HSV vectors for delivery of NT3 and treatment of CIPN
10799560 ยท 2020-10-13
Assignee
Inventors
- David M. Krisky (Pittsburgh, PA, US)
- James B. Wechuck (Pittsburgh, PA, US)
- James R. Goss (Pittsburgh, PA, US)
Cpc classification
C12N2710/16643
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C12N2830/008
CHEMISTRY; METALLURGY
C12N2710/16621
CHEMISTRY; METALLURGY
A61K38/185
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are compositions and methods for treating neuropathy, embodiments, HSV vectors are provided comprising nucleic acid molecules encoding neurotrophins, such as neurotrophin 3 (NT3).
Claims
1. A variant of herpes simplex virus (HSV) McKrae strain whose genome contains an alteration such that the variant fails to express one or more immediate early genes, wherein the genome comprises a nucleic acid molecule encoding a neurotrophin 3 polypeptide.
2. The variant of herpes simplex virus (HSV) McKrae strain according to claim 1, wherein the variant fails to express a functional protein characterized by SEQ ID NO: 2.
3. The variant of herpes simplex virus (HSV) McKrae strain according to claim 1, wherein the variant fails to express a functional protein characterized by SEQ ID NO: 16.
4. A composition comprising: a vector comprising a variant of herpes simplex virus (HSV) McKrae strain whose genome contains an alteration such that the variant fails to express one or more immediate early genes, wherein the genome comprises a nucleic acid molecule encoding a neurotrophin 3 polypeptide; and a pharmaceutically acceptable carrier.
5. The composition according to claim 4, wherein, the variant fails to express a functional protein characterized by SEQ ID NO: 2.
6. The composition according to claim 4 wherein, the variant fails to express a functional protein characterized by SEQ ID NO: 16.
7. The composition of claim 4, wherein the vector further comprises a promoter operatively linked to a sequence encoding neurotrophin 3.
8. The composition of claim 7 wherein the vector further comprises an enhancer upstream of the promoter.
9. The composition of claim 8, wherein the promoter is tissue specific.
10. The composition of claim 8, wherein the promoter is neuron specific.
11. The composition of claim 7 wherein the promoter is a human cytomegalovirus (HCMV) promoter.
12. The composition of claim 7 wherein the promoter is a calcitonin gene-related peptide (CGRP) promoter.
13. The composition of claim 4, wherein the vector comprises a bovine growth hormone (BGH) polyadenylation signal.
14. The composition of claim 4, wherein the carrier is a polyol.
15. The composition of claim 4, wherein the carrier is glycerol.
16. The composition of claim 4, wherein the nucleic acid molecule encoding a neurotrophin 3 polypeptide is codon optimized.
17. A method of inhibiting the development or progression of neuropathy in a subject, the method comprising administering to the subject a vector comprising a variant of herpes simplex virus (HSV) McKrae strain whose genome contains an alteration such that the variant fails to express one or more immediate early genes, wherein the genome comprises a nucleic acid molecule encoding a neurotrophin 3 polypeptide.
18. The method according to claim 17, wherein the variant fails to express a functional protein characterized by SEQ ID NO: 2.
19. The method according to claim 17, wherein the variant fails to express a functional protein characterized by SEQ ID NO: 16.
20. A method of treating neuropathy in a subject, the method comprising administering to the subject a vector comprising a variant of herpes simplex virus (HSV) McKrae strain whose genome contains an alteration such that the variant fails to express one or more immediate early genes, wherein the genome comprises a nucleic acid molecule encoding a neurotrophin 3 polypeptide.
21. The method of treating neuropathy in a subject according to claim 20, wherein the variant fails to express a functional protein characterized by SEQ ID NO: 2.
22. The method of treating neuropathy in a subject according to claim 20, wherein the variant fails to express a functional protein characterized by SEQ ID NO: 16.
