STIMULATION OF THE NITRIFICATION OF A SOIL WITH COMPOUNDS COMPRISING A PLANT EXTRACT
20200331819 ยท 2020-10-22
Inventors
Cpc classification
Y02A40/20
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C05D3/02
CHEMISTRY; METALLURGY
C05F11/08
CHEMISTRY; METALLURGY
C05F5/004
CHEMISTRY; METALLURGY
C05F11/08
CHEMISTRY; METALLURGY
C05F11/02
CHEMISTRY; METALLURGY
C05F5/004
CHEMISTRY; METALLURGY
C05D3/02
CHEMISTRY; METALLURGY
C05F11/10
CHEMISTRY; METALLURGY
International classification
C05F11/02
CHEMISTRY; METALLURGY
C05D3/02
CHEMISTRY; METALLURGY
Abstract
The invention relates to the use of an amendment composition comprising an extract of Cynara leaves for stimulating the nitrification of a soil, a process for stimulating the nitrification of a soil with an amendment composition comprising an extract of Cynara leaves and an amendment composition comprising an extract of Cynara leaves and one or more compound(s) selected from (i) a basic calcium amendment, (ii) a yeast extract, and (iii) an extract of a legume of the family Fabaceae.
Claims
1. A method for stimulating the nitrification of a soil, comprising application to said soil of an amendment composition comprising an extract of Cynara leaves.
2. The method as claimed in claim 1, wherein the composition further comprises one or more compound(s) selected from: a basic calcium amendment, a yeast extract, and a legume extract from the family Fabaceae.
3. The method as claimed in claim 1, wherein the composition further comprises one or more fertilizer substance(s) selected from urea, ammonium sulfate, ammonium nitrate, phosphate, potassium chloride, ammonium sulfate, magnesium nitrate, manganese nitrate, zinc nitrate, copper nitrate, phosphoric acid, potassium nitrate and boric acid.
4. The method as claimed in claim 1, wherein Cynara is Cynara scolymus.
5. The method as claimed in claim 2, wherein the yeast extract is a yeast hydrolysate, preferably a yeast hydrolysate with CAS No. 8013-01-2.
6. The method as claimed in claim 2, wherein the extract of a legume of the family Fabaceae is a soybean extract, preferably a soybean permeate.
7. The method as claimed in claim 1, wherein the soil is acidic soil.
8. The method as claimed in claim 1, wherein the extract of Cynara leaves is applied to the soil in an amount ranging from 1 kg/ha to 50 kg/ha (kilograms/hectare), preferably from 2 kg/ha to 10 kg/ha, preferably from 4 to 5 kg/ha.
9. A process for stimulating the nitrification of a soil, characterized in that it comprises supplying to said soil an amendment composition comprising an extract of Cynara leaves.
10. The process as claimed in claim 9, wherein the composition further comprises one or more compound(s) selected from: a basic calcium amendment, a yeast extract, and a legume extract from the family Fabaceae.
11. The process as claimed in claim 9, wherein the composition further comprises one or more fertilizer substance(s) selected from urea, ammonium sulfate, ammonium nitrate, phosphate, potassium chloride, ammonium sulfate, magnesium nitrate, manganese nitrate, zinc nitrate, copper nitrate, phosphoric acid, potassium nitrate and boric acid.
12. The process as claimed in claim 9, wherein Cynara is Cynara scolymus.
13. The process as claimed in claim 10, wherein the yeast extract is a yeast hydrolysate, preferably with CAS No. 8013-01-2.
14. The process as claimed in claim 10, wherein the extract of a legume of the family Fabaceae is a soybean extract, preferably a soybean permeate.
15. The process as claimed in claim 9, wherein the soil is an acidic soil.
16. The process as claimed in claim 9, wherein the extract of Cynara leaves is applied to the soil in an amount ranging from 1 kg/ha to 50 kg/ha (kilograms/hectare), preferably from 2 kg/ha to 10 kg/ha, preferably from 4 to 5 kg/ha.
17. An amendment composition comprising an extract of Cynara leaves and one or more compound(s) selected from: a basic calcium amendment, a yeast extract, and a legume extract from the family Fabaceae.
