COMPOSITIONS AND METHODS FOR TREATING ACUTE MYELOID LEUKEMIA
20200323898 ยท 2020-10-15
Inventors
- Scott Lowe (New York, NY, US)
- Lingbo Zhang (Cold Spring Harbor, NY, US)
- Chichao CHEN (New York, NY, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N2320/12
CHEMISTRY; METALLURGY
A61K9/0021
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
G01N33/6803
PHYSICS
G01N2800/52
PHYSICS
A61K9/0019
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
C12N15/00
CHEMISTRY; METALLURGY
A61K9/0014
HUMAN NECESSITIES
C12N2330/50
CHEMISTRY; METALLURGY
International classification
A61K31/7105
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The present disclosure relates generally to methods for ameliorating or treating acute myeloid leukemia (AML). In particular, the present technology relates to administering a therapeutically effective amount of one or more compositions that inhibit the vitamin B6 pathway to a subject diagnosed with, or at risk for AML.
Claims
1. A method for treating or preventing AML in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one inhibitor of Vitamin B6 pathway selected from the group consisting of isoniazid, aftin-4, DFMO, gingkotoxin, aminooxyacetic acid, and myriocin, or a therapeutically effective amount of at least one sgRNA or shRNA that targets one or more genes selected from the group consisting of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2.
2. (canceled)
3. The method of claim 1 wherein the at least one sgRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of: TABLE-US-00004 (SEQIDNO:1) 5TGGCTACGTGGGTAACAGAG3(Pdxksg-1), (SEQIDNO:2) 5ATCCAGAGCCATGTTGTCCG3(Pdxksg-2), (SEQIDNO:3) 5GTGCAGTTTTCAAACCACAC3(Pdxksg-3), (SEQIDNO:4) 5GCTTGGGGTGCCTGCAGAGA3(Odc1-a106), (SEQIDNO:5) 5TGCTGTTGACAGTGAGCGCCAAGGTGAACGATGTCAATAATAGT GAAGCCACAGATGTATTATTGACATCGTTCACCTTGATGCCTACTGC CTCGGA3(Pdxk.307), (SEQIDNO:6) TGCTGTTGACAGTGAGCGCCAGGTTCAATGTGAGGTTACATAGTGAA GCCACAGATGTATGTAACCTCACATTGAACCTGATGCCTACTGCCTC GGA3(Pdxk.3259), (SEQIDNO:7) 5ACGCCCAGGATGGGATCTGG3(Got2.a41), (SEQIDNO:8) 5AAAGAATACCTGCCCATTGG3(Got2.a99), (SEQIDNO:9) 5GACTGGAGCCTTAAGGGTCG3(Got2.a140), (SEQIDNO:10) 5ATACAGAGCCACGTCATCCG3(hPdxk-aa15), (SEQIDNO:11) 5CGGCTACGTGGGCAACCGGG3(hPdxk-aa22), (SEQIDNO:12) 5GCCTACCGTACACCAGCCTG3(hPdxk-aa105), (SEQIDNO:13) 5GTCCCCAGTGCCCACAAAGA3(hPDXK-aa230), (SEQIDNO:14) 5AATGGCTTTAGTGCAAGAAT3(Azin1-a100), (SEQIDNO:15) 5GAACTACTCCGTTGGCCTGT3(Azin1-a14), (SEQIDNO:16) 5GCCAAGATCTCAAGCACGGC3(Azin1-a76), (SEQIDNO:17) 5ATATTGACGTCATTGGTGTG3(Odc1-a194), (SEQIDNO:18) 5AGGCAGCAGCGTCTTCCGCA3(ALAS1sg-1), (SEQIDNO:19) 5CACCGTTTTAAAAACTCGGT3(ALAS2sg-2), (SEQIDNO:20) 5CTCGGGATAAGAATGGGCAT3(ALAS1sg-3), (SEQIDNO:21) 5TGCGTAAAAGGGAGTGACGC3(Odc1-a62), (SEQIDNO:22) 5GCTGGCCAACCCTCGAGTTA3(SPTLC1sg-1), (SEQIDNO:23) 5GATGGTGCAGGCGCTGTACG3(SPTLC1sg-2), (SEQIDNO:24) 5TCAACTACAACATCGTGTCC3(SPTLC1sg-3), (SEQIDNO:25) 5GCTCCAGGCACACTACAGAT3(SPTLC2sg-1), (SEQIDNO:26) 5GAACGGCTGCGTCAAGAACG3(SPTLC2sg-2), (SEQIDNO:27) 5AATCTCGAAGATATCCAAAG3(SPTLC2sg-3), (SEQIDNO:28) 5GGTGTGTGGTTTCCCCAGGT3(hGOT2.a162), (SEQIDNO:29) 5GATGGGTGTGTGGTTTCCCC3(hGOT2.a163), (SEQIDNO:30) 5GGACGCGGGTCCACTCCCGT3(hGOT2.a218), (SEQIDNO:31) 5TGGACCCGCGTCCGGAACAG3(hGOT2.a224), (SEQIDNO:39) 5ACGATGAACATGTTAGACAT3(hAZIN1-a233), (SEQIDNO:40) 5CTATGTTTATGAACATACCC3(hAZIN1-a33), (SEQIDNO:41) 5TATCTGCTTGATATTGGCGG3(hODC1-a235), (SEQIDNO:42) 5CAACGCTGGGTTGATTACGC3(hODC1-a254), (SEQIDNO:982) 5GGAGGTCCTGGGGAACGTAC3(Pdxksg-4), (SEQIDNO:983) 5CATGGCAGCGAAGAGGTCCC3(Pdxksg-5), (SEQIDNO:984) 5AGCTGTCTTCGTGGGCACCG3(Pdxksg-6), (SEQIDNO:985) 5TGTAACCTCACATTGAACCTGA3, (SEQIDNO:986) 5TTATTGACATCGTTCACCTTGA3, (SEQIDNO:987) 5CATGCGCAAGAGTTACCGCG3(hPNPO-a42:); (SEQIDNO:988) 5ATGACCGGATAGTCTTTCGG3(hPNPO-a232); (SEQIDNO:989) 5GAGTTACCGCGGGGACCGAG3(hPNPO-a45); and (SEQIDNO:990) 5TTCTGTGATCCCTGATCGGG3(hPNPO-a181).
4. The method of claim 1, wherein the subject displays elevated expression levels of PDXK protein in leukemic cells prior to treatment.
5. The method of claim 1, wherein treatment with the at least one sgRNA, shRNA, or inhibitor of Vitamin B6 pathway results in a decrease in PDXK and/or PLP levels in the subject compared to that observed prior to treatment.
6. The method of claim 1, wherein the subject has been diagnosed as having AML.
7. The method of claim 6, wherein the signs or symptoms of AML comprise one or more of leukemic cell proliferation, enlarged lymph nodes, anemia, neutropenia, leukopenia, leukostasis, chloroma, granulocytic sarcoma, myeloid sarcoma, fatigue, weakness, dizziness, chills, headaches, shortness of breath, thrombocytopenia, excess bruising and bleeding, frequent or severe nosebleeds, bleeding gums, gum pain and swelling, headache, weakness in one side of the body, slurred speech, confusion, sleepiness, blurry vision, vision loss, deep venous thrombosis (DVT), pulmonary embolism, bone or joint pain, swelling in the abdomen, seizures, vomiting, facial numbness, defects in balance, weight loss, fever, night sweats, or loss of appetite.
8. The method of claim 1, wherein the subject harbors one or more point mutations in NRAS, DNMT3A, FLT3, KIT, IDH1, IDH2, CEBPA and NPM1.
9. The method of claim 1, wherein the subject harbors one or more gene fusions selected from the group consisting of CBFB-MYH11, DEK-NUP214, MLL-MLLT3, PML-RARA, RBM15-MKL1, RPN1-EVI1 and RUNX1-RUNX1T1.
10. The method of claim 1, wherein the subject is human.
11. The method of claim 1, wherein the at least one sgRNA, shRNA, or inhibitor of Vitamin B6 pathway is administered orally, topically, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, iontophoretically, transmucosally, or intramuscularly.
12. The method of claim 1, further comprising separately, sequentially or simultaneously administering one or more additional therapeutic agents to the subject.
13. The method of claim 12, wherein the one or more additional therapeutic agents are selected from the group consisting of cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, edatrexate (10-ethyl-10-deaza-aminopterin), thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, anthracyclines (e.g., daunorubicin and doxorubicin), cladribine, midostaurin, bevacizumab, oxaliplatin, melphalan, etoposide, mechlorethamine, bleomycin, microtubule poisons, annonaceous acetogenins, chlorambucil, ifosfamide, streptozocin, carmustine, lomustine, busulfan, dacarbazine, temozolomide, altretamine, 6-mercaptopurine (6-MP), cytarabine, floxuridine, fludarabine, hydroxyurea, pemetrexed, epirubicin, idarubicin, SN-38, ARC, NPC, campothecin, 9-nitrocamptothecin, 9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-8951f, MAG-CPT, amsacnne, etoposide phosphate, teniposide, azacitidine (Vidaza), decitabine, accatin III, 10-deacetyltaxol, 7-xylosyl-10-deacetyltaxol, cephalomannine, 10-deacetyl-7-epitaxol, 7-epitaxol, 10-deacetylbaccatin III, 10-deacetyl cephalomannine, streptozotocin, nimustine, ranimustine, bendamustine, uramustine, estramustine, mannosulfan, camptothecin, exatecan, lurtotecan, lamellarin D9-aminocamptothecin, amsacrine, ellipticines, aurintricarboxylic acid, HU-331, and combinations thereof.
14. The method of claim 1, wherein the at least one sgRNA, shRNA, or inhibitor of Vitamin B6 pathway is administered daily for 6 weeks 12 weeks or more.
15. (canceled)
16. A method for monitoring the therapeutic efficacy of a dosage of an inhibitor of Vitamin B6 pathway or an inhibitory RNA that targets a gene selected from the group consisting of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2 in a subject diagnosed with AML comprising: (a) detecting PDXK protein levels or intracellular PLP levels in a test sample obtained from the subject after the subject has been administered the dosage of the inhibitor of Vitamin B6 pathway or the inhibitory RNA; and (b) determining that the dosage of the inhibitor of Vitamin B6 pathway or the inhibitory RNA is effective when the PDXK protein levels or intracellular PLP levels in the test sample are reduced compared to that observed in a control sample obtained from the subject prior to administration of the inhibitor of Vitamin B6 pathway or the inhibitory RNA, wherein the inhibitor of Vitamin B6 pathway is isoniazid, aftin-4, DFMO, gingkotoxin, aminooxyacetic acid, or myriocin.
