METHODS FOR SCREENING NUCLEIC ACID APTAMERS

Abstract

The present invention relates to a method for screening a nucleic acid aptamer comprising: (a) contacting a target molecule immobilized on a solid phase support with a nucleic acid aptamer candidate; (b) collecting the nucleic acid aptamer candidate binding with the target molecule by a capillary electrophoresis; and (c) amplifying the nucleic acid aptamer candidate by PCR.

Claims

1. A method for screening a nucleic acid aptamer comprising: (a) contacting a target molecule immobilized on a solid phase support with a nucleic acid aptamer candidate; (b) collecting the nucleic acid aptamer candidate binding with the target molecule by a capillary electrophoresis; (c) amplifying the nucleic acid aptamer candidate by PCR.

2. The method according to claim 1 further comprising (d) making the amplified PCR product into a single strand.

3. The method according to claim 1, wherein the solid phase support is a particle.

4. The method according to claim 3, wherein the minimum value of the particle size of the particle is 0.05 m.

5. The method according to claim 1, wherein the target molecule is a protein or a low molecular compound.

6. The method according to claim 1, wherein the nucleic acid aptamer candidate is a single-stranded DNA library.

7. The method according to claim 2, wherein the steps (a) to (d) are repeated for a maximum of three times.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] FIG. 1 shows the points of difference of the present invention to the conventional CE-SELEX.

[0024] FIG. 2 shows assessment of the binding ability of thrombin aptamer candidates by an SPR sensor (conventional CE-SELEX). Each figure A to J (in total 10) shows the results of examining 10 aptamer candidate sequences shown in the upper row of Table 3.

[0025] FIG. 3 shows assessment of the binding ability of thrombin aptamer candidates by an SPR sensor (MB-CE-SELEX of the present invention). Each figure A to J (in total 10) shows the results of examining 10 aptamer candidate sequences shown in the middle row of Table 3.

[0026] FIG. 4 shows assessment of the binding ability of thrombin aptamer candidates by an SPR sensor (MB-CE-SELEX of the present invention, improved version). Each figure A to J (in total 10) shows the results of examining 10 aptamer candidate sequences shown in the bottom row of Table 3.

[0027] FIG. 5 shows a unique dissociation phase of T_beads_re_apt.1 and T_beads_re_apt.5. (A) The response curve of 200 nM T_beads_re_apt.1 and the enlarged image. (B) The response curve of 200 nM T_beads_re_apt.5 and the enlarged image.

[0028] FIG. 6 shows the yield rate of thrombin aptamers in each selection method (calculated based only on the top 10 sequences). Conventional CE-SELEX: 23%; MB-CE-SELEX: 83%; MB-CE-SELEX (improved version): 91%

DESCRIPTION OF EMBODIMENTS

[0029] Hereinafter, the present invention is further explained in details in the Examples. Nonetheless, the present invention would not be restricted to these Examples.

Example 1

[0030] Immobilization of the Target Molecules to the Magnetic Particles

[0031] Magnetic particles having a carboxy group on the surface Dynabeads MyOne (Trade Mark) Carboxylic Acid (Invitrogen) were used as a support and immobilization of the molecules was carried out according to the protocol attached to the product. Hundred l of 20 mM Tris-HCl, 10 mM NaCl, 1 mM MgCl.sub.2 buffer (pH7.4) was added and this was preserved at 4 C. as a 10 mg/ml magnetic particle stock solution.

[0032] Optimization of Conditions of CE-SELEX

[0033] Conditions of Capillary Electrophoresis

[0034] Capillary electrophoresis system (Agilent 7100: Otsuka Electronics Co., Ltd.) was used. As for the capillary, a 75 m inner diameter bubble cell fused-silica capillary (Agilent technologies) of 80.6 cm in length and of 72.2 cm in effective length (the length up to the detection window) was used. The capillary was set on a cassette so that capillaries of the same length would leave from between the inlet side (injection inlet, positively charged electrode) and the outlet side (elution outlet, negatively charged electrode). As a pre-treatment, by applying a pressure of about 1 bar, a 0.1 M NaOH aqueous solution was allowed to run for 10 to 20 minutes. Furthermore, the capillary was equilibrated by running a running buffer (100 mM borate buffer, pH 8.5) for 10 to 20 minutes.

