Method for solid-phase synthesis of DNA encoded compound library

Abstract

The present invention provides a method of solid-phase synthesis of DNA-encoded compound library. The method includes following steps: a) reacting solid carrier G-1 with linker molecule L-1 to prepare L-G-1; b) reacting DNA with linker molecule L-0 to prepare L-2; c) reacting L-G-1 with L-2 to prepare L-G-2; d) removing protection group of the L-G-2 and obtaining L-G-2-1; e) reacting the L-G-2-1 with synthetic building block and performing DNA encoding; and f) removing the solid carrier and obtaining the DNA-encoded compound library. Compared with the prior art, the present invention can complete post-treatment purification of the reaction only by filtration and irrigation processes for several times. The present invention is simple to operate, can shorten the production cycle of DNA encoded compound library with more than 50%, significantly increases the production efficiency and the unicity as well as the purity of the final products.

Claims

1. A method for solid-phase synthesis of a DNA-encoded compound library, comprising: (a) reacting controlled pore glass (CPG) beads comprising a free amine as a solid carrier with a first linker ##STR00041## in an organic solvent to obtain ##STR00042## wherein the resulting product is filtrated to remove the organic solvent and then washed by an organic solvent; and Fmoc is a protecting group fluorenylmethoxycarbonyl; (b) reacting a single-stranded DNA (ssDNA) with a second linker ##STR00043## to obtain ##STR00044## wherein the resulting product is precipitated, washed with ethanol, and centrifuged; (c) reacting ##STR00045## with ##STR00046## in an organic solvent to obtain ##STR00047## wherein the resulting product is filtrated to remove the solvent and then washed with water and a triethylammonium acetate (TEAA) buffer solution; (d) removing the Fmoc protecting group by contact with a base to obtain ##STR00048## (e) reacting with a skeleton molecule comprising a carboxylic acid which reacts with the free amine of the first linker, in an organic solvent, wherein the skeleton molecule is selected from the group consisting of 4-aminobenzoic acid, dl-4-hydroxyphenylglycine, Fmoc-glycine, Fmoc-1-phenylalanine, t-butylisocynide, cyclohexyl isocyanide, 3-methyl butyraldehyde, cyclopentyl aldehyde and ##STR00049## (f) reacting the product obtained in step (e) with a synthetic building block, wherein the synthetic building block is selected from the group consisting of isocyanate, benzyl alcohol and benzoic acid; (g) perform DNA-encoding on the product obtained in step (f), wherein the synthetic building block is specifically labeled by a marker sequence which is connected to the ssDNA; and (h) cleaving the product obtained in step (g) from the solid carrier to obtain a DNA-encoded compound library.

2. The method of claim 1, wherein in step (a), the organic solvent for reaction is dichloromethane.

3. The method of claim 1, wherein the product obtained in step (a) is washed by DMF and dichloromethane.

4. The method of claim 1, wherein in step (d), the base is pyridine.

5. The method of claim 1, wherein the ssDNA has the sequence of GGAGCTTGTGAATTCTGGCACTCG.

6. The method of claim 1, further comprising: before step (f), performing DNA-encoding on the product obtained in (e), wherein the skeleton molecule is specifically labeled by a marker sequence which is connected to the ssDNA.

7. The method of claim 1, wherein in step (h), the step of cleaving the product obtained in step (g) from the solid carrier is carried out in ammonium hydroxide.

8. The method of claim 1, wherein in step (e), the skeleton molecule is 4-aminobenzoic acid.

9. The method of claim 8, wherein the product obtained in step (e) is ##STR00050##

10. The method of claim 1, wherein in step (e), the skeleton molecule is ##STR00051##

11. The method of claim 10, wherein the product obtained in step (e) is ##STR00052##

12. The method of claim 1, wherein in step (e), the skeleton molecule is a combination of Fmoc-glycine, t-butylisocynide and 3-methyl butyraldehyde.

13. The method of claim 1, wherein in step (e), the skeleton molecule is a combination of Fmoc-1-phenylalanine, cyclohexyl isocyanide and cyclopentyl aldehyde.

14. The method of claim 1, wherein in step (f), the synthetic building block is isocyanate.

15. The method of claim 1, herein in step (f), the synthetic building block is benzoic acid.

Description

DETAILED DESCRIPTION

(1) The raw materials and equipments used in the present invention are known products and can be purchased in the market.

