METHODS FOR THE PRODUCTION OF STERILE FISH AND OTHER EGG-PRODUCING AQUATIC ANIMALS AND COMPOUNDS FOR USE IN THE METHODS

20200323180 · 2020-10-15

Assignee

Inventors

Cpc classification

International classification

Abstract

This invention relates to methods and compounds for the production of sterile fish and other egg-producing aquatic animals. The methods include/the compounds are useful to cause disruption of gonadal development in fish or other egg-producing aquatic animals through the administration of compounds that lead to the failure of fertile gonadal development, and thus to reproductively sterile fish or other egg-producing aquatic animals. The methods and compounds are for use in e.g. aquaculture, the aquarium trade or control of invasive species.

Claims

1-31. (canceled)

32. A method for producing sterile egg-producing aquatic animals, said method comprising transfecting such eggs with a gapmer that is effective to render individuals produced therefrom sterile, wherein the gapmer has a sequence suitable for targeting RNA of genes that are essential for embryonic germ cell development and wherein the eggs are transfected by immersion in an aqueous immersion medium that comprises the gapmer.

33. The method according to claim 32, wherein the gapmer has a sequence suitable for targeting dead end (dnd), nanos, vasa, piwi, gnrh or fsh receptor RNA.

34. The method according to claim 32 wherein the gapmer has a sequence suitable for targeting dnd RNA.

35. The method according to claim 32, wherein the gapmer comprises a gap that comprises a continuous stretch of RNase H recruiting nucleotides and wherein said gap is flanked by a 5 wing region and a 3 wing region, each of which comprise affinity-enhancing chemically modified nucleotides.

36. The method according to claim 32, wherein the gapmer consists of 8 to 36 nucleotides.

37. The method according to claim 32, wherein the gapmer consists of 10 to 22 nucleotides.

38. The method according to claim 32, wherein the gapmer consists of 14 to 20 nucleotides.

39. The method according to claim 32, wherein the gapmer is taken up into the eggs by gymnosis.

40. The method according to claim 32, wherein the eggs are transfected by electroporation.

41. The method according to claim 32, wherein the immersion medium comprises a transfection agent.

42. The method according to claim 41, wherein the transfection agent is a cationic agent.

43. The method according to claim 41, wherein the transfection agent is selected from the group consisting of cationic lipid, cationic liposome, cationic polymer, cationic dendrimer and cationic peptide.

44. The method according to claim 32, wherein the egg-producing aquatic animal is a fish.

45. The method according to claim 44, wherein the fish is selected from the group consisting of salmonid, moronid, cichlid, gadid, pangasid, ictalurid and cyprinid.

46. The method according to claim 32, wherein the egg-producing aquatic animal is an Atlantic salmon and wherein the gapmer has sequence selected from the group consisting of SED ID NO: 1, SED ID NO: 2 and SED ID NO: 3 or a variant thereof.

47. A gapmer having a sequence suitable for targeting dnd RNA of salmonids, which is effective to transfect eggs from salmonids and render individuals produced therefrom sterile.

48. The gapmer according to claim 47, wherein the gapmer has a sequence selected from the group consisting of SED ID NO: 1, SED ID NO: 2 and SED ID NO: 3 or a variant thereof.

49. The gapmer according to claim 47, wherein the gapmer has a sequence selected from the group consisting of SED ID NO: 1, SED ID NO: 2 and SED ID NO: 3.

50. A composition comprising a gapmer having a sequence suitable for targeting dnd RNA of salmonids, which is effective to transfect eggs from salmonids and render individuals produced therefrom sterile and a pharmaceutically acceptable carrier.

51. The composition according to claim 50, wherein the gapmer has a sequence selected from the group consisting of SED ID NO: 1, SED ID NO: 2 and SED ID NO: 3 or a variant thereof.

52. The composition according to claim 50, wherein the gapmer has a sequence selected from the group consisting of SED ID NO: 1, SED ID NO: 2 and SED ID NO: 3.

53. The composition according to claim 50, wherein the pharmaceutically acceptable carrier is water or an aqueous buffer.

Description

EXAMPLES

Example 1

Transfection of Fertilized Salmo Salar Eggs by Immersion in an Aqueous Immersion Medium Comprising a Gapmer that Targets Dead End mRNA

[0074] Gapmers 1-3 that target Salmo salar dead end (dnd) mRNA and gapmer 4 having a non-dnd specific sequence (negative control) were designed using the online Qiagen gapmer design tool and purchased from Qiagen:

TABLE-US-00001 Gapmer1: (SEQIDNO:1) TTGAACGCTCCTCCAT Gapmer2: (SEQIDNO:2) GGAGCAGCGAGGAGGT Gapmer3: (SEQIDNO:3) GCAAAACATTTAAGTA Gapmer4: (SEQIDNO:4) GCTCCCTTCAATCCAA

[0075] The gap of the gapmers comprised phosphorothioate-modified nucleotides while the wings comprised LNAs.