17. (canceled)
18. The method of claim 16, wherein the inhibitory RNA is a shRNA or a sgRNA.
19. A method for inhibiting leukemic cell proliferation in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one inhibitor of Vitamin B6 pathway selected from the group consisting of isoniazid, aftin-4, DFMO, gingkotoxin, aminooxyacetic acid, and myriocin, or a therapeutically effective amount of at least one sgRNA or shRNA that targets one or more genes selected from the group consisting of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2, wherein the subject suffers from a disease or condition characterized by elevated expression levels and/or increased activity of PDXK.
20. (canceled)
21. The method of claim 16, further comprising detecting intracellular levels of PLP in the subject.
22. The method of claim 19, wherein the at least one sgRNA or shRNA comprises a nucleic acid sequence selected from the group consisting of: TABLE-US-00005 (SEQIDNO:1) 5TGGCTACGTGGGTAACAGAG3(Pdxksg-1), (SEQIDNO:2) 5ATCCAGAGCCATGTTGTCCG3(Pdxksg-2), (SEQIDNO:3) 5GTGCAGTTTTCAAACCACAC3(Pdxksg-3), (SEQIDNO:4) 5GCTTGGGGTGCCTGCAGAGA3(Odc1-a106), (SEQIDNO:5) 5TGCTGTTGACAGTGAGCGCCAAGGTGAACGATGTCAATAATAGT GAAGCCACAGATGTATTATTGACATCGTTCACCTTGATGCCTACTGC CTCGGA3(Pdxk.307), (SEQIDNO:6) TGCTGTTGACAGTGAGCGCCAGGTTCAATGTGAGGTTACATAGTGAA GCCACAGATGTATGTAACCTCACATTGAACCTGATGCCTACTGCCTC GGA3(Pdxk.3259), (SEQIDNO:7) 5ACGCCCAGGATGGGATCTGG3(Got2.a41), (SEQIDNO:8) 5AAAGAATACCTGCCCATTGG3(Got2.a99), (SEQIDNO:9) 5GACTGGAGCCTTAAGGGTCG3(Got2.a140), (SEQIDNO:10) 5ATACAGAGCCACGTCATCCG3(hPdxk-aa15), (SEQIDNO:11) 5CGGCTACGTGGGCAACCGGG3(hPdxk-aa22), (SEQIDNO:12) 5GCCTACCGTACACCAGCCTG3(hPdxk-aa105), (SEQIDNO:13) 5GTCCCCAGTGCCCACAAAGA3(hPDXK-aa230), (SEQIDNO:14) 5AATGGCTTTAGTGCAAGAAT3(Azin1-a100), (SEQIDNO:15) 5GAACTACTCCGTTGGCCTGT3(Azin1-a14), (SEQIDNO:16) 5GCCAAGATCTCAAGCACGGC3(Azin1-a76), (SEQIDNO:17) 5ATATTGACGTCATTGGTGTG3(Odc1-a194), (SEQIDNO:18) 5AGGCAGCAGCGTCTTCCGCA3(ALAS1sg-1), (SEQIDNO:19) 5CACCGTTTTAAAAACTCGGT3(ALAS2sg-2), (SEQIDNO:20) 5CTCGGGATAAGAATGGGCAT3(ALAS1sg-3), (SEQIDNO:21) 5TGCGTAAAAGGGAGTGACGC3(Odc1-a62), (SEQIDNO:22) 5GCTGGCCAACCCTCGAGTTA3(SPTLC1sg-1), (SEQIDNO:23) 5GATGGTGCAGGCGCTGTACG3(SPTLC1sg-2), (SEQIDNO:24) 5TCAACTACAACATCGTGTCC3(SPTLC1sg-3), (SEQIDNO:25) 5GCTCCAGGCACACTACAGAT3(SPTLC2sg-1), (SEQIDNO:26) 5GAACGGCTGCGTCAAGAACG3(SPTLC2sg-2), (SEQIDNO:27) 5AATCTCGAAGATATCCAAAG3(SPTLC2sg-3), (SEQIDNO:28) 5GGTGTGTGGTTTCCCCAGGT3(hGOT2.a162), (SEQIDNO:29) 5GATGGGTGTGTGGTTTCCCC3(hGOT2.a163), (SEQIDNO:30) 5GGACGCGGGTCCACTCCCGT3(hGOT2.a218), (SEQIDNO:31) 5TGGACCCGCGTCCGGAACAG3(hGOT2.a224), (SEQIDNO:39) 5ACGATGAACATGTTAGACAT3(hAZIN1-a233), (SEQIDNO:40) 5CTATGTTTATGAACATACCC3(hAZIN1-a33), (SEQIDNO:41) 5TATCTGCTTGATATTGGCGG3(hODC1-a235), (SEQIDNO:42) 5CAACGCTGGGTTGATTACGC3(hODC1-a254), (SEQIDNO:982) 5GGAGGTCCTGGGGAACGTAC3(Pdxksg-4), (SEQIDNO:983) 5CATGGCAGCGAAGAGGTCCC3(Pdxksg-5), (SEQIDNO:984) 5AGCTGTCTTCGTGGGCACCG3(Pdxksg-6), (SEQIDNO:985) 5TGTAACCTCACATTGAACCTGA3, (SEQIDNO:986) 5TTATTGACATCGTTCACCTTGA3, (SEQIDNO:987) 5CATGCGCAAGAGTTACCGCG3(hPNPO-a42:); (SEQIDNO:988) 5ATGACCGGATAGTCTTTCGG3(hPNPO-a232); (SEQIDNO:989) 5GAGTTACCGCGGGGACCGAG3(hPNPO-a45); and (SEQIDNO:990) 5TTCTGTGATCCCTGATCGGG3(hPNPO-a181).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
DETAILED DESCRIPTION
[0179] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.
[0180] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Pat. No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir's Handbook of Experimental Immunology.
Definitions
[0181] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms a, an and the include plural referents unless the content clearly dictates otherwise. For example, reference to a cell includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.
[0182] As used herein, the term about in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).
[0183] As used herein, the administration of an agent or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including but not limited to, orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), rectally, intrathecally, intratumorally or topically. Administration includes self-administration and the administration by another.
[0184] The terms complementary or complementarity as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5 end of one sequence is paired with the 3 end of the other, is in antiparallel association. For example, the sequence 5-A-G-T-3 is complementary to the sequence 3-T-C-A-S. Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complementary sequence can also be an RNA sequence complementary to the DNA sequence or its complementary sequence, and can also be a cDNA.
[0185] As used herein, a control is an alternative sample used in an experiment for comparison purpose. A control can be positive or negative. For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.
[0186] As used herein, the term effective amount refers to a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic compositions may be administered to a subject having one or more signs or symptoms of AML. As used herein, a therapeutically effective amount of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.
[0187] As used herein, expression includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.
[0188] As used herein, the term gene means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression.
[0189] As used herein, the terms individual, patient, or subject can be an individual organism, a vertebrate, a mammal, or a human. In some embodiments, the individual, patient or subject is a human.
[0190] As used herein, the term pharmaceutically-acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, compatible with pharmaceutical administration. Pharmaceutically-acceptable carriers and their formulations are known to one skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (20.sup.th edition, ed. A. Gennaro, 2000, Lippincott, Williams & Wilkins, Philadelphia, Pa.).
[0191] As used herein, prevention or preventing of a disorder or condition refers to a compound that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset of one or more symptoms of the disorder or condition relative to the untreated control sample. As used herein, preventing AML, includes preventing or delaying the initiation of symptoms of AML. As used herein, prevention of AML also includes preventing a recurrence of one or more signs or symptoms of AML.
[0192] As used herein, the term sample means biological sample material derived from living cells of a subject. Biological samples may include tissues, cells, protein or membrane extracts of cells, and biological fluids (e.g., ascites fluid or cerebrospinal fluid (CSF)) isolated from a subject, as well as tissues, cells and fluids (blood, plasma, saliva, urine, serum etc.) present within a subject.
[0193] As used herein, the term separate therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes.
[0194] As used herein, the term sequential therapeutic use refers to administration of at least two active ingredients at different times, the administration route being identical or different. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before administering the other active ingredient or ingredients. There is no simultaneous treatment in this case.
[0195] As used herein, the term simultaneous therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time.
[0196] As used herein, the term therapeutic agent is intended to mean a compound that, when present in an effective amount, produces a desired therapeutic effect on a subject in need thereof (e.g, ameliorating or treating AML).
[0197] Treating or treatment as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the disorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission.
[0198] It is also to be appreciated that the various modes of treatment of disorders as described herein are intended to mean substantial, which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.
Inhibitors of Vitamin B6 Pathway
[0199] In one aspect, the present disclosure provides inhibitory RNAs (e.g., sgRNAs, antisense RNAs or shRNAs) that inhibit the vitamin B6 pathway by targeting at least one gene selected from the group consisting of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2. The mammalian nucleic acid sequences of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2 are known in the art (e.g., NCBI Gene IDs: 8566, 55163, 51582, 4953, 2806, 211, 10558, and 9517). The inhibitory nucleic acids of the present technology may comprise a nucleic acid molecule which is complementary to a portion of a PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2 nucleic acid sequence. In some embodiments, the inhibitory RNAs (e.g., sgRNAs, antisense RNAs or shRNAs) target at least one exon and/or intron of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2.
[0200] The present disclosure also provides an antisense nucleic acid comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of a PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 mRNA. The antisense nucleic acid may be antisense RNA, or antisense DNA. Antisense nucleic acids based on the known nucleic acid sequences of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 can be readily designed and engineered using methods known in the art.
[0201] Antisense nucleic acids are molecules which are complementary to a sense nucleic acid strand, e.g., complementary to the coding strand of a double-stranded DNA molecule (or cDNA) or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can form hydrogen bonds with a sense nucleic acid. The antisense nucleic acid can be complementary to an entire coding strand of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2, or to a portion thereof, e.g., all or part of the protein coding region (or open reading frame). In some embodiments, the antisense nucleic acid is an oligonucleotide which is complementary to only a portion of the coding region of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 mRNA. In certain embodiments, an antisense nucleic acid molecule can be complementary to a noncoding region of the PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 coding strand. In some embodiments, the noncoding region refers to the 5 and 3 untranslated regions that flank the coding region and are not translated into amino acids. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
[0202] An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-hodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thouridine, 5-carboxymethylaminometh-yluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-metnylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopenten-yladenine, uracil-5-oxyacetic acid (v), wybutosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thlouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-cxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
[0203] The antisense nucleic acid molecules may be administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding the protein of interest to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. The hybridization can occur via Watson-Crick base pairing to form a stable duplex, or in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix.
[0204] In some embodiments, the antisense nucleic acid molecules are modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens. In some embodiments, the antisense nucleic acid molecule is an alpha-anomeric nucleic acid molecule. An alpha-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual 13-units, the strands run parallel to each other (Gaultier et al., Nucleic Acids. Res. 15:6625-6641(1987)). The antisense nucleic acid molecule can also comprise a 2-O-methylribonucleotide (Inoue et al., Nucleic Acids Res. 15:6131-6148 (1987)) or a chimeric RNA-DNA analogue (Inoue et al., FEBS Lett 215:327-330 (1987)).