[0035] Separation and Collection of ssDNA Binding to a Target

Preparation of the Samples

[0036] Thrombin of the target protein and ssDNA library were dissolved or diluted in a sample buffer (20 mM Tris-HCl, 10 mM NaCl, 1 mM MgCl.sub.2 buffer, pH 7.4). For the ssDNA library, a synthetic oligo DNA of a total of 70 mers in which the two ends (5 end and 3 end) of a 30 mer random sequence being sandwiched with a 20 mer immobilized sequence was used. A sample buffer and 100 m of ssDNA library were placed in a PCR tube which was mixed by pipetting. The ssDNA library solution was heated at 95 C. for 2 minutes by a thermal cycler (TAKARA BIO INC.) and annealing was carried out by cooling down to 25 C. at a rate of 0.1 C./sec.

[0037] Sample Injection

[0038] After annealing, 2 M thrombin or 1 l of 5 to 10 mg/ml thrombin-immobilized magnetic particle solution was added and incubated at room temperature (25 C.) for 30 minutes or more. The target/ssDNA library mixed solution was injected from the inlet side of the capillary by applying a pressure of 100 mbar for 6 to 9 seconds. Based on the Hagen-poiseuille law, an approximate amount of injection could be predicted from the below-mentioned formula. V represents the amount of injection (nl), P represents pressure change (bar), d represents the inner diameter of the capillary (m), it represents the ratio of a circle's circumference to its diameter, T represents injection time (s), represents solution viscosity, and L represents the total length of the capillary (m).

V=Pd.sup.4T/128L10.sup.12[nL]

[0039] Electrophoresis Samples

[0040] A vial which contains 50 l of running buffer was each placed at the inlet side (injection inlet, positively-charged electrode side) and outlet side (elution outlet, negatively-charged electrode side) and a 30 kV constant voltage was applied to carry out electrophoresis. During electrophoresis, absorbance at 195, 260, 280, and 550 nm were measured over time by a diode array detector. The electrophoresis rate was assumed to be always constant and by calculating the elution time from the below-mentioned formula, the collection time was set. T elution represents elution time, T detection represents detection time, L total length represents the total length of the capillary, and L effective length represents the effective length of the capillary.

T.sub.elution=T.sub.detectionL.sub.total length/L.sub.effective length

[0041] Recovery of Sample

[0042] The collected sample using thrombin-immobilized magnetic particles was heated at 95 C. for 10 minutes using a thermal cycler to degenerate the proteins of the magnetic particle surface, and thereby ssDNA was released. This was allowed to stand still for 1 minute on a magnet stand, and the supernatant was recovered.

[0043] Amplification of the Collected Sample by PCR

[0044] The collected ssDNA sample obtained by capillary electrophoresis was amplified by PCR. In a 1.5 ml tube, 400 l of 2 premix, 192 l of DEPC treated water, 80 l of 4 M of forward primer, and 80 l of 4 M of 5-biotinylated reverse primer, were placed and mixed. These were aliquoted into eight 200 l PCR tubes, each tube containing 94 l of the solution. To each of the 6 tubes, 6 l of the collected sample was added, and to the remaining 2 tubes, 6 l of 1-10 pM ssDNA library and 6 l of DEPC treated water were added as a positive and negative control, respectively. Using a thermal cycler (TAKARA BIO INC.), this was heated at 94 C. for 1 minute, and an operation such as 94 C. for 15 seconds, 55 C. for 5 seconds, and 72 C. for 20 seconds was repeated for 23 to 28 times. Once PCR was over, whether the target size DNA was amplified was examined by a polyacrylamide gel electrophoresis (PAGE).

[0045] Once electrophoresis was carried out, the gel was soaked in a staining solution and shaked for 10 minutes. DNA bands after staining were detected by using an UV irradiator.

