primers are as follows.
(112) C 3UTR-RACE-primer: CACAGGCTGTCTTACAATCTTGCAGATC (SEQ ID No:119)
(113) C1 3UTR-RACE-primer: CTCCACTTCCAGGGCTGCCTTCA (SEQ ID No:120)
(114) C2 3UTR-RACE-primer: TGACCTGGGATGGTTTTGGAGCTA (SEQ ID No:121)
(115) Further, PCR reaction was performed in the following reaction solution composition using KOD FX (TOYOBO).
(116) TABLE-US-00002 TABLE 1 2x PCR buffer for KOD FX 12.5 l 2 mM dNTPs 5.0 l 10x UPM 2.5 l 10 M reverse primer 1.0 l Template DNA 1.0 l KOD FX (1.0 U/l) 0.5 l distilled water up to 25 l Volume of the reaction solution 25 l PCR cycle is as follows: 94 C., 2 min .fwdarw. (98 C., 10 sec .fwdarw. 68 C., 1 min) 35 cycles .fwdarw. 15 C., hold
(117) After the PCR reaction, 1.0% agarose gel electrophoresis was performed, single bands of near 900-1000 bp were cut, and the PCR products were purified with 50 l of distilled water using QIAquick Gel Extraction Kit (QIAGEN). It is necessary to add adenine to both ends of the PCR products for TA-cloning. The addition of adenine was performed using Platinum Taq DNA polymerase (invitrogen) as follows.
(118) (1) 2 reaction solution shown in the table below is prepared.
(119) TABLE-US-00003 TABLE 2 10x PCR buffer 10 l 2 mM dNTPs 10 l 25 mM MgCl2 8.0 l Platinum Taq polymerase 1.0 l 21 l of distilled water is added so that a total volume is 50 l.
(120) (2) 2 reaction solution is incubated at 95 C. for 5 minutes.
(121) (3) The purified PCR products are added thereto.
(122) (4) The resultants are incubated at 72 C. for 10 minutes.
(123) PCR products added with adenines were purified and concentrated by ethanol precipitation, and then, inserted into pCR 2.1 vectors (invitrogen) using DNA Ligation Kit, Mighty Mix>(TaKaRa). pCR 2.1 vectors comprising the PCR products were introduced into HST02 competent cells by transformation and cloned.
(124) (3-3) Purification of Plasmids Comprising Full-Length TCR -Chain and -Chain cDNAs
(125) The transformed HST02 competent cells were plated on ampicillin/LB plates and incubated at 37 C. Then, single colonies were picked into ampicillin/LB liquid medium, and incubated 37 C. while being stirred at 200 rpm. Then, plasmids were purified from the Escherichia coli solution using AUTOMATIC DNA ISOLATION SYSTEM PI-50 (KURABO).
(126) (3-4) Determination of CDR3 Sequence of TCR by Sequencing
(127) For sequencing of the purified plasmids, BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) was used. In addition, M13 reverse primer: caggaaacagctatgac (SEQ ID No: 122) was used. For analysis of TCR and CD3, IMGT/V-QUEST (www.imgt.org/IMGT_vquest/share/textes/) was utilized.
(128) The determined nucleotide and amino acid sequences of CDR3 are shown in
Example 2
Example 2 Introduction of T-Cell Receptor (TCR) Genes Derived from a WT1.SUB.332.-Specific CD4.SUP.+ T-Cell to Human CD4.SUP.+ T-Cells
(129) It was confirmed that human CD4.sup.+ T-cell transduced with T-cell receptor (TCR) genes derived from a WT1.sub.332-specific CD4.sup.+ T-cell showed proliferative response and production of cytokines in a WT1.sub.332-specific and HLA class II-restricted manner.