[0205] The present disclosure also provides a short hairpin RNA (shRNA) or small interfering RNA (siRNA) comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of a PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 mRNA, thereby reducing or inhibiting gene expression. In some embodiments, the shRNA or siRNA is about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 base pairs in length. Double-stranded RNA (dsRNA) can induce sequence-specific post-transcriptional gene silencing (e.g., RNA interference (RNAi)) in many organisms such as C. elegans, Drosophila, plants, mammals, oocytes and early embryos. RNAi is a process that interferes with or significantly reduces the number of protein copies made by an mRNA. For example, a double-stranded siRNA or shRNA molecule is engineered to complement and hydridize to a mRNA of a target gene. Following intracellular delivery, the siRNA or shRNA molecule associates with an RNA-induced silencing complex (RISC), which then binds and degrades a complementary target mRNA (such as PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 mRNA).
[0206] The present disclosure also provides a synthetic guide RNA (sgRNA) comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of a PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 nucleic acid sequence. Guide RNAs for use in CRISPR-Cas systems are typically generated as a single guide RNA comprising a crRNA segment and a tracrRNA segment. The crRNA segment and a tracrRNA segment can also be generated as separate RNA molecules. The crRNA segment comprises the targeting sequence that binds to a portion of a PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 nucleic acid sequence, and a stem portion that hybridizes to a tracrRNA. The tracrRNA segment comprises a nucleotide sequence that is partially or completely complementary to the stem sequence of the crRNA and a nucleotide sequence that binds to the CRISPR enzyme. In some embodiments, the crRNA segment and the tracrRNA segment are provided as a single guide RNA. In some embodiments, the crRNA segment and the tracrRNA segment are provided as separate RNAs. The combination of the CRISPR enzyme with the crRNA and tracrRNA make up a functional CRISPR-Cas system. Exemplary CRISPR-Cas systems for targeting nucleic acids, are described, for example, in WO2015/089465.
[0207] In some embodiments, a synthetic guide RNA is a single RNA represented as comprising the following elements: 5-X1-X2-Y-Z-3
[0208] where X1 and X2 represent the crRNA segment, where X1 is the targeting sequence that binds to a portion of a PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 nucleic acid sequence, X2 is a stem sequence the hybridizes to a tracrRNA, Z represents a tracrRNA segment comprising a nucleotide sequence that is partially or completely complementary to X2, and Y represents a linker sequence. In some embodiments, the linker sequence comprises two or more nucleotides and links the crRNA and tracrRNA segments. In some embodiments, the linker sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides. In some embodiments, the linker is the loop of the hairpin structure formed when the stem sequence hybridized with the tracrRNA.
[0209] In some embodiments, a synthetic guide RNA is provided as two separate RNAs where one RNA represents a crRNA segment: 5-X1-X2-3 where X1 is the targeting sequence that binds to a portion of a PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2 nucleic acid sequence, X2 is a stem sequence the hybridizes to a tracrRNA, and one RNA represents a tracrRNA segment, Z, that is a separate RNA from the crRNA segment and comprises a nucleotide sequence that is partially or completely complementary to X2 of the crRNA.
[0210] Exemplary crRNA stem sequences and tracrRNA sequences are provided, for example, in WO/2015/089465, which is incorporated by reference herein. In general, a stem sequence includes any sequence that has sufficient complementarity with a complementary sequence in the tracrRNA to promote formation of a CRISPR complex at a target sequence, wherein the CRISPR complex comprises the stem sequence hybridized to the tracrRNA. In general, degree of complementarity is with reference to the optimal alignment of the stem and complementary sequence in the tracrRNA, along the length of the shorter of the two sequences. Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self-complementarity within either the stem sequence or the complementary sequence in the tracrRNA. In some embodiments, the degree of complementarity between the stem sequence and the complementary sequence in the tracrRNA along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. In some embodiments, the stem sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length. In some embodiments, the stem sequence and complementary sequence in the tracrRNA are contained within a single RNA, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin. In some embodiments, the tracrRNA has additional complementary sequences that form hairpins. In some embodiments, the tracrRNA has at least two or more hairpins. In some embodiments, the tracrRNA has two, three, four or five hairpins. In some embodiments, the tracrRNA has at most five hairpins.
[0211] In a hairpin structure, the portion of the sequence 5 of the final N and upstream of the loop corresponds to the crRNA stem sequence, and the portion of the sequence 3 of the loop corresponds to the tracrRNA sequence. Further non-limiting examples of single polynucleotides comprising a guide sequence, a stem sequence, and a tracr sequence are as follows (listed 5 to 3), where N represents a base of a guide sequence (e.g. a modified oligonucleotide provided herein), the first block of lower case letters represent stem sequence, and the second block of lower case letters represent the tracrRNA sequence, and the final poly-T sequence represents the transcription terminator:
TABLE-US-00002 (a) (SEQIDNO:991) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaagatttaGAAAtaaa tcttgcagaagctacaaagataaggcttcatgccgaaatcaacaccctgt cattttatggcagggtgttttcgttatttaaTTTTTT; (b) (SEQIDNO:992) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagcta caaagataaggcttcatgccgaaatcaacaccctgtcattttatggcagg gtgttttcgttatttaaTTTTTT; (c) (SEQIDNO:993) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagcta caaagataaggcttcatgccgaaatcaacaccctgtcattttatggcagg gtgtTTTTTT; (d) (SEQIDNO:994) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtagcaagttaaaat aaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcTTTT TT; (e) (SEQIDNO:995) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAATAGcaagttaaaat aaggctagtccgttatcaacttgaaaaagtgTTTTTTT; and (f) (SEQIDNO:996) NNNNNNNNNNNNNNNNNNNNgttttagagctagAAATAGcaagttaaaat aaggctagtccgttatcaTTTTTTTT.
[0212] Selection of suitable oligonucleotides for use in as a targeting sequence in a CRISPR Cas system depends on several factors including the particular CRISPR enzyme to be used and the presence of corresponding proto-spacer adjacent motifs (PAMs) downstream of the target sequence in the target nucleic acid. The PAM sequences direct the cleavage of the target nucleic acid by the CRISPR enzyme. In some embodiments, a suitable PAM is 5-NRG or 5-NNGRR (where N is any Nucleotide) for SpCas9 or SaCas9 enzymes (or derived enzymes), respectively. Generally the PAM sequences should be present between about 1 to about 10 nucleotides of the target sequence to generate efficient cleavage of the target nucleic acid. Thus, when the guide RNA forms a complex with the CRISPR enzyme, the complex locates the target and PAM sequence, unwinds the DNA duplex, and the guide RNA anneals to the complementary sequence on the opposite strand. This enables the Cas9 nuclease to create a double-strand break.
[0213] A variety of CRISPR enzymes are available for use in conjunction with the disclosed guide RNAs of the present disclosure. In some embodiments, the CRISPR enzyme is a Type II CRISPR enzyme. In some embodiments, the CRISPR enzyme catalyzes DNA cleavage. In some embodiments, the CRISPR enzyme catalyzes RNA cleavage. In some embodiments, the CRISPR enzyme is any Cas9 protein, for instance any naturally-occurring bacterial Cas9 as well as any chimeras, mutants, homologs or orthologs. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologues thereof, or modified variants thereof. In some embodiments, the CRISPR enzyme cleaves both strands of the target nucleic acid at the Protospacer Adjacent Motif (PAM) site. In some embodiments, the CRISPR enzyme is a nickase, which cleaves only one strand of the target nucleic acid.
[0214] Examples of suitable inhibitory RNAs (e.g., sgRNAs, antisense RNAs or shRNAs) include those with sequences comprising 5 TGGCTACGTGGGTAACAGAG 3 (Pdxk sg-1) (SEQ ID NO: 1), 5 ATCCAGAGCCATGTTGTCCG 3 (Pdxk sg-2) (SEQ ID NO: 2), 5 GTGCAGTTTTCAAACCACAC 3 (Pdxk sg-3) (SEQ ID NO: 3), 5 GCTTGGGGTGCCTGCAGAGA 3 (Odc1-a106) (SEQ ID NO: 4), 5 TGCTGTTGACAGTGAGCGCCAAGGTGAACGATGTCAATAATAGTGAAGCCACAG ATGTATTATTGACATCGTTCACCTTGATGCCTACTGCCTCGGA 3 (Pdxk.307) (SEQ ID NO: 5), 5 TGCTGTTGACAGTGAGCGCCAGGTTCAATGTGAGGTTACATAGTGAAGCCACAG ATGTATGTAACCTCACATTGAACCTGATGCCTACTGCCTCGGA 3 (Pdxk.3259) (SEQ ID NO: 6), 5 ACGCCCAGGATGGGATCTGG 3 (Got2.a41) (SEQ ID NO: 7), 5 AAAGAATACCTGCCCATTGG 3 (Got2.a99) (SEQ ID NO: 8), 5 GACTGGAGCCTTAAGGGTCG 3 (Got2.a140) (SEQ ID NO: 9), 5 ATACAGAGCCACGTCATCCG 3 (hPdxk-aa15) (SEQ ID NO: 10), 5 CGGCTACGTGGGCAACCGGG 3 (hPdxk-aa22) (SEQ ID NO: 11), 5 GCCTACCGTACACCAGCCTG 3 (hPdxk-aa105) (SEQ ID NO: 12), 5 GTCCCCAGTGCCCACAAAGA 3 (hPDXK-aa230) (SEQ ID NO: 13), 5 AATGGCTTTAGTGCAAGAAT 3 (Azin1-a100) (SEQ ID NO: 14), 5 GAACTACTCCGTTGGCCTGT 3 (Azin1-a14) (SEQ ID NO: 15), 5 GCCAAGATCTCAAGCACGGC 3 (Azin1-a76) (SEQ ID NO: 16), 5 ATATTGACGTCATTGGTGTG 3 (Odc1-a194) (SEQ ID NO: 17), 5 AGGCAGCAGCGTCTTCCGCA 3 (ALAS1 sg-1) (SEQ ID NO: 18), 5 CACCGTTTTAAAAACTCGGT 3(ALAS1 sg-2) (SEQ ID NO: 19), 5 CTCGGGATAAGAATGGGCAT 3 (ALAS1 sg-3) (SEQ ID NO: 20), 5 TGCGTAAAAGGGAGTGACGC 3 (Odc1-a62) (SEQ ID NO: 21), 5 GCTGGCCAACCCTCGAGTTA 3 (SPTLC1 sg-1) (SEQ ID NO: 22), 5 GATGGTGCAGGCGCTGTACG 3 (SPTLC1 sg-2) (SEQ ID NO: 23), 5 TCAACTACAACATCGTGTCC 3 (SPTLC1 sg-3) (SEQ ID NO: 24), 5 GCTCCAGGCACACTACAGAT 3 (SPTLC2 sg-1) (SEQ ID NO: 25), 5 GAACGGCTGCGTCAAGAACG 3 (SPTLC2 sg-2) (SEQ ID NO: 26), 5 AATCTCGAAGATATCCAAAG 3 (SPTLC2 sg-3) (SEQ ID NO: 27), 5 GGTGTGTGGTTTCCCCAGGT 3 (hGOT2.a162) (SEQ ID NO: 28), 5 GATGGGTGTGTGGTTTCCCC 3 (hGOT2.a163) (SEQ ID NO: 29), 5 GGACGCGGGTCCACTCCCGT 3(hGOT2.a218) (SEQ ID NO: 30), 5 TGGACCCGCGTCCGGAACAG 3 (hGOT2.a224) (SEQ ID NO: 31), 5 ACGATGAACATGTTAGACAT 3 (hAZIN1-a233) (SEQ ID NO: 39), 5 CTATGTTTATGAACATACCC 3 (hAZIN1-a33) (SEQ ID NO: 40), 5 TATCTGCTTGATATTGGCGG 3 (hODC1-a235) (SEQ ID NO: 41), 5 CAACGCTGGGTTGATTACGC 3 (hODC1-a254) (SEQ ID NO: 42), 5 GGAGGTCCTGGGGAACGTAC 3 (Pdxk sg-4) (SEQ ID NO: 982), 5 CATGGCAGCGAAGAGGTCCC 3 (Pdxk sg-5) (SEQ ID NO: 983), 5 AGCTGTCTTCGTGGGCACCG 3 (Pdxk sg-6) (SEQ ID NO: 984), 5 TGTAACCTCACATTGAACCTGA 3 (SEQ ID NO: 985), 5 TTATTGACATCGTTCACCTTGA 3 (SEQ ID NO: 986), 5 CATGCGCAAGAGTTACCGCG 3 (hPNPO-a42:) (SEQ ID NO: 987); 5 ATGACCGGATAGTCTTTCGG 3 (hPNPO-a232) (SEQ ID NO: 988); 5 GAGTTACCGCGGGGACCGAG 3 (hPNPO-a45) (SEQ ID NO: 989); and 5 TTCTGTGATCCCTGATCGGG 3 (hPNPO-a181) (SEQ ID NO: 990) or any complementary sequences thereof.
