Mutant Bordetella Strains and Methods of Use

20200323901 ยท 2020-10-15

    Inventors

    Cpc classification

    International classification

    Abstract

    A method of reducing or preventing the development of airway inflammation in a subject includes the step of infecting the respiratory tract of a subject an amount of a composition including a pharmaceutically acceptable carrier and live attenuated pertactin-deficient Bordetella bacteria sufficient to colonize the respiratory tract of the subject. The step of infecting the subject with the live attenuated pertactin-deficient Bordetella bacteria results in reduction or prevention of the development of airway inflammation in the subject.

    Claims

    1. A composition comprising a pharmaceutically acceptable carrier and live attenuated pertactin-deficient Bordetella bacteria sufficient to colonize the respiratory tract of the subject, wherein the live attenuated pertactin-deficient Bordetella bacteria are deficient in at least one virulence factor selected from the group consisting of tracheal cytotoxin (TCT), pertussis toxin (PTX), and dermonecrotic toxin (DNT).

    2. The composition of claim 1, wherein the live attenuated pertactin-deficient Bordetella bacteria lack a functional gene encoding pertactin.

    3. The composition of claim 1, wherein the live attenuated pertactin-deficient Bordetella bacteria are deficient in at least two virulence factors selected from the group consisting of tracheal cytotoxin (TCT), pertussis toxin (PTX), and dermonecrotic toxin (DNT).

    4. The composition of claim 1, wherein the live attenuated pertactin-deficient Bordetella bacteria are deficient in tracheal cytotoxin (TCT), pertussis toxin (PTX), and dermonecrotic toxin (DNT).

    5. The composition of claim 1, wherein the live attenuated pertactin-deficient Bordetella bacteria are the BPZE1P strain deposited with the Collection Nationale de Cultures de Microorganismes under accession number CNCM-I-5150.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0020] FIG. 1A is a diagram showing the structure of a plasmid used in the construction of BPZE1P.

    [0021] FIG. 1B is another diagram showing the construction of BPZE1P, and photographs of gels showing the results of PCR amplification of the prn UPg and prn Log fragments.

    [0022] FIG. 1C is photographs of immunoblots showing the presence of pertactin in BPZE1, but not in BPZE1P lysates and supernatants.

    [0023] FIG. 2 is a graph showing the results of lung colonization in Balb/c mice using either BPZE1 or BPZE1P.

    [0024] FIG. 3 is a graph showing total IgG titers after BPZE1P or BPZE1 administration to mice.

    [0025] FIG. 4A is a graph showing BPZE1- and BPZE1P-mediated protection in Balb/c mice challenged intranasally with 10.sup.6 viable B. pertussis bacteria of the BPSM strain.

    [0026] FIG. 4B is a graph showing BPZE1- and BPZE1P-mediated protection in Balb/c mice challenged intranasally with 10.sup.6 viable B. pertussis bacteria of the BPSMP strain.

    [0027] FIG. 4C is a graph showing BPZE1- and BPZE1P-mediated protection in Balb/c mice challenged intranasally with 10.sup.6 viable B. pertussis bacteria of the B1917 strain.

    [0028] FIG. 5 is a graph showing the fitness of BPZE1 and BPZE1P in mice preimmunized with an acellular B. pertussis vaccine (aPv).

    [0029] FIG. 6 is a diagram of the experimental protocol of an assay for airway responsiveness in allergic mice vaccinated with BPZE1, BPZE1P or left unvaccinated, and a graph showing the results of the assay.

    [0030] FIG. 7A is a graph showing the total airway cell population infiltration in the bronchoalveolar (BAL) fluid of the allergic mice of the experiments shown in FIG. 6.

    [0031] FIG. 7B is a graph showing the percentage of eosinophils in the cells in the BAL fluid of the allergic mice of the experiments shown in FIG. 6.

    [0032] FIG. 7C is a graph showing the percentage of neutrophils in the cells in the BAL fluid of the allergic mice of the experiments shown in FIG. 6.

    [0033] FIG. 7D is a graph showing the percentage of lymphocytes in the cells in the BAL fluid of the allergic mice of the experiments shown in FIG. 6.