[0076] Salmo salar eggs were fertilized in an aqueous immersion medium (150 mM NaCl, 3.3 mM KCl, 20 mM Tris-HCl, pH 8.4) for 10 minutes before the fertilized eggs were collected and rinsed once in the aqueous immersion medium. The eggs were placed into 10 test tubes (3 eggs/test tube) and immersed in an aqueous immersion medium (150 mM NaCl, 3.3 mM KCl, 20 mM Tris-HCl, pH 8.4) containing either 10 nM of gapmer 1, 2, 3 or 4 (2 test tubes each) or no gapmer (2 test tubes). Of the two equal test tubes, one was briefly sonicated (10 s, 42 kHz). All test tubes were stored at 8 C. in the dark for 4 hours, then RNA was extracted according to the TRIzol method, and treated with DNase to completely remove any DNA from the extracted RNA.

[0077] RNAs were reverse transcribed into cDNAs using the Qiagen OneStep RT-PCR kit, following the manufacturer's instructions. PCR was carried out with a BioRad MyCycler thermocycler using the OneTaq Polymerase kit (New England Biolabs) and following the manufacturer's instructions. The following dnd-specific primers were used (amplicon size 401 bp):

TABLE-US-00002 Salgap2-F: (SEQIDNO:5) GAGCGTTCAAGTCAGGTGTTG Salgap2-R: (SEQIDNO:6) CAGAGCTGACGTTTCTCCGT

[0078] PCR amplification of a common Salmo salar house-keeping gene was carried out to control integrity of the extracted RNA/transcribed cDNA. All samples showed an equally strong band for the house-keeping gene. No-template PCR controls were blank, i.e. showing that there was no dnd template contamination in the PCR reagents and/or the equipment which could produce false results.

[0079] Eggs which had been immersed in immersion medium only (without gapmer) gave strong PCR signals, showing that the dnd-mRNA was detectable in such eggs. Eggs which had been immersed in immersion medium comprising gapmer 4 also gave strong PCR signals, showing that the random gapmer sequence did not target dnd mRNA.

[0080] Eggs which had been immersed in immersion medium comprising gapmer 1 gave very weak (with sonication) and no PCR signal (without sonication), showing that the eggs had been successfully transfected and that gapmer 1 was effective to target and destroy dnd-mRNA, i.e. knockdown of the dead end gene which is crucial for the migration and survival of PGCs. If the eggs had been allowed to develop, the fish hatched therefrom would have been reproductively sterile.

[0081] Eggs which had been immersed in immersion medium comprising gapmer 2 gave a weak PCR signal (with or without sonication), showing that the eggs had been successfully transfected and that gapmer 2 was to a large degree effective to target and destroy dnd-mRNA. It is likely that gapmer 2 could show equally good effectivity under optimized incubation conditions, e.g. longer incubation time.

[0082] Eggs which had been immersed in immersion medium comprising gapmer 3 gave a strong PCR signal (with sonication) and no PCR signal (without sonication). It is believed that the strong PCR signal in the sonicated eggs is not due to failure to transfect the eggs or lack of effectiveness of the gapmer but rather due to the eggs having suffered from the mechanical treatment. This hypothesis is supported by the absence of the PCR signal in the non-sonicated eggs which shows that the eggs had been successfully transfected and that gapmer 3 was effective to target and destroy dnd-mRNA, i.e. knockdown of the dead end gene which is crucial for the migration and survival of PGCs. If the eggs had been allowed to develop, the fish hatched therefrom would have been reproductively sterile.

Example 2

Transfection of Fertilized Salmo Salar Eggs by Microinjection of a Gapmer that Targets Dead End mRNA

[0083] Salmo salar eggs are fertilized in water supplemented with glutathione to prevent hardening of the chorion. At the one-cell stage, eggs are collected and divided up in 5 batches (10 eggs/batch) and the gapmers described in Example 1 are dissolved in physiological saline to prepare solutions of gapmers 1-4 at a concentration of 400 ng/l. One batch of eggs is microinjected with a gapmer solution, i.e. batch 1/solution of gapmer 1, batch 2/solution of gapmer 2 and so on while batch 5 is injected with physiological saline only (same volume as gapmer solution). Microinjection is carried out using a World Precision instruments, PV820 pneumatic PicoPump, coupled with a Narishige MN-151 micromanipulator. After injection, the eggs are cultured in water containing glutathione at 8 C. in the dark for 24 hours. From each batch, 3 eggs are transferred into a test tube for RNA extraction, reverse transcription and PCR which is carried out as described in Example 1. The absence of or a weak PCR signal shows that the transfection is successful and that the gapmer is effective to target and destroy dnd-mRNA, i.e. knockdown of the dead end gene which is crucial for the migration and survival of PGCs. The remaining eggs are rinsed in physiological saline and transferred for further development into their natural habitat until reproductively sterile fish hatch therefrom.