23. The method according to claim 20, wherein the neuropathy is a peripheral neuropathy.
24. The method according to claim 20, wherein the neuropathy is iatrogenic.
25. The method according to claim 20, wherein the neuropathy is a result of a cancer treatment.
26. The method according to claim 20, wherein the neuropathy is a result of chemotherapy.
27. The method according to claim 26, wherein the chemotherapy comprises a platinum based chemotherapeutic.
28. The method according to claim 20, wherein the vector is administered by contact with the skin of a subject.
29. The method according to claim 20, wherein the vector is administered intradermally.
30. In a method of treating a subject having cancer with a chemotherapeutic agent, the improvement comprising administering to the subject a vector comprising a variant of herpes simplex virus (HSV) McKrae strain whose genome contains an alteration such that the variant fails to express one or more immediate early genes, wherein the genome comprises a nucleic acid molecule encoding a neurotrophin 3 polypeptide, wherein the vector is administered to promote tolerance against chemotherapy induced neuropathy.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The drawings are for illustration purposes only, not for limitation.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
DEFINITIONS
(35) In this application, unless otherwise clear from context, (i) the term a may be understood to mean at least one; (ii) the term or may be understood to mean and/or; (iii) the terms comprising and including may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps; and (iv) the terms about and approximately may be understood to permit standard variation as would be understood by those of ordinary skill in the art; and (v) where ranges are provided, endpoints are included.
(36) Administration: As used herein, the term administration refers to the administration of a composition to a subject or system. Administration to an animal subject (e.g., to a human) may be by any appropriate route. For example, in some embodiments, administration may be bronchial (including by bronchial instillation), buccal, enteral, interdermal, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e. g. intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (including by intratracheal instillation), transdermal, vaginal and vitreal. In some embodiments, administration may involve intermittent dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.
(37) Agent: As used herein, the term agent refers to a compound or entity of any chemical class including, for example, polypeptides, nucleic acids, saccharides, lipids, small molecules, or combinations thereof. In some embodiments, an agent is or comprises a natural product in that it is found in and/or is obtained from nature. In some embodiments, an agent is or comprises one or more entities that is man-made in that it is designed, engineered, and/or produced through action of the hand of man and/or is not found in nature. Some particular embodiments of agents that may be utilized in accordance with the present invention include small molecules, antibodies, antibody fragments, aptamers, nucleic acids (e.g., siRNAs, shRNAs, DNA/RNA hybrids, antisense oligonucleotides, ribozymes), peptides, peptide mimetics, etc.
(38) Amelioration: As used herein, the term amelioration refers to the prevention, reduction or palliation of a state, or improvement of the state of a subject. Amelioration includes, but does not require complete recovery or complete prevention of a disease, disorder or condition.
(39) Animal: As used herein, the term animal refers to any member of the animal kingdom. In some embodiments, animal refers to humans, of either sex and at any stage of development. In some embodiments, animal refers to non-human animals, at any stage of development. In some embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically engineered animal, and/or a clone.
(40) Approximately: As used herein, the term approximately or about, as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term approximately or about refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 40%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
(41) Characteristic sequence: As used herein, the term characteristic sequence refers to a sequence that is found in all members of a family of polypeptides or nucleic acids, and therefore can be used by those of ordinary skill in the art to define members of the family.
(42) Combination therapy: As used herein, the term combination therapy refers to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some embodiments, two or more agents or may be administered simultaneously; in some embodiments, such agents may be administered sequentially; in some embodiments, such agents are administered in overlapping dosing regimens.
(43) Composition: As used herein, the term composition or a pharmaceutical composition refers to the combination of two or more agents as described herein for co-administration or administration as part of the same regimen. It is not required in all embodiments that the combination of agents result in physical admixture, that is, administration as separate co-agents each of the components of the composition is possible; however many patients or practitioners in the field may find it advantageous to prepare a composition that is an admixture of two or more of the ingredients in a pharmaceutically acceptable carrier, diluent, or excipient, making it possible to administer the component ingredients of the combination at the same time.
(44) Engineered: As used herein, the term engineered refers to the aspect of having been manipulated by the hand of man. For example, a polynucleotide is considered to be engineered when two or more sequences, that are not linked together in that order in nature, are manipulated by the hand of man to be directly linked to one another in the engineered polynucleotide. For example, in some embodiments of the present disclosure, an engineered polynucleotide comprises a regulatory sequence that is found in nature in operative association with a first coding sequence but not in operative association with a second coding sequence, is linked by the hand of man so that it is operatively associated with the second coding sequence. Comparably, a cell or organism is considered to be engineered if it has been manipulated so that its genetic information is altered (e.g., new genetic material not previously present has been introduced, for example by transformation, mating, somatic hybridization, transfection, transduction, or other mechanism, or previously present genetic material is altered or removed, for example by substitution or deletion mutation, or by mating protocols). As is common practice and is understood by those in the art, progeny of an engineered polynucleotide or cell are typically still referred to as engineered even though the actual manipulation was performed on a prior entity.