    [0034] FIG. 7E is a graph showing the percentage of macrophages in the cells in the BAL fluid of the allergic mice of the experiments shown in FIG. 6.

    [0035] FIG. 8A is a graph showing the amount of IL-1 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in FIG. 6.

    [0036] FIG. 8B is a graph showing the amount of IL-1 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in FIG. 6.

    [0037] FIG. 8C is a graph showing the amount of IL-6 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in FIG. 6.

    [0038] FIG. 8D is a graph showing the amount of IL-13 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in FIG. 6.

    [0039] FIG. 8E is a graph showing the amount of CXCL1 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in FIG. 6.

    [0040] FIG. 8F is a graph showing the amount of CXCL9 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in FIG. 6.

    [0041] FIG. 8G is a graph showing the amount of CXCL10 normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in FIG. 6.

    [0042] FIG. 8H is a graph showing the amount of GM-CSF normalized against total proteins measured in the lung lobe in the allergic mice of the experiments shown in FIG. 6.

    [0043] FIG. 9 is a diagram of the experimental protocol of an assay for airway responsiveness in a therapeutic model of allergic mice vaccinated with BPZE1, BPZE1P or left unvaccinated, and a graph showing the results of the assay.

    DETAILED DESCRIPTION

    [0044] Described herein are Bordetella strains deficient in pertactin and their use in stimulating anti-Bordetella immune responses as well as in preventing and treating respiratory tract inflammation. The below described embodiments illustrate representative examples of these methods. Nonetheless, from the description of these embodiments, other aspects of the invention can be made and/or practiced based on the description provided below.

    General Methodology

    [0045] Methods involving conventional microbiological, immunological, molecular biological, and medical techniques are described herein. Microbiological methods are described in Methods for General and Molecular Microbiology (3d Ed), Reddy et al., ed., ASM Press. Immunological methods are generally known in the art and described in methodology treatises such as Current Protocols in Immunology, Coligan et al., ed., John Wiley & Sons, New York. Techniques of molecular biology are described in detail in treatises such as Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Sambrook et al., ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001; and Current Protocols in Molecular Biology, Ausubel et al., ed., Greene Publishing and Wiley-Interscience, New York. General methods of medical treatment are described in McPhee and Papadakis, Current Medical Diagnosis and Treatment 2010, 49th Edition, McGraw-Hill Medical, 2010; and Fauci et al., Harrison's Principles of Internal Medicine, 17th Edition, McGraw-Hill Professional, 2008.

    Pertactin-Deficient Bordetella Strains

    [0046] Bordetella species such as Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica that are deficient in pertactin expression (e.g., those that express at least 50, 60, 70, 80, 90, 95, 96, 97, 98, or 99% less pertactin than do corresponding strains) can be used to generate immune responses against Bordetella species, as well as to treat and/or prevent respiratory tract inflammation such as that which occurs in allergic asthma. Live, attenuated, pertactin-deficient Bordetella pertussis and live, attenuated, pertactin-deficient Bordetella parapertussis are preferred for use for treating or preventing allergic respiratory tract inflammation in human subjects. The live attenuated pertactin-deficient Bordetella strains described herein can be made by adapting methods known in the art such as those described in the Examples section below. The starting strain can be any suitable Bordetella species. Examples of Bordetella species include B. pertussis, B. parapertussis, and B. bronchiseptica. B. pertussis is preferred for use as the starting strain for vaccines and methods for preventing pertussis infection. Several suitable Bordetella strains for use as starting strains are available from established culture collections (e.g., the American Type Culture Collection in Manassas, Va.) or can be isolated from natural reservoirs (e.g., a patient having pertussis) by known techniques (e.g., as described in Aoyama et al., Dev. Biol. Stand, 73:185-92, 1991).