(130) TCR genes shown in Table 3 were isolated from clone 9 which is the CD4.sup.+ T-cell clone which specifically recognizes WT1.sub.332 in an HLA-DPB1*05:01-restricted manner. These TCR genes were transduced into CD4.sup.+ T-cells derived from peripheral blood of healthy subjects by using lentivirus vectors, and the response to WT1.sub.332 was examined by using the productions of cytokines (interferon- and IL-2) as indicators (
(131) The effect of the concentration of WT1.sub.332 peptide on the expression of cytokine by WT1.sub.332-TCR-transduced CD4.sup.+ T-cells was examined. WT1.sub.332-TCR-transduced CD4.sup.+ T-cells were stimulated with various concentrations of WT1.sub.332 peptide for 4 hours, and intracellular cytokine staining assay was performed to examine the ratio of TNF--producing CD4.sup.+ T-cells to CD4.sup.+ T-cells. The results are shown in
(132) The production of the cytokine was WT1.sub.332 peptide concentration-dependent and ED50 was 4.85 M.
(133) When a proliferation potency of the WT1.sub.332-TCR-transduced CD4.sup.+ T-cells was examined, a WT1.sub.332-specific, strong proliferation potency was found and the proliferative response was markedly inhibited by anti-HLA-DP antibody (
(134) Next, the proliferative response and IFN- production of the WT1.sub.332-TCR-transduced CD4.sup.+ T-cells to autologous PBMCs pulsed with WT1.sub.332 peptide, autologous PBMCs pulsed with full-length WT1 protein, autologous PBMCs pulsed with truncated WT1 protein (not comprising WT1.sub.332 sequence), PBMCs pulsed with the lysate of PHA-blast, PBMCs pulsed with the lysate of leukemia cell line TF-1 expressing WT1, and PBMCs pulsed with the lysate of leukemia cell line K562 expressing WT1 were examined. The cell proliferation was measured by [3H]-thymidine incorporation, and IFN- was measured by ELISA. The results are shown in
(135) Further, the production of various cytokines that responded to WT1.sub.332 peptides of WT1.sub.332-TCR-transduced CD4.sup.+ T-cell lines prepared similarly to those of Example 2, that were derived from 3 healthy (HLA-DPB1*05:01 positive) donors (i.e., three kinds of cell lines), was also examined. The mean values of the cytokine-producing abilities of the three kinds of cell lines are shown in
(136) TABLE-US-00004 TABLE3 TCRgenesisolatedformclone9 Vgene Jsegment Dgene CDR3sequence Va TRAV13- TRAJ53*01 CAENSGGSNYKLTF 8.2 2*01 (SEQIDNo:73) Vb TRAB6- TRBJ1- TRBD01*01 CASTAGASDQPQHF 13.3 1*01 5*01 (SEQIDNo:74)
Example 3
Example 3 Enhanced Induction of WT1-Specific CTLs by Human CD4.SUP.+ T-Cells Transduced with TCR Genes Derived from WT1.SUB.332.-Specific CD4.SUP.+ T-Cells
(137) Generally, it is known that CD4.sup.+ T-cell serves as helper T-cell and is important for introduction and maintenance of CD8.sup.+ T-cells (CTLs) that are the primary effector cells that attack cancer cells. Thus, it was examined whether WT1.sub.332-TCR-transduced CD4.sup.+ T-cells enhanced the induction of WT1-specific CTLs.
(138) PBMCs of HLA-A*24:02 and HLA-DPB1*05:01-positive healthy subjects were mixed with WT1.sub.332-TCR-transduced CD4.sup.+ T-cells prepared from the same healthy subjects at the ratio of 10:1 and 5:1 (indicated as 1:0.1 and 1:0.2 in
Example 4
Example 4 HLA-DPB1*05:01-Restricted Damage of WT1-Expressing Leukemia Cells by Human CD4.SUP.+ T-Cells Transduced with TCR Genes Derived from WT1.SUB.332.-Specific CD4.SUP.+ T-Cells
(139) Next, the cytotoxic activity, i.e., killing activity, of WT1.sub.332-TCR-transduced CD4.sup.+ T-cells was evaluated.