(2) Some abbreviations are given:

(3) Fmoc: fluorenylmethoxycarbonyl group;

(4) DMF: N,N-dimethylformamide;

(5) DMSO: dimethyl sulfoxide;

(6) DMT-MM: 2-chloro-4,6-dimethoxy-1,3,5-triazine;

(7) TEAA: triethylammonium acetate; and

(8) DETA: ethyldiisopropylamine.

Embodiment 1

(9) (1). The Preparation of L-G-1

(10) ##STR00019##

(11) adding 3 mL of dichloromethane solution of compound L-1 (69 mg, 0.1 mmol, manufacturer: Aldrich) to G-1 (0.5 g, starting loading of CPG: 32 mol/g, derived from Shanghai Lingjiang Industrial Development Co., Ltd) and allowing reaction overnight under room temperature; removing the solvent by filtration after the reaction to obtaina solid; washing the solid respectively with DMF (2 mL3) and dichloromethane (2 mL3) to obtain L-G-1.

(12) Taking L-G-1, removing Fmoc protection group with piperidine, and determining that the loading of L-G-1 is 14.5 mol/g by measuring UV absorption of the Fmoc-removed product, the productivity is 91%.

(13) (2) The Preparation of L-2

(14) ##STR00020##

(15) dissolving single strand DNA (32.0 nmol, molar weight is 7663.9) (sequence of the single strand DNA is GGAGCTTGTGAATTCTGGCACTCG) into 30 L NaHCO.sub.3 buffer solution, adding successively 20 mL DMSO solution of L-0 (1.0 mg, 3.0 mol, manufacturer: Aldrich) and 10 L water solution of DMT-MM solution (0.83 mg, 3.0 mol); allowing reaction overnight under room temperature; adjust pH to 45 with 3 mol/L HCl solution after the above mentioned reaction is finished; adding 240 L ethanol and precipitating at 20 C. for 2 hours, and centrifugating to obtain a solid; washing the solid with 85% ethanol to obtain L-2, and determining that the amount of substance of L-2 is 28.0 nmol using OD ultraviolet absorption, the productivity is 80%.

(16) MS(ESI) m/z 7979.6 (M+1).sup.+.

(17) (3) The Preparation of L-G-2

(18) ##STR00021##

(19) adding 90 L aqueous solution of L-2 (28 nmol) and 10 L pyridine into L-G-1 (10 mg, 140 nmol), and allowing reaction with stirring for 21 hours at 40 C.; filtrating the solution after the above mentioned reaction, removing the solvent to obtain a solid; washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2.

(20) (4) The Preparation of L-G-2-1

(21) ##STR00022##

(22) Adding DMF (160 L) and pyridine (40 L) into L-G-2 (8.0 mg), and allowing react with stirring for 6 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-1.

(23) Taking part of L-G-2-1 (3.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. and reacting for 1 hour to remove the solid carrier, removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times, adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid and precipitating at 20 C. to obtain the DNA in L-G-2-1, determining that the amount of substance of DNA in L-G-2-1 is 6.0 nmol by using OD ultraviolet absorption, the productivity is 65%.

(24) MS(ESI) m/z 8251.0 (M+1).sup.+.

(25) (5) The Preparation of L-G-2-2.a

(26) ##STR00023##

(27) Adding molecule skeleton containing carboxylic acid, O-(7-azabenzotriazole-1-yl)-N,N,N,N-trtramethyluronium hexafluorophosphate, DIEA as well as DMF into L-G-2-1 and allowing react with stirring for 16 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.a.

(28) More specifically,

(29) Adding 4-aminobenzoic acid (4.15 mg, manufacturer: Alfa) O-(7-azabenzotriazole-1-yl)-N,N,N,N-trtramethyluronium hexafluorophosphate (6.9 mg manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into L-G-2-1 (20 mg) and allowing reaction with stirring for 1216 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.a.

(30) Taking part of L-G-2-2.a (3.0 mg), adding 150 L of strong aqueous ammonia and heating the solution to 55 C. for 1 hour to remove the solid carrier, removing the solvent by reducing the pressure after filtration process, washing respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid and precipitating at 20 C. to obtain the DNA in L-G-2-2, determining that the amount of substance of DNA in L-G-2-1 is 4.5 nmol by using OD ultraviolet absorption, the productivity is 75%.