    [0047] Bordetella strains which express functional pertactin can be made deficient in this molecule or its activity by selection or, preferably for stability purposes, mutagenesis (e.g., deletion of the native prn gene as described below). Alternatively, Bordetella species deficient in pertactin can also be isolated from natural sources (e.g., human subjects or other mammals infected or colonized with such strains). Because insufficient attenuation of a pathogenic strain of Bordetella might cause a pathological infection in a subject, it is preferred that the pertactin-deficient Bordetella strain used also have lower levels of other functional virulence factors. On the other hand, to ensure that the pertactin-deficient Bordetella strain retains the ability to colonize a subject and exert a protective effect on respiratory tract inflammation, it must not be overly attenuated. Attenuation might be achieved by mutating the strain to reduce its expression of pertactin and one or more (e.g., 1, 2, 3, 4, 5 or more) of the following: pertussis toxin (PTX), dermonecrotic toxin (DNT), tracheal cytotoxin (TCT), adenylate cyclase (AC), lipopolysaccharide (LPS), filamentous hemagglutinin (FHA), or any of the bvg-regulated components. Attenuation might also be achieved by mutating the strain to reduce the biological activity of pertactin and one or more (e.g., 1, 2, 3, 4, 5 or more) of the following: pertussis toxin (PTX), dermonecrotic toxin (DNT), tracheal cytotoxin (TCT), adenylate cyclase (AC), lipopolysaccharide (LPS), filamentous hemagglutinin (FHA), or any of the bvg-regulated components. Examples of methods for making such mutants are described herein and in U.S. Pat. No. 9,119,804. In the experiments presented below, a Bordetella strain deficient in functional pertactin, functional PTX, functional DNT, and functional TCT was able to colonize the respiratory tract of subjects, induce immune responses against Bordetella, and reduce or prevent the development of allergic and inflammatory responses. Accordingly, Bordetella strains, such as BPZE1P, which are deficient in these four virulence factors and can colonize a subject and induce immune responses targeting Bordetella strains and/or reduce or prevent the development of allergic and inflammatory responses are preferred.

    [0048] A variety of methods are known in the art for attenuating an infectious bacterial strain. These include passaging the strain in vitro until virulence is lost, non-specific chemical mutagenesis followed by screening and selection based on phenotype, and using targeted molecular biology techniques such as those described in the Examples section below (including allelic exchange) and in Methods for General and Molecular Microbiology (3d Ed), Reddy et al., ed., ASM Press. Using these methods, the genes encoding pertactin, PTX, and/or DNT can be deleted or mutated to an enzymatically inactive form (which is preferred where it is desired to retain the toxin's antigenicity). TCT production can be significantly (e.g., > than 99.99, 99.90, 99.8, 99.7, 99.6, 99.5, 99.0, 98, 97, 96, 95, or 90%) reduced by replacing the native ampG gene (unlike other species, B. pertussis ampG does not actively recycle TCT-containing peptidoglycan) with a heterologous (e.g., from E. coli or another gram-negative species) ampG gene, or by mutating the native ampG gene such that it is active at recycling peptidoglycan.

    [0049] Modification of a starting strain to reduce or remove toxin/virulence factor activity can be confirmed by sequencing the genomic DNA or genes encoding the toxins of the modified strains. Southern, Northern, and/or Western blotting might also be used to confirm that the target genes have been deleted or that expression of the target factors has been reduced or removed. Biological activity can also be evaluated to confirm reduction or removal of toxin/virulence factor activity. Once the modifications have been confirmed, the modified strains can be tested for the ability to colonize a subject and to induce protective immunity against Bordetella infection or to reduce or prevent the development of allergic and inflammatory responses by known methods such as those described in the Examples section below.

    Compositions for Modulating Immune Responses

    [0050] The live attenuated Bordetella strains described herein can be used in compositions that protect a mammalian subject from developing a Bordetella infection (e.g., pertussis), or to reduce the symptoms of such an infection. They can also be used to reduce or prevent the development of allergic and inflammatory responses in a subject such as asthma, allergic rhinitis, interstitial lung disease, food allergies, peanut allergy, venom allergies, atopic dermatitis, contact hypersensitivity, and anaphylaxis. For use in therapeutic or prophylactic compositions, the live attenuated Bordetella strains are typically formulated with a pharmaceutically acceptable excipient. Examples of pharmaceutically acceptable excipients include, e.g., buffered saline solutions, distilled water, emulsions such as an oil/water emulsion, various types of wetting agents, sterile solutions, and the like.