Description
LEGEND FOR THE FIGURES
[0114]
[0115]
[0116]
EXAMPLES
Example 1: Preparation of an Extract of Cynara scolymus (Artichoke) Leaves
Equipment Used
[0117] The following equipment was used: [0118] 10 L KGW jacketed glass reactor [0119] Lenz 400 mm NS29/32 glass cooling column [0120] Huber Unichiller 012W recirculating cooler [0121] PTFE stirring paddle [0122] IKA RW20 stirring motor [0123] Julabo MA immersion thermostat [0124] Bchner funnel [0125] Velp Scientifica JPV recirculating water vacuum pump [0126] Fischer 200 m nylon filter cloth [0127] Beckman Coulter Avanti J-26 XP centrifuge [0128] Beckman Coulter J-Lite PP-1000 bottles
For Extraction
[0129] The 10 L jacketed glass reactor (KGW) was equipped with an immersion thermostat (Julabo MA) to adjust the temperature of the extraction medium. The reactor was surmounted by a glass column (Lenz 400 mm NS29/32) connected to a circulation cooler (Huber Unichiller 012W). The extraction medium was stirred by a PTFE stirring paddle driven by a stirring motor (IKA RW20).
For Filtration
[0130] Bchner filtration of the extract was carried out using a recirculating water vacuum pump (yelp Scientifica JPV). The filter used was cut to the dimensions of the Bchner funnel in a 200 m nylon filter cloth (Fischer).
For Centrifugation
[0131] An Avanti J-26 XP centrifuge and J-Lite PP-1000 bottles (Beckman Coulter) were used.
Protocols
[0132] Preparation of an Extract of Cynara scolymus (Extract A)
[0133] 4000 g of water was introduced into a 10 L glass beaker. The water was heated to 40 C. with gentle stirring. 1000 g of artichoke leaf powder titrated in cynarin (Tortay langeais 37130-France) were added to the water under stirring. When the artichoke leaf powder was dispersed in water, the pH was around 5-6. The pH was adjusted to 7 with a 30% w/w sodium hydroxide solution (Quaron). The mixture thus obtained was maintained under stirring for 3 h at 40 C. on a VWR VMS-A IP21 magnetic hot plate stirrer. The mixture was Bchner filtered on a 200 m nylon filter by applying a partial vacuum with a Waston Marlow pump. The liquid fraction was recovered (filtrate) and was centrifuged at 7000 rpm at 15 C. for 20 min in a Beckman Coulter centrifuge.
[0134] The extract obtained (Extract A) after filtration was stored at 80 C. in a Liebherr Scientific ultra-low temperature vertical laboratory freezer until use.
Measurement of the Amount of Cynarin in a Cynara Extract (Cynarin Titration) by HPLC-UV: Example of Extract A
[0135] Extract A (70 L) was mixed with 30 L of Tris/HCL (pH 8.75; 2 M) and 20 mg of alumina and stirred for 5 min with a magnetic stirring rod and centrifuged (10 000 g, 5 min) in a Beckman Coulter centrifuge. The precipitate containing insoluble cynarin was washed once with Milli-Q ultrapure water (1 mL).
[0136] Cynarin, soluble in acid medium, was resolubilized with 70 L phosphoric acid (0.4 M) and then the mixture was centrifuged (10 000 g, 5 min) with a Beckman Coulter centrifuge. The cynarin remained in the supernatant.
[0137] Aliquots of 20 L of the supernatant were injected into a Varian 9012 chromatographic apparatus comprising a 20 L injection valve (Rheodyne USA) and a Varian 9050 ultraviolet detector and set at 316 nm. An Ib-SiI ODS reversed-phase column (250 mm4.6 mm5 m) (Phenomenex USA) was used. The chromatographic protocol was performed at room temperature (18-25 C.).
[0138] The column was eluted with a water/methanol/acetic acid mixture (78.5:20:2.5, v/v/v). The mobile phase was injected at a flow rate of 1.3 mL/min. The results obtained were compared with a calibration line obtained with cynarin standard solutions. The cynarin standard solutions were obtained from a stock solution of 0.1 mg/mL cynarin prepared in a methanol/water mixture (1:1, v/v). The cynarin standard solutions that provided the calibration line were obtained by diluting the stock solution in the same methanol-water mixture (1:1, v/v).
Characterization of Extract A by HPLC-UV
[0139] Extract A consisted mainly of cynarin and other polyphenols derived from chlorogenic acid in the following proportions: [0140] Cynarin: 41.7 mg/100 g of dry extract [0141] Other polyphenols derived from chlorogenic acid: 2291.3 mg/100 g of dry extract [0142] Total polyphenols derived from chlorogenic acid: 2333.0 mg/100 g of dry extract
Example 2: Measuring the Stimulation of Soil Nitrification by Measuring the Increase in Soil Nitrate Content
[0143] Soil Preparation
[0144] 10 g of dry soil (Table 1) sieved with a sieve with a mesh diameter of 2 mm, was placed in 60 mL glass flasks to which 1 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 1 h incubation, the treatments were applied.