[0046] Purification and formation of a single strand of PCR products PCR products were made into a single strand and then made as an ssDNA library to be used in the next round. By using a magnosphere MS300/Streptavidin (Invitrogen) which is a streptavidin-immobilized magnetic particle, the immobilization and washing procedures were carried out according to the attached instruction. Fifty l of 0.1 M NaOH previously prepared was added, which was subjected for 10 to 15 times of gentle pipetting for suspension and then this was allowed to stand still at room temperature for 4 minutes to release/extract aptamer candidates.

[0047] Base Sequence Analysis Using a Next Generation Sequencer

Sample Preparation and Emulsion PCR

[0048] Samples for emulsion PCR is prepared according to the attached protocol, and by using PAGE, whether the target size DNA was amplified or not was confirmed.

[0049] After that, column purification of the PCR product was carried out using Fast Gene Gel/PCR Extraction Kit (Nippon Genetics Co., Ltd.). Finally, emulsion PCR and beads purification were carried out using Ion OneTouch 2 system (Life Technologies) and Ion PGM Template OT2 200 Kit (Life Technologies). The attached protocol which was referred to is Publication Number MAN0007220, Rev. 5.0.

[0050] A Large-Scale Sequence Analysis Using a Next Generation Sequencer

[0051] Using a purified beads after emulsion PCR, a large-scale sequence analysis using Ion PGM system (Life technologies), semiconductor chip Ion 314 chip, Ion 318 chip (Life technologies), and Ion PGM Sequencing 200 Kit v2 (Life technologies) was carried out. The operation was carried out according to the attached protocol (Publication Number MAN0007273, Rev. 3.0). The sequence data was output to a FASTAQ file, and the sequence of the primer region (immobilized sequence) of the DNA library was removed using CLC Genomics Workbench (CLC bio) and only random sequences of 28 to 32 mers were extracted. Furthermore, the count number of repeated sequence was checked and the sequence information was output to an excel file. The sequence was converted into FASTA format on Excel (microsoft) which was output to a text file. Alignment was made using Mafft and similar sequences (family sequences) were extracted. Furthermore, MEME suite 4.11.0 was used to study the family sequences.

[0052] Assessment of the Binding Ability of the Selected Aptamer

Immobilization of the Target Protein to a Sensor Chip

[0053] Using Biacore X100 (GE healthcare), immobilization of the target protein to a sensor surface and the interaction analysis of the target protein with the aptamer were carried out in accordance to the attached manual.

[0054] HBS-EP (HEPES, 150 mM NaCl, pH 7.0) was used as a running buffer. A carboxymethyl dextran-modified CM5 sensor chip (GE healthcare) was set in the flow path, EDC/NHS solution was allowed to flow for 7 minutes at a flow rate of 10 l/min and the carboxy group on the sensor chip was activated. Ten to twenty g/ml of thrombin solution diluted with a 10 mM acetic acid/sodium acetate buffer, pH 6.0, was allowed to flow for 7 minutes. Finally, ethanolamine was allowed to flow for 7 minutes to block and complete the coupling reaction.

[0055] Calculation of dissociation constant using interaction analysis Aptamer candidate samples were diluted to 2 to 4 M with a running buffer. After heating for 2 minutes at 95 C. using a thermal cycler, annealing was performed by cooling to 25 C. at a rate of 0.1 C./sec. After annealing, it was further diluted with a running buffer to 50-200 nM. The thrombin-immobilized chip was set in the flow path and this was investigated whether a specific response was demonstrated when the diluted aptamer candidate was allowed to flow at a flow rate of 30 l/min. As a regeneration solution, 1 M NaCl solution was used. For aptamer candidates demonstrating specific responses, a plural number of dilution samples were adjusted in the range of 6.25-400 nM and multi-kinetic analysis was performed. However, for aptamer candidates that could not be regenerated with a 1 M NaCl solution, single kinetic analysis (which does not have a regeneration process in between) was performed. Evaluation software was used to calculate the dissociation constant.

[0056] Identification of Thrombin Aptamer Candidate Sequence by a Next Generation Sequencer

[0057] The procedures and results for determining the thrombin aptamer candidate sequence using the next generation sequencer are given below.

