High titer recombinant influenza viruses with enhanced replication in vero cells

10808229 · 2020-10-20

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides a composition useful to prepare high titer influenza viruses, e.g., in the absence of helper virus, which includes internal genes from an influenza virus vaccine strain or isolate, e.g., one that is safe in humans, for instance, one that does not result in significant disease, and genes from vaccine seed virus isolates which include a HA gene segment with a HA2 sequence encoding a HA2 that confers enhanced growth in cells in culture, such as Vero cells.

Claims

1. An isolated Vero cell infected with a recombinant reassortant influenza virus having PA, PB1, PB2, NP, NS, and M gene segments from a first influenza vaccine virus isolate, an influenza virus NA gene segment, and an influenza virus HA gene segment selected to encode an aspartic acid or glutamic acid at position 117 in HA2, wherein the numbering for HA2residues is that for H1 HA.

2. The isolated cell of claim 1, wherein the NA gene segment and the HA gene segment in the reassortant virus are from the same influenza virus isolate and the HA gene segment in the reassortant virus is mutated to encode the aspartic acid or glutamic acid at position 117.

3. The isolated cell of claim 1, wherein the PA, PB1, PB2, NP, NS, and M gene segments in the reassortant virus comprise sequences for at least one of the following: a PB1 having the amino acid sequence encoded by SEQ ID NO:2 or PB1 with at least 95% amino acid sequence identity to the PB1 encoded by SEQ ID NO:2; a PB2 having the amino acid sequence encoded by SEQ ID NO:3 or PB2 with at least 95% amino acid sequence identity to the PB2encoded by SEQ NO:3; a PA having the amino acid sequence encoded by SEQ ID NO:1 or PA with at least 95% amino acid sequence identity to the PA encoded by SEQ ID NO:1; a NP having the amino acid sequence encoded by SEQ ID NO:4 or NP with at least 95% amino acid sequence identity to the NP encoded by SEQ ID NO:4; a M having the amino acid sequence encoded by SEQ ID NO:5 or M with at least 95% amino acid sequence identity to the M encoded by SEQ ID NO:5; or a NS having the amino acid sequence encoded by SEQ ID NO:6 or NS with at least 95% amino acid sequence identity to the NS encoded by SEQ ID NO:6.

4. The isolated cell of claim 1, wherein the PA, PB1, PB2, NP, NS, and M gene segments in the reassortant virus comprise sequences for at least one of the following: a PB1 having the amino acid sequence encoded by SEQ ID NO:10 or PB1 with at least 95% amino acid sequence identity to the PB1 encoded by SEQ NO:10; a PB2 having the amino acid sequence encoded by SEQ ID NO:11 or PB2 with at least 95% amino acid sequence identity to the PB2 encoded by SEQ ID NO:11; a PA having the amino acid sequence encoded by SEQ ID NO:12or PA with at least 95% amino acid sequence identity to the PA encoded by SEQ ID NO:12; a NP having the amino acid sequence encoded by SEQ ID NO:13 or NP with at least 95% amino acid sequence identity to the NP encoded by SEQ ID NO:13; a M having the amino acid sequence encoded by SEQ ID NO:14 or M with at least 95% amino acid sequence identity to the M encoded by SEQ ID NO:14; or a NS having the amino acid sequence encoded by SEQ ID NO:15 or NS with with at least 95% amino acid sequence identity to the NS encoded by SEQ ID NO:15.

5. The isolated cell of claim 1, wherein the HA gene segment is a H1, H2, H3, H5, H7, or H9 gene segment.

6. An isolated recombinant reassortant influenza virus having enhanced replication in Vero cells, prepared by: providing a vector comprising sequences for a HA gene segment that does not encode an aspartic acid or glutamic: acid at position 117 in HA2, wherein the numbering for HA2 residues is that for H1 HA2; altering the residue at position 117 in HA2 in the HA to aspartic acid or glutamic acid; contacting cells with one or more vectors for expression of vRNAs for PA, PB1, PB2, NP, NS, M, HA and NA gene segments, wherein the vector for expression of HA vRNA comprises the sequences for a HA gene segment with the altered residue; and isolating from the cells recombinant reassortant influenza virus having enhanced replication in Vero cells.

7. The isolated recombinant virus of claim 6, wherein the HA gene segment is a H1, H2, H3, H5, H7, or H9 gene segment.

8. The isolated recombinant virus of claim 6, wherein the NA gene segment and the HA gene segment are from the same influenza virus isolate.

9. The isolated recombinant virus of claim 6, wherein the HA gene segment that does not encode an aspartic acid or glutamic acid at position 117 in HA2 has an alanine, asparagine, arginine or lysine at position 117 in HA2.

10. The isolated recombinant virus of claim 6, wherein the PA, PB1, PB2, NP, NS, and M gene segments are from the same influenza virus isolate.

11. The isolated recombinant virus of claim 6, wherein the PA, PB1, PB2, NP, NS, and M gene segments comprise sequences for a PB1 having the amino acid sequence encoded by SEQ ID NO:2; or PB1 with at least 90% amino acid sequence identity to the PB1encoded by SEQ ID NO:2; a PB2 having the amino acid sequence encoded by SEQ ID NO:3 or PB2 with at least 90% amino acid sequence identity to the PB2 encoded by SEQ ID NO:3; a PA having the amino acid sequence encoded by SEQ ID NO:1 or PA with at least 90% amino acid sequence identity to the PA encoded by SEQ NO:1; a NP having the amino acid sequence encoded by SEQ ID NO:4 or NP with at least 90% amino acid sequence identity to the NP encoded by SEQ ID NO:4; a M having the amino acid sequence encoded by SEQ ID NO:5 or M with at least 90% amino acid sequence identity to the M encoded by SEQ ID NO:5; or a NS having the amino acid sequence encoded by SEQ ID NO:6 or NS with at least 90% amino acid sequence identity to the NS encoded by SEQ ID NO:6.

12. The isolated recombinant virus of claim 6, wherein the PA, PB1, PB2, NP, NS, and M gene segments comprise sequences for a PB1 having the amino acid sequence encoded by SEQ ID NO:10 or PB1 with at least 90% amino acid sequence identity to the PB1encoded by SEQ ID NO:10; a PB2 having the amino acid sequence encoded by SEQ ID NO:11 or PB2 with at least 90% amino acid sequence identity to the PB2 encoded by SEQ ID NO:11; a PA having the amino acid sequence encoded by SEQ ID NO:12 or PA with at least 05% amino acid sequence identity to the PA encoded by SEQ ID NO:12; a NP having the amino acid sequence encoded by SEQ ID NO:13 or NP with at least 90% amino acid sequence identity to the NP encoded by SEQ ID NO:13; a M having the amino acid sequence encoded by SEQ ID NO:14 or M with at least 90% amino acid sequence identity to the M encoded by SEQ ID NO:14; or a NS having the amino acid sequence encoded by SEQ ID NO:15 or NS with at least 90% amino acid sequence identity to the NS encoded by SEQ ID NO:15.

13. The isolated recombinant of claim 6, wherein the cells are isolated avian cells.

14. The isolated recombinant virus of claim 6, wherein the cells are isolated mammalian cells.

15. The isolated recombinant virus of claim 14, wherein the isolated mammalian cells comprise a Vero cell, an isolated human cell or an isolated hamster cell.

16. The isolated recombine of claim 6, wherein the HA gene segment is a H1, H2, H3, H5, H7, or H9 gene segment.

17. A method to prepare an influenza virus with enhanced replication in Vero cells, comprising: providing a vector comprising a recombinant nucleic acid molecule comprising sequences for an influenza virus HA gene segment from a first influenza virus isolate, which segment encodes an HA with an alanine, asparagine, arginine or lysine at position 117 in HA2, wherein the numbering for HA2 residues is that for H1 HA2; modifying the HA gene segment to encode an aspartic acid or glutamic acid at position 117in HA2, thereby yielding a modified HA segment; and contacting a cell with a vector comprising promoter that yields full length, genomic influenza, virus RNA or its complement, operably linked to an influenza virus PA segment DNA linked to a transcription termination sequence, a vector comprising a promoter that yields full length, genomic influenza virus RNA or its complement operably linked to an influenza virus PB1 segment DNA linked to a transcription termination sequence, a vector comprising a promoter that yields full length, genomic influenza virus RNA or its complement operably linked to an influenza virus PB2 segment DNA linked to a transcription termination sequence, a vector comprising a promoter that yields full length, genomic influenza virus RNA or its complement operably linked to the modified HA segment linked to a transcription termination sequence, a vector comprising a promoter that yields full length, genomic influenza virus RNA or its complement operably linked to an influenza virus NP segment DNA linked to a transcription termination sequence, a vector comprising a promoter that yields full length, genomic influenza virus RNA or its complement operably linked to an influenza virus NA segment DNA linked to a transcription termination sequence, a vector comprising a promoter that yields full length, genomic influenza virus RNA or its complement operably linked to an influenza virus M segment DNA linked to a transcription termination sequence, and a vector comprising a promoter that yields full length, genomic influenza virus RNA or its complement operably linked to an influenza virus NS segment DNA linked to a transcription termination sequence; and a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus PA, a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus PB2, and a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus HA, a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus NA, a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus M1, a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus M2, or a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus NS1 or a vector comprising a promoter that yields mRNA operably linked to a DNA segment encoding influenza virus NS2; in an amount effective to yield infectious influenza virus.