(31) MS(ESI) m/z 8369.7 (M+1)+.

(32) (6) The Preparation of L-G-3-1.a

(33) ##STR00024##

(34) adding R.sup.j (R.sup.j is synthetic building block and selected from substituted isocyanate), DIEA and DMF into L-G-2-2.a; allowing reaction with stirring for 16 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2-1.a;

(35) referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-1-1.a is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.a;

(36) after the encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking a part of the solid washing, adding 50 L of strong aqueous ammonia, and allowing reaction for 1 hour at 55 C.; washing the solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test.

(37) (7) The Synthesis of Compound Library L-D-T-1

(38) ##STR00025##

(39) removing CPG from L-G-3-1.a by alkaline removal method or light removal method to obtain the DNA encoded compound library L-D-T-1.

Embodiment 2

(40) (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;

(41) (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;

(42) (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;

(43) (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and

(44) (5) The Preparation of L-G-3-1.b

(45) ##STR00026##

(46) adding 2-ethylphenyl isocyanate (1.47 mg, manufacturer: Alfa), triethylamine (5 L) as well as DMF (15 L) into L-G-2-1 (5 mg) and reacting for 16 hours at 25 C.30 C.; filtrating the solution and removing the solvent to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-1-1.b;

(47) taking part of L-G-2-1-1.b (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-1-1.b. The amount of substance is 2.5 nmol by using OD ultraviolet absorption quantitation, the productivity is 63%.

(48) MS(ESI) m/z 8395.4 (M+1).sup.+.

(49) Referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-1-1.b is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.b;

(50) after the encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking a part of solids after the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test.

(51) (6) L-D-T-2 is Obtained According to the Preparation Method in Embodiment 1.

(52) ##STR00027##

Embodiment 3

(53) (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;

(54) (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;

(55) (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;

(56) (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and

(57) (5) the preparation of L-G-2-2.c

(58) ##STR00028##

(59) adding 4-aminobenzoic acid (4.15 mg, manufacturer: Alfa), O-(7-azabenzotriazole-1-yl)-N,N,N,N-trtramethyluronium hexafluorophosphate (6.9 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into L-G-2-1 (20 mg), and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and to obtain a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.c;

(60) taking part of L-G-2-2.c (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2.c, the amount of substance of the obtained DNA in L-G-2-2.c is 3.0 nmol by using OD ultraviolet absorption quantification, the productivity is 75%.

(61) MS(ESI) m/z 8369.7 (M+1).sup.+.

(62) (6) The Preparation of L-G-3-1.c

(63) ##STR00029## ##STR00030##

(64) adding benzoic acid (2.0 mg), O-(7-azabenzotriazole-1-yl)-N,N,N,N-trtramethyluronium hexafluorophosphate (6.9 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into L-G-2-1 (20 mg), and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2-1.c;

(65) taking part of L-G-2-2-1.c (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2-1.c, the amount of substance of the obtained DNA in L-G-2-2-1.c is 1.5 nmol by using OD ultraviolet absorption quantification, the productivity is 38%.

(66) MS(ESI) m/z 8473.1 (M+1).sup.+.

(67) Referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-2-1.c is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.c;

(68) after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing the solid with 100l L distilled water; taking a part of solid the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test.

(69) (7) L-D-T-3 is Obtained According to the Preparation Method of L-D-T-1 in Embodiment 1.

(70) ##STR00031##

Embodiment 4

(71) (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;

(72) (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;

(73) (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;

(74) (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and

(75) (5) the preparation of L-G-2-2.d

(76) ##STR00032##

(77) adding S-2 (17.4 mg, manufacturer: Alfa), O-(7-azabenzotriazole-1-yl)-N, N,N,N-trtramethyluronium hexafluorophosphate (6.9 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into L-G-2-1 (20 mg) and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.d;

(78) taking part of L-G-2-2.d (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2.d, the amount of substance of the obtained DNA in L-G-2-2.d is 2.0 nmol by using OD ultraviolet absorption quantification, the productivity is 50%.

(79) MS(ESI) m/z 8698.0 (M+1).sup.+.