    [0051] The vaccines can be packaged in unit dosage form for convenient administration to a subject. For example, a single dose of between 110.sup.4 to 110.sup.9 (e.g., 110.sup.4, 510.sup.4, 110.sup.5, 510.sup.5, 110.sup.6, 510.sup.6, 110, 510.sup.7, 110.sup.8, 510.sup.8, or 110.sup.9+/10, 20, 30, 40, 50, 60, 70, 80, or 90%) live bacteria of the selected attenuated Bordetella strain and any excipient can be separately contained in packaging or in an administration device. The vaccine can be contained within an administration device such as a syringe, spraying device, or insufflator.

    Formulations/Dosage/Administration

    [0052] The compositions described herein can be administered to a mammalian subject (e.g., a human being, a human child or neonate, a human adult, a human being at high risk from developing complications from pertussis, a human being with lung disease, a human being that is or will become immunosuppressed, and a human being having or at high risk for developing respiratory tract inflammation such as asthma, allergic rhinitis, or interstitial lung disease) by any suitable method that deposits the bacteria within the composition in the respiratory tract or other mucosal compartment. For example, the compositions may be administered by inhalation or intranasal introduction, e.g., using an inhaler, a syringe, an insufflator, a spraying device, etc.

    [0053] The pertactin-deficient Bordetella strains described herein can be formulated as compositions for administration to a subject. A suitable number of live bacteria are mixed with a pharmaceutically suitable excipient or carrier such as phosphate buffered saline solutions, distilled water, emulsions such as an oil/water emulsions, various types of wetting agents, sterile solutions and the like. In some cases, the vaccine can be lyophilized and then reconstituted prior to administration. The use of pharmaceutically suitable excipients or carriers which are compatible with mucosal (particularly nasal, bronchial, or lung) administration are preferred for colonizing the respiratory tract. See Remington's Pharmaceutical Sciences, a standard text in this field, and USP/NF.

    [0054] When formulated for mucosal administration, each dose of a composition can include a sufficient number of live pertactin-deficient Bordetella bacteria to result in colonization of the mucosal site, e.g., approximately (i.e., +/50%) 510.sup.3 to 510.sup.9 bacteria. For administration to human subjects, the dose can include approximately 110.sup.6, 510.sup.6, 110, 510.sup.7, 110.sup.8, 510.sup.8, 110.sup.9, 510.sup.9, or 110.sup.10 live pertactin-deficient Bordetella bacteria. The dose may be given once or on multiple (2, 3, 4, 5, 6, 7, 8 or more) occasions at intervals of 1, 2, 3, 4, 5, or 6 days or 1, 2, 3, 4, 5, or 6 weeks, or 1, 2, 3, 4, 5, 6, or 12 months. Generally, sufficient amounts of a composition are administered to result in colonization and the protective and/or anti-inflammatory response. Additional amounts are administered after the induced protective and/or anti-inflammatory response wanes (e.g., after the subject resumes suffering from the symptoms of respiratory tract inflammation).

    [0055] Subjects which can be administered a composition containing live pertactin-deficient Bordetella bacteria can include any capable of being colonized with a selected live pertactin-deficient Bordetella bacterial strain. For example, the subject can be a mammal such as a human being. Human subjects having, or at high risk of developing, respiratory tract inflammation such as those having or prone to developing allergic asthma or allergic rhinitis are preferred recipients of the composition. While the composition can be used in subjects regardless of their titers of anti-pertactin antibodies, the composition may be used in those having measurable titers (e.g., greater than 10, 20, 50, 100, 200, or 500 ng per ml of serum) of anti-pertactin antibodies and those having previously been immunized with a vaccine containing pertactin or a pertactin-like antigen because pertactin-deficient Bordetella bacterial strains are not subject to pertactin-targeting immune responses.

    [0056] The effectiveness of the compositions in dampening respiratory tract inflammation can be assessed by known methods, e.g., measuring the number of inflammatory cells, IgE titers, levels of pro-inflammatory cytokines/chemokines (such as eotaxin, GM-CSF, IFN, IL-4, IL-5, IL-8, IL-10, IL-12, IL-13, IL-17A, IL-17F, IL-18, and TNF) in fluid taken from the respiratory tract (e.g., bronchoalveolar lavage fluid), or clinical parameters such as spirometry or the level of dyspnea, coughing, wheezing, or respiratory capacity. Improvement in any of one or more of these parameters (at least 10, 20, 30, 40, 50, 60, 70, 80, 90% or more improved compared to a subject not receiving the composition) indicates that the composition is effective. Animal models of allergic respiratory tract inflammation can also be used to assess the effectiveness of a composition, see e.g., U.S. Pat. No. 8,986,709.