[0215] The present disclosure also provides pharmacological inhibitors of the vitamin B6 pathway including, but not limited to, isoniazid, aftin-4 (see
Therapeutic Methods
[0216] The following discussion is presented by way of example only, and is not intended to be limiting.
[0217] One aspect of the present technology includes methods of treating a disease or condition characterized by elevated expression levels and/or increased activity of PDXK. Additionally or alternatively, in some embodiments, the present technology includes methods of treating AML. In one aspect, the present disclosure provides a method for inhibiting leukemic cell proliferation in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one inhibitor of Vitamin B6 pathway, wherein the at least one inhibitor is selected from the group consisting of isoniazid, aftin-4, DFMO, gingkotoxin, aminooxyacetic acid, and myriocin, and wherein the subject suffers from a disease or condition characterized by elevated expression levels and/or increased activity of PDXK. In another aspect, the present disclosure provides a method for inhibiting leukemic cell proliferation in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one inhibitory RNA that targets one or more genes selected from the group consisting of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2, wherein the subject suffers from a disease or condition characterized by elevated expression levels and/or increased activity of PDXK
[0218] In some embodiments, the subject is diagnosed as having, suspected as having, or at risk of having a disease or condition characterized by elevated expression levels and/or increased activity of PDXK. Additionally or alternatively, in some embodiments, the subject is diagnosed as having AML.
[0219] In therapeutic applications, compositions or medicaments comprising a vitamin B6 pathway inhibitor disclosed herein are administered to a subject suspected of, or already suffering from such a disease or condition (such as, a subject diagnosed with a disease or condition characterized by elevated expression levels and/or increased activity of PDXK and/or a subject diagnosed with AML), in an amount sufficient to cure, or at least partially arrest, the symptoms of the disease, including its complications and intermediate pathological phenotypes in development of the disease.
[0220] Subjects suffering from a disease or condition characterized by elevated expression levels and/or increased activity of PDXK and/or a subject diagnosed with AML can be identified by any or a combination of diagnostic or prognostic assays known in the art. For example, typical symptoms of AML include, but are not limited to, enlarged lymph nodes, anemia, neutropenia, leukopenia, leukostasis, chloroma, granulocytic sarcoma, myeloid sarcoma, fatigue, weakness, dizziness, chills, headaches, shortness of breath, thrombocytopenia, excess bruising and bleeding, frequent or severe nosebleeds, bleeding gums, gum pain and swelling, headache, weakness in one side of the body, slurred speech, confusion, sleepiness, blurry vision, vision loss, deep venous thrombosis (DVT), pulmonary embolism, bone or joint pain, swelling in the abdomen, seizures, vomiting, facial numbness, defects in balance, weight loss, fever, night sweats, and loss of appetite.
[0221] In some embodiments, the subject may exhibit one or more point mutations in NRAS, DNMT3A, FLT3, KIT, IDH1, IDH2, CEBPA, and NPM1 and/or one or more chromosomal alterations (e.g., an inversion, translocation, or gene fusion) such as CBFB-MYH11, DEK-NUP214, MLL-MLLT3, PML-RARA, RBM15-MKL1, RPN1-EVI1 and RUNX1-RUNX1T1, and are detectable using techniques known in the art. See Naoe & Kiyoi, Int J Hematol. 97(2):165-74 (2013); Shih et al., Nat Rev Cancer. 12(9):599-612 (2012).
[0222] In some embodiments, subjects with a disease or condition characterized by elevated expression levels and/or increased activity of PDXK, and/or subjects suffering from AML that are treated with the vitamin B6 pathway inhibitor will show amelioration or elimination of one or more of the following symptoms: enlarged lymph nodes, anemia, neutropenia, leukopenia, leukostasis, chloroma, granulocytic sarcoma, myeloid sarcoma, fatigue, weakness, dizziness, chills, headaches, shortness of breath, thrombocytopenia, excess bruising and bleeding, frequent or severe nosebleeds, bleeding gums, gum pain and swelling, headache, weakness in one side of the body, slurred speech, confusion, sleepiness, blurry vision, vision loss, deep venous thrombosis (DVT), pulmonary embolism, bone or joint pain, swelling in the abdomen, seizures, vomiting, facial numbness, defects in balance, weight loss, fever, night sweats, and loss of appetite.
[0223] In certain embodiments, subjects with a disease or condition characterized by elevated expression levels and/or increased activity of PDXK, and/or subjects suffering from AML that are treated with the vitamin B6 pathway inhibitor will show reduced leukemic cell proliferation and/or increased survival compared to untreated AML subjects. In certain embodiments, subjects with a disease or condition characterized by elevated expression levels and/or increased activity of PDXK, and/or subjects suffering from AML that are treated with the vitamin B6 pathway inhibitor will show reduced PDXK and PLP expression levels compared to untreated AML subjects.
[0224] In one aspect, the present disclosure provides a method for monitoring the therapeutic efficacy of a dosage of an inhibitor of Vitamin B6 pathway in a subject diagnosed with AML comprising: (a) detecting PDXK protein levels or intracellular PLP levels in a test sample obtained from the subject after the subject has been administered the dosage of the inhibitor of Vitamin B6 pathway, wherein the inhibitor of Vitamin B6 pathway is isoniazid, aftin-4, DFMO, gingkotoxin, aminooxyacetic acid, or myriocin; and (b) determining that the dosage of the inhibitor of Vitamin B6 pathway is effective when the PDXK protein levels or intracellular PLP levels in the test sample are reduced compared to that observed in a control sample obtained from the subject prior to administration of the inhibitor of Vitamin B6 pathway. In some embodiments, the intracellular PLP levels are detected via high-performance liquid chromatography-mass spectrometry. The test sample may be tissues, cells or biological fluids (blood, plasma, saliva, urine, serum etc.) present within a subject. Alternatively, PLP intracellular levels may be used to determine efficacy of the inhibitor of Vitamin B6 pathway in the subject. Accordingly, in certain embodiments, the method further comprises detecting intracellular levels of PLP in the subject, wherein a decrease in PLP intracellular levels relative to those observed in the subject prior to treatment is indicative of the therapeutic efficacy of the dosage of the inhibitor of Vitamin B6 pathway.
[0225] Also disclosed herein are methods for monitoring the therapeutic efficacy of an inhibitory RNA that targets a gene selected from the group consisting of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, and SPTLC2 in a subject diagnosed with AML comprising: (a) detecting PDXK protein levels or intracellular PLP levels in a test sample obtained from the subject after the subject has been administered the inhibitory RNA; and (b) determining that the inhibitory RNA is effective when the PDXK protein levels or intracellular PLP levels in the test sample are reduced compared to that observed in a control sample obtained from the subject prior to administration of the inhibitory RNA. The inhibitory RNA may be a shRNA or a sgRNA. The test sample may be tissues, cells or biological fluids (blood, plasma, saliva, urine, serum etc.) present within a subject. In certain embodiments, the method further comprises detecting intracellular levels of PLP in the subject, wherein a decrease in PLP intracellular levels relative to those observed in the subject prior to treatment is indicative of the therapeutic efficacy of the inhibitory RNA. In some embodiments, the intracellular PLP levels are detected via high-performance liquid chromatography-mass spectrometry.
Prophylactic Methods
[0226] In one aspect, the present technology provides a method for preventing or delaying the onset of a disease or condition characterized by elevated expression levels and/or increased activity of PDXK. Additionally or alternatively, in some aspects, the present technology provides a method for preventing or delaying the onset AML.
[0227] Subjects at risk or susceptible to a disease or condition characterized by elevated expression levels and/or increased activity of PDXK, and/or subjects at risk or susceptible to AML include those that exhibit one or more point mutations in NRAS, DNMT3A, FLT3, KIT, IDH1, IDH2, CEBPA, and NPM1 and/or one or more chromosomal alterations (e.g., an inversion, translocation, or gene fusion) such as CBFB-MYH11, DEK-NUP214, MLL-MLLT3, PML-RARA, RBM15-MKL1, RPN1-EVI1 and RUNX1-RUNX1T1. Such subjects can be identified by, e.g., any or a combination of diagnostic or prognostic assays known in the art.
[0228] In prophylactic applications, pharmaceutical compositions or medicaments comprising a vitamin B6 pathway inhibitor disclosed herein are administered to a subject susceptible to, or otherwise at risk of a disease or condition characterized by elevated expression levels and/or increased activity of PDXK, and/or a subject susceptible to, or otherwise at risk of AML, in an amount sufficient to eliminate or reduce the risk, or delay the onset of the disease, including biochemical, histologic and/or behavioral symptoms of the disease, its complications and intermediate pathological phenotypes presenting during development of the disease. Administration of a prophylactic vitamin B6 pathway inhibitor can occur prior to the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented or, alternatively, delayed in its progression.