[0058] Large-Scale Sequence Analysis

[0059] The aptamer candidate sequences obtained in each round (1st to 3rd round) of the conventional CE-SELEX, MB-CE-SELEX (first round), and MB-CE-SELEX (improved version) were analyzed by a next generation sequencer (Ion PGM system). The total number of read sequences per round was 90000 to 800000 (Table 2). Of the sequences of the 3.sup.rd round obtained by each selection method, analysis was proceeded mainly on the 10 sequences with large count numbers. Their sequences were named as follows: T_apt. 1 to 10 (conventional CE-SELEX), T_beads_apt. 1 to 10 (MB-CE-SELEX), T_beads_re_apt. 1 to 10 (MB-CE-SELEX improved version).

[0060] Table 2 Total read number of the aptamer candidate sequences selected in each round

TABLE-US-00002 TABLE 2 Read Number Selection Method R1 R2 R3 Conventional CE-SELEX 799730 804061 418048 CE-SELEX introduced 96988 395167 283822 with magnetic particles Improved version of 181248 165641 97890 CE-SELEX introduced with magnetic particles

[0061] Calculation of the Concentration Efficiency of the Higher Ranking Base Sequences

[0062] First of all, the presence rate (the count number of each sequence/the number of total read sequences)100(%) of the higher ranking sequence was examined. As a result of this, it was found that the presence rate of the most concentrated sequence in each selection method was as follows: 0.16% for conventional CE-SELEX, 12% for MB-CE-SELEX and 5.1% for MB-CE-SELEX (improved version) (Table 3). According to the paper related to the acquisition of VEGF aptamer using CE-SELEX, which was reported by Bowser et al., an assumption is made that the aptamers acquired by CE-SELEX is rich in diversity and certain sequences are difficult to be concentrated, and in fact, the presence rate of the sequence which was most concentrated at the end of the 4.sup.th round was around 0.8%. In comparison to the results of the present study, as for the presence rate of the high ranking sequences obtained by the conventional CE-SELEX, a similar tendency was found as in the prior studies. On the other hand, as for the presence rate of the high ranking sequences obtained by MB-CE-SELEX selection, a high presence rate of approximately 50 to 100 times higher than that obtained by conventional CE-SELEX was demonstrated, and it was revealed that it shows a considerably high concentration effect as compared to that of the prior studies. Moreover, it is believed that a condition that is likely to concentrate an ssDNA having a specific binding ability exists in MB-CE-SELEX.

[0063] Table 3 Count number/presence rate of the high ranking sequence per round in the 3.sup.rd round of each selection method