Example 3

Transfection of Fertilized Salmo Salar Eggs by Immersion in an Aqueous Immersion Medium Comprising a Gapmer that Targets Dead End mRNA and a Transfection Agent

[0084] Salmo salar eggs are fertilized in an aqueous immersion medium (150 mM NaCl, 3.3 mM KCl, 20 mM Tris-HCl, pH 8.4) for 10 minutes before the fertilized eggs are collected and rinsed once in the same aqueous immersion medium. The eggs are placed into 10 test tubes (10 eggs/test tube) and immersed in an aqueous immersion medium (150 mM NaCl, 3.3 mM KCl, 20 mM Tris-HCl, pH 8.4) containing a pre-mix of the gapmer 1, 2, 3 or 4 and Oligofectamine (Thermofisher) following the manufacturer's instructions or only the transfection agent and no gapmer. The concentration of gapmer in the gapmer-containing immersion media is 8 nM. All test tubes are stored at 8 C. in the dark for 6 hours. From each test tube, 3 eggs are transferred into a fresh test tube for RNA extraction, reverse transcription and PCR which is carried out as described in Example 1. The absence of or a weak PCR signal shows that the transfection is successful and that the gapmer is effective to target and destroy dnd-mRNA, i.e. knockdown the of dead end gene which is crucial for the migration and survival of PGCs. The remaining eggs are rinsed in physiological saline and transferred for further development into their natural habitat until reproductively sterile fish hatch therefrom.