[0229] In some embodiments, treatment with the vitamin B6 pathway inhibitor will prevent or delay the onset of one or more of the following symptoms: leukemic cell proliferation, enlarged lymph nodes, anemia, neutropenia, leukopenia, leukostasis, chloroma, granulocytic sarcoma, myeloid sarcoma, fatigue, weakness, dizziness, chills, headaches, shortness of breath, thrombocytopenia, excess bruising and bleeding, frequent or severe nosebleeds, bleeding gums, gum pain and swelling, headache, weakness in one side of the body, slurred speech, confusion, sleepiness, blurry vision, vision loss, deep venous thrombosis (DVT), pulmonary embolism, bone or joint pain, swelling in the abdomen, seizures, vomiting, facial numbness, defects in balance, weight loss, fever, night sweats, and loss of appetite. In certain embodiments, (a) subjects with a disease or condition characterized by elevated expression levels and/or increased activity of PDXK, and/or (b) subjects with AML that are treated with the vitamin B6 pathway inhibitor will show PDXK and/or PLP expression levels that resemble those observed in healthy control subjects.
[0230] For therapeutic and/or prophylactic applications, a composition comprising a vitamin B6 pathway inhibitor disclosed herein, is administered to the subject. In some embodiments, the vitamin B6 pathway inhibitor is administered one, two, three, four, or five times per day. In some embodiments, the vitamin B6 pathway inhibitor is administered more than five times per day. Additionally or alternatively, in some embodiments, the vitamin B6 pathway inhibitor is administered every day, every other day, every third day, every fourth day, every fifth day, or every sixth day. In some embodiments, the vitamin B6 pathway inhibitor is administered weekly, bi-weekly, tri-weekly, or monthly. In some embodiments, the vitamin B6 pathway inhibitor is administered for a period of one, two, three, four, or five weeks. In some embodiments, the vitamin B6 pathway inhibitor is administered for six weeks or more. In some embodiments, the vitamin B6 pathway inhibitor is administered for twelve weeks or more. In some embodiments, the vitamin B6 pathway inhibitor is administered for a period of less than one year. In some embodiments, the vitamin B6 pathway inhibitor is administered for a period of more than one year. In some embodiments, the vitamin B6 pathway inhibitor is administered throughout the subject's life.
[0231] In some embodiments of the methods of the present technology, the vitamin B6 pathway inhibitor is administered daily for 1 week or more. In some embodiments of the methods of the present technology, the vitamin B6 pathway inhibitor is administered daily for 2 weeks or more. In some embodiments of the methods of the present technology, the vitamin B6 pathway inhibitor is administered daily for 3 weeks or more. In some embodiments of the methods of the present technology, the vitamin B6 pathway inhibitor is administered daily for 4 weeks or more. In some embodiments of the methods of the present technology, the vitamin B6 pathway inhibitor is administered daily for 6 weeks or more. In some embodiments of the methods of the present technology, the vitamin B6 pathway inhibitor is administered daily for 12 weeks or more. In some embodiments, the vitamin B6 pathway inhibitor is administered daily throughout the subject's life.
Determination of the Biological Effect of Inhibitors of the Vitamin B6 Pathway
[0232] In various embodiments, suitable in vitro or in vivo assays are performed to determine the effect of a specific inhibitor of the vitamin B6 pathway and whether its administration is indicated for treatment. In various embodiments, in vitro assays can be performed with representative animal models, to determine if a given inhibitor of the vitamin B6 pathway exerts the desired effect on reducing or eliminating signs and/or symptoms of AML. Compounds for use in therapy can be tested in suitable animal model systems including, but not limited to rats, mice, chicken, cows, monkeys, rabbits, and the like, prior to testing in human subjects. Similarly, for in vivo testing, any of the animal model system known in the art can be used prior to administration to human subjects. In some embodiments, in vitro or in vivo testing is directed to the biological function of one or more inhibitors of the vitamin B6 pathway.
[0233] Animal models of AML may be generated using techniques known in the art. Such models may be used to demonstrate the biological effect of inhibitors of the vitamin B6 pathway in the prevention and treatment of conditions arising from disruption of a particular gene, and for determining what comprises a therapeutically effective amount of the one or more inhibitors of the vitamin B6 pathway disclosed herein in a given context.
Modes of Administration and Effective Dosages
[0234] Any method known to those in the art for contacting a cell, organ or tissue with one or more inhibitors of the vitamin B6 pathway disclosed herein may be employed. Suitable methods include in vitro, ex vivo, or in vivo methods. In vivo methods typically include the administration of one or more inhibitors of the vitamin B6 pathway to a mammal, suitably a human. When used in vivo for therapy, the one or more inhibitors of the vitamin B6 pathway described herein are administered to the subject in effective amounts (i.e., amounts that have desired therapeutic effect). The dose and dosage regimen will depend upon the degree of the disease state of the subject, the characteristics of the particular inhibitor of the vitamin B6 pathway used, e.g., its therapeutic index, and the subject's history.
[0235] The effective amount may be determined during pre-clinical trials and clinical trials by methods familiar to physicians and clinicians. An effective amount of one or more inhibitors of the vitamin B6 pathway useful in the methods may be administered to a mammal in need thereof by any of a number of well-known methods for administering pharmaceutical compounds. The inhibitors may be administered systemically or locally.
[0236] The one or more inhibitors of the vitamin B6 pathway described herein can be incorporated into pharmaceutical compositions for administration, singly or in combination, to a subject for the treatment or prevention of AML. Such compositions typically include the active agent and a pharmaceutically acceptable carrier. As used herein the term pharmaceutically acceptable carrier includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.
[0237] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoretic, and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. For convenience of the patient or treating physician, the dosing formulation can be provided in a kit containing all necessary equipment (e.g., vials of drug, vials of diluent, syringes and needles) for a treatment course (e.g., 7 days of treatment).
[0238] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, a composition for parenteral administration must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
[0239] The pharmaceutical compositions having one or more inhibitors of the vitamin B6 pathway disclosed herein can include a carrier, which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thiomerasol, and the like. Glutathione and other antioxidants can be included to prevent oxidation. In many cases, it will be advantageous to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.
[0240] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation include vacuum drying and freeze drying, which can yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0241] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0242] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressurized container or dispenser, which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 6,468,798.
[0243] Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. In one embodiment, transdermal administration may be performed by iontophoresis.
[0244] A therapeutic agent can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be a liposome, a phospholipid bilayer vehicle. In one embodiment, the therapeutic agent is encapsulated in a liposome while maintaining the agent's structural integrity. One skilled in the art would appreciate that there are a variety of methods to prepare liposomes. (See Lichtenberg, et al., Methods Biochem. Anal., 33:337-462 (1988); Anselem, et al., Liposome Technology, CRC Press (1993)). Liposomal formulations can delay clearance and increase cellular uptake (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). An active agent can also be loaded into a particle prepared from pharmaceutically acceptable ingredients including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable or gastroretentive polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles and viral vector systems.
[0245] The carrier can also be a polymer, e.g., a biodegradable, biocompatible polymer matrix. In one embodiment, the therapeutic agent can be embedded in the polymer matrix, while maintaining the agent's structural integrity. The polymer may be natural, such as polypeptides, proteins or polysaccharides, or synthetic, such as poly -hydroxy acids. Examples include carriers made of, e.g., collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharide, fibrin, gelatin, and combinations thereof. In one embodiment, the polymer is poly-lactic acid (PLA) or copoly lactic/glycolic acid (PGLA). The polymeric matrices can be prepared and isolated in a variety of forms and sizes, including microspheres and nanospheres. Polymer formulations can lead to prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). A polymer formulation for human growth hormone (hGH) has been used in clinical trials. (See Kozarich and Rich, Chemical Biology, 2:548-552 (1998)).
[0246] Examples of polymer microsphere sustained release formulations are described in PCT publication WO 99/15154 (Tracy, et al.), U.S. Pat. Nos. 5,674,534 and 5,716,644 (both to Zale, et al.), PCT publication WO 96/40073 (Zale, et al.), and PCT publication WO 00/38651 (Shah, et al.). U.S. Pat. Nos. 5,674,534 and 5,716,644 and PCT publication WO 96/40073 describe a polymeric matrix containing particles of erythropoietin that are stabilized against aggregation with a salt.
[0247] In some embodiments, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using known techniques. The materials can also be obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to specific cells with monoclonal antibodies to cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0248] The therapeutic compounds can also be formulated to enhance intracellular delivery. For example, liposomal delivery systems are known in the art, see, e.g., Chonn and Cullis, Recent Advances in Liposome Drug Delivery Systems, Current Opinion in Biotechnology 6:698-708 (1995); Weiner, Liposomes for Protein Delivery: Selecting Manufacture and Development Processes, Immunomethods, 4(3):201-9 (1994); and Gregoriadis, Engineering Liposomes for Drug Delivery: Progress and Problems, Trends Biotechnol., 13(12):527-37 (1995). Mizguchi, et al., Cancer Lett., 100:63-69 (1996), describes the use of fusogenic liposomes to deliver a protein to cells both in vivo and in vitro.
[0249] Dosage, toxicity and therapeutic efficacy of any therapeutic agent can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are advantageous. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
[0250] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds may be within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to determine useful doses in humans accurately. Levels in plasma may be measured, for example, by high performance liquid chromatography.
[0251] Typically, an effective amount of the one or more inhibitors of the vitamin B6 pathway disclosed herein sufficient for achieving a therapeutic or prophylactic effect, range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day. For example dosages can be 1 mg/kg body weight or 10 mg/kg body weight every day, every two days or every three days or within the range of 1-10 mg/kg every week, every two weeks or every three weeks. In one embodiment, a single dosage of the therapeutic compound ranges from 0.001-10,000 micrograms per kg body weight. In one embodiment, one or more inhibitors of the vitamin B6 pathway concentrations in a carrier range from 0.2 to 2000 micrograms per delivered milliliter. An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, or until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.
[0252] In some embodiments, a therapeutically effective amount of one or more inhibitors of the vitamin B6 pathway may be defined as a concentration of inhibitor at the target tissue of 10 to 10 molar, e.g., approximately 10.sup.7 molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg/kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue, such as by single daily or weekly administration, but also including continuous administration (e.g., parenteral infusion or transdermal application).
[0253] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to, the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.
[0254] The mammal treated in accordance with the present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits. In some embodiments, the mammal is a human.
Combination Therapy
[0255] In some embodiments, one or more inhibitors of the vitamin B6 pathway disclosed herein may be combined with one or more additional therapies for the prevention or treatment of AML. Additional therapeutic agents include, but are not limited to, chemotherapeutic agents, arsenic trioxide (Trisenox), all-trans retinoic acid (ATRA), and stem cell transplants.