18. The method of claim 17, wherein the PA, PB1, PB2, NP, NS, and M segments are from an influenza vaccine virus isolate.

19. The method of claim 17, wherein the NA segment and the HA segment are from a different isolate than the PA, PB1, PB2, NR, NS, and M segments.

20. The method of claim 17, wherein the HA gene segment is a H1, H2, H3, H5,H7, or H9 gene segment.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIGS. 1A-C. Nucleotide sequence for PR8(Cambridge) genes (SEQ ID NOs:10-15).

(2) FIG. 2. Growth properties of Vero cell-adapted PR8 virus in Vero cells.

(3) FIG. 3. Comparison of amino acid sequence differences between PR8 and Vero cell-adapted PR8.

(4) FIG. 4. Growth properties of Vero cell-adapted PR8, non Vero cell-adapted wild-type PR8, and recombinant viruses with one or two substitutions relative to wild-type virus in Vero cells.

(5) FIG. 5. Growth properties of HA2 N117D virus and wild-type PR8 in MDCK cells.

(6) FIG. 6. Three dimensional structure of HA as a trimer (A), HA as a monomer (B) and HA2 (C).

(7) FIG. 7. Schematic of fusion assay which expresses full length HA.

(8) FIG. 8. Photomicrographs of Vero cells expressing wild-type PR8 HA or HA2 N117D virus at various pH conditions.

(9) FIGS. 9A-B, pH sensitivity of Alexa647 and Oregon Green dyes. A) The fluorescence intensity of Oregon Green dye is sensitive to variations in pH while the fluorescence intensity of Alexa647 does not vary over pH 3 to 7. B) Schematic of assay to detect endosomal pH.

(10) FIG. 10. Comparison of endosomal pH in MDCK cells and Vero cells.

(11) FIGS. 11A-C. HA2 N117D substitution mutants have enhanced infectivity titers in Vero cells. A) Vero cells were infected with A/Kawasaki/173/2001 (H1N1) and A/Kawasaki/173/2001 HA2 N117D and the titers over time determined. B) Vero cells were infected with A/Kawasaki/UTK-4/2009 (H1N1) and A/Kawasaki/UKT-4/2009 HA2 N117D and the titers over time determined. C) Vero cells were infected with A/Yokohama/2017/2003 (H3N2) and A/Yokohama/2017/2003 HA2 N116D and the titers over time determined.

(12) FIGS. 12A-B. A) Alignment of HA2 sequences from A/Aichi/2/68; A/Dk/Sing/97; A/HK/486/97; A/Sw/9/98; and A/HongKong/1073/99 (SEQ ID Nos.16-20 and 23-27). B) Amino acid sequence of HA sequence from A/California/08/2009 (SEQ ID NO:21). HA2 sequences correspond to residues 336-566 (SEQ ID NO:22).

(13) FIG. 13. HA2 sequences for A/Kawasaki/173/2001, A/Kawasaki/UKT-4/2009, and A/Yokohama/2017/2003 (SEQ ID NOs:28-30). According to the NCBI database, influenza virus HA2 sequences for H1, H2, H3, H5, H7, and H9 HAs were generally conserved at position 116 or 117 (N116 or N117) (more than 99%).

DETAILED DESCRIPTION OF THE INVENTION

(14) Definitions

(15) As used herein, the term isolated refers to in vitro preparation and/or isolation of a nucleic acid molecule, e.g., vector or plasmid, peptide or polypeptide (protein), or virus of the invention, so that it is not associated with in vivo substances, or is substantially purified from in vitro substances. An isolated virus preparation is generally obtained by in vitro culture and propagation, and/or via passage in eggs, and is substantially free from other infectious agents.

(16) As used herein, substantially purified means the object species is the predominant species, e.g., on a molar basis it is more abundant than any other individual species in a composition, and preferably is at least about 80% of the species present, and optionally 90% or greater, e.g., 95%, 98%, 99% or more, of the species present in the composition.

(17) As used herein, substantially free means below the level of detection for a particular infectious agent using standard detection methods for that agent.

(18) A recombinant virus is one which has been manipulated in vitro, e.g., using recombinant DNA techniques, to introduce changes to the viral genome. Reassortant viruses can be prepared by recombinant or nonrecombinant techniques.

(19) As used herein, the term recombinant nucleic acid or recombinant DNA sequence or segment refers to a nucleic acid, e.g., to DNA, that has been derived or isolated from a source, that may be subsequently chemically altered in vitro, so that its sequence is not naturally occurring, or corresponds to naturally occurring sequences that are not positioned as they would be positioned in the native genome. An example of DNA derived from a source, would be a DNA sequence that is identified as a useful fragment, and which is then chemically synthesized in essentially pure form. An example of such DNA isolated from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.

(20) As used herein, a heterologous influenza virus gene or gene segment is from an influenza virus source that is different than a majority of the other influenza viral genes or gene segments in a recombinant, e.g., reassortant, influenza virus.

(21) The terms isolated polypeptide, isolated peptide or isolated protein include a polypeptide, peptide or protein encoded by cDNA or recombinant RNA including one of synthetic origin, or some combination thereof.

(22) The term recombinant protein or recombinant polypeptide as used herein refers to a protein molecule expressed from a recombinant DNA molecule. In contrast, the term native protein is used herein to indicate a protein isolated from a naturally occurring (i.e., a nonrecombinant) source. Molecular biological techniques may be used to produce a recombinant form of a protein with identical properties as compared to the native form of the protein.

(23) Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm.

(24) Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Alignments using these programs can be performed using the default parameters. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). The algorithm may involve first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.

(25) In addition to calculating percent sequence identity, the BLAST algorithm may also perform a statistical analysis of the similarity between two sequences. One measure of similarity provided by the BLAST algorithm may be the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

(26) The BLASTN program (for nucleotide sequences) may use as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5. N=4, and a comparison of both strands. For amino acid sequences, the BLASTP program may use as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. See http://www.ncbi.n1m.nih.gov. Alignment may also be performed manually by inspection.

(27) For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

(28) Influenza Virus Structure and Propagation

(29) Influenza A viruses possess a genome of eight single-stranded negative-sense viral RNAs (vRNAs) that encode at least ten proteins. The influenza virus life cycle begins with binding of the hemagglutinin (HA) to sialic acid-containing receptors on the surface of the host cell, followed by receptor-mediated endocytosis. The low pH in late endosomes triggers a conformational shift in the HA, thereby exposing the N-terminus of the HA2 subunit (the so-called fusion peptide). The fusion peptide initiates the fusion of the viral and endosomal membrane, and the matrix protein (M1) and RNP complexes are released into the cytoplasm. RNPs consist of the nucleoprotein (NP), which encapsidates vRNA, and the viral polymerase complex, which is formed by the PA, PB1, and PB2 proteins. RNPs are transported into the nucleus, where transcription and replication take place. The RNA polymerase complex catalyzes three different reactions: synthesis of an mRNA with a 5 cap and 3 polyA structure, of a full-length complementary RNA (cRNA), and of genomic vRNA using the cRNA as a template. Newly synthesized vRNAs, NP, and polymerase proteins are then assembled into RNPs, exported from the nucleus, and transported to the plasma membrane, where budding of progeny virus particles occurs. The neuraminidase (NA) protein plays a crucial role late in infection by removing sialic acid from sialyloligosaccharides, thus releasing newly assembled virions from the cell surface and preventing the self aggregation of virus particles. Although virus assembly involves protein-protein and protein-vRNA interactions, the nature of these interactions is largely unknown.

(30) Although influenza B and C viruses are structurally and functionally similar to influenza A virus, there are some differences. For example, influenza B virus does not have a M2 protein with ion channel activity but has BM2 and has a gene segment with both NA and NB sequences. Influenza C virus has only seven gene segments.