Embodiments

[0085] 1. A method for producing sterile egg-producing aquatic animals, said method comprising transfecting such eggs with a gapmer that is effective to render individuals produced therefrom sterile. [0086] 2. The method according to embodiment 1, wherein the gapmer has a sequence suitable for targeting RNA of genes that are essential for embryonic germ cell development. [0087] 3. The method according to embodiments 1 or 2, wherein the gapmer has a sequence 25 suitable for targeting dead end (dnd), nanos, vasa, piwi, gnrh or fsh receptor RNA. [0088] 4. The method according to embodiment 3, wherein the gapmer has a sequence suitable for targeting dnd RNA. [0089] 5. The method according to any of the preceding embodiments, wherein the gapmer comprises a gap that comprises a continuous stretch of RNase H recruiting nucleotides and wherein said gap is flanked by a 5 wing region and a 3 wing region, each of which comprise affinity-enhancing chemically modified nucleotides. [0090] 6. The method according to embodiment 5, wherein each nucleotide of the gap is a 2 deoxynucleotide. [0091] 7. The method according to embodiment 6, wherein one of more of the 2deoxynucleotides are substituted by a modified nucleotide that is DNA-like. [0092] 8. The method according to embodiment 6, wherein one or more of the 2deoxynucleotides are substituted by a non-DNA-like nucleotide and wherein the gapmer nonetheless supports RNase H activation by virtue of the number or placement of the non-DNA-like nucleotides. [0093] 9. The method according to any of embodiments 5 to 8, wherein the 5 wing region of the gapmer consists of 1 to 8 linked nucleotides. [0094] 10. The method according to any of embodiments 5 to 9, wherein the 3 wing region of the gapmer consists of 1 to 8 linked nucleotides. [0095] 11. The method according to any of embodiments 5 to 10, wherein the 5 wing region of the gapmer consists of the same number of linked nucleotides as the 3 wing region. [0096] 12. The method according to any of embodiments 5 to 10, wherein the 5 wing region of the gapmer consists of a different number of linked nucleotides than the 3 wing region. [0097] 13. The method according to any of embodiments 5 to 12, wherein the 5 wing region of the gapmer and/or the 3 wing region of the gapmer comprise LNA and/or 2alkylated RNA nucleotides. [0098] 14. The method according to embodiment 13, wherein the 5 wing region of the gapmer and/or the 3 wing region of the gapmer consist of LNA. [0099] 15. The method according to any of the preceding embodiments, wherein the gapmer consists of 8 to 36 nucleotides, e.g. 10 to 22 nucleotides, such as 12 to 18, 13 to 17 or 12 to 16 nucleotides, e.g. 12, 13, 14, 15 or 16 nucleotides or 14, 15, 16, 17, 18, 19 or 20 nucleotides. [0100] 16. The method according to any of embodiments 5 to 15, wherein the wing-gap-wing motif of the gapmer is 5-8-5, 5-6-5, 4-10-4, 4-8-4, 4-6-4, 3-12-3, 3-10-3, 3-8-3, 2-16-2, 2-14-2, 2-12-2, 2-10-2, 1-16-1, 1-14-1, 1-12-1, 1-10-1, 2-8-2, 1-8-1, 3-6-3 or 1-6-1. [0101] 17. The method according to any of the preceding embodiments, wherein the internucleoside linkages between the nucleotides in the gapmer are all phosphorothioate internucleoside linkages. [0102] 18. The method according to any of the preceding embodiments wherein the eggs are either unfertilized eggs or pre-water activated fertilized eggs or fertilized eggs. [0103] 19. The method according to any of the preceding embodiments, wherein the eggs are transfected by immersion in an aqueous immersion medium that comprises the gapmer. [0104] 20. The method according to embodiment 19, wherein the immersion medium further comprises other compounds, including compounds that assist or promote the transfection and/or compounds that are beneficial to the embryos/egg-producing aquatic animals hatched from the transfected eggs. [0105] 21. The method according to embodiment 20, wherein the immersion medium further comprises compounds selected from salts, buffering agents, chelating agents and amino acids, hormones, growth promoters, protective antigens, antibiotics, nutrients, ovarian fluid, serum and protease inhibitors. [0106] 22. The method according to any of embodiments 19 to 21, wherein the gapmer is taken up into the eggs by gymnosis. [0107] 23. The method according to embodiment 22, wherein the eggs are unfertilized eggs or 5 pre-water activated fertilized eggs. [0108] 24. The method according to embodiment 22, wherein the eggs are fertilized eggs. [0109] 25. The method according to any of embodiments 22 to 24, wherein the concentration of the gapmer in the immersion medium is in the range of 1 nM to 250 M, e.g. 1 nM to 5 nM or 5 nM to 50 nM or 10 nM to 20 nM or 100 nM to 250 M, e.g. 100 to 250 nM, 250 to 500 nM, 500 to 1000 nM, 1 M to 50 M, 50 M to 100 M, 100 M to 150 M, 150 M to 200 M or 200 M to 250 M, such as at least 5 nM, at least 10 nM, at least 20 nM, at least 50 nM, at least 100 nM, at least 250 nM, at least 500 nM, at least 1 M, at least 50 M, at least 100 m, at least 150 M, at least 200 M. [0110] 26. The method according to any of embodiments 22 to 25, wherein the eggs are immersed in the aqueous immersion medium comprising the gapmer for 1 to 144 hours, e.g. 1 hour to 2 hours, 2 hours to 6 hours, 6 hours to 12 hours, 12 hours to 24 hours, 24 hours to 36 hours, 36 hours to 48 hours, 48 hours to 120 hours or 4 hours to 12 hours, 24 hours to 96 hours, or 36 to 72 hours, such as at least 2 hours, at least 4 hours, at least 6 hours, at least 8 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 108 hours, at least 120 hours or at least 132 hours. [0111] 27. The method according to any of embodiments 19 to 21, wherein the eggs are transfected by electroporation. [0112] 28. The method according to embodiment 27, wherein