    EXAMPLES

    Example 1Construction and Characterization of a Pertactin-Deficient Strain of B. pertussis

    [0057] Escherichia coli DH5a, SM10 and B. pertussis BPZE1, BPSM (Menozzi et al., Infect Immun 1994; 62:769-778) and B1917 (Bart et al. Genome Announc 2014; 2(6)) were used in this study. The Bordetella strains were cultured at 37 C. on Bordet-Gengou agar (BG), supplemented with 1% glycerol and 10% defibrinated sheep blood. After growth, the bacteria were harvested by scraping the plates and resuspended in phosphate-buffered saline (PBS) at the desired density. For liquid culture the Bordetella strains were grown at 3T C in modified Stainer-Scholte medium (Imaizumi et al. Infect Immun 1983; 41:1138-1143) containing 1 g/l heptakis (2,6-di-o-methyl) -cyclodextrin (Sigma). E. coli strains used for cloning procedures were growth in LB broth or LB agar plates. When required, streptomycin (Sm) was used at 100 g/ml, gentamycin (Gm) at 10 g/ml and ampicillin (Amp) at 100 g/ml.

    [0058] To delete prn, the gene coding for pertactin, in BPZE1, a 739-bp fragment downstream (prn LO) of the prn gene and a 759-bp fragment upstream (prn UP) of the prn gene were cloned into pSS4940 to introduce the prn deletion in the BPZE1 and BPSM genomes by homologous recombination. Referring to FIGS. 1A and 1B, the upstream and downstream prn flanking region were PCR amplified using prn_KO_fw (ATCCTCAAGCAAGACTGCGAGCTG) (SEQ ID NO:1)) and OL_prn_KO_rv (GGGGATAGACCCTCCTCGCTTGGATGCCAGGTGGAGAGCA) (SEQ ID NO:2)), and OL_prn_KO_fw (TGCTCTCCACCTGGCATCCAAGCGAGGAGGGTCTATCCCC) (SEQ ID NO:3)) and prn_KO_rv (CCATCATCCTGTACGACCGCCT) (SEQ ID NO:4)), respectively, as primers. These fragments then served as template for a PCR elongation using prn_KO_fw and prn_KO_rv as primers. The resulting fragment (containing the prn deletion) was inserted into the TOPO Blunt vector (ThermoFisher Scientific) and then excised as a KpnI-NotI fragment. The excised KpnI-NotI fragment was inserted into KpnI- and NotI-digested p554940, a pSS4245 (Inatsuka et al., Infect Immun 2010; 78 2901-2909) derivative. The resulting plasmid was transformed into E. coli SM10, which was then conjugated with BPZE1. Following two successive homologous recombination events, as described elsewhere (Mielcarek et al., PLoS Pathog 2006; 2:e65), referring to FIG. 1B, PCR was used to confirm deletion of the entire prn gene by amplifying the flanking regions covering the construction using prnKO_UP (TTCTTGCGCGAACAGATCAAAC) (SEQ ID NO:5))-prnKOin_UPrv (CTGCTGGTCATCGGCGAAGT) (SEQ ID NO:6)) for the 5 region and prnKOin_LOfw (CGCCCATTCTTCCCTGTTCC) (SEQ ID NO:7))-prnKO_LO (GAACAGGAACTGGAACAGGCG) (SEQ ID NO:8)) for the 3 region. A strain carrying the prn deletion was selected and named BPZE1P. The same strategy was used to construct a pertactin-deficient BPSM mutant, named BPSMP.