[0256] In some embodiments, the one or more inhibitors of the vitamin B6 pathway disclosed herein may be separately, sequentially or simultaneously administered with at least one additional therapeutic agent selected from the group consisting of alkylating agents, topoisomerase inhibitors, endoplasmic reticulum stress inducing agents, antimetabolites, mitotic inhibitors, nitrogen mustards, nitrosoureas, alkylsulfonates, platinum agents, taxanes, vinca agents, anti-estrogen drugs, aromatase inhibitors, ovarian suppression agents, VEGF/VEGFR inhibitors, EGF/EGFR inhibitors, PARP inhibitors, cytostatic alkaloids, cytotoxic antibiotics, antimetabolites, endocrine/hormonal agents, bisphosphonate therapy agents, phenphormin and targeted biological therapy agents (e.g., therapeutic peptides described in U.S. Pat. No. 6,306,832, WO 2012007137, WO 2005000889, WO 2010096603 etc.). In some embodiments, the at least one additional therapeutic agent is a chemotherapeutic agent.
[0257] Specific chemotherapeutic agents include, but are not limited to, cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, edatrexate (10-ethyl-10-deaza-aminopterin), thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, anthracyclines (e.g., daunorubicin and doxorubicin), cladribine, midostaurin, bevacizumab, oxaliplatin, melphalan, etoposide, mechlorethamine, bleomycin, microtubule poisons, annonaceous acetogenins, chlorambucil, ifosfamide, streptozocin, carmustine, lomustine, busulfan, dacarbazine, temozolomide, altretamine, 6-mercaptopurine (6-MP), cytarabine, floxuridine, fludarabine, hydroxyurea, pemetrexed, epirubicin, idarubicin, SN-38, ARC, NPC, campothecin, 9-nitrocamptothecin, 9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-8951f, MAG-CPT, amsacnne, etoposide phosphate, teniposide, azacitidine (Vidaza), decitabine, accatin III, 10-deacetyltaxol, 7-xylosyl-10-deacetyltaxol, cephalomannine, 10-deacetyl-7-epitaxol, 7-epitaxol, 10-deacetylbaccatin III, 10-deacetyl cephalomannine, streptozotocin, nimustine, ranimustine, bendamustine, uramustine, estramustine, mannosulfan, camptothecin, exatecan, lurtotecan, lamellarin D9-aminocamptothecin, amsacrine, ellipticines, aurintricarboxylic acid, HU-331, or combinations thereof.
[0258] Examples of antimetabolites include 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, and mixtures thereof.
[0259] Examples of taxanes include accatin III, 10-deacetyltaxol, 7-xylosyl-10-deacetyltaxol, cephalomannine, 10-deacetyl-7-epitaxol, 7-epitaxol, 10-deacetylbaccatin III, 10-deacetyl cephalomannine, and mixtures thereof.
[0260] Examples of DNA alkylating agents include cyclophosphamide, chlorambucil, melphalan, bendamustine, uramustine, estramustine, carmustine, lomustine, nimustine, ranimustine, streptozotocin; busulfan, mannosulfan, and mixtures thereof.
[0261] Examples of topoisomerase I inhibitor include SN-38, ARC, NPC, camptothecin, topotecan, 9-nitrocamptothecin, exatecan, lurtotecan, lamellarin D9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-8951f, MAG-CPT, and mixtures thereof. Examples of topoisomerase II inhibitors include amsacrine, etoposide, etoposide phosphate, teniposide, daunorubicin, mitoxantrone, amsacrine, ellipticines, aurintricarboxylic acid, doxorubicin, and HU-331 and combinations thereof.
[0262] In certain embodiments, an additional therapeutic agent is administered to a subject in combination with the one or more inhibitors of the vitamin B6 pathway disclosed herein such that a synergistic therapeutic effect is produced. For example, administration of one or more inhibitors of the vitamin B6 pathway with one or more additional therapeutic agents for the prevention or treatment of AML will have greater than additive effects in the prevention or treatment of the disease. For example, lower doses of one or more of the therapeutic agents may be used in treating or preventing AML resulting in increased therapeutic efficacy and decreased side-effects. In some embodiments, the one or more inhibitors of the vitamin B6 pathway disclosed herein are administered in combination with any of the at least one additional therapeutic agents described above, such that a synergistic effect in the prevention or treatment of AML results.
[0263] In any case, the multiple therapeutic agents may be administered in any order or even simultaneously. If simultaneously, the multiple therapeutic agents may be provided in a single, unified form, or in multiple forms (by way of example only, either as a single pill or as two separate pills). One of the therapeutic agents may be given in multiple doses, or both may be given as multiple doses. If not simultaneous, the timing between the multiple doses may vary from more than zero weeks to less than four weeks. In addition, the combination methods, compositions and formulations are not to be limited to the use of only two agents.
Kits
[0264] The present disclosure also provides kits for the prevention and/or treatment of AML comprising one or more of: isoniazid, aftin-4, DFMO, gingkotoxin, aminooxyacetic acid, myriocin, and/or one or more inhibitory RNAs comprising a nucleic acid sequence of any one of SEQ ID NOs: 1-31, 39-42, or 982-990. Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for the prevention and/or treatment of AML.
[0265] The above-mentioned components may be stored in unit or multi-dose containers, for example, sealed ampoules, vials, bottles, syringes, and test tubes, as an aqueous, preferably sterile, solution or as a lyophilized, preferably sterile, formulation for reconstitution. The kit may further comprise a second container which holds a diluent suitable for diluting the pharmaceutical composition towards a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition and a saline solution. Furthermore, the kit may comprise instructions for diluting the pharmaceutical composition and/or instructions for administering the pharmaceutical composition, whether diluted or not. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper which may be pierced by a hypodermic injection needle). The kit may further comprise more containers comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable hosts. The kits may optionally include instructions customarily included in commercial packages of therapeutic or diagnostic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic or diagnostic products.
[0266] The kit can also comprise, e.g., a buffering agent, a preservative or a stabilizing agent. The kit can also contain a control sample or a series of control samples, which can be assayed and compared to the test sample. Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit. The kits of the present technology may contain a written product on or in the kit container. The written product describes how to use the reagents contained in the kit. In certain embodiments, the use of the reagents can be according to the methods of the present technology.
EXAMPLES
[0267] The present technology is further illustrated by the following Examples, which should not be construed as limiting in any way. The following Examples demonstrate the preparation, characterization, and use of illustrative compositions of the present technology that inhibit the vitamin B6 pathway.
Example 1: Experimental Materials and Methods
[0268] CRISPR/Cas sgRNA library construction and functional genomic screening. A CRISPR/Cas sgRNA library was designed as previously described in H. Koike-Yusa et al., Nat Biotechnol 32:267-273 (2014). sgRNAs targeting Renilla luciferase were included as negative controls. sgRNAs targeting Bcl2, Mcl1, Myc, Pcna, Rpa1, and Rpa3 were included as controls for positive regulators of leukemic cell proliferation. sgRNA sequences targeting Trp53 were included as controls for negative regulators of leukemic cell proliferation. sgRNA sequences targeting the above control genes and 236 metabolic genes were adapted from H. Koike-Yusa et al., Nat Biotechnol 32:267-273 (2014).
[0269] sgRNA inserts were designed as GTGGAAAGGACGAAACACCG (U6 promoter: SEQ ID NO: 32)+20 nt sgRNA+GTTTTAGAGCTAGAAATAGC (tracrRNA; SEQ ID NO: 33)+GGCCCTGGGGGATCTTT (barcode sequence; SEQ ID NO: 34). sgRNA inserts were synthesized by CustomArray, Inc. (Bothell, Wash.) and were amplified with the forward primer: 5 AAAGATCCCCCAGGGCC 3 (SEQ ID NO: 35) and the reverse primer: 5 TTATATATCTTGTGGAAAGGACGAAACACC 3 (SEQ ID NO: 36) in a first round PCR reaction, and were subsequently amplified with the forward primer: 5 TAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC 3 (SEQ ID NO: 37), and the reverse primer: 5 ATTTCTTGGCTTTATATATCTTGTGGAAAGG 3 (SEQ ID NO: 38) in a second round PCR reaction. Second round PCR products were then treated with T4 Polynucleotide Kinase followed with a Gibson assembly reaction with a LentiCRISPR v2 vector (Addgene, Watertown Mass.) that had been digested with BsmBI and treated with alkaline phosphatase. Transformation was performed using electrocompetent cells (Lucigen Corp., Middleton, Wis.), and bacterial colonies were collected for plasmid extraction (QIAGEN Plasmid Maxi Kit, Qiagen, Hilden, Germany).
[0270] For functional genomic screening, viral sgRNA pools were produced by transfecting HEK293 cells with LentiCRISPR v2 sgRNA libraries with VSVG and Pak2 packaging vectors. Two days after transfection, viral sgRNA pool supernatants were collected and filtered. Nras(G12D)/MLL-AF9 leukemic cells (cultured in RPMI medium supplemented with 10 ng/ml SCF, 2 ng/ml IL-6 and 0.7 ng/ml IL-3) were spin infected with viral sgRNA pool supernatants at 1,500 RPM for 60 minutes (37 C.). Viral infection was performed at a viral titer such that the majority of leukemic cells only contained one sgRNA integration. After spin infection, viral supernatants were substituted with leukemic cell culture medium. Genomic DNA was extracted from leukemic cells that were collected at day 1 and day 9 of cell culture. The integrated sgRNAs were PCR amplified and were pooled for deep sequencing analysis. Deep sequencing reads corresponding to each sgRNA at each day were identified after demultiplexing of the deep sequencing results.
[0271] Culture, Infection, and Compound Treatment of Leukemic Cells, iMEF Cells, and 3T3 Cells.
[0272] Mouse AML cell lines, human AML cell lines, iMEF cell line and 3T3 cell line were infected with virus encoding Cas9 (Addgene 52962, Watertown Mass.) followed with blastcitidin selection to generate Cas9 cell lines. All viral sgRNA infection experiments were performed on Cas9 cell lines. All viral shRNA infection experiments were performed on cell lines carrying rtTA3. Mouse leukemic cell lines including Nras(G12D)/MLL-AF9, MLL-AF9, Nras(G12D)/IDH, Nras(G12D)/NPM1, and IDH/Flt3 were cultured in RPMI medium supplemented with 10% Fetal Bovine Serum (FBS), L-glutamine, penicillin streptomycin, recombinant mouse SCF, IL-3 and IL-6. Human leukemic cell lines MOLM13, M12, Semk2, THP1, and K562 were cultured in RPMI medium supplemented with 10% FBS, L-glutamine, penicillin, and streptomycin. Vitamin B6 depleted medium (VB6) was prepared by customized pyridoxin () RPMI (Gibco, Gaithersburg, Md.) with 10% dialyzed FBS, L-glutamine, penicillin, and streptomycin. Pyridoxin hydrochloride (Sigma, St Louis Mo.) was added back to VB6() medium to make the VB6 (+) medium used for leukemia and MEF culture. Control or gene targeting sgRNAs or shRNAs were delivered by lentivirus. Spin infections were performed at 37 C. and 1500 RPM for 60 minutes. After spin infection, viral supernatants were substituted with leukemic cell culture medium. For compound treatment, isoniazid was added in culture medium at indicated concentrations.