the eggs are immersed in the aqueous immersion medium comprising the gapmer for milliseconds to seconds. [0113] 29. The method according to any of embodiment 19 to 21, wherein the immersion medium comprises a transfection agent. [0114] 30. The method according to embodiment 29, wherein the transfection agent is a cationic agent, preferably a cationic lipid/cationic liposome, a cationic polymer, a cationic dendrimer or a cationic peptide. [0115] 31. The method according to embodiment 30, wherein the transfection agent comprises either 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA) or N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA) together with dioleoyl phosphatidylethanolamine (DOPE). [0116] 32. The method according to any of embodiments 29 to 31, wherein the concentration of the gapmer in the aqueous immersion medium is about 0.1 nM to 100 M. [0117] 33. The method according to any of embodiments 29 to 32, wherein the eggs are fertilized eggs and the concentration of the gapmer in the aqueous immersion medium is about 1 nM to 100 M, e.g. 1 nM to 100 nM, 100 nM to 1 M, 1 M to 20 M, 20 M to 80 M, 20 M to 60 M or 20 M to 40 M, such as at least 1 nM, at least 10 nM, at least 50 nM, at least 100 nM, at least 1 M, at least 10 M, at least 20 M, at least 40 M, at least 60 M or at least 80 M. [0118] 34. The method according to any of embodiments 29 to 32, wherein the eggs are unfertilized eggs or pre-water activated fertilized eggs and the concentration of the gapmer in the aqueous immersion medium is about0.1 nm to 1 nM, 1 nM to 10 nM, 10 nM to 100 nM, 1 M to 40 M, e.g. 1 M to 30 M, 1 M to 20 M, 1 M to 15 M, 1 M to 10 M or 1 M to 5 M, such as at least 0.1 nM, at least 1 nM, at least 10 nM, at least 100 nM, at least 1 M, at least 3 M, at least 5 M, at least 10 M, at least 15 M, at least 20 M or at least 30 M. [0119] 35. The method according to any of embodiments 29 to 34, wherein the eggs are immersed in the immersion medium comprising the gapmer and the transfection agent for 1 to 96 hours, e.g. 1 to 2 hours, 2 to 4 hours, 4 to 8 hours, 8 to 10 hours, 10 to 12 hours, 12 to 24 hours, 24 to 48 hours, 48 to 72 hours or 72 to 96 hours. [0120] 36. The method according to any of embodiments 19 to 21, wherein the eggs are transfected by microinjection. [0121] 37. The method according to embodiment 36, wherein the eggs are fertilized eggs at the one cell stage. [0122] 38. The method according to embodiments 36 or 37, wherein the gapmer is injected at a concentration of 5-5000 ng/l, e.g. 50-500 ng/l or 100-400 ng/l. [0123] 39. The method according to any of the preceding embodiments, wherein the egg-producing aquatic animal is a fish, a crustacean or a mollusc. [0124] 40. The method according to embodiment 39, wherein the egg-producing aquatic animal is a fish. [0125] 41. The method according to embodiment 40, wherein said fish is a salmonid, moronid, cichlid, gadid, pangasid, ictalurid or cyprinid. [0126] 42. The method according to embodiment 40, wherein said fish is an Atlantic salmon, coho salmon, chinook salmon, chum salmon, sockeye salmon, pink salmon, masu salmon, rainbow trout, brook trout, brown trout, common grayling, Arctic grayling, Arctic char, bass, striped bass, white bass, striped-white bass hybrids, yellow bass, white perch, yellow perch European perch, bass-perch hybrid, Nile tilapia, blue tilapia, blue Nile tilapia hybrid, Mozambique tilapia, zebrafish seabream, porgy, cod, haddock, whiting, pollock or catfish. [0127] 43. The method according to embodiment 39, wherein the egg-producing aquatic animal is a crustacean. [0128] 44. The method according to embodiment 43, wherein said crustacean is a shrimp, a prawn, a lobster, a crayfish or a crab. [0129] 45. The method according to embodiment 39, wherein said egg-producing animal is a mollusc. [0130] 46. The method according to embodiment 45, wherein said mollusc is an oyster, mussel, scallop, geoduck, squid, abalone, octopus or cuttlefish. [0131] 47. A gapmer for use in a method for producing sterile egg-producing aquatic animals, wherein said method comprises transfecting such eggs with the gapmer, which is effective to render individuals, produced therefrom sterile. [0132] 48. The gapmer for use in the method according to embodiment 47, wherein the gapmer has a sequence suitable for targeting RNA of genes that are essential for embryonic germ cell development. [0133] 49. The gapmer for use in the method according to embodiments 47 or 48, wherein the gapmer has a sequence suitable for targeting dead end (dnd), nanos, vasa, piwi, gnrh or fsh receptor RNA. [0134] 50. The gapmer for use in the method according to embodiment 49, wherein the gapmer has a sequence suitable for targeting dnd RNA. [0135] 51. The gapmer for use in the method according to any of embodiments 47 to 50, wherein the gapmer comprises a gap that comprises a continuous stretch of RNase H recruiting nucleotides and wherein said gap is flanked by a 5 wing region and a 3 wing region, each of which comprise affinity-enhancing chemically modified nucleotides. [0136] 52. The gapmer for use in the method according to embodiment 51, wherein each nucleotide of the gap is a 2-deoxynucleotide. [0137] 53. The gapmer for use in the method according to embodiment 52, wherein one of more of the 2-deoxynucleotides are substituted by a modified nucleotide that is DNA-like. [0138] 54. The gapmer for use in the method according to embodiment 52, wherein one or more 5 of the 2-deoxynucleotides are substituted by a non-DNA-like nucleotide and wherein the gapmer nonetheless supports RNase H activation by virtue of the number or placement of the non-DNA-like nucleotides. [0139] 55. The gapmer for use in the method according to embodiments 51 to 54, wherein the 5 wing region of the gapmer consists