TABLE-US-00001 TABLE 1 Main soil characteristics Texture Silty clay pH 8.2 Organic matter 5 (% by mass) Cation exchange 19.2 capacity (meq/100 g)
[0145] Soil Treated with an Extract of Cynara scolymus Leaves (+EVF)
[0146] 10 g of dry soil sieved with a sieve with a mesh diameter of 2 mm was placed in 60 mL glass bottles to which 1 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 1 h incubation, 30 kg/ha of nitrogen in the form of ammonium sulfate was added. The Cynara scolymus leaf extract (EVF) was applied at a rate corresponding to a treatment of 1 kg/ha. The bottles were then sealed and incubated at 10 C. for up to 20 days. During this period, nitrification kinetics associated with the appearance of nitrate in soil were established by nitrate determinations at 2, 6, 15 and 20 days.
[0147] Untreated Soil (EVF)
[0148] 10 g of dry soil sieved with a sieve with a mesh diameter of 2 mm was placed in 60 mL glass bottles to which 1 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 1 h incubation, 30 kg/ha of nitrogen in the form of ammonium sulfate was added. The vials were then sealed and incubated at 10 C. for up to 20 days. During this period, nitrification kinetics associated with the appearance of nitrate in soil were established by performing nitrate determinations at 2, 6, 15 and 20 days.
[0149] Extraction of Nitrates from the Soil
[0150] The extraction was done by adding 30 mL of pure water to the vial containing the 10 g of soil and then shaking with a rotary shaker for one hour. The vials were allowed to settle for 10 min. The supernatant was recovered and centrifuged at 11 000 rpm (rotations per minute) for 5 min at 4 C. and then filtered through a 0.25 m filter to remove all particles.
[0151] Determination of Soil Nitrates
[0152] The nitrate content was determined by high-performance ion chromatography (HPIC, ICS 5000+). 25 L of filtered extract was injected through an autosampler. The samples were eluted using a methane sulfonic acid solution (MSA; 20 mM) delivered by an isocratic pump system. The cations in the sample were detected, after separation, by a conductivity detector. Nitrate was quantified by calibrating the system with standard solutions. For each of the incubation conditions (+EVF and EVF), four batches of soil were made up (1 batch=1 biological replicate).
[0153] All the treatments were carried out systematically for each of the biological repetitions, i.e. in quadruple batches. The data obtained were presented as a mean and the variability of the results was given as the standard error of the mean for n=4. A statistical analysis of the results was performed using Student's test.
[0154] The determination of nitrate content is shown in
[0155] Conclusion: Soils treated with the extract of Cynara scolymus leaves (+EVF) showed a significant increase in soil nitrate content: +15% (after 2 days incubation), +17% (after 6 days incubation), +10% (after 15 days incubation) and +13% (after 20 days incubation).
Example 3: Measuring the Stimulation of Soil Nitrification by Measuring the Decrease of Soil pH
[0156] Soil Preparation
[0157] 80 g of dry soil (Table 1) sieved with a sieve with a mesh diameter of 2 mm, was placed in 90 cm.sup.3 (5.444.2 cm) Plexiglas tanks, an optode was glued to one of the transparent sides of the Plexiglas tanks to which 15 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 24 h incubation, the treatments were applied.
[0158] Soil Treated with a Cynara scolymus Leaf Extract (+EVF)
[0159] 80 g of dry soil (Table 1) sieved with a sieve with a mesh diameter of 2 mm, was placed in 90 cm.sup.3 (5.444.2 cm) Plexiglas tanks, an optode was glued to one of the transparent sides of the Plexiglas tanks to which 15 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 24 h incubation, the treatments were applied.
[0160] 80 kg/ha of nitrogen in the form of ammonium sulfate was then added. The Cynara scolymus leaf extract (+EVF) was applied at a rate corresponding to a treatment of 1 kg/ha. The tanks were then placed in the dark for 13 days. Photographs of the optode were taken after 4, 5, 6, 7, 8, 9, 10, 11, 12 and 13 days using a camera connected to a computer. Each photo was then analyzed by the imaging software (VisiSens) to determine the change in pH (by measuring the change in fluorescence) during this period.
[0161] Soil not Treated with a Cynara scolymus Leaf Extract (+EVF)
[0162] 80 g of dry soil (Table 1) sieved with a sieve with a mesh diameter of 2 mm, was placed in 90 cm.sup.3 (5.444.2 cm) Plexiglas tanks, an optode was glued to one of the transparent sides of the Plexiglas tanks to which 15 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 24 h incubation, the treatments were applied.
[0163] 80 kg/ha of nitrogen in the form of ammonium sulfate was then added. The tanks were then placed in the dark for 13 days. Photographs of the optode were taken after 4, 5, 6, 7, 8, 9, 10, 11, 12 and 13 days using a camera connected to a computer. Each photo was then analyzed by the imaging software (VisiSens) to determine the change in fluorescence during this period.