TABLE-US-00003 TABLE3 Countnumber Presencerate(%) Sequencesoftherandomregion(5.fwdarw.3) R1 R2 R3 R1 R2 R3 ConventionalCE-SELEX T_apt.1 GTTTGGGTGGTTAGGTGTTGACCTGGGATG 4 143 0.018 T_apt.2 GAGTCGGGTGGCTATTGGGTATGGACCGTG 5 151 0.019 T_apt.3 GATGGTGTAGGTTGGGAGAGGCTCAGTGCC 4 0.0080 T_apt.4 TTGGTGGGGTGGCTTTGGGTATTTACTTGG 3 30 T_apt.5 GTGGATTTGGGTGGATTGGTATGAACTGAC 5 40 T_apt.6 GTTGGGTAGGGTTGGATAGGGGCAAGTAGA 0 0 T_apt.7 GTGTACTATTATGGTGTGGTTGGTATGGTT 2 0.042 T_apt.8 GGTTGGGTGGTGTGGGTAGTGATCCCTGTG 1 0.0013 0.037 T_apt.9 TGGATTGGTTGGATTGGGGGTGTGACTGTG 0 0 0.033 T_apt.10 TCGGGTTGGATTGGTTGGCTTAAACTATGT 3 0.022 TBA_like_apt.1 TCTGGTTGGTGTGGTTGGGAGTTTTTTGATC 1 4 6 0.0014 CE-SELEXintroducewithmagneticparticles T_beads_apt.1 GATGGTGTAGGTTGGGAGAGGCTCAGTGCC 2 8110 0.0021 2.1 12 T_beads_apt.2 GTTTGGGTGGTTAGGTGTTGACCTGGGATG 0 2251 0 0.57 T_beads_apt.3 GATGGTGTAGGTTGGGAGAGGCTCAGTGC 0 225 1059 0 T_beads_apt.4 TTAGGGTTGGGAGGGTGGCTGACTAATGTA 0 5 1035 0 0.0013 T_beads_apt.5 GAGTCGGGTGGCTATTGGGTATGGACCGTG 0 5 853 0 0.0013 0.31 T_beads_apt.6 GGGTTGGATTGGGTGGCGGTGTGAACTATG 0 0 800 0 0 T_beads_apt.7 GTTGGTTATGGTGGTTTTAGTGGGACTCGA 0 5 532 0 0.0013 T_beads_apt.8 ATAGGATGGGTGGGTGGGTTCGTCAGTTA 0 3 270 0 T_beads_apt.9 TGGGTCCGGGGTTGGGGGGGTGGCCGGGTC 0 0 260 0 0 0.092 T_beads_apt.10 GGGTGGGGTGGATTGGTTGGCGTTCCTGGA 0 2 246 0 CE-SELEXintroducedwithmagneticparticles(Improvedversion) T_beads_re_apt.1 AAGAGGGTGGAGTGGTTGGCTTCACAATGG 0 17 4979 0 0.010 5.1 T_beads_re_apt.2 GTTGGTTATGGTGGTTTTAGTGGGACTCGA 0 17 2244 0 0.010 2.3 T_beads_re_apt.3 GGGGTGGATGTGGTATTTTAGTGGCGATCT 0 0 0.0030 T_beads_re_apt.4 AAGGGGGTGGGGGTCGGGTGGCCTCACGAT 0 0 0.0042 T_beads_re_apt.5 GGATGGATTGGTTGGCGTCTGATAATGGTG 0 643 0 0.0042 T_beads_re_apt.6 GTTTGGGTGGTTAGGTGTTGACCTGGGATG 2 191 549 0.0011 0.12 T_beads_re_apt.7 GATGGTGTAGGTTGGGAGAGGCTCAGTGCC 1 105 540 0.00055 0.053 T_beads_re_apt.8 TTGGTGGGGTGGCTTTGGGTATTTACTTGG 2 0.0011 0.033 T_beads_re_apt.9 GGGGATGGTTAGGGTGGCTTAATATTGACC 0 450 0 0.005 T_beads_re_apt.10 ACGGGGATGGGGGGGTGGAGGAGGCCTGT 0 6 0 0.004 indicates data missing or illegible when filed

[0064] Binding Ability of Aptamer Candidate Sequence

[0065] Table 4 shows the binding ability of each candidate sequence to thrombin calculated by using a surface plasmon resonance (SPR) sensor.

[0066] Comparing the Aptamer Yield Rates Between the Conventional CE-SELEX and MB-CE-SELEX

[0067] Of the high ranking sequences, by comparing the ratio of sequences having a high binding ability to thrombin, the performance of the novel MB-CE-SELEX was assessed. First, the presence of the binding ability of the higher ranking sequence (in total 10 sequences) obtained by conventional CE-SELEX was examined (FIG. 2). The preliminary experiments revealed that thrombin did not interact non-specifically with ssDNA, as no increase in specific response was observed in the ssDNA library (FIG. 2A). Of T_apt. 1 to 10, in 3 aptamer candidates such as T_apt. 3, T_apt. 4, and T_apt. 6, specific response was obtained (FIGS. 2B to 2K). With respect to, T_apt. 1 and T_apt. 10, although a slight increase in response was observed, the binding ability was considered to be low because the shape of the peak was of a box shape, i.e., dissociation was very fast (FIG. 2B, K). As a control, a binding experiment was carried out for TBA_like_apt. 1 having the exact same sequence as TBA 15, and a specific response was obtained (FIG. 2L).

[0068] Similarly, as a result of studying the presence of the binding ability in the higher ranking sequences (in total 10 sequences) obtained by MB-CE-SELEX, in 4 aptamer candidates such as T_beads_apt. 1, T_beads_apt. 3, T_beads_apt. 7, and T_beads_apt. 8, a specific response was obtained (FIG. 3).