(45) Expression: As used herein, expression of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5 cap formation, and/or 3 end formation); (3) translation of an RNA into a polypeptide or protein; and/or (4) post-translational modification of a polypeptide or protein.
(46) Homology: As used herein, the term homology refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be homologous to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polymeric molecules are considered to be homologous to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar.
(47) Inhibit: As used herein, the term inhibit or inhibiting refers to slowing, stopping, reducing, or delaying onset. In some embodiments, inhibiting neuropathy comprises slowing progression of pathology or symptoms. In some embodiments, inhibiting neuropathy comprises reducing severity of tissue damage and/or associated neurological symptoms. In some embodiments, inhibiting neuropathy comprises delaying the onset of tissue damage and/or associated neurological symptoms.
(48) Isolated: As used herein, the term isolated refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) designed, produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were initially associated. In some embodiments, isolated agents are about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is pure if it is substantially free of other components. In some embodiments, as will be understood by those skilled in the art, a substance may still be considered isolated or even pure, after having been combined with certain other components such as, for example, one or more carriers or excipients (e.g., buffer, solvent, water, etc.); in such embodiments, percent isolation or purity of the substance is calculated without including such carriers or excipients. To give but one example, in some embodiments, a biological polymer such as a polypeptide or polynucleotide that occurs in nature is considered to be isolated when, a) by virtue of its origin or source of derivation is not associated with some or all of the components that accompany it in its native state in nature; b) it is substantially free of other polypeptides or nucleic acids of the same species from the species that produces it in nature; c) is expressed by or is otherwise in association with components from a cell or other expression system that is not of the species that produces it in nature. Thus, for instance, in some embodiments, a polypeptide that is chemically synthesized or is synthesized in a cellular system different from that which produces it in nature is considered to be an isolated polypeptide. Alternatively or additionally, in some embodiments, a polypeptide that has been subjected to one or more purification techniques may be considered to be an isolated polypeptide to the extent that it has been separated from other components a) with which it is associated in nature; and/or b) with which it was associated when initially produced.
(49) Marker element: As used herein, the term marker element refers to a detectable or selectable agent. In some embodiments, a marker element is a detectable or selectable nucleic acid sequence. In some embodiments a marker element is an expression product (e.g., RNA or protein) whose presence or absence is detectable and/or selectable in cells. In some embodiments, an expression product is or comprises an enzyme. In some embodiments, an expression product is a fluorophore.
(50) Nucleic acid: As used herein, the term nucleic acid refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, nucleic acid refers to individual nucleic acid residues (e.g., nucleotides and/or nucleosides); in some embodiments, nucleic acid refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a nucleic acid is or comprises RNA; in some embodiments, a nucleic acid is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid is, comprises, or consists of one or more peptide nucleic acids, which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present disclosure. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and/or 5-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2-fluororibose, ribose, 2-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is single stranded, in some embodiments, a nucleic acid is double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. In some embodiments, a nucleic acid has enzymatic activity.
(51) Patient: As used herein, the term patient refers to any organism to which a provided composition is or may be administered, e.g., for experimental, diagnostic, prophylactic, cosmetic, and/or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and/or humans). In some embodiments, a patient is a human. In some embodiments, a patient is suffering from or susceptible to one or more disorders or conditions. In some embodiments, a patient displays one or more symptoms of a disorder or condition. In some embodiments, a patient has been diagnosed with one or more disorders or conditions. In some embodiments, the patient is receiving or has received certain therapy to diagnose and/or to treat a disease, disorder, or condition.
(52) Pharmaceutical composition: As used herein, the term pharmaceutical composition refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.
(53) Pharmaceutically acceptable: As used herein, the term pharmaceutically acceptable applied to the carrier, diluent, or excipient used to formulate a composition as disclosed herein means that the carrier, diluent, or excipient must be compatible with the other ingredients of the composition and not deleterious to the recipient thereof.
(54) Pharmaceutically acceptable carrier: As used herein, the term pharmaceutically acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil, glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid, pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and/or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.
(55) Prevent or prevention: As used herein, the terms prevent or prevention, when used in connection with the occurrence of a disease, disorder, and/or condition, refers to reducing the risk of developing the disease, disorder and/or condition and/or to delaying onset of one or more characteristics or symptoms of the disease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder or condition has been delayed for a predefined period of time.
(56) Subject: As used herein, the term subject refers to a mammal (e.g., a human, in some embodiments including prenatal human forms). In some embodiments, a subject is suffering from a relevant disease