(31) Cell Lines that can be Used in the Present Invention

(32) Any cell, e.g., any avian or mammalian cell, such as a human, e.g., 293T or PER.C6 cells, or canine, bovine, equine, feline, swine, ovine, rodent, for instance mink, e.g., MvLu1 cells, or hamster, e.g., CHO cells, or non-human primate, e.g., Vero cells, including mutant cells, which supports efficient replication of influenza virus can be employed to isolate and/or propagate influenza viruses. Isolated viruses can be used to prepare a reassortant virus. In one embodiment, host cells for vaccine production are continuous mammalian or avian cell lines or cell strains. A complete characterization of the cells to be used, may be conducted so that appropriate tests for purity of the final product can be included. Data that can be used for the characterization of a cell includes (a) information on its origin, derivation, and passage history; (b) information on its growth and morphological characteristics; (c) results of tests of adventitious agents; (d) distinguishing features, such as biochemical, immunological and cytogenetic patterns which allow the cells to be clearly recognized among other cell lines; and (e) results of tests for tumorigenicity. In one embodiment, the passage level, or population doubling, of the host cell used is as low as possible.

(33) In one embodiment, the cells are WHO certified, or certifiable, continuous cell lines. The requirements for certifying such cell lines include characterization with respect to at least one of genealogy, growth characteristics, immunological markers, virus susceptibility tumorigenicity and storage conditions, as well as by testing in animals, eggs, and cell culture. Such characterization is used to confirm that the cells are free from detectable adventitious agents. In some countries, karyology may also be required. In addition, tumorigenicity may be tested in cells that are at the same passage level as those used for vaccine production. The virus may be purified by a process that has been shown to give consistent results, before vaccine production (see, e.g., World Health Organization, 1982).

(34) Virus produced by the host cell may be highly purified prior to vaccine or gene therapy formulation. Generally, the purification procedures result in extensive removal of cellular DNA and other cellular compoenents, and adventitious agents. Procedures that extensively degrade or denature DNA may also be used.

(35) Influenza Vaccines

(36) A vaccine of the invention includes an isolated recombinant influenza virus of the invention, and optionally one or more other isolated viruses including other isolated influenza viruses, one or more immunogenic proteins or glycoproteins of one or more isolated influenza viruses or one or more other pathogens, e.g., an immunogenic protein from one or more bacteria, non-influenza viruses, yeast or fungi, or isolated nucleic acid encoding one or more viral proteins (e.g., DNA vaccines) including one or more immunogenic proteins of the isolated influenza virus of the invention. In one embodiment, the influenza viruses of the invention may be vaccine vectors for influenza virus or other pathogens.

(37) A complete virion vaccine may be concentrated by ultrafiltration and then purified by zonal centrifugation or by chromatography. Viruses other than the virus of the invention, such as those included in a multivalent vaccine, may be inactivated before or after purification using formalin or beta-propiolactone, for instance.

(38) A subunit vaccine comprises purified glycoproteins. Such a vaccine may be prepared as follows: using viral suspensions fragmented by treatment with detergent, the surface antigens are purified, by ultracentrifugation for example. The subunit vaccines thus contain mainly HA protein, and also NA. The detergent used may be cationic detergent for example, such as hexadecyl trimethyl ammonium bromide (Bachmeyer, 1975), an anionic detergent such as ammonium deoxycholate (Laver & Webster, 1976); or a nonionic detergent such as that commercialized under the name TRITON X100. The hemagglutinin may also be isolated after treatment of the virions with a protease such as bromelin, and then purified. The subunit vaccine may be combined with an attenuated virus of the invention in a multivalent vaccine.

(39) A split vaccine comprises virions which have been subjected to treatment with agents that dissolve lipids. A split vaccine can be prepared as follows: an aqueous suspension of the purified virus obtained as above, inactivated or not, is treated, under stirring, by lipid solvents such as ethyl ether or chloroform, associated with detergents. The dissolution of the viral envelope lipids results in fragmentation of the viral particles. The aqueous phase is recuperated containing the split vaccine, constituted mainly of hemagglutinin and neuraminidase with their original lipid environment removed, and the core or its degradation products. Then the residual infectious particles are inactivated if this has not already been done. The split vaccine may be combined with an attenuated virus of the invention in a multivalent vaccine.

(40) Inactivated Vaccines. Inactivated influenza virus vaccines are provided by inactivating replicated virus using known methods, such as, but not limited to, formalin or -propiolactone treatment. Inactivated vaccine types that can be used in the invention can include whole-virus (WV) vaccines or subvirion (SV) (split) vaccines. The WV vaccine contains intact, inactivated virus, while the SV vaccine contains purified virus disrupted with detergents that solubilize the lipid-containing viral envelope, followed by chemical inactivation of residual virus.

(41) In addition, vaccines that can be used include those containing the isolated HA and NA surface proteins, which are referred to as surface antigen or subunit vaccines.

(42) Live Attenuated Virus Vaccines. Live, attenuated influenza virus vaccines, such as those including a recombinant virus of the invention can be used for preventing or treating influenza virus infection. Attenuation may be achieved in a single step by transfer of attenuated genes from an attenuated donor virus to a replicated isolate or reassorted virus according to known methods. Since resistance to influenza A virus is mediated primarily by the development of an immune response to the HA and/or NA glycoproteins, the genes coding for these surface antigens come from the reassorted viruses or clinical isolates. The attenuated genes are derived from an attenuated parent. In this approach, genes that confer attenuation generally do not code for the HA and NA glycoproteins.

(43) Viruses (donor influenza viruses) are available that are capable of reproducibly attenuating influenza viruses, e.g., a cold adapted (ca) donor virus can be used for attenuated vaccine production. Live, attenuated reassortant virus vaccines can be generated by mating the ca donor virus with a virulent replicated virus. Reassortant progeny are then selected at 25 C. (restrictive for replication of virulent virus), in the presence of an appropriate antiserum, which inhibits replication of the viruses bearing the surface antigens of the attenuated ca donor virus. Useful reassortants are: (a) infectious, (b) attenuated for seronegative non-adult mammals and immunologically primed adult mammals, (c) immunogenic and (d) genetically stable. The immunogenicity of the ca reassortants parallels their level of replication. Thus, the acquisition of the six transferable genes of the ca donor virus by new wild-type viruses has reproducibly attenuated these viruses for use in vaccinating susceptible mammals both adults and non-adult.

(44) Other attenuating mutations can be introduced into influenza virus genes by site-directed mutagenesis to rescue infectious viruses bearing these mutant genes. Attenuating mutations can be introduced into non-coding regions of the genome, as well as into coding regions. Such attenuating mutations can also be introduced into genes other than the HA or NA, e.g., the PB2 polymerase gene. Thus, new donor viruses can also be generated bearing attenuating mutations introduced by site-directed mutagenesis, and such new donor viruses can be used in the production of live attenuated reassortants vaccine candidates in a manner analogous to that described above for the ca donor virus. Similarly, other known and suitable attenuated donor strains can be reassorted with influenza virus to obtain attenuated vaccines suitable for use in the vaccination of mammals.

(45) In one embodiment, such attenuated viruses maintain the genes from the virus that encode antigenic determinants substantially similar to those of the original clinical isolates. This is because the purpose of the attenuated vaccine is to provide substantially the same antigenicity as the original clinical isolate of the virus, while at the same time lacking pathogenicity to the degree that the vaccine causes minimal chance of inducing a serious disease condition in the vaccinated mammal.

(46) The viruses in a multivalent vaccine can thus be attenuated or inactivated, formulated and administered, according to known methods, as a vaccine to induce an immune response in an animal, e.g., a mammal. Methods are well-known in the art for determining whether such attenuated or inactivated vaccines have maintained similar antigenicity to that of the clinical isolate or high growth strain derived therefrom. Such known methods include the use of antisera or antibodies to eliminate viruses expressing antigenic determinants of the donor virus; chemical selection (e.g., amantadine or rimantidine); HA and NA activity and inhibition; and nucleic acid screening (such as probe hybridization or PCR) to confirm that donor genes encoding the antigenic determinants (e.g., HA or NA genes) are not present in the attenuated viruses.

(47) Pharmaceutical Compositions

(48) Pharmaceutical compositions of the present invention, suitable for inoculation, e.g., nasal, parenteral or oral administration, comprise one or more influenza virus isolates, e.g., one or more attenuated or inactivated influenza viruses, a subunit thereof, isolated protein(s) thereof, and/or isolated nucleic acid encoding one or more proteins thereof, optionally further comprising sterile aqueous or non-aqueous solutions, suspensions, and emulsions. The compositions can further comprise auxiliary agents or excipients, as known in the art. The composition of the invention is generally presented in the form of individual doses (unit doses).

(49) Conventional vaccines generally contain about 0.1 to 200 g, e.g., 30 to 100 g, of HA from each of the strains entering into their composition. The vaccine forming the main constituent of the vaccine composition of the invention may comprise a single influenza virus, or a combination of influenza viruses, for example, at least two or three influenza viruses, including one or more reassortant(s).

(50) Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and/or emulsions, which may contain auxiliary agents or excipients known in the art. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption. Liquid dosage forms for oral administration may generally comprise a liposome solution containing the liquid dosage form. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water. Besides the inert diluents, such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents.