of 1 to 8 linked nucleotides. [0140] 56. The gapmer for use in the method according to embodiments 51 to 55, wherein the 3 wing region of the gapmer consists of 1 to 8 linked nucleotides. [0141] 57. The gapmer for use in the method according to embodiments 51 to 56, wherein the 5 wing region of the gapmer consists of the same number of linked nucleotides as the 3 wing region. [0142] 58. The gapmer for use in the method according to embodiments 51 to 56, wherein the 5 wing region of the gapmer consists of a different number of linked nucleotides than the 3 wing region. [0143] 59. The gapmer for use in the method according to embodiments 51 to 58, wherein the 5 wing region of the gapmer and/or the 3 wing region of the gapmer comprise LNA 25 and/or 2-alkylated RNA nucleotides. [0144] 60. The gapmer for use in the method according to embodiment 59, wherein the 5 wing region of the gapmer and/or the 3 wing region of the gapmer consist of LNA. [0145] 61. The gapmer for use in the method according to embodiments 46 to 60, wherein the gapmer consists of 8 to 36 nucleotides, e.g. 10 to 22 nucleotides, such as 12 to 18, 13 to 17 or 12 to 16 nucleotides, e.g. 12, 13, 14, 15 or 16 nucleotides or 14, 15, 16, 17, 18, 19 or 20 nucleotides. [0146] 62. The gapmer for use in the method according to embodiments 51 to 61, wherein the 5 wing-gap-wing motif of the gapmer is 5-8-5, 5-6-5, 4-10-4, 4-8-4, 4-6-4, 3-12-3, 3-103, 3-8-3, 2-16-2, 2-14-2, 2-12-2, 2-10-2, 1-16-1, 1-14-1, 1-12-1, 1-10-1, 2-8-2, 1-8-1, 36-3 or 1-6-1. [0147] 63. The gapmer for use in the method according to embodiments 46 to 62, wherein the internucleoside linkages between the nucleotides in the gapmer are all phosphorothioate internucleoside linkages. [0148] 64. The gapmer for use in the method according to embodiments 46 to 63 wherein the eggs are either unfertilized eggs or pre-water activated fertilized eggs or fertilized eggs. [0149] 65. The gapmer for use in the method according to embodiments 46 to 64, wherein the eggs are transfected by immersion in an aqueous immersion medium that comprises the gapmer. [0150] 66. The gapmer for use in the method according to embodiment 65, wherein the immersion medium further comprises other compounds, including compounds that assist or promote the transfection and/or compounds that are beneficial to the embryos/egg-producing aquatic animals hatched from the transfected eggs. [0151] 67. The gapmer for use in the method according to embodiment 66, wherein the immersion medium further comprises compounds selected from salts, buffering agents, chelating agents and amino acids, hormones, growth promoters, protective antigens, antibiotics, nutrients, ovarian fluid, serum and protease inhibitors. [0152] 68. The gapmer for use in the method according to embodiments 65 to 67, wherein the gapmer is taken up into the eggs by gymnosis. [0153] 69. The gapmer for use in the method according to embodiment 68, wherein the eggs are unfertilized eggs or pre-water activated fertilized eggs. [0154] 70. The gapmer for use in the method according to embodiment 68, wherein the eggs are fertilized eggs. [0155] 71. The gapmer for use in the method according to embodiments 68 to 70, wherein the concentration of the gapmer in the immersion medium is in the range of 1 nM to 250 M, e.g. 1 nM to 5 nM or 5 nM to 50 nM or 10 nM to 20 nM or 100 nM to 250 M, e.g. 100 to 250 nM, 250 to 500 nM, 500 to 1000 nM, 1 M to 50 M, 50 M to 100 M, 100 M to 150 M, 150 M to 200 M or 200 M to 250 M, such as at least 5 nM, at least 10 nM, at least 20 nM, at least 50 nM, at least 100 nM, at least 250 nM, at least 500 nM, at least 1 M, at least 50 M, at least 100 m, at least 150 M, at least 200 M. [0156] 72. The gapmer for use in the method according to embodiments 68 to 71, wherein the eggs are immersed in the aqueous immersion medium comprising the gapmer for 1 to 144 hours, e.g. 1 hour to 2 hours, 2 hours to 6 hours, 6 hours to 12 hours, 12 hours to 24 hours, 24 hours to 36 hours, 36 hours to 48 hours, 48 hours to 120 hours or 4 hours to 12 hours, 24 hours to 96 hours, or 36 to 72 hours, such as at least 2 hours, at least 4 hours, at least 6 hours, at least 8 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 108 hours, at least 120 hours or at least 132 hours. [0157] 73. The gapmer for use in the method according to embodiments 65 to 67, wherein the eggs are transfected by electroporation. [0158] 74. The gapmer for use in the method according to embodiment 73, wherein the eggs are immersed in the aqueous immersion medium comprising the gapmer for milliseconds to seconds. [0159] 75. The gapmer for use in the method according to embodiments 65 to 67, wherein the immersion medium comprises a transfection agent. [0160] 76. The method according to embodiment 75, wherein the transfection agent is a cationic agent, preferably a cationic lipid/cationic liposome, a cationic polymer, a cationic dendrimer or a cationic peptide. [0161] 77. The gapmer for use in the method according to embodiment 76, wherein the transfection agent comprises either 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA) or N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA) together with dioleoyl phosphatidylethanolamine (DOPE). [0162] 78. The gapmer for use in the method according to embodiments 75 to 77, wherein the concentration of the gapmer in the aqueous immersion medium is about 0.1 nM to 100 M. [0163] 79. The gapmer for use in the method according to embodiments 75 to 78, wherein the eggs are fertilized eggs and the concentration of the gapmer in the aqueous immersion medium is about 1 nM to 100 M, e.g. 1 nM to 100 nM, 100 nM to 1 M, 1 M to 20 M, 20 M to 80 M, 20 M to 60 M or 20 M to 40 M, such as at least 1 nM, at least 10 nM, at least 50 nM, at least 100 nM, at least 1 M, at least 