    [0059] The presence of pertactin was tested by immunoblotting of BPZE1 and BPZE1P lysates and supernatants, using purified Prn (List Biological laboratories) as control for correct size of the band. For protein extraction, BPZE1 and BPZE1P strains were plated onto BG blood agar and incubated for 48 h at 37 C. After growth, the bacteria were scraped off the plates, resuspended in 10 ml of Stainer-Scholte medium and grown for 4 days at 37 C. The bacteria were then harvested by centrifugation. The supernatants were recovered and treated with trichloroacetic acid (TCA) as described previously (Solans et al., PLoS Pathog 2014; 10:e1004183) for protein concentration. The bacterial pellets were resuspended in PBS complemented with an EDTA-free protease inhibitor cocktail (Roche) and lysed using a French pressure cell. Bacterial debris were removed by centrifugation for 30 minutes at 15,000g, and the supernatants were recovered for immunoblotting. Proteins were separated by 12% SDS-PAGE and then transferred onto a Nitrocellulose, membrane using the Criterion cell system (Bio-Rad). After blocking with 5% w/v skim milk powder in PBS 0.01% Tween 20 for 30 min, the membrane was incubated with an anti-pertactin monoclonal antibody pertactin at 1:1,000 dilution. Goat-anti mouse-HRP (Abeam) was then added at a 1:10,000 dilution, and the blot was developed using chemiluminescent substrates (GE Healthcare). As shown in FIG. 1C, an anti-pertactin antibody reactive protein co-migrating with purified pertactin was detected in the supernatant of BPZE1, but not in the supernatant of BPZE1P. This protein was not detected in the bacterial cell lysate of either BPZE1 or BPZE1P.

    Example 2BPZE1P Colonizes Mice as Well as BPZE1

    [0060] Groups of 18 six-week old mice were inoculated intranasally with 20 l PBS containing 10.sup.6 viable bacteria as described previously (Mielcarek et al., supra). At the indicated time points (3 hours, 3 days, 7 days, 14 days, 21 days and 28 days), 3 mice per group were sacrificed, and lungs were harvested and homogenized for measuring total number of colony formation units (CFU). Statistical analysis was done by a 2-way ANOVA test, using post hoc comparison Bonferroni test with confidence intervals of 95%. Referring to FIG. 2, both BPZE1 and BPZE1P colonized the animals equally well. Both strains exhibited a peak of multiplication 3 days post vaccination and colonization persisted for 4 weeks. No statistically significant difference was observed between these strains in their ability to colonize the mouse lungs.

    Example 3BPZE1P is as Immunogenic and Protective Against Challenge with Virulent B. pertussis as BPZE1

    [0061] Immunity induced by BPZE1P in comparison with BPZE1 was measured by antibody titration of mouse immune serum after nasal vaccination. Groups of 8 mice were vaccinated intranasally with 10.sup.5 viable BPZE1 or BPZE1P. Four weeks later, the mice were bled, and total IgG titers were measured against total BPSM lysate. Blood was centrifuged for 5 min. at 5,000g to separate the serum from the cells. Antibody titers against B. pertussis were estimated using enzyme-linked immunosorbent assays (ELISA) as described previously (Mielcarek et al., supra), using total B. pertussis BPSM lysate at 1 g of total protein per well. Statistical analysis was performed using GraphPad Prism software. As shown in FIG. 3, BPZE1- and BPZE1P-vaccinated mice exhibited much higher antibody titers than did nave control mice. No significant difference in antibody titers between BPZE1- and BPZE1P-vaccinated mice was detected.

    [0062] The protective efficacy of BPZE1P compared with BPZE1 was tested in a suboptimal protection protocol by measuring the CFU counts in the lungs 7 days post challenge, and comparing a nave group with the vaccinated groups. Groups of 8 six-week old mice were vaccinated intranasally with 20 l PBS containing 10.sup.5 viable BPZE1 or BPZE1P, or were left unvaccinated. Four weeks later, all mice were challenged intranasally with 20 l PBS containing 10.sup.6 viable BPSM, BPSMP or B1917. Three hours after the challenge 3 mice per group were sacrificed, and lungs were harvested and homogenized for CFU counting. The remaining 5 mice per group were sacrificed 7 days after challenge for CFU counting. Three hours post infection, 3 mice were euthanized, and their lungs were harvested to determine the CFU counts shortly after challenge. Seven days post-infection, the remaining 5 mice were euthanized, their lungs were harvested, and the CFU counts were measured. Statistical analysis was done applying a parametric 2-way ANOVA test, using post hoc Bonferroni comparison test with a confidence interval of 95%. *, p<0.005; **, p<0.001; ***, p<0.0001. As shown in FIGS. 4A-C, vaccination with either strain protected against challenge with BPSM, BPSMP and B1917 equally well. These results show that the deletion of prn does not impact on the protective capacity of the live attenuated vaccineeither against the laboratory strain BPSM, its pertactin-deficient derivative BPSMP, or clinical isolate B1917.