(51) When a composition of the present invention is used for administration to an individual, it can further comprise salts, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition. For vaccines, adjuvants, substances which can augment a specific immune response, can be used. Normally, the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the organism being immunized.

(52) Heterogeneity in a vaccine may be provided by mixing replicated influenza viruses for at least two influenza virus strains, such as 2-20 strains or any range or value therein. Vaccines can be provided for variations in a single strain of an influenza virus, using techniques known in the art.

(53) A pharmaceutical composition according to the present invention may further or additionally comprise at least one chemotherapeutic compound, for example, for gene therapy, immunosuppressants, anti-inflammatory agents or immune enhancers, and for vaccines, chemotherapeutics including, but not limited to, gamma globulin, amantadine, guanidine, hydroxybenzimidazole, interferon-, interferon, interferon-, tumor necrosis factor-alpha, thiosemicarbarzones, methisazone, rifampin, ribavirin, a pyrimidine analog, a purine analog, foscarnet, phosphonoacetic acid, acyclovir, dideoxynucleosides, a protease inhibitor, or ganciclovir.

(54) The composition can also contain variable but small quantities of endotoxin-free formaldehyde, and preservatives, which have been found safe and not contributing to undesirable effects in the organism to which the composition is administered.

(55) Pharmaceutical Purposes

(56) The administration of the composition (or the antisera that it elicits) may be for either a prophylactic or therapeutic purpose. When provided prophylactically, the compositions of the invention which are vaccines are provided before any symptom or clinical sign of a pathogen infection becomes manifest. The prophylactic administration of the composition serves to prevent or attenuate any subsequent infection. When provided prophylactically, the gene therapy compositions of the invention, are provided before any symptom or clinical sign of a disease becomes manifest. The prophylactic administration of the composition serves to prevent or attenuate one or more symptoms or clinical signs associated with the disease.

(57) When provided therapeutically, a viral vaccine is provided upon the detection of a symptom or clinical sign of actual infection. The therapeutic administration of the compound(s) serves to attenuate any actual infection. When provided therapeutically, a gene therapy composition is provided upon the detection of a symptom or clinical sign of the disease. The therapeutic administration of the compound(s) serves to attenuate a symptom or clinical sign of that disease.

(58) Thus, a vaccine composition of the present invention may be provided either before the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection. Similarly, for gene therapy, the composition may be provided before any symptom or clinical sign of a disorder or disease is manifested or after one or more symptoms are detected.

(59) A composition is said to be pharmacologically acceptable if its administration can be tolerated by a recipient mammal. Such an agent is said to be administered in a therapeutically effective amount if the amount administered is physiologically significant. A composition of the present invention is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient, e.g., enhances at least one primary or secondary humoral or cellular immune response against at least one strain of an infectious influenza virus.

(60) The protection provided need not be absolute, i.e., the influenza infection need not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population or set of mammals. Protection may be limited to mitigating the severity or rapidity of onset of symptoms or clinical signs of the influenza virus infection.

(61) Pharmaceutical Administration

(62) A composition of the present invention may confer resistance to one or more pathogens, e.g., one or more influenza virus strains, by either passive immunization or active immunization. In active immunization, an attenuated live vaccine composition is administered prophylactically to a host (e.g., a mammal), and the host's immune response to the administration protects against infection and/or disease. For passive immunization, the elicited antisera can be recovered and administered to a recipient suspected of having an infection caused by at least one influenza virus strain. A gene therapy composition of the present invention may yield prophylactic or therapeutic levels of the desired gene product by active immunization.

(63) In one embodiment, the vaccine is provided to a mammalian female (at or prior to pregnancy or parturition), under conditions of time and amount sufficient to cause the production of an immune response which serves to protect both the female and the fetus or newborn (via passive incorporation of the antibodies across the placenta or in the mother's milk).

(64) The present invention thus includes methods for preventing or attenuating a disorder or disease, e.g., an infection by at least one strain of pathogen. As used herein, a vaccine is said to prevent or attenuate a disease if its administration results either in the total or partial attenuation (i.e., suppression) of a clinical sign or condition of the disease, or in the total or partial immunity of the individual to the disease. As used herein, a gene therapy composition is said to prevent or attenuate a disease if its administration results either in the total or partial attenuation (i.e., suppression) of a clinical sign or condition of the disease, or in the total or partial immunity of the individual to the disease.

(65) A composition having at least one influenza virus of the present invention, including one which is attenuated and one or more other isolated viruses, one or more isolated viral proteins thereof, one or more isolated nucleic acid molecules encoding one or more viral proteins thereof, or a combination thereof, may be administered by any means that achieve the intended purposes.

(66) For example, administration of such a composition may be by various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, oral or transdermal routes. Parenteral administration can be accomplished by bolus injection or by gradual perfusion over time.

(67) A typical regimen for preventing, suppressing, or treating an influenza virus related pathology, comprises administration of an effective amount of a vaccine composition as described herein, administered as a single treatment, or repeated as enhancing or booster dosages, over a period up to and including between one week and about 24 months, or any range or value therein.

(68) According to the present invention, an effective amount of a composition is one that is sufficient to achieve a desired effect. It is understood that the effective dosage may be dependent upon the species, age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect wanted. The ranges of effective doses provided below are not intended to limit the invention and represent dose ranges.

(69) The dosage of a live, attenuated or killed virus vaccine for an animal such as a mammalian adult organism may be from about 10.sup.2-10.sup.15, e.g., 10.sup.3-10.sup.12, plaque forming units (PFU)/kg, or any range or value therein. The dose of inactivated vaccine may range from about 0.1 to 1000, e.g., 30 to 100 g, of HA protein. However, the dosage should be a safe and effective amount as determined by conventional methods, using existing vaccines as a starting point.

(70) The dosage of immunoreactive HA in each dose of replicated virus vaccine may be standardized to contain a suitable amount, e.g., 30 to 100 g or any range or value therein, or the amount recommended by government agencies or recognized professional organizations. The quantity of NA can also be standardized, however, this glycoprotein may be labile during purification and storage.

(71) The dosage of immunoreactive HA in each dose of replicated virus vaccine can be standardized to contain a suitable amount, e.g., 1-50 g or any range or value therein, or the amount recommended by the U.S. Public Heath Service (PHS), which is usually 15 g, per component for children >3 years of age, and 7.5 g per component for children <3 years of age. The quantity of NA can also be standardized, however, this glycoprotein can be labile during the processor purification and storage (Kendal et al., 1980; Kerr et al., 1975). Each 0.5-ml dose of vaccine may contains approximately 1-50 billion virus particles, and preferably 10 billion particles.

(72) The invention will be described by the following nonlimiting examples.

EXAMPLE 1

(73) Methods

(74) Cells and Viruses

(75) 293T human embryonic kidney cells are maintained in Dulbecco's modified Eagle's minimal essential medium (DMEM) with 10% fetal calf serum and antibiotics. Madin-Darby canine kidney (MDCK) cells are grown in MEM with 5% newborn calf serum and antibiotics. African green monkey Vero WCB cells, which had been established after biosafety tests for use in human vaccine production (Sugawara et al., 2002), are maintained in serum-free VP-SFM medium (GIBCO-BRL) with antibiotics. Cells are maintained at 37 C., in 5% CO.sub.2. A WHO-recommended vaccine seed virus is NIBRG-14.

(76) Construction of Plasmids and Reverse Genetics

(77) To generate reassortants of influenza A viruses, a plasmid-based reverse genetics (Neumann et al., 1999) is used. The full-length cDNAs were cloned into a plasmid under control of the human polymerase I promoter and the mouse RNA polymerase I terminator (PolI plasmids).

(78) A previously produced series of PolI constructs, derived from A/WSN/33 (H5N1; WSN) or PR8 strains is used, for reverse genetics (Horimoto et al., 2006; Neumann et al., 1999). The World Health Organization (WHO) recommends A/Puerto Rico/8/34 (H1N1; PR8) as a donor virus, because of its safety in humans (Wood & Robertson, 2004; Webby & Webster, 2003).

(79) Plasmids expressing WSN or PR8 NP, PA, PB1, or PB2 under control of the chicken -actin promoter are used for all reverse genetics experiments (Horimoto et al., 2006; Neumann et al., 1999). Briefly, PolI plasmids and protein expression plasmids are mixed with a transfection reagent, Trans-IT 293T (Panvera), incubated at room temperature for 15 minutes, and then added to 293T cells. Transfected cells are incubated in Opti-MEM I (GIBCO-BRL) for 48 hours. For reverse genetics in Vero WCB cells, an electroporator (Amaxa) is used to transfect the plasmid mixtures according to the manufacturer's instructions. Sixteen hours after transfection, freshly prepared Vero WCB cells were added onto the transfected cells and TPCK-trypsin (1 g/mL) is added to the culture 6 hours later. Transfected cells are incubated in serum-free VP-SFM for a total of 4 days. Supernatants containing infectious viruses are harvested, and may bebiologically cloned by limiting dilution.