10 M, at least 20 M, at least 40 M, at least 60 M or at least 80 M. [0164] 80. The gapmer for use in the method according to embodiments 75 to 78, wherein the eggs are unfertilized eggs or pre-water activated fertilized eggs and the concentration of the gapmer in the aqueous immersion medium is about0.1 nm to 1 nM, 1 nM to 10 nM, 10 nM to 100 nM, 1 M to 40 M, e.g. 1 M to 30 M, 1 M to 20 M, 1 M to 15 M, 1 M to 10 M or 1 M to 5 M, such as at least 0.1 nM, at least 1 nM, at least 10 nM, at least 100 nM, at least 1 M, at least 3 M, at least 5 M, at least 10 M, at least 15 M, at least 20 M or at least 30 M. [0165] 81. The gapmer for use in the method according to embodiments 75 to 80, wherein the eggs are immersed in the immersion medium comprising the gapmer and the transfection agent for 1 to 96 hours, e.g. 1 to 2 hours, 2 to 4 hours, 4 to 8 hours, 8 to 10 hours, 10 to 12 hours, 12 to 24 hours, 24 to 48 hours, 48 to 72 hours or 72 to 96 hours. [0166] 82. The gapmer for use in the method according to embodiments 65 to 67, wherein the 5 eggs are transfected by microinjection. [0167] 83. The gapmer for use in the method according to embodiment 82, wherein the eggs are fertilized eggs at the one cell stage. [0168] 84. The gapmer for use in the method according to embodiments 82 or 83, wherein the gapmer is injected at a concentration of 5-5000 ng/l, e.g. 50-500 ng/l or 100-400 ng/l. [0169] 85. The gapmer for use in the method according to embodiments 46 to 84, wherein the egg-producing aquatic animal is a fish, a crustacean or a mollusc. [0170] 86. The gapmer for use in the method according to embodiment 85, wherein the egg-producing aquatic animal is a fish. [0171] 87. The gapmer for use in the method according to embodiment 86, wherein said fish is a salmonid, moronid, cichlid, gadid, pangasid, ictalurid or cyprinid. [0172] 88. The gapmer for use in the method according to embodiment 86, wherein said fish is an Atlantic salmon, coho salmon, chinook salmon, chum salmon, sockeye salmon, pink salmon, masu salmon, rainbow trout, brook trout, brown trout, common grayling, Arctic grayling, Arctic char, bass, striped bass, white bass, striped-white bass hybrids, yellow bass, white perch, yellow perch European perch, bass-perch hybrid, Nile tilapia, blue tilapia, blue-Nile tilapia hybrid, Mozambique tilapia, zebrafish seabream, porgy, cod, haddock, whiting, pollock or catfish. [0173] 89. The gapmer for use in the method according to embodiment 85, wherein the egg-producing aquatic animal is a crustacean. [0174] 90. The gapmer for use in the method according to embodiment 89, wherein said crustacean is a shrimp, a prawn, a lobster, a crayfish or a crab. [0175] 91. The gapmer for use in the method according to embodiment 85, wherein said egg 5 producing animal is a mollusc. [0176] 92. The gapmer for use in the method according to embodiment 91, wherein said mollusc is an oyster, mussel, scallop, geoduck, squid, abalone, octopus or cuttlefish. [0177] 93. A gapmer which is effective to transfect eggs from egg-producing aquatic animals and render individuals produced therefrom sterile. [0178] 94. The gapmer according to embodiment 93 which suppresses expression of a protein that is essential for embryonic germ cell development in said egg-producing aquatic animals. [0179] 95. The gapmer according to embodiments 93 or 94, wherein the gapmer has a sequence suitable for targeting RNA of genes that are essential for embryonic germ cell development in the egg-producing aquatic animals. [0180] 96. The gapmer according to embodiments 93 to 95, wherein the gapmer has a sequence suitable for targeting dead end (dnd), nanos, vasa, piwi, gnrh or fsh receptor RNA. [0181] 97. The gapmer according to embodiment 96, wherein the gapmer has a sequence 25 suitable for targeting dnd RNA. [0182] 98. The gapmer according to any of embodiments 96 to 97, wherein said RNA is an RNA from a fish, a crustacean or a mollusc. [0183] 99. The gapmer according to embodiment 98, wherein said RNA is RNA from a fish. [0184] 100. The gapmer according to embodiment 99, wherein said fish is a salmonid, moronid, cichlid, gadid, pangasid, ictalurid or cyprinid. [0185] 101. The gapmer according to embodiment 99, wherein said fish is an Atlantic salmon, coho salmon, chinook salmon, chum salmon, sockeye salmon, pink salmon, masu salmon, rainbow trout, brook trout, brown trout, common grayling, Arctic grayling, Arctic char, bass, striped bass, white bass, striped-white bass hybrids, yellow bass, white perch, yellow perch European perch, bass-perch hybrid, Nile tilapia, blue tilapia, blueNile tilapia hybrid, Mozambique tilapia, zebrafish seabream, porgy, cod, haddock, whiting, pollock or catfish. [0186] 102. The gapmer according to embodiment 98, wherein said RNA is RNA from a crustacean. [0187] 103. The gapmer according to embodiment 102, wherein said crustacean is a shrimp, a prawn, a lobster, a crayfish or a crab. [0188] 104. The gapmer according to embodiment 98, wherein said RNA is RNA from a mollusc. [0189] 105. The gapmer according to embodiment 104, wherein said mollusc is an oyster, mussel, scallop, geoduck, squid, abalone, octopus or cuttlefish. [0190] 106. The gapmer according to any of embodiments 93 to 105, wherein the gapmer comprises a gap that comprises a continuous stretch of RNase H recruiting nucleotides and wherein said gap is flanked by a 5 wing region and a 3 wing region, each of which comprise affinity-enhancing chemically modified nucleotides. [0191] 107. The gapmer according to embodiment 106, wherein each nucleotide of the gap is a 2-deoxynucleotide. [0192] 108. The gapmer according to embodiment 107, wherein one of more of the 2deoxynucleotides are substituted by a modified nucleotide that is DNA-like. [0193] 109. The gapmer according to embodiment 