[0069] Finally, as a result of studying the presence of the binding ability in the higher ranking sequences (in total 10 sequences) obtained by MB-CE-SELEX (improved version), in 8 aptamer candidates other than T_beads_re_apt. 6, and T_beads_apt. 9, a specific response was obtained (FIG. 4). In particular, with respect to T_beads_re_apt. 1 and T_beads_re_apt. 5, a unique response curve that cannot be found in other aptamers was obtained. These two aptamers, after drawing a relatively fast dissociation curve, maintained a certain level of response (FIG. 5). In other words, it was considered that a condition exists that a certain number of aptamers were firmly bound to thrombin and did not separate.

[0070] Of the higher ranking sequence of each selection method, the ratio of those showing high binding ability was as follows: 3/10 for conventional CE-SELEX, 4/10 for MB-CE-SELEX, and 8/10 for MB-CE-SELEX (improved version). The aptamer yield rate (the sum of the count numbers of the sequences having high binding ability/the sum of the count numbers of the sequences whose binding ability was examined) from the count number (the presence rate) of the 10 sequences of each set of high ranking sequences was calculated as follows: 23% in the conventional CE-SELEX, 83% in MB-CE-SELEX and 91% in MB-CE-SELEX (improved version) (FIG. 6). In MB-CE-SELEX, it was revealed that thrombin aptamers could be acquired with a higher probability than the conventional CE-SELEX.

[0071] Calculation of Dissociation Constant of Thrombin Aptamer

[0072] With respect to a sequence from which a specific response curve was obtained, the binding rate constant (ka), the dissociation rate constant (kd), and the dissociation constant KD were calculated by multi-kinetic analysis or single kinetic analysis (FIG. 7, Table 4). With respect to T_beads_re_apt. 10, dissociation constant was calculated by single kinetic analysis (FIG. 7J) since dissociation was very slow and even with high concentrations of NaCl, they did not dissociate from thrombin. T_beads_re_apt. 1 and T_beads_re_apt. 5 are likely to have a high binding ability, but it is difficult to calculate the dissociation rate (kd) because no slope is present in the dissociation curve (Figures A and E), and the dissociation constant (KD) was unable to be calculated by an SPR sensor.

[0073] The binding rate constant, the dissociation rate constant, and the dissociation constant in the high ranking sequences in the 3.sup.rd round of each selection method