(140) Firstly, HLA-DPB1*05:01 gene was isolated and transfected into leukemia cell line TF-1 expressing WT1 to prepare HLA-DPB1*05:01-positive TF-1 cells. As shown in
(141) Next, it was examined whether WT1.sub.332-TCR-transduced CD4.sup.+ T-cells exerted the cytotoxic activity via the granzyme B and perforin pathway. High expressions of granzyme B and perforin were found in the WT1.sub.332-TCR-transduced CD4.sup.+ T-cells (
(142) WT1.sub.332-TCR-transduced CD4.sup.+ T-cells and CD4.sup.+ T-cells similarly treated with mock-vector (mock-transduced CD4.sup.+ T-cells) were cultured with HLA-DPB1*05:01-positive TF-1 cells pulsed with WT1.sub.332 peptide or HLA-DPB1*05:01-positive TF-1 cells not pulsed with WT1.sub.332 peptide for 5 hours in the presence of anti-CD107a-APC-monoclonal antibody. Then, IFN--staining was performed and the resultants were subjected to Flow cytometry. The co-expression of IFN- and CD107a was found in the WT1.sub.332-TCR-transduced CD4.sup.+ T-cells only when the WT1.sub.332-TCR-transduced CD4.sup.+ T-cells were incubated with HLA-DPB1*05:01-positive TF-1 cells pulsed with WT1.sub.332 peptide (
(143) To confirm whether the cytotoxic activity of the WT1.sub.332-TCR-transduced CD4.sup.+ T-cells was dependent on the granzyme B/perforin pathway, HLA-DPB1*05:01-positive TF-1 cells pretreated with 100 M of a granzyme-inhibitor, Ac-IETD-Cho, were used as target cells. The HLA-DPB1*05:01-positive TF-1 cells were pretreated with 100 M of Ac-IETD-Cho or DMSO (control) for 2 hours, then labeled with .sup.51Cr, and incubated with WT1.sub.332-TCR-transduced CD4.sup.+ T-cells, and .sup.51Cr releasing assay was performed. The cytotoxic activity of the WT1.sub.332-TCR-transduced CD4.sup.+ T-cells on HLA-DPB1*05:01-positive TF-1 cells pretreated with Ac-IETD-Cho was markedly lower compared with the cytotoxic activity on TF-1 cells pretreated with DMSO (
(144) Considering these results together, it was confirmed that the WT1.sub.332-TCR-transduced CD4.sup.+ T-cells obtained by the present invention directly recognized HLA-DPB1*05:01-positive leukemia cells expressing WT1 and damaged them via granzyme B/perforin pathway.
Example 5
Example 5 Anti-Tumor Effect in NOG Mouse by Human CD4.SUP.+ T-Cells Transduced with TCR Genes Derived from WT1.SUB.332.-Specific CD4.SUP.+ T-Cells
(145) WT1-expressing HLA-DPB1*05:01-positive human leukemia cells C2F8 (5104 cells) were transferred to NOG mice (7 mice) via tail vein. Next day, as an experimental group, human CD4.sup.+ T-cells transduced with HLA-DPB1*05:01-restricted WT1.sub.332-specific TCR genes (SEQ ID Nos: 14 and 15) (5106 cells) and T-cell-depleted human peripheral blood mononuclear cells (2106 cells) from the same subject as antigen-presenting cells were transferred to the above NOG mice (3 mice). As a control, human CD4.sup.+ T-cells transduced with the control vector (5106 cells) and T-cell-depleted human peripheral blood mononuclear cells (2106 cells) from the same subject as antigen-presenting cells were transferred to the above NOG mice (4 mice).
(146) After 1 and 2 weeks, human CD4.sup.+ T-cells transduced with HLA-DPB1*05:01-restricted WT1.sub.332-specific TCR genes (5106 cells) were transferred to the mice of the experimental group via tail vein. Human CD4.sup.+ T-cells transduced with control vector (5106 cells) were transferred to the control mice via tail vein. Then, the survival of mice was examined.
(147) The results are shown in
INDUSTRIAL APPLICABILITY
(148) The present invention can be used in the fields of pharmaceuticals for treating or preventing cancer, of reagents for cancer research, and of cancer test kits or reagents, and the like.