[0273] Molecular Cloning.
[0274] PDXK shRNAs were cloned into a doxycycline inducible H2 vector (D9891-25G, Sigma-Aldrich, St. Louis, Mo.). Leukemic cells were infected with viruses encoding shRNAs targeting Renilla luciferase or PDXK, followed by either in vitro culture or transplantation. For in vitro culture experiments, doxycycline was supplemented into culture medium, and the percentage of GFP.sup.+ cells was monitored. For in vivo AML mouse model experiments, the dietary feed of the mice was supplemented with doxycycline, and luciferase expression levels were monitored. For in vivo drug efficacy experiments, leukemic cells were transplanted into sub-lethally irradiated mice. Control PBS or isoniazid (90 mg/kg) was injected 6 hours after transplant and then daily into the transplant containing mice, and luciferase expression levels were monitored. High-performance liquid chromatography-mass spectrometry (HPLC-MS) was performed as previously described in A. M. Intlekofer et al., Nat Chem Biol 13, 494-500 (2017).
[0275] Bone marrow hematopoietic stem and progenitor cell isolation, culture, and compound treatment. For isolation of bone marrow cells, the bone marrow from the femur and tibia was flushed into ice cold PBS buffer. After red blood cell lysis with ammonium chloride (STEMCELL 07850, Vancouver Canada), the bone marrow cells were resuspended with PBS and filtered into a round bottom tube with cell strainer cap. The hematopoietic cells lineages were stained with biotin mouse lineage panel (BD Biosciences 559971, San Jose Calif.), then isolated by magnetic beads separation. For c-Kit positive cells, mouse hematopoietic cells were isolated from bone marrow using MACS CD117 isolation system. Purified bone marrow cells were cultured in RPMI medium supplemented with recombinant mouse SCF, IL-3, and IL-6. Control or Pdxk targeting sgRNAs or shRNAs were delivered by lentivirus. Spin infections were performed at 37 degree and 1500 RPM for 60 minutes. After spin infection, viral supernatants were substituted with leukemic cell culture medium. For compound treatment, isoniazid was added in culture at indicated concentrations.
[0276] Cell Cycle, Apoptosis, Differentiation, and Redox Experiments.
[0277] For competition and cell proliferation experiments, mouse or human leukemic cells were infected with viruses encoding sgRNAs or shRNAs. Spin infections were performed at 37 degree and 1500 RPM for 60 minutes. After spin infection, viral supernatants were substituted with leukemic cell culture medium. GFP+ percentage or cell number was monitored during culture using guava flow cytometer. The absolute cell number was measured by using flow cytometry absolute count standard (Bangs Laboratories Inc., Fishers Ind.). The experimental results were analyzed by guavasoft software.
[0278] For cell cycle experiment, Nras(G12D)/MLL-AF9 cells or MOLM13 cells were infected with viruses encoding sgRNAs either targeting Rosa26 or Pdxk. On day 9, 10, 12, 17 of infection, Nras(G12D)/MLL-AF9 cells or MOLM13 cells were stained with EdU Alexa Fluor 647 Flow Cytometry Assay Kit (Invitrogen C10634, Carlsbad Calif.). Briefly, 10 M Edu was pulsed in culture for 20 mins. Cells were then washed and fixed with Click-iT fixative for 15 min following by Click-iT reaction. The percentages of S-phase cell in population were measured by flow cytometry analysis.
[0279] For apoptosis experiment, Nras(G12D)/MLL-AF9 cells were infected with viruses encoding either control Rosa26 sgRNA or Pdxk sgRNAs. On day 9 of infection, cultured cells were stained with Annexin-APC and 7-AAD. GFP+ and GFP populations were gated for standard flow cytometry analysis.
[0280] For differentiation experiment, Nras(G12D)/MLL-AF9 or MOLM13 cells were infected with viruses encoding either control Rosa26 sgRNA or Pdxk sgRNAs. On day 9 of infection, cultured cells were stained with c-Kit or Mac-1 antibodies. GFP+ and GFP populations were gated for standard flow cytometry analysis to detect c-Kit and Mac-1 expression levels. Cultured cells were also processed with May-Grunwald Giemsa staining.
[0281] Leukemia Mouse Models and Xenogen Bioluminescence Imaging.
[0282] The mouse model of human AML was produced as previously described with some modification. For doxycycline inducible shRNA mouse models, Nras(G12D)/MLL-AF9 leukemic cells infected with viruses encoding shRNAs either targeting Renilla luciferase or Pdxk. Leukemic cells were collected and resuspended in PBS at a concentration of 5 million/ml. 5-6 weeks old B6-LY5 mice (Charles River Labs, Wilmington Mass.) were sublethally irradiated (450 cGy) and transplanted with 1 million leukemic cells through tail vein injection. 6 days after transplantation, Xenogen bioluminescence imaging was utilized to monitor luciferase signal intensity. Before imaging, all mice were anesthetized with 2% isoflurane, and anesthesia was also maintained during the image acquisition inside Xenogen dark chamber. Briefly, 300 mg/kg luciferin (Gold Biotechnology, Olivette, Mo.) was intraperitoneally injected into mice. 10 minutes after luciferin injection, Xenogen bioluminescence imaging was applied to monitor luciferase signal intensities of the mice. After confirmation of disease establishment, doxycycline was supplemented into mouse diet and water to induce shRNA expression. Xenogen bioluminescence imaging was then utilized every three days to monitor luciferase signal intensities and disease progression.
[0283] For isoniazid injection experiment, Nras(G12D)/MLL-AF9 leukemic cells were collected and resuspended in PBS at a concentration of 5 million/ml. 5-6 weeks old B6-LY5 mice (Charles River Labs, Wilmington Mass.) were sublethally irradiated (450 cGy) and transplanted with 1 million leukemic cells through tail vein injection. PBS or 90 mg/kg isoniazid were intraperitoneally injected daily.
[0284] The leukemia disease progress was monitored by in vivo bioluminescent imaging using IVIS Lumina image system (Xenogen) every 3 days. Before imaging, all mice were anesthetized with 2% isoflurane, and anesthesia was also maintained during the image acquisition inside Xenogen dark chamber. 300 mg/kg D-Luciferin (Gold Biotechnology Olivette, Mo.) in PBS at 15 mg/ml was intraperitoneally injected 12 minutes before image capturing. The bioluminescence was acquired and quantitatively analyzed by the Living Image software.
[0285] Western Blot Experiments.
[0286] For viral shRNA infection, leukemic cells or bone marrow HSPCs were infected with virus encoding control shRNA or shRNAs targeting PDXK. After doxycycline induction, leukemic cells were collected and washed once with PBS. Cell pellets were counted and lysed with laemmli lysis buffer at room temperature for 4 hours and boiled at 95 degree for 5 minutes. For viral sgRNA infection, leukemic cells and iMEF cells were infected with virus encoding control sgRNA or sgRNAs targeting PDXK. After infection, GFP+ cells were sorted and proteins were extracted using RIPA buffer. For bone marrow cells, cells were collected from moribund mice, and GFP+ cells were sorted and proteins were extracted using RIPA buffer.
[0287] Protein samples were run on 4-15% Mini-PROTEAN TGX Gel, transferred to PVDF membranes (Millipore, Burlington Mass.). After blocking with 5% skimmed milk, membranes were incubated with primary antibodies (1:1000) overnight and HRP-conjugated secondary antibody (1:10000) for 1 hour. Primary antibodies include anti-PDXK antibody (Sigma HPA030196, St Louis, Mo.), anti-GFP antibody (Hypromatrix HM2020, Worcester Mass.), and anti-Actin antibody (Sigma A3854, St Louis, Mo.). Images were acquired using FluorChem imaging system or X-ray films and quantified by Image J.
[0288] High-Performance Liquid Chromatography-Mass Spectrometry (HPLC-MS).
[0289] LC-MS grade solvents were purchased from Thermo Fisher Scientific (Waltham, Mass.), metabolite standards were purchased from Sigma (St. Louis, Mo.) unless stated otherwise. Nras(G12D)/MLL-AF9 cells infected with viruses encoding Pdxk shRNAs were harvested after 5 days of doxycycline induction. Human MOLM13 cells infected with viruses encoding Pdxk sgRNAs were harvested at day 11 post infection. Nras(G12D)/MLL-AF9 cells or MOLM13 cells were treated with indicated concentrations of isoniazid and harvested after 5 days treatment.
[0290] Measurement of Vitamin B6 Species.
[0291] In each case, 2 million cells were collected by centrifugation at 440g, media was aspirated and 1004 of ice-cold 10% trichloroacetic acid with or without 100 ng/mL d3-pyridoxal (d3-PL), d3-pyridoxine (d3-PN), d3-pyridoxamine (d3-PM), d3-pyridoxal phosphate (d3-PLP) (IsoSciences LLC, Ambler Pa.) was added for metabolite extraction. For experiments involving isoniazid treatment, cells were washed once with PBS to remove residual drug and minimize post-lysis reactions between isoniazid and PLP, which was confirmed by monitoring the d3-PLP internal standard. After overnight incubation at 80 C., samples were vortexed and transferred to 1.7 mL conical eppendorf tubes and centrifuged at 21,000g for 20 min at 4 C. The supernatant was transferred to autosampler vials for LC-MS analysis. Vitamin B species separation was performed using an Agilent 1290 infinity pump and XSelect HSS T3 column (1502.1 mm, 3.5 m; Waters Corporation, Milford Mass.). Mobile phase A was 0.1% heptaflurobutyric acid (HFBA, Thermo Fisher, Waltham Mass.) and 0.1% formic acid (FA, Thermo Fisher, Waltham Mass.) in water, mobile phase B was 0.1% HFBA and 0.1% FA in acetonitrile. The injection volume was 10 L and LC gradient conditions were: 0 min: 0% B; 1 min: 0% B; 7 min: 25% B; 8 min: 25% B; 9 min: 100% B; 10.5 min: 100% B, with 4.5 min of re-equilibration time. MS detection was performed using an Agilent 6230 TOF accurate mass spectrometer with Dual JetStream source operating in positive ionization mode. MS parameters were: gas temp 250 C.; gas flow: 13 L/min; nebulizer pressure: 45 psig; sheath gas temp: 225 C.; sheath gas flow: 12 L/min; VCap: 3,500 V; Fragmentor: 175 V; Skimmer: 65 V; Octopole RF: 750 V. Active mass axis correction was performed using a second nebulizer and pyridine (80.049480) and roxithromycin (837.53185). Data was acquired from m/z 50-1700 at 1.5 spectra/sec. Accurate mass (20 ppm) and retention time was confirmed relative to the pure standards. Data analysis was performed using MassHunter software (Agilent, Santa Clara Calif.).
[0292] Metabolite Profiling.