(80) (6) The preparation of L-G-3-1.d

(81) ##STR00033##

(82) adding piperidine (5 L) into L-G-2-2.d (15 mg) and reacting with stirring for 6 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain a solid; adding R.sup.j (R.sup.j is selected from isocyanate substituted by RR, 1.5 mg), triethylamine (10 L) as well as DMF (100 L) into the solid; reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2-1.d;

(83) referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-2-1.d is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.d;

(84) after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4*100 L) and distilled water (4*100 L), finally washing with 100 L distilled water; taking a part of the solid after the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test.

(85) (7) Synthesis of L-D-T-4 Compound Library

(86) ##STR00034##

(87) taking part of L-G-3-1.d (3.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, and precipitating at 20 C. to obtain L-D-T-4.

Embodiment 5

(88) (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;

(89) (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;

(90) (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;

(91) (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and

(92) (5) the preparation of L-G-2-2.e

(93) ##STR00035##

(94) adding S-1, S-2 and S-3 as well as DMF into L-G-2-1 and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.e.

(95) Specifically,

(96) adding S-1 (FMOC-glycine, manufacturer: Alfa, 14.8 mg), S-2 (t-butylisocynide, manufacturer: Alfa, 4.2 mg) and S-3 (isovaleraldehyde, manufacturer: Alfa, 4.3 mg) as well as DMF (100 L) into L-G-2-1 and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.e;

(97) taking part of L-G-2-2-1.e (2.0 mg), adding 150 L of strong aqueous ammonia to, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, finally washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2.e, the amount of substance of DNA in L-G-2-2.e is 38 nmol by using OD ultraviolet absorption quantitation, the productivity is 76%.

(98) MS(ESI) m/z 9111.4 (M+1).sup.+.

(99) (6) The preparation of L-G-3-1.e

(100) ##STR00036##

(101) referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-2-1.e is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.e;

(102) after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking a part of the solid after the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, freeze-drying for agarose electrophoresis test;

(103) adding piperidine (40 L) into L-G-2-2-1.e (10 mg) and reacting with stirring for 6 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain a solid; adding R.sup.k (R.sup.k is selected from synthetic building block containing carboxylic acids, aldehydes or isocyanates), O-(7-azbenzotriazole-1-yl)-N,N,N,N-tetramethyluronium hexafluorophosphate (6.1 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into the solid; reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-3-1-1.e;

(104) referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-3-1-1.e is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.e; after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking a part of the solid after the irrigation, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test; and

(105) (7) Synthesis of L-D-T-5 Compound Library

(106) ##STR00037##

(107) taking part of L-G-3-1.e (2.0 mg), adding 40 L of aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for several times to obtain filtrated solution; concentrating the filtrated solution, and adding appropriate ethanol, precipitating at 20 C. and centrifugating to obtain a solid; washing the solid with 85% ethanol to obtain DNA encode compound library L-D-T-5 is finally.

Embodiment 6

(108) (1) L-G-1 is obtained according to the preparation method for L-G-1 in embodiment 1;

(109) (2) L-2 is obtained according to the preparation method for L-2 in embodiment 1;

(110) (3) L-G-2 is obtained according to the preparation method for L-G-2 in embodiment 1;

(111) (4) L-G-2-1 is obtained according to the preparation method for L-G-2-1 in embodiment 1; and

(112) (5) the preparation of L-G-2-2.f

(113) ##STR00038##

(114) adding S-1, S-2 and S-3 as well as DMF into L-G-2-1, and reacting with stirring for 16 hours at 25 C. 30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-2-2.f.

(115) Specifically,

(116) adding S-1 (FMOC-L-phenylalanine, manufacturer: Alfa, 15.1 mg), S-2 (cyclohexylisocynide, manufacturer: Alfa, 4.8 mg) and S-3 (cyclopentylaldehyde, manufacturer: Alfa, 4.1 mg) as well as DMF (100 L) into L-G-2-1 (20 mg), and reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining the filtrated cake; washing the filtrated cake respectively with distilled water and 0.1M TEAA buffer solution for 3 times to obtain L-G-2-2.f;

(117) taking part of L-G-2-2-1.d (2.0 mg), adding 150 L of strong aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Removing the solvent by reducing the pressure after filtration process, washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times. Adding 250 L ethanol and 100 L acetic acid-sodium acetate buffer solution (pH=4.7, 0.5 mol/L) to the solid, precipitating at 20 C. to obtain DNA in L-G-2-2.f, the amount of substance of DNA in L-G-2-2.f is 35 nmol by using OD ultraviolet absorption quantitation, the productivity is 70%.