[0164] The change in soil pH was visualized by the VisiSens software (photographic data not shown).
[0165] Conclusion: Soils treated with the extract of Cynara scolymus leaves (+EVF) showed a decrease in soil pH between 4 and 13 days of incubation, indicating soil acidification related to the stimulation of soil nitrification.
Example 3: Measuring the Stimulation of Nitrification of a Soil by Measuring the Increase in the Soil in the Copy Number of the AmoA Gene (Gene Involved in the Synthesis of the Enzyme Ammonia Monooxygenase Responsible for the Transformation of Ammonium to Nitrate)
[0166] Soil Preparation
[0167] 10 g of dry soil (Table 2) sieved with a sieve with a mesh diameter of 2 mm, was placed in 60 mL glass bottles to which 1 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 1 h incubation, the treatments were applied.
TABLE-US-00002 TABLE 2 Main soil characteristics Texture Silty pH 6.2 Organic matter 3.6 (%) Cation exchange 8.2 capacity (meq/100 g)
[0168] Soil Treated with an Extract of Cynara scolymus Leaves (+EVF)
[0169] 10 g of dry soil (Table 2) sieved with a sieve with a mesh diameter of 2 mm, was placed in 60 mL glass bottles to which 1 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 1 h incubation, the Cynara scolymus leaf extract (+EVF) was applied at a rate of 1 kg/ha. The vials were then sealed and incubated at room temperature for a period of one hour. After this period, the copy number of the AmoA gene was measured by quantitative PCR.
[0170] Soil not Treated with an Extract of Cynara scolymus Leaves (EVF)
[0171] 10 g of dry soil (Table 2) sieved with a sieve with a mesh diameter of 2 mm, was placed in 60 mL glass bottles to which 1 mL of water was added, this volume allowing 70% of the field capacity of the soil studied to be reached. After 1 h incubation, the bottles were then sealed and incubated at room temperature for a period of one hour. After this period, the copy number of the AmoA gene was measured by quantitative PCR.
[0172] Extraction of DNA from Soil Samples
[0173] DNA was extracted from the soil samples using the Nucleospin soil extraction kit (Macherey Nagel) and following the manufacturer's instructions. For all samples, DNA was eluted in 50 L of elution buffer.
[0174] DNA Quality Analysis
[0175] After DNA extraction and elution, the quality and concentration of the DNA was analyzed by means of Agilent Technologies' automated 4200 TapeStation System and using the genomic DNA screentapes software.
[0176] qPCR Analysis of the AmoA Gene Copy Number
[0177] The AmoA gene copy number was measured by qPCR using primers specific for this gene. For AOA-amoA F (SAATGGTCTGGCTTAGACG), AOA-amoA R (GCG-GCCATCCATCTGTATGT) and for AOB-amoA F (GGGGTTTCTACTGGTGGT), AOB-amoA R (CCCCTTCGGGAAAGCCTTCTTC). DNA standards were created by PCR amplification of soil DNA extracts. The resulting amplicons were purified prior to quantification in the TapeStation system. The copy number of the target genes was calculated using the following formula:
Copy number=6.0231023 (copies/mol)the concentration of the standard (g/mL)/molecular mass (g/mol).
[0178] Standard curves for the AmoA gene in AOB and AOA were performed using a series of DNA dilutions ranging from 101 to 106 copies of the target gene. The standard, the DNA samples and the control were amplified in three replicates with the respective primer pairs. All reactions were performed with the Bio-Rad CFX384 real-time PCR system, with initial denaturation at 98 C. for 3 min, followed by 40 cycles at 98 C. for 15 s, 65 C. for 30 seconds and 72 C. for 50 s and final extension at 72 C. for 5 min. Each 10 L reaction contained 1 L of DNA and a concentration of 300 nM of each primer. The samples were quantified against the corresponding standard curve using the CFX Manager version 3.1 software (BIORAD). The final gene copy number was calculated and reported per gram of soil.
[0179] For each of the incubation conditions (+EVF and EVF), four batches of soil were made up (1 batch=1 biological replicate).
[0180] All the treatments were carried out systematically for each of the biological repetitions, i.e. in quadruple batches. The data obtained were presented as a mean and the variability of the results was given as the standard error of the mean for n=4. A statistical analysis of the results was performed using Student's test.
[0181] The copy number of the AmoA gene in AOB and AOA is shown in
[0182] Conclusion: Soils treated with the extract of Cynara scolymus leaves (+EVF) show a significant increase in the copy number of the AmoA gene in AOB (+144%) and AOA (+51%) after 1 hour incubation.