[0293] 2 million cells were washed once with PBS for the amino acid detection and isoniazid treatment. The supernatant was vacuum dried down (Genevac EZ-2 Elite). Cells were harvested as described above with the exception that the extraction solvent was 80:20 methanol: water containing 1.5 M .sup.13C.sup.15N-labeled amino acid mix (Cambridge Isotope Laboratories) and the 50 ng/mL vitamin B6 internal standards described above. After overnight incubation at 80 C., samples were vortexed well and transferred to 1.7 mL conical eppendorf tubes and centrifuged at 21,000g for 20 mins at 4 C. Samples were re-suspended in 70 L of water and divided between hydrophilic interaction liquid chromatography (HILIC) and Heptafluorobutyric acid (HFBA) methods. For HFBA positive mode profiling, 30 L of re-suspended extract+20 L MPA were mixed and analyzed as described for B6 species. For HILIC negative mode profiling, 404 of re-suspended extract was diluted with 604 of acetonitrile. HILIC metabolite separation was performed using an Agilent 1290 Infinity pump and ZIC-pHILIC polymeric column (PEEK 1502.1 mm, 5 m; Merck Sequent). Mobile phase A was 90:10 water: acetonitrile containing 10 mM ammonium bicarbonate (pH 9.4), mobile phase B was 90:10 acetonitrile: water containing 10 mM ammonium bicarbonate (pH 9.4). The injection volume was 5 L and LC gradient conditions were: 0 min: 95% B; 1 min: 95% B; 10 min: 50% B; 13 min: 50% B; 14 min: 30% B; 16 min 30% B, with 7 min of re-equilibration time. MS detection was performed using an Agilent 6545 Q-TOF mass spectrometer with Dual JetStream source operating in negative ionization mode. MS parameters were: gas temp: 200 C.; gas flow: 10 L/min; nebulizer pressure: 40 psig; sheath gas temp: 300 C.; sheath gas flow: 12 L/min; VCap: 3,000 V; Fragmentor: 125 V; Skimmer: 45 V; Octopole RF: 750 V. Active reference mass correction was through a second nebulizer using masses with m/z: 119.03632 and 980.016375. Data was acquired from m/z 50-1700 at 1 spectra/sec. Accurate mass (20 ppm) and reference metabolite standards and MS/MS spectra collected from pooled QC samples were used to confirm the identity of the metabolites. Data analysis was performed within MassHunter software (Agilent, Santa Clara Calif.) and metabolites reported have <30% CV in pooled QC samples injected regularly throughout the analytical batch.
[0294] Plasmid Construction.
[0295] For sgRNA experiments, the pLKO5.sgRNA.EFS.GFP vector was used (Addgene 57822, Watertown Mass.). For shRNA experiments, RT3GEN vector was used (Fellmann et al., Cell Rep 5:1704-1713 (2013)). For c-kit positive bone marrow cells viral shRNA infection experiment, miR-E based MLS retroviral vector. The full length of mouse or human PDXK cDNA was cloned into MSCV Hygro-PGK-Hygro vector (Clontech 634401, Mountain View Calif.). The deletion and point mutant of PDXK were made by QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara Calif.).
Example 2: Identification of PDXK Function in AML Cell Proliferation
[0296] To identify AML specific metabolic vulnerabilities, 2752 genes encoding metabolic enzymes and transporters were analyzed and 236 genes were found to be abundantly expressed in leukemic cells (
[0297] Among the 236 screened metabolic genes, 23 genes were identified with at least two sgRNA hits each with more than 50% copy number depletion (
[0298] As shown in
[0299] By contrast, Pdxk depletion had no influence on the proliferation of several immortalized murine and human cell lines (immortalized mouse embryonic fibroblasts (iMEFs), 3T3 cells, and sarcoma cells) (
[0300] To test the in vivo significance of PDXK for leukemia disease progression, the consequences of suppressing PDXK in established leukemia in vivo was evaluated. A previously generated AML mouse model with a reverse tetracycline transactivator (rtTA) and a tetracycline-responsive element (TRE) promoter, where shRNA expression is induced by doxycycline was used (Zuber et al., Nat Biotech 29:79-83 (2011)). In this mouse model, Nras(G12D) was co-expressed with luciferase to allow for monitoring of disease progression with bioluminescence imaging. These Nras(G12D)/MLL-AF9 leukemic cells were transduced with viruses encoding shRNAs targeting control Renilla luciferase or Pdxk, and were subsequently transplanted into sub-lethally irradiated recipient mice (See e.g., Zuber et al., Genes Dev 23:877-889 (2009)). Induction of Pdxk shRNAs by doxycyline treatment significantly delayed disease progression and extended overall animal survival (
[0301] In addition, depletion of PDXK had no influence on the proliferation of RagMEF and 3T3 cell lines (
[0302] These results demonstrate that PDXK is selectively required for the proliferation of leukemic cells and that inhibitors of PDXK can effectively inhibit leukemic cell proliferation both in vitro and in vivo. Accordingly, the vitamin B6 pathway inhibitors disclosed herein are useful in methods for inhibiting leukemic cell proliferation and treating AML in a subject in need thereof.
Example 3: PDXK Catalyzes PLP Formation in Leukemic Cells
[0303] The PDXK product PLP is a cofactor for multiple enzymes involved in amino acid, nucleic acid, and lipid metabolism. Although plasma PLP levels can be readily measured, no reliable assays currently detect intracellular PLP. To determine whether genetic blockage of PDXK signaling affected PLP levels in leukemia cells, a high-performance liquid chromatography-mass spectrometry (HPLC-MS) based method was developed to compare intracellular PLP levels in leukemic cells in the presence or absence of PDXK inhibition (
[0304] The availability of a pharmacodynamic marker of PDXK inhibition permits correlation between the leukemia selective dependence of PDXK and its role in PLP production and vitamin B6 metabolism. Hence, re-expression of a wild-type PDXK cDNA but not a kinase dead PDXK mutant (D235A) was able to rescue the proliferative defects and PLP depletion produced by a PDXK sgRNA that targets the intron-exon junction of the human gene (
[0305] Inhibition of another PLP-production pathway (PNPO) partially inhibited growth inhibitory in AML cells, which demonstrates that cell growth is regulated by intracellular PLP levels. See
TABLE-US-00003 hPNPO-a42: (SEQIDNO:987) 5CATGCGCAAGAGTTACCGCG3; hPNPO-a232 (SEQIDNO:988) 5ATGACCGGATAGTCTTTCGG3; hPNPO-a45 (SEQIDNO:989) 5GAGTTACCGCGGGGACCGAG3; and hPNPO-a181 (SEQIDNO:990) 5TTCTGTGATCCCTGATCGGG3.
[0306] In addition, since unphosphorylated vitamin B6 species (PN, PL, and PM) but not the phosphorylated forms (PNP, PLP, PMP) can cross cell membrane, these results also demonstrated that PDXK is the only enzyme that is both necessary and sufficient to sustain the intracellular level of PLP in AML cells. Consistent with these findings, genome wide-CRISPR screens indicate that, in contrast to PDXK, pyridoxamine phosphate oxidase (PNPO) and pyridoxal phosphatase (PDXP) are not required for AML cell proliferation (
[0307] Taken together, these results demonstrate that PDXK catalyzes PLP formation in leukemic cells and that PLP is selectively required for leukemic cell proliferation. Accordingly, the vitamin B6 pathway inhibitors disclosed herein are useful in methods for inhibiting leukemic cell proliferation and treating AML in a subject in need thereof.
Example 4: Pharmacological Inhibition of PDXK/Vitamin B6 Pathway Reduces AML Cell Proliferation
[0308] Isoniazid inhibits TB by suppressing the activity of enoyl-acyl carrier protein reductase, thereby blocking mycolic acids and mycobacterial cell wall synthesis. An inadvertent off-target effect of isoniazid results from its ability to bind and sequester PLP, thereby preventing it from regulating its downstream enzymes and producing symptoms of vitamin B6 deficiency in some patients (Laine-Cessac et al., Biochem Pharmacol 54:863-870 (1997)). Indeed, isoniazid reduced intracellular PLP levels, albeit to a lesser extent than the genetic approaches (
[0309] Similar effects on leukemic cell proliferation were observed when AML cells were treated with two other PDXK inhibitors, Aftin-4 and gingkotoxin (see
[0310] The effects of pharmacological suppression of PLP on leukemic maintenance were assessed. Treatment of mice bearing Nras(G12D)/MLL-AF9 leukemia with isoniazid produced a 25% reduction of PLP in plasma and bone marrow cells (
[0311] Further,
[0312] These results demonstrate that pharmacological inhibition of PDXK/vitamin B6 pathway can effectively inhibit leukemic cell proliferation, both in vitro and in vivo. Further, these results demonstrate that isoniazid may be used to treat AML in a subject without causing undesirable side effects, such as bone marrow suppression. Accordingly, the vitamin B6 pathway inhibitors disclosed herein are useful in methods for inhibiting leukemic cell proliferation and treating AML in a subject in need thereof.
Example 5: Identification of PLP-Dependent Enzymes that are Essential for Leukemic Cell Proliferation
[0313] The downstream mechanism by which PLP contributes to leukemia maintenance was explored. Since PLP is a cofactor of nearly 60 metabolic enzymes, HPLC-MS metabolomics was used to determine how PDXK inhibition influenced the levels of a range of cellular metabolites. Genetic depletion of PDXK in leukemic cells led to changes in the levels of a wide range of metabolites, with putrescine, nucleosides, and several amino acids being the most dramatically decreased (
[0314] A CRISPR/Cas9 based gene knockout experiment was performed in parallel to functionally test whether any of the 27 PLP-dependent enzymes expressed in AML cells were important for leukemia cell proliferation (
[0315] These functional results were intriguing in light of the changes in metabolite levels that were observed following PDXK inhibition. As shown in
[0316] To further explore the functional relevance of these enzymes to leukemia cell maintenance, an experiment to determine whether exogenous addition of downstream metabolites could rescue, in whole or in part, the proliferative defect produced by PLP depletion following isoniazid treatment was performed. Indeed, the addition of putrescine, uridine, or asparagine partially rescued the proliferative block produced by isoniazid (
[0317] Taken together, these results demonstrate that AML cells are dependent on the vitamin B6 pathway for leukemic cell proliferation and that leukemic cell proliferation may be selectively inhibited by disrupting the gene function of PDXK, PNPO, AZIN1, ODC1, GOT2, ALAS1, SPTLC1, or SPTLC2. The elevated PDXK expression level observed in AML cells correlates with the increased demand of highly proliferative leukemic cells on biomass synthesis. PDXK contributes to biomass synthesis partially through the regulation of PLP dependent transaminase GOT2 and asparagine and nucleotides production. Accordingly, the vitamin B6 pathway inhibitors disclosed herein are useful in methods for inhibiting leukemic cell proliferation and treating AML in a subject in need thereof.
EQUIVALENTS
[0318] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0319] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0320] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as up to, at least, greater than, less than, and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.
[0321] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.