(80) A recombinant virus having the HA and NA genes from A/Hong Kong/213/2003 (H5N1) and the remainder of the type A influenza virus genes from PR8(UW) was prepared. The titer of the recombinant virus was 10.sup.10.67 EID.sub.50/mL, and the HA titer was 1:1600

(81) TABLE-US-00001 TABLE 1 Virus possessing PR8 genes together with the following HA and NA HA titer (HAU/mL) in each dilition genes 10-2 10-3 10-4 10-5 10-6 10-7 10-8 WSN-HA NA 160 40 40 320 40 640 <1 HK-HAavir 400 800 400 400 400 800 <1 NA

(82) The sequences of PR8 (UW) genes are as follows:

(83) TABLE-US-00002 PA (SEQIDNO:1) AGCGAAAGCAGGTACTGATCCAAAATGGAAGATTTTGTGCGACAATGCTT CAATCCGATGATTGTCGAGCTTGCGGAAAAAACAATGAAAGAGTATGGGG AGGACCTGAAAATCGAAACAAACAAATTTGCAGCAATATGCACTCACTTG GAAGTATGCTTCATGTATTCAGATTTTCACTTCATCAATGAGCAAGGCGA GTCAATAATCGTAGAACTTGGTGATCCAAATGCACTTTTGAAGCACAGAT TTGAAATAATCGAGGGAAGAGATCGCACAATGGCCTGGACAGTAGTAAAC AGTATTTGCAACACTACAGGGGCTGAGAAACCAAAGTTTCTACCAGATTT GTATGATTACAAGGAGAATAGATTCATCGAAATTGGAGTAACAAGGAGAG AAGTTCACATATACTATCTGGAAAAGGCCAATAAAATTAAATCTGAGAAA ACACACATCCACATTTTCTCGTTCACTGGGGAAGAAATGGCCACAAAGGC AGACTACACTCTCGATGAAGAAAGCAGGGCTAGGATCAAAACCAGACTAT TCACCATAAGACAAGAAATGGCCAGCAGAGGCCTCTGGGATTCCTTTCGT CAGTCCGAGAGAGGAGAAGAGACAATTGAAGAAAGGTTTGAAATCACAGG AACAATGCGCAAGCTTGCCGACCAAAGTCTCCCGCCGAACTTCTCCAGCC TTGAAAATTTTAGAGCCTATGTGGATGGATTCGAACCGAACGGCTACATT GAGGGCAAGCTGTCTCAAATGTCCAAAGAAGTAAATGCTAGAATTGAACC TTTTTTGAAAACAACACCACGACCACTTAGACTTCCGAATGGGCCTCCCT GTTCTCAGCGGTCCAAATTCCTGCTGATGGATGCCTTAAAATTAAGCATT GAGGACCCAAGTCATGAAGGAGAGGGAATACCGCTATATGATGCAATCAA ATGCATGAGAACATTCTTTGGATGGAAGGAACCCAATGTTGTTAAACCAC ACGAAAAGGGAATAAATCCAAATTATCTTCTGTCATGGAAGCAAGTACTG GCAGAACTGCAGGACATTGAGAATGAGGAGAAAATTCCAAAGACTAAAAA TATGAAGAAAACAAGTCAGCTAAAGTGGGCACTTGGTGAGAACATGGCAC CAGAAAAGGTAGACTTTGACGACTGTAAAGATGTAGGTGATTTGAAGCAA TATGATAGTGATGAACCAGAATTGAGGTCGCTTGCAAGTTGGATTCAGAA TGAGTTTAACAAGGCATGCGAACTGACAGATTCAAGCTGGATAGAGCTCG ATGAGATTGGAGAAGATGTGGCTCCAATTGAACACATTGCAAGCATGAGA AGGAATTATTTCACATCAGAGGTGTCTCACTGCAGAGCCACAGAATACAT AATGAAGGGAGTGTACATCAATACTGCCTTGCTTAATGCATCTTGTGCAG CAATGGATGATTTCCAATTAATTCCAATGATAAGCAAGTGTAGAACTAAG GAGGGAAGGCGAAAGACCAACTTGTATGGTTTCATCATAAAAGGAAGATC CCACTTAAGGAATGACACCGACGTGGTAAACTTTGTGAGCATGGAGTTTT CTCTCACTGACCCAAGACTTGAACCACATAAATGGGAGAAGTACTGTGTT CTTGAGATAGGAGATATGCTTATAAGAAGTGCCATAGGCCAGGTTTCAAG GCCCATGTTCTTGTATGTGAGAACAAATGGAACCTCAAAAATTAAAATGA AATGGGGAATGGAGATGAGGCGTTGCCTCCTCCAGTCACTTCAACAAATT GAGAGTATGATTGAAGCTGAGTCCTCTGTCAAAGAGAAAGACATGACCAA AGAGTTCTTTGAGAACAAATCAGAAACATGGCCCATTGGAGAGTCCCCCA AAGGAGTGGAGGAAAGTTCCATTGGGAAGGTCTGCAGGACTTTATTAGCA AAGTCGGTATTCAACAGCTTGTATGCATCTCCACAACTAGAAGGATTTTC AGCTGAATCAAGAAAACTGCTTCTTATCGTTCAGGCTCTTAGGGACAACC TGGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAG TGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCTTCTTGGTTCAACTC CTTCCTTACACATGCATTGAGTTAGTTGTGGCAGTGCTACTATTTGCTAT CCATACTGTCCAAAAAAGTACCTTGTTTCTACT PB1 (SEQIDNO:2) AGCGAAAGCAGGCAAACCATTTGAATGGATGTCAATCCGA CCTTACTTTTCTTAAAAGTGCCAGCACAAAATGCTATAAGCACAACTTTC CCTTATACTGGAGACCCTCCTTACAGCCATGGGACAGGAACAGGATACAC CATGGATACTGTCAACAGGACACATCAGTACTCAGAAAAGGGAAGATGGA CAACAAACACCGAAACTGGAGCACCGCAACTCAACCCGATTGATGGGCCA CTGCCAGAAGACAATGAACCAAGTGGTTATGCCCAAACAGATTGTGTATT GGAGGCGATGGCTTTCCTTGAGGAATCCCATCCTGGTATTTTTGAAAACT CGTGTATTGAAACGATGGAGGTTGTTCAGCAAACACGAGTAGACAAGCTG ACACAAGGCCGACAGACCTATGACTGGACTCTAAATAGAAACCAACCTGC TGCAACAGCATTGGCCAACACAATAGAAGTGTTCAGATCAAATGGCCTCA CGGCCAATGAGTCTGGAAGGCTCATAGACTTCCTTAAGGATGTAATGGAG TCAATGAACAAAGAAGAAATGGGGATCACAACTCATTTTCAGAGAAAGAG ACGGGTGAGAGACAATATGACTAAGAAAATGATAACACAGAGAACAATGG GTAAAAAGAAGCAGAGATTGAACAAAAGGAGTTATCTAATTAGAGCATTG ACCCTGAACACAATGACCAAAGATGCTGAGAGAGGGAAGCTAAAACGGAG AGCAATTGCAACCCCAGGGATGCAAATAAGGGGGTTTGTATACTTTGTTG AGACACTGGCAAGGAGTATATGTGAGAAACTTGAACAATCAGGGTTGCCA GTTGGAGGCAATGAGAAGAAAGCAAAGTTGGCAAATGTTGTAAGGAAGAT GATGACCAATTCTCAGGACACCGAACTTTCTTTCACCATCACTGGAGATA ACACCAAATGGAACGAAAATCAGAATCCTCGGATGTTTTTGGCCATGATC ACATATATGACCAGAAATCAGCCCGAATGGTTCAGAAATGTTCTAAGTAT TGCTCCAATAATGTTCTCAAACAAAATGGCGAGACTGGGAAAAGGGTATA TGTTTGAGAGCAAGAGTATGAAACTTAGAACTCAAATACCTGCAGAAATG CTAGCAAGCATCGATTTGAAATATTTCAATGATTCAACAAGAAAGAAGAT TGAAAAAATCCGACCGCTCTTAATAGAGGGGACTGCATCATTGAGCCCTG GAATGATGATGGGCATGTTCAATATGTTAAGCACTGTATTAGGCGTCTCC ATCCTGAATCTTGGACAAAAGAGATACACCAAGACTACTTACTGGTGGGA TGGTCTTCAATCCTCTGACGATTTTGCTCTGATTGTGAATGCACCCAATC ATGAAGGGATTCAAGCCGGAGTCGACAGGTTTFATCGAACCTGTAAGCTA CTTGGAATCAATATGAGCAAGAAAAAGTCTTACATAAACAGAACAGGTAC ATTTGAATTCACAAGTTTTTTCTATCGTTATGGGTTTGTTGCCAATTTCA GCATGGAGCTTCCCAGTTTTGGGGTGTCTGGGATCAACGAGTCAGCGGAC ATGAGTATTGGAGTTACTGTCATCAAAAACAATATGATAAACAATGATCT TGGTCCAGCAACAGCTCAAATGGCCCTTCAGTTGTTCATCAAAGATTACA GGTACACGTACCGATGCCATATAGGTGACACACAAATACAAACCCGAAGA TCATTTGAAATAAAGAAACTGTGGGAGCAAACCCGTTCCAAAGCTGGACT GCTGGTCTCCGACGGAGGCCCAAATTTATACAACATTAGAAATCTCCACA TTCCTGAAGTCTGCCTAAAATGGGAATTGATGGATGAGGATTACCAGGGG CGTTTATGCAACCCACTGAACCCATTTGTCAGCCATAAAGAAATTGAATC