    Example 4BPZE1P Increases Pulmonary Vaccine Uptake in aPv-Vaccinated Mice

    [0063] The ability of BPZE1P to colonize the lungs of mice having pre-existing antibodies against pertactin was investigated. Groups of 8 six-week old mice were vaccinated subcutaneously with of the human dose of the acellular pertussis vaccine (aPv; Infanrix, GSK; containing inactivated pertussis toxin, filamentous hemagglutinin and pertactin). Four weeks later, the mice were boosted with the same dose of aPv. Four weeks after boosting, the mice were infected intranasally with 10.sup.6 BPZE1 or BPZE1P. Three hours post infection, 3 mice were euthanized, and the lungs were harvested to determine the CFU counts. Seven days post-infection, the remaining 5 mice were euthanized, the lungs harvested, and the CFU counts were measured. Statistical analysis was done applying a parametric 2-way ANOVA test, using post hoc Bonferroni comparison test with a confidence interval of 95%. ***, p<0.0001. Referring to FIG. 5, at 3 hours post-administration, no significant difference in colonization was seen between the two strains. In contrast, seven days after inoculation, BPZE1P colonized the lungs significantly better than BPZE1. Mice infected with BPZE1P had almost 10.sup.4 CFU in the lungs 7 days after administration, while the CFU counts in the lungs of the mice given BPZE1 reached 10.sup.2 CFU. These data show that the deletion of the prn gene improves BPZE1 pulmonary take in mice pre-immunized with pertactin-containing aP vaccine.

    Example 5BPZE1P and BPZE1 Protect Equally Well Against Allergic Airway Inflammation

    [0064] The effect of vaccination with BPZE1P on airway responsiveness was investigated in allergic mice as described in the protocol shown in FIG. 6. Groups of 4 weeks-old mice were vaccinated intranasally with 20 l PBS containing 10.sup.6 viable BPZE1 or BPZE1P, or were left unvaccinated. Four weeks later, the mice were sensitized intranasally with 20 l of house dust mite (HDM; Stallergenes S.A.) of 5 index of reactivity (IR) of Dermatophagoides farinae extract (Derf 5IR) or 20 l of PBS as control. Ten days later, the mice where challenged intranasally with 20 l of Derf 5IR or PBS daily for 5 days, and two days later, the mice were anesthetized and intubated intratracheally for mechanical ventilation using the FlexiVent (SCIREQ) device. The mice were then exposed to increasing concentrations of nebulized methacholine (0-50 mg/mL in PBS) (Sigma-Aldrich) to determine the resistance in their respiratory airways using plethysmography. Statistical analysis was done by applying a parametric 2-way ANOVA test, using the post hoc Bonferroni comparison test with a confidence interval of 95%. ***, p<0.0001; **, p<0.001; *, p<0.005. In FIG. 6, comparisons between Derf 5IR and BPZE1+Derf 5IR are represented the solid line, and comparisons between Derf 5IR and BPZE1P+Derf 5IR are represented the dashed line. Both the BPZE1- and the BPZE1P-vaccinated mice presented significantly less resistance in their airways after treatment with methacholine at 6, 12 and 25 mg/ml compared to the non-vaccinated mice. The resistance of the vaccinated mice was comparable to that of the PBS control group, which was not sensitized, nor challenged throughout the entire experiment.