107, wherein one or more of the 2deoxynucleotides are substituted by a non-DNA-like nucleotide and wherein the gapmer nonetheless supports RNase H activation by virtue of the number or placement of the non-DNA-like nucleotides. [0194] 110. The gapmer according to any of embodiments 106 to 109, wherein the 5 wing region of the gapmer consists of 1 to 8 linked nucleotides. [0195] 111. The gapmer according to any of embodiments 106 to 110, wherein the 3 wing region of the gapmer consists of 1 to 8 linked nucleotides. [0196] 112. The gapmer according to any of embodiments 106 to 111, wherein the 5 wing region of the gapmer consists of the same number of linked nucleotides as the 3 wing region. [0197] 113. The gapmer according to any of embodiments 106 to 111, wherein the 5 wing region of the gapmer consists of a different number of linked nucleotides than the 3 wing region. [0198] 114. The gapmer according to any of embodiments 106 to 113, wherein the 5 wing region of the gapmer and/or the 3 wing region of the gapmer comprise LNA and/or 2-alkylated RNA nucleotides. [0199] 115. The gapmer according to embodiment 114, wherein the 5 wing region of the gapmer and/or the 3 wing region of the gapmer consist of LNA. [0200] 116. The gapmer according to any of embodiments 106 to 115, wherein the gapmer consists of 8 to 36 nucleotides, e.g. 10 to 22 nucleotides, such as 12 to 18, 13 to 17 or 12 to 16 nucleotides, e.g. 12, 13, 14, 15 or 16 nucleotides or 14, 15, 16, 17, 18, 19 or 20 nucleotides. [0201] 117. The gapmer according to any of embodiments 106 to 116, wherein the wing-gap-wing motif of the gapmer is 5-8-5, 5-6-5, 4-10-4, 4-8-4, 4-6-4, 3-12-3, 3-10-3, 3-8-3, 2-16-2, 2-14-2, 2-12-2, 2-10-2, 1-16-1, 1-14-1, 1-12-1, 1-10-1, 2-8-2, 1-8-1, 3-6-3 or 1-6-1. [0202] 118. The gapmer according to any of embodiments 106 to 117, wherein the internucleoside linkages between the nucleotides in the gapmer are all phosphorothioate internucleoside linkages. [0203] 119. The gapmer according to embodiment 97, wherein said dnd RNA is that of salmonids. [0204] 120. The gapmer according to embodiment 119, wherein said salmonid is Atlantic salmon, coho salmon, chinook salmon, chum salmon, sockeye salmon, pink salmon, masu salmon, rainbow trout, brook trout, brown trout, common grayling, Arctic grayling or Arctic char. [0205] 121. The gapmer according to embodiment 120, wherein said salmonid is Atlantic salmon. [0206] 122. The gapmer according to embodiment 121, wherein said gapmer has a sequence selected from SED ID NO: 1, SED ID NO: 2 or SED ID NO: 3 or a variant thereof. [0207] 123. The gapmer according to embodiment 122, wherein said gapmer has a sequence selected from SED ID NO: 1, SED ID NO: 2 or SED ID NO: 3. [0208] 124. A composition comprising the gapmer according to any of embodiments 93 to 123 and a pharmaceutically acceptable carrier. [0209] 125. A composition according to embodiment 124, wherein said composition comprises two or more gapmers. [0210] 126. The composition according to embodiment 125, wherein said composition comprises the gapmer of SED ID NO: 1 and the gapmer of SED ID NO: 2 or variants thereof or the gapmer of SED ID NO: 1 and the gapmer of SED ID NO: 3 or variants thereof or the gapmer of SED ID NO: 2 and the gapmer SED ID NO: 3 or variants thereof or the gapmer of SED ID NO: 1 and the gapmer of SED ID NO: 2 and the gapmer of SED ID NO: 3 or variants thereof. [0211] 127. The composition according to embodiment 126, wherein said composition comprises the gapmer of SED ID NO: 1 and the gapmer of SED ID NO: 2 or the gapmer of SED ID NO: 1 and the gapmer of SED ID NO: 3 or the gapmer of SED ID NO: 2 and the gapmer SED ID NO: 3 or the gapmer of SED ID NO: 1 and the gapmer of SED ID NO: 2 and the gapmer of SED ID NO: 3. [0212] 128. The composition according to any of embodiments 124 to 127, wherein the pharmaceutically acceptable carrier is water or an aqueous buffer. [0213] 129. A method for producing sterile fish, said method comprising transfecting such fish eggs with a gapmer that has a sequence suitable for targeting dnd RNA by immersing the eggs in an aqueous immersion medium comprising said gapmer. [0214] 130. The method according to embodiment 129, wherein said immersion medium comprises the gapmer at a concentration of 1 nM to 100 nM, preferably 5 nM to 50 nM. [0215] 131. The method according to embodiments 129 or 130, wherein the immersion medium consists of an aqueous buffer and the gapmer. [0216] 132. The method according to embodiments 129 to 131, wherein the eggs are immersed in the aqueous immersion medium for 1 to 48 hours, preferably 2 to 24 hours. [0217] 133. The method according to embodiments 129 to 132, wherein the eggs are salmonid eggs. [0218] 134. The method according to embodiments 129 to 133, wherein the eggs are from Atlantic salmon. [0219] 135. The method according to embodiment 134, wherein the gapmer has a sequence selected from SED ID NO: 1, SED ID NO: 2 and SED ID NO: 3 or a variant thereof. [0220] 136. The method according to embodiment 135, wherein the gapmer has a sequence selected from SED ID NO: 1, SED ID NO: 2 and SED ID NO: 3

[0221] While the disclosure has been has been set out herein in reference to specific aspects, features and illustrative embodiments, it will be appreciated that the utility of the disclosure is not thus limited, but rather extends to and encompasses numerous other variations, modifications and alternative embodiments, as will suggest themselves to those of ordinary skill in the field of the present disclosure, based on the description herein. Correspondingly, the invention as hereinafter claimed is intended to be broadly construed and interpreted, as including all such variations, modifications and alternative embodiments, within its spirit and scope.