AATGAACAATGCAGTGATGATGCCAGCACATGGTCCAGCCAAAAACATGG AGTATGATGCTGTTGCAACAACACACTCCTGGATCCCCAAAAGAAATCGA TCCATCTTGAATACAAGTCAAAGAGGAGTACTTGAGGATGAACAAATGTA CCAAAGGTGCTGCAATTTATTTGAAAAATTCTTCCCCAGCAGTTCATACA GAAGACCAGTCGGGATATCCAGTATGGTGGAGGCTATGGTTTCCAGAGCC CGAATTGATGCACGGATTGATTTCGAATCTGGAAGGATAAAGAAAGAAGA GTTCACTGAGATCATGAAGATCTGTTCCACCATTGAAGAGCTCAGACGGC AAAAATAGTGAATTTAGCTTGTCCTTCATGAAAAAATGCCTTGTTTCTAC T PB2 (SEQIDNO:3) AGCGAAAGCAGGTCAATTATATTCAATATGGAAAGAATAAAAGAACTACG AAATCTAATGTCGCAGTCTCGCACCCGCGAGATACTCACAAAAACCACCG TGGACCATATGGCCATAATCAAGAAGTACACATCAGGAAGACAGGAGAAG AACCCAGCACTTAGGATGAAATGGATGATGGCAATGAAATATCCAATTAC AGCAGACAAGAGGATAACGGAAATGATTCCTGAGAGAAATGAGCAAGGAC AAACTTTATGGAGTAAAATGAATGATGCCGGATCAGACCGAGTGATGGTA TCACCTCTGGCTGTGACATGGTGGAATAGGAATGGACCAATAACAAATAC AGTTCATTATCCAAAAATCTACAAAACTTATTTTGAAAGAGTCGAAAGGC TAAAGCATGGAACCTTTGGCCCTGTCCATTTTAGAAACCAAGTCAAAATA CGTCGGAGAGTTGACATAAATCCTGGTCATGCAGATCTCAGTGCCAAGGA GGCACAGGATGTAATCATGGAAGTTGTTTTCCCTAACGAAGTGGGAGCCA GGATACTAACATCGGAATCGCAACTAACGATAACCAAAGAGAAGAAAGAA GAACTCCAGGATTGCAAAATTTCTCCTTTGATGGTTGCATACATGTTGGA GAGAGAACTGGTCCGCAAAACGAGATTCCTCCCAGTGGCTGGTGGAACAA GCAGTGTGTACATTGAAGTGTTGCATTTGACTCAAGGAACATGCTGGGAA CAGATGTATACTCCAGGAGGGGAAGTGAGGAATGATGATGTTGATCAAAG CTTGATTATTGCTGCTAGGAACATAGTGAGAAGAGCTGCAGTATCAGCAG ATCCACTAGCATCTTTATTGGAGATGTGCCACAGCACACAGATTGGTGGA ATTAGGATGGTAGACATCCTTAGGCAGAACCCAACAGAAGAGCAAGCCGT GGATATATGCAAGGCTGCAATGGGACTGAGAATTAGCTCATCCTTCAGTT TTGGTGGATTCACATTTAAGAGAACAAGCGGATCATCAGTCAAGAGAGAG GAAGAGGTGCTTACGGGCAATCTTCAAACATTGAAGATAAGAGTGCATGA GGGATATGAAGAGTTCACAATGGTTGGGAGAAGAGCAACAGCCATACTCA GAAAAGCAACCAGGAGATTGATTCAGCTGATAGTGAGTGGGAGAGACGAA CAGTCGATTGCCGAAGCAATAATTGTGGCCATGGTATTTTCACAAGAGGA TTGTATGATAAAAGCAGTCAGAGGTGATCTGAATTTCGTCAATAGGGCGA ATCAACGATTGAATCCTATGCATCAACTTTTAAGACATTTTCAGAAGGAT GCGAAAGTGCTTTTTCAAAATTGGGGAGTTGAACCTATCGACAATGTGAT GGGAATGATTGGGATATTGCCCGACATGACTCCAAGCATCGAGATGTCAA TGAGAGGAGTGAGAATCAGCAAAATGGGTGTAGATGAGTACTCCAGCACG GAGAGGGTAGTGGTGAGCATTGACCGTTTTTTGAGAATCCGGGACCAACG AGGAAATGTACTACTGTCTCCCGAGGAGGTCAGTGAAACACAGGGAACAG AGAAACTGACAATAACTTACTCATCGTCAATGATGTGGGAGATTAATGGT CCTGAATCAGTGTTGGTCAATACCTATCAATGGATCATCAGAAACTGGGA AACTGTTAAAATTCAGTGGTCCCAGAACCCTACAATGCTATACAATAAAA TGGAATTTGAACCATTTCAGTCTTTAGTACCTAAGGCCATTAGAGGCCAA TACAGTGGGTTTGTAAGAACTCTGTTCCAACAAATGAGGGATGTGCTTGG GACATTTGATACCGCACAGATAATAAAACTTCTTCCCTTCGCAGCCGCTC CACCAAAGCAAAGTAGAATGCAGTTCTCCTCATTTACTGTGAATGTGAGG GGATCAGGAATGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTA TAACAAGGCCACGAAGAGACTCACAGTTCTCGGAAAGGATGCTGGCACTT TAACTGAAGACCCAGATGAAGGCACAGCTGGAGTGGAGTCCGCTGTTCTG AGGGGATTCCTCATTCTGGGCAAAGAAGACAAGAGATATGGGCCAGCACT AAGCATCAATGAACTGAGCAACCTTGCGAAAGGAGAGAAGGCTAATGTGC TAATTGGGCAAGGAGACGTGGTGTTGGTAATGAAACGGAAACGGGACTCT AGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCAT CAATTAGTGTCGAATAGTTTAAAAACGACCTTGTTTCTACT NP (SEQIDNO:4) AGCAAAAGCAGGGTAGATAATCACTCACTGAGTGACATCA AAATCATGGCGTCTCAAGGCACCAAACGATCTTACGAACAGATGGAGACT GATGGAGAACGCCAGAATGCCACTGAAATCAGAGCATCCGTCGGAAAAAT GATTGGTGGAATTGGACGATTCTACATCCAAATGTGCACCGAACTCAAAC TCAGTGATTATGAGGGACGGTTGATCCAAAACAGCTTAACAATAGAGAGA ATGGTGCTCTCTGCTTTTGACGAAAGGAGAAATAAATACCTTGAAGAACA TCCCAGTGCGGGGAAAGATCCTAAGAAAACTGGAGGACCTATATACAGGA GAGTAAACGGAAAGTGGATGAGAGAACTCATCCTTTATGACAAAGAAGAA ATAAGGCGAATCTGGCGCCAAGCTAATAATGGTGACGATGCAACGGCTGG TCTGACTCACATGATGATCTGGCATTCCAATTTGAATGATGCAACTTATC AGAGGACAAGAGCTCTTGTTCGCACCGGAATGGATCCCAGGATGTGCTCT CTGATGCAAGGTTCAACTCTCCCTAGGAGGTCTGGAGCCGCAGGTGCTGC AGTCAAAGGAGTTGGAACAATGGTGATGGAATTGGTCAGAATGATCAAAC GTGGGATCAATGATCGGAACTTCTGGAGGGGTGAGAATGGACGAAAAACA AGAATTGCTTATGAAAGAATGTGCAACATTCTCAAAGGGAAATTTCAAAC TGCTGCACAAAAAGCAATGATGGATCAAGTGAGAGAGAGCCGGAACCCAG GGAATGCTGAGTTCGAAGATCTCACTTTTCTAGCACGGTCTGCACTCATA TTGAGAGGGTCGGTTGCTCACAAGTCCTGCCTGCCTGCCTGTGTGTATGG ACCTGCCGTAGCCAGTGGGTACGACTTTGAAAGGGAGGGATACTCTCTAG TCGGAATAGACCCTTTCAGACTGCTTCAAAACAGCCAAGTGTACAGCCTA ATCAGACCAAATGAGAATCCAGCACACAAGAGTCAACTGGTGTGGATGGC ATGCCATTCTGCCGCATTTGAAGATCTAAGAGTATTAAGCTTCATCAAAG GGACGAAGGTGCTCCCAAGAGGGAAGCTTTCCACTAGAGGAGTTCAAATT GCTTCCAATGAAAATATGGAGACTATGGAATCAAGTACACTTGAACTGAG AAGCAGGTACTGGGCCATAAGGACCAGAAGTGGAGGAAACACCAATCAAC AGAGGGCATCTGCGGGCCAAATCAGCATACAACCTACGTTCTCAGTACAG AGAAATCTCCCTTTTGACAGAACAACCATTATGGCAGCATTCAATGGGAA TACAGAGGGGAGAACATCTGACATGAGGACCGAAATCATAAGGATGATGG AAAGTGCAAGACCAGAAGATGTGTCTTTCCAGGGGCGGGGAGTCTTCGAG CTCTCGGACGAAAAGGCAGCGAGCCCGATCGTGCCTTCCTTTGACATGAG TAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAGGAGTACGACAATT AAAGAAAAATACCCTTGTTTCTACT M (SEQIDNO:5) AGCAAAAGCAGGTAGATATTGAAAGATGAGTCTTCTAACCGAGGTCGAAA CGTACGTACTCTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCA CAGAGACTTGAAGATGTCTTTGCAGGGAAGAACACCGATCTTGAGGTTCT CATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGA TTTTAGGATTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAG CGTAGACGCTTTGTCCAAAATGCCCTTAATGGGAACGGGGATCCAAATAA CATGGACAAAGCAGTTAAACTGTATAGGAAGCTCAAGAGGGAGATAACAT TCCATGGGGCCAAAGAAATCTCACTCAGTTATTCTGCTGGTGCACTTGCC