    Example 6Measurement of Lung Cell Infiltration and Cytokine Profiles

    [0065] Airway cell population infiltration in the allergic mice of the experiment shown in FIG. 6 and discussed immediately above was assessed. After plethysmography measurements, Bronchoalveolar lavage (BAL) fluids were collected to measure the cell infiltration in the airway. Cells from the BAL fluids were harvested by centrifugation at 1,200 rpm for 5 min at 4 C., resuspended in PBS for cell counting using the Shandon cytospin 4 (Thermo Fisher Scientific) and stained with May Grnwald Giemsa (DiffQuik) for cell type counting. Total cell numbers were measured in the BAL fluid of mice (FIG. 7A), and percentages of eosinophils (FIG. 7B), neutrophils (FIG. 7C), lymphocytes (FIG. 7D) and macrophages (FIG. 7E) were calculated. Statistical analysis was done by applying a parametric one-way ANOVA test, using the post hoc Bonferroni comparison test with a confidence interval of 95%. ***, p<0.0001; *, p<0.005. BPZE1 or BPZE1P vaccination significantly reduced the recruitment of total cells in the airways after allergen exposure and challenge, compared to the non-vaccinated mice (FIG. 7A). This reduction reflected essentially the reduction in eosinophil recruitment in the vaccinated mice (FIG. 7B), whereas there was no significant change in the percentages of neutrophils or lymphocytes (FIGS. 7C and D) between the vaccinated and non-vaccinated mice. A small, but significant increase in the percentage of macrophages was observed in the mice that were vaccinated with BPZE1P (FIG. 7E).

    [0066] Following BAL, the right lung lobes were harvested and directly frozen in liquid Nitrogen for protein extraction. The lung lobes were resuspended in 1 mL of lysis buffer, PBS with 0.5% nonidet P40 and protease inhibitor cocktail (Roche), and homogenized at 4 C. using T-18 Ultra-Turrax (Ika). The samples were centrifuged, and the supernatants were collected for total protein quantification using the Pierce BCA protein assay (Thermo Fisher Scientific), and for cytokine and chemokine measurements using the Cytokine 20-Plex Mouse Panel (Invitrogen, Thermo Fisher Scientific) per the manufacturer's specifications. Referring to FIG. 8, cytokine levels are represented as the normalization of the cytokine/chemokine quantification against total proteins measured in the lung lobe. Statistical analysis was done by applying a parametric one-way ANOVA test, using the post hoc Bonferroni comparison test with a confidence interval of 95%. **, p<0.001. *; p<0.005.

    [0067] As shown in FIG. 8, HDM (Derf 5IR)-treated mice produced significantly increased levels of IL1 and IL1 in the lungs, compared to non-treated mice. Vaccination with BPZE1 or BPZE1P prior to HDM sensitization significantly decreased these levels (FIGS. 8A and B). A similar trend was observed for IL6 and IL13 although the differences between the vaccinated and the non-vaccinated mice did not reach statistical significance (FIGS. 8C and D). Significantly lower levels of induced CXCL1 (KC), CXCL9 (MIG), CXCL10 (IP-10) and GM-CSF were observed in the vaccinated mice compared to the mice which were only treated with HDM (FIG. 8F-H). Generally, there was no statistical difference between the BPZE1-vaccinated and the BPZE1P-vaccinated mice.

    Example 7

    [0068] Vaccination of pre-sensitized subjects with either BPZE1 or BPZE1P present significantly lower levels of airway resistance compared to those that were not vaccinated. As shown in the diagram of FIG. 9, groups of 5-week-old mice were either sensitized intranasally with Derf 5IR or administrated PBS, and then either vaccinated with 10.sup.6 BPZE1 or BPZE1P, or left unvaccinated. Nine days later, the mice were challenged intranasally with Derf 5IR or PBS during 5 days. Two days after last challenge, the mice were anesthetized, and their resistance in the respiratory airway was measured by plethysmography as described above. Statistical analysis was done by applying a parametric 2-way ANOVA test, using the post hoc Bonferroni comparison test with a confidence interval of 95%. ***, p<0.0001. **; p<0.001. Comparisons between Derf 5IR and BPZE1+Derf 5IR are represented by the solid line, and comparisons between Derf 5IR and BPZE1P+Derf 5IR are represented by the dashed line. The mice vaccinated with either BPZE1 or BPZE1P present significantly lower levels of airway resistance compared to those that were not vaccinated. Again, the airway resistance of the vaccinated mice was indistinguishable from that of the control group, which were not sensitized nor challenged with Derf 5IR.

    OTHER EMBODIMENTS

    [0069] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.