(118) MS(ESI) m/z 9241.9 (M+1).sup.+.

(119) (6) The Preparation of L-G-3-1.f

(120) ##STR00039##

(121) referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-2-2.f is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-2-2-1.f; after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking part of the solid after washing, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, and freeze-drying for agarose electrophoresis test;

(122) taking part of L-G-2-2-1.f (10 mg), adding piperidine (40 L), and reacting with stirring for 6 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain the solid; add R.sup.k (R.sup.k is selected from synthetic building block containing carboxylic acids, aldehydes or isocyanates), O-(7-azbenzotriazole-1-yl)-N,N,N,N-tetramethyluronium hexafluorophosphate (6.1 mg, manufacturer: Alfa), DIEA (20 L) as well as DMF (60 L) into the solid; reacting with stirring for 16 hours at 25 C.30 C.; filtrating the solution to remove the solvent and obtaining a filtrated cake; washing the filtrated cake respectively with distilled water and 0.1 mol/L TEAA buffer solution for 3 times to obtain L-G-3-1-1.f;

(123) referencing to the DNA encoded method disclosed in the patent named Synthesis and Screening Method and Kit for Lead Compound (application number: CN201210555548.3), L-G-3-1-1.f is performed DNA encoding in solid-phase condition (single strand DNA sequence is GGAGCTTGTGAAATCTGGCACTCG) to obtain L-G-3-1.f; after encoding, washing the solid respectively with 0.1 mol/L TEAA buffer solution (4100 L) and distilled water (4100 L), finally washing with 100 L distilled water; taking part of the solid after washing, adding 50 L of strong aqueous ammonia, and reacting for 1 hour at 55 C.; washing the obtained solid with 0.1 mol/L TEAA buffer solution and distilled water for 3 times; precipitating the filtrated solution by ethanol, freeze-drying for agarose electrophoresis test; and

(124) (7) Synthesis of L-D-T-6 Compound Library

(125) ##STR00040##

(126) taking part of L-G-3-1.f (2.0 mg), adding 40 L of aqueous ammonia, and heating the solution to 55 C. for 1 hour to remove the solid carrier. Washing the solid respectively with distilled water and 0.1 mol/L TEAA buffer solution for several times to obtain a filtrated solution; concentrating the filtrated solution, and adding appropriate amount of ethanol, precipitating at 20 C. and centrifugating to obtain a solid; washing the solid with 85% ethanol to obtain DNA encode compound library L-D-T-6.

(127) The present invention can realize synthesis of DNA coding compound in organic solvent system. It can make the unrealized or relatively low synthesis of chemical reaction in the DNAcoding compound library in the traditional liquid phase condition successfully reacted, and further enlarge reaction types of coding compound library and the space of diversity of the encoded compound library. The enlarged reaction types include organic catalyzed aldol reactions, alkenes metathesis reactions etc. In the traditional liquid phase DNA encoded compound library the efficiencies are rather low, while the present invention significantly increase the synthesis efficiencies of these reactions.

(128) Compared with the existed method for liquid phase synthesis of DNA encoded compound library, the synthesis technology with CPG carrying DNA encoded compound in the present invention, performs the after-reaction purification process through several simple filtration and washing procedures. It simplifies the after-process of chemical synthesis and of DNA encode reactions, and simplifies the processes of separation and purification. It also shortens the cycle of synthesis of compound library at more than 50% and saves the cost enormously. Moreover, it significantly enhances the purified quality, that is, enhances the purity of final products and enhance the DNA encoding efficiency as well as unicity.

(129) The method for synthesis of DNA encoded compound library in the present invention, is able to remove the excessive DNA, decreases the interference which excessive DNA would make on the following screening process during the DNA encoded compound library synthesis and also significantly increases the targeting ability and the accuracy on the screening of new pharmaceuticals.

(130) The linker molecules in the present invention, connect the CPG, DNA and small molecules at a suitable distance. Thus the forces between molecules can be formed and also be broken under moderate condition, which makes a variety of reactions happens with the co-existence of DNA and CPG.