AGTTGTATGGGCCTCATATACAACAGGATGGGGGCTGTGACCACTGAAGT GGCATTTGGCCTGGTATGTGCAACCTGTGAACAGATTGCTGACTCCCAGC ATCGGTCTCATAGGCAAATGGTGACAACAACCAATCCACTAATCAGACAT GAGAACAGAATGGTTTTAGCCAGCACTACAGCTAAGGCTATGGAGCAAAT GGCTGGATCGAGTGAGCAAGCAGCAGAGGCCATGGAGGTTGCTAGTCAGG CTAGACAAATGGTGCAAGCGATGAGAACCATTGGGACTCATCCTAGCTCC AGTGCTGGTCTGAAAAATGATCTTCTTGAAAATTTGCAGGCCTATCAGAA ACGAATGGGGGTGCAGATGCAACGGTTCAAGTGATCCTCTCACTATTGCC GCAAATATCATTGGGATCTTGCACTTGACATTGTGGATTCTTGATCGTCT TTTTTTCAAATGCATTTACCGTCGCTTTAAATACGGACTGAAAGGAGGGC CTTCTACGGAAGGAGTGCCAAAGTCTATGAGGGAAGAATATCGAAAGGAA CAGCAGAGTGCTGTGGATGCTGACGATGGTCATTTTGTCAGCATAGAGCT GGAGTAAAAAACTACCTTGTTTCTACT NS (SEQIDNO:6) AGCAAAAGCAGGGTGACAAAAACATAATGGATCCAAACACTGTGTCAAGC TTTCAGGTAGATTGCTTTCTTTGGCATGTCCGCAAACGAGTTGCAGACCA AGAACTAGGCGATGCCCCATTCCTTGATCGGCTTCGCCGAGATCAGAAAT CCCTAAGAGGAAGGGGCAGTACTCTCGGTCTGGACATCAAGACAGCCACA CGTGCTGGAAAGCAGATAGTGGAGCGGATTCTGAAAGAAGAATCCGATGA GCACTTAAAATGACCATGGCCTCTGTACCTGCGTCGCGTTACCTAACTG ACATGACTCTTGAGGAAATGTCAAGGGACTGGTCCATGCTCATACCCAAG CAGAAAGTGGCAGGCCCTCTTTGTATCAGAATGGACCAGGCGATCATGGA TAAGAACATCATACTGAAAGCGAACTTCAGTGTGATTTTTGACCGGCTGG AGACTCTAATATTGCTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGC GAAATTTCACCATTGCCTTCTCTTCCAGGACATACTGCTGAGGATGTCAA AAATGCAGTTGGAGTCCTCATCGGAGGACTTGAATGGAATGATAACACAG TTCGAGTCTCTGAAACTCTACAGAGATTCGCTTGGAGAAGCAGTAATGAG AATGGGAGACCTCCACTCACTCCAAAACAGAAACGAGAAATGGCGGGAAC AATTAGGTCAGAAGTTTGAAGAAATAAGATGGTTGATTGAAGAAGTGAGA CACAAACTGAAGATAACAGAGAATAGTTTTGAGCAAATAACATTTATGCA AGCCTTACATCTATTGCTTGAAGTGGAGCAAGAGATAAGAACTTTCTCGT TTCAGCTTATTTAGTACTAAAAAACACCCTTGTTTCTACT HA (SEQIDNO:7) AGCAAAAGCAGGGGAAAATAAAAACAACCAAAATGAAGGCAAACCTACTGGTCCTGTTATGTGC ACTTGCAGCTGCAGAT GCAGACACAATATGTATAGGCTACCATGCGAACAATTCAACCGACACTGTTGACACAGTACTCGA GAAGAATGTGACAGT GACACACTCTGTTAACCTGCTCGAAGACAGCCACAACGGAAAACTATGTAGATTAAAAGGAATA GCCCCACTACAATTGG GGAAATGTAACATCGCCGGATGGCTCTTGGGAAACCCAGAATGCGACCCACTGCTTCCAGTGAG ATCATGGTCCTACATT GTAGAAACACCAAACTCTGAGAATGGAATATGTTATCCAGGAGATTTCATCGACTATGAGGAGCT GAGGGAGCAATTGAG CTCAGTGTCATCATTCGAAAGATTCGAAATATTTCCCAAAGAAAGCTCATGGCCCAACCACAACA CAAACGGAGTAACGG CAGCATGCTCCCATGAGGGGAAAAGCAGTTTTTACAGAAATTTGCTATGGCTGACGGAGAAGGA GGGCTCATACCCAAAG CTGAAAAATTCTTATGTGAACAAAAAAGGGAAAGAAGTCCTTGTACTGTGGGGTATTCATCACCC GCCTAACAGTAAGGA ACAACAGAATCTCTATCAGAATGAAAATGCTTATGTCTCTGTAGTGACTTCAAATTATAACAGGA GATTTACCCCGGAAA TAGCAGAAAGACCCAAAGTAAGAGATCAAGCTGGGAGGATGAACTATTACTGGACCTTGCTAAA ACCCGGAGACACAATA ATATTTGAGGCAAATGGAAATCTAATAGCACCAATGTATGCTTTCGCACTGAGTAGAGGCTTTGG GTCCGGCATCATCAC CTCAAACGCATCAATGCATGAGTGTAACACGAAGTGTCAAACACCCCTGGGAGCTATAAACAGC AGTCTCCCTTACCAGA ATATACACCCAGTCACAATAGGAGAGTGCCCAAAATACGTCAGGAGTGCCAAATTGAGGATGGT TACAGGACTAAGGAAC ATTCCGTCCATTCAATCCAGAGGTCTATTTGGAGCCATTGCCGGTTTTATTGAAGGGGGATGGAC TGGAATGATAGATGG ATGGTATGGTTATCATCATCAGAATGAACAGGGATCAGGCTATGCAGCGGATCAAAAAAGCACA CAAAATGCCATTAACG GGATTACAAACAAGGTGAACACTGTTATCGAGAAAATGAACATTCAATTCACAGCTGTGGGTAA AGAATTCAACAAATTA GAAAAAAGGATGGAAAAITTAAATAAAAAAGTTGATGATGGATTTCTGGACATTTGGACATATA ATGCAGAATTGTTAGT TCTACTGGAAAATGAAAGGACTCTGGATTTCCATGACTCAAATGTGAAGAATCTGTATGAGAAAG TAAAAAGCCAATTAA AGAATAATGCCAAAGAAATCGGAAATGGATGTTTTGAGTTCTACCACAAGTGTGACAATGAATG CATGGAAAGTGTAAGA AATGGGACTTATGATTATCCCAAATATTCAGAAGAGTCAAAGTTGAACAGGGAAAAGGTAGATG GAGTGAAATTGGAATC AATGGGGATCTATCAGATTCTGGCGATCTACTCAACTGTCGCCAGTTCACTGGTGCTTTTGGTCTC CCTGGGGGCAATCA GTTTCTGGATGTGTTCTAATGGATCTTTGCAGTGCAGAATATGCATCTGAGATTAGAATTTCAGAG ATATGAGGAAAAAC ACCCTTGTTTCTACT NA (SEQIDNO:8) AGCAAAAGCAGGGGTTTAAAATGAATCCAAATCAGAAAATAATAACCATTGGATCAATCTGTCT GGTAGTCGGACTAATT AGCCTAATATTGCAAATAGGGAATATAATCTCAATATGGATTAGCCATTCAATTCAAACTGGAAG TCAAAACCATACTGG AATATGCAACCAAAACATCATTACCTATAAAAATAGCACCTGGGTAAAGGACACAACTTCAGTG ATATTAACCGGCAATT CATCTCTTTGTCCCATCCGTGGGTGGGCTATATACAGCAAAGACAATAGCATAAGAATTGGTTCC AAAGGAGACGTTTTT GTCATAAGAGAGCCCTTTATTTCATGTTCTCACTTGGAATGCAGGACCTTTTTTCTGACCCAAGGT GCCTTACTGAATGA CAAGCATTCAAGTGGGACTGTTAAGGACAGAAGCCCTTATAGGGCCTTAATGAGCTGCCCTGTCG GTGAAGCTCCGTCCC CGTACAATTCAAGATTTGAATCGGTTGCTTGGTCAGCAAGTGCATGTCATGATGGCATGGGCTGG CTAACAATCGGAATT TCAGGTCCAGATAATGGAGCAGTGGCTGTATTAAAATACAACGGCATAATAACTGAAACCATAA AAAGTTGGAGGAAGAA AATATTGAGGACACAAGAGTCTGAATGTGCCTGTGTAAATGGTTCATGTTTTACTATAATGACTG ATGGCCCGAGTGATG GGCTGGCCTCGTACAAAATTTTCAAGATCGAAAAGGGGAAGGTTACTAAATCAATAGAGTTGAA TGCACCTAATTCTCAC TATGAGGAATGTTCCTGTTACCCTGATACCGGCAAAGTGATGTGTGTGTGCAGAGACAATTGGCA TGGTTCGAACCGGCC ATGGGTGTCTTTCGATCAAAACCTGGATTATCAAATAGGATACATCTGCAGTGGGGTTTTCGGTG ACAACCCGCGTCCCG AAGATGGAACAGGCAGCTGTGGTCCAGTGTATGTTGATGGAGCAAACGGAGTAAAGGGATTTTC ATATAGGTATGGTAAT GGTGTTTGGATAGGAAGGACCAAAAGTCACAGTTCCAGACATGGGTTTGAGATGATTTGGGATCC TAATGGATGGACAGA GACTGATAGTAAGTTCTCTGTGAGGCAAGATGTTGTGGCAATGACTGATTGGTCAGGGTATAGCG GAAGTTTCGTTCAAC ATCCTGAGCTGACAGGGCTAGACTGTATGAGGCCGTGCTTCTGGGTTGAATTAATCAGGGGACGA CCTAAAGAAAAAACA ATCTGGACTAGTGCGAGCAGCATTTCTTTTTGTGGCGTGAATAGTGATACTGTAGATTGGTCTTGG CCAGACGGTGCTGA GTTGCCATTCAGCATTGACAAGTAGTCTGTTCAAAAAACTCCTTGTTTCTACT