TABLE-US-00004 TABLE4 Sequencesoftherandom region(5.fwdarw.3) ka(M.sup.-1s.sup.-1) SE(ka) kd(s.sup.-1) SE(kd) KD(nM) ConventionalCE-SELEX T_apt.1 GTTTGGGTGGTTAGGTGTTGACCTGGGATG T_apt.2 GAGTCGGGTGGCTATTGGGTATGGACCGTG T_apt.3 GATGGTGTAGGTTGGGAGAGGCTCAGTGCC 1.8 4.410.sup.3 1.410.sup.-2 1.310.sup.-4 76 T_apt.4 TTGGTGGGGTGGCTTTGGGTATTTACTTGG 1.1 1.710.sup.3 9.0 5.3 81 T_apt.5 GTGGATTTGGGTGGATTGGTATGAACTGAC T_apt.6 GTTGGGTAGGGTTGGATAGGGGCAAGTAGA 7.110.sup.4 2.710.sup.3 4.010.sup.-3 1.110.sup.-4 55 T_apt.7 GTGTACTATTATGGTGTGGTTGGTATGGTT T_apt.8 GGTTGGGTGGTGTGGGTAGTGATCCCTGTG T_apt.9 TGGATTGGTTGGATTGGGGGTGTGACTGTG T_apt.10 TCGGGTTGGATTGGTTGGCTTAAACTATGT TBA_like_apt.1 TCTGGTTGGTGTGGTTGGGAGTTTTTTGATC 3.810.sup.4 1.310.sup.3 8.310.sup.-3 1.310.sup.-4 217 CE-SELEXintroducewithmagneticparticles T_beads_apt.1 GATGGTGTAGGTTGGGAGAGGCTCAGTGCC 1.810.sup.5 4.4 1.410.sup.-2 1.310.sup.-4 76 T_beads_apt.2 GTTTGGGTGGTTAGGTGTTGACCTGGGATG T_beads_apt.3 GATGGTGTAGGTTGGGAGAGGCTCAGTGC 1.410.sup.5 7.2 2.210.sup.-2 9.910.sup.-4 165 T_beads_apt.4 TTAGGGTTGGGAGGGTGGCTGACTAATGTA T_beads_apt.5 GAGTCGGGTGGCTATTGGGTATGGACCGTG T_beads_apt.6 GGGTTGGATTGGGTGGCGGTGTGAACTATG T_beads_apt.7 GTTGGTTATGGTGGTTTTAGTGGGACTCGA 5.110.sup.4 2.1 1.710.sup.-2 2.610.sup.-4 329 T_beads_apt.8 ATAGGATGGGTGGGTGGGTTCGTCAGTTA 4.710.sup.4 6.010.sup.2 2.010.sup.-3 1.710.sup.-5 43 T_beads_apt.9 TGGGTCCGGGGTTGGGGGGGTGGCCGGGTC T_beads_apt.10 GGGTGGGGTGGATTGGTTGGCGTTCCTGGA CE-SELEXintroducedwithmagneticparticles(Improvedversion) T_beads_re_apt.1 AAGAGGGTGGAGTGGTTGGCTTCACAATGG T_beads_re_apt.2 GTTGGTTATGGTGGTTTTAGTGGGACTCGA 5.110.sup.4 2.110.sup.3 1.710.sup.-2 2.510.sup.-4 329 T_beads_re_apt.3 GGGGTGGATGTGGTATTTTAGTGGCGATCT 4.610.sup.4 1.310.sup.4 4.410.sup.-2 4.010.sup.-3 947 T_beads_re_apt.4 AAGGGGGTGGGGGTCGGGTGGCCTCACGAT 2.010.sup.4 1.210.sup.3 1.310.sup.-2 1.510.sup.-2 645 T_beads_re_apt.5 GGATGGATTGGTTGGCGTCTGATAATGGTG T_beads_re_apt.6 GTTTGGGTGGTTAGGTGTTGACCTGGGATG T_beads_re_apt.7 GATGGTGTAGGTTGGGAGAGGCTCAGTGCC 1.810.sup.5 4.410.sup.2 1.410.sup.-2 1.310.sup.-4 76 T_beads_re_apt.8 TTGGTGGGGTGGCTTTGGGTATTTACTTGG 1.110.sup.5 1.710.sup.3 9.010.sup.-3 5.310.sup.-5 81 T_beads_re_apt.9 GGGGATGGTTAGGGTGGCTTAATATTGACC T_beads_re_apt.10 ACGGGGATGGGGGGGTGGAGGAGGCCTGT 6.0 6.810 6.010.sup.-4 6.010.sup.-5 101 indicates data missing or illegible when filed

[0074] In MB-CE-SELEX (improved version), as the aptamer yield rate (the sum of the count numbers of sequences having high binding ability/the sum of the count numbers of the sequences examining the binding ability) increases, nucleic acid aptamers with smaller dissociation rate constant (difficult to dissociate) were mainly obtained. For example, T_beads_re_apt.1 and T_beads_re_apt. 5 having a binding ability binding to a degree so that a slope of the dissociation curve cannot be obtained as well as T_beads_re_apt.10 whose dissociation constant was able to be calculated only by single kinetic analysis, were obtained. The difference of only 18 seconds of the collection region between the first MB-CE-SELEX whose collection window (time) was deliberately expanded and MB-CE-SELEX (improved version) whose collection window (time) was narrowed was revealed to attribute to the aptamer yield rate and the dissociation rate constant. It is possible that the present system may be further improved by optimizing the collection window (time) and by adjusting the peak deriving from the magnetic particles to be sharper.

INDUSTRIAL APPLICABILITY

[0075] The present invention is useful for screening nucleic acid aptamers.