(84) High-titer A/PR/8/34 (H1N1, PR8(UW)) virus grows 10 times better than other A/PR/8/34 PR8 strains in eggs (10.sup.10 EID.sub.50/mL; HA titer:1:8.000). Thus, replacement of the HA and NA genes of PR8(UW) with those of a currently circulating strain of influenza virus results in a vaccine strain that can be safely produced, and validates the use of PR8(UW) as a master vaccine strain.

(85) Genes that contribute to different growth properties between PR8(UW) and PR8 (Cambridge), which provides the non-HA and -NA genes of the NIBRG-14 vaccine strain (FIGS. 1A-C), were determined. Higher titers in eggs were obtained when the majority of internal genes were from PR8(UW). Highest titers were with the M gene segment of PR8(UW) and the NS gene of PR8 (Cambridge). The NS gene in PR8(UW) has a K (lysine) at residue 55 while the NS gene in PR8(Cam) has a E (glutamic acid). The polymerase subunit (PA, PB1, and PB2) and NP genes of PR8(UW) enhanced the growth of an H5N1 vaccine seed virus in chicken embryonated eggs, and the NS gene of PR8(Cambridge) enhanced the growth of an H5N1 vaccine seed virus in chicken embryonated eggs. A tyrosine (Y) at position 360 in PB2 of PR8(UW) likely contributes to the high growth rate of that virus in MDCK cells.

EXAMPLE 2

(86) To establish robust systems for influenza vaccine production, egg-free, cell culture-based systems are needed. Vero cells are approved for human use and so are candidate hosts for influenza virus vaccine production. To elucidate the molecular basis for efficient growth of influenza vaccine seed virus in Vero cells. A/Puerto Rico/8/34 (PR8) virus was passaged through Vero cells 12 times and the infectivity titer of the resulting virus was determined. Vero cell-adapted PR8 had over a 4 log increase in infectivity titers relative to non Vero cell-adapted PR8 (FIG. 2).

(87) To determine the molecular basis for that growth difference, the genomes of both isolates were sequenced. Three amino acid differences were found: one in HA2, one in NA and one in PB2 (FIG. 3). To identify the contribution of each individual substitution, and of a combination of two of the substitutions, recombinant viruses with the individual substitution(s) were prepared and the growth of those recombinant viruses was compared to Vero cell-adapted PR8 and non Vero cell-adapted PR8 (FIG. 4). The results indicated that the substitution in HA2 was primarily responsible for the enhanced growth in Vero cells. The substitution in HA2 (N117D) did not enhance growth in MDCK cells (FIG. 5).

(88) Because HA2 has a fusion domain that is exposed after infection, a fusion assay was employed to compare the properties of wild-type PR8 HA2 and HA2 N117D (FIGS. 7-8). The HA2 N117D mutant fused Vero cells at a higher pH than wild-type PR8. The endosomal pH in Vero cells and MDCK cells was determined using pH sensitive and insensitive dyes (FIGS. 9-10). The endosomes of Vero cells likely have a higher pH than those from MDCK cells. Thus, the HA2 N117D mutation may elevate the optimal pH for membrane fusion mediated by HA2, thereby enhancing virus replication efficiency in Vero cells.

(89) To determine if the HA2 N117D mutation alone could enhance virus replication efficiency in different viruses in Vero cells, that substitution was introduced into two different H1N1 viruses (a AAT to GAT mutation) and one H3N2 virus (a AAC to GAC mutation) in a PR8 background (six gene segments were from Vero cell-adapted PR8; PA, PB1, PB2, M. NS and NP) (FIG. 11). The HA2 N117D mutation enhanced the replication efficiency of all three tested viruses in Vero cells. Such a strategy may be employed to prepare vaccine viruses with enhanced replication in Vero cells.

REFERENCES

(90) Avery's Drug Treatment: Principles and Practice of Clinical Pharmacology and Therapeutics, 3rd edition. ADIS Press, Ltd., Williams and Wilkins, Baltimore, Md. (1987).

(91) Aymard-Henry et al., Virology: A Practical Approach, Oxford IRL Press, Oxford, 119-150 (1985).

(92) Bachmeyer, Intervirology, 5:260 (1975).

(93) Berkow et al., eds., The Merck Manual. 16th edition, Merck & Co., Rahway, N.J. (1992).

(94) Hatta et al., Science, 293:1840 (2001).

(95) Horimoto et al., J. Virol., 68:3120 (1994).

(96) Horimoto et al., Vaccine, 24:3669 (2006).

(97) Keitel et al., in Textbook of Influenza, eds. Nickolson. K. G., Webster. R. G., and Hay, A. (Blackwell, Oxford), pp. 373-390 (1998).

(98) Laver & Webster, Virology. 69:511 (1976).

(99) Neumann et al., Adv. Virus Res., 53:265 (1999).

(100) Neumann et al., J. Gen. Virol., 83:2635 (2002).

(101) Neumann et al., J. Virol., 71:9690 (1997).

(102) Neumann et al., Proc. Natl. Acad. Sci. USA, 96:9345 (1999).

(103) Neumann et al., Virology, 287:243 (2001).

(104) Osol (ed.), Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 1324-1341 (1980).

(105) Sugawara et al., Biologicals. 30:303 (2002).

(106) Webby & Webster et al., Science. 302:1519 (2003).

(107) Wood & Robertson. Nat. Rev. Microbiol., 2:842 (2004).

(108) World Health Organization TSR No. 673 (1982).

(109) World Health Organization. Confirmed human cases of avian influenza A (H5N1). http://www.who.int/csr/disease/avian_influenza/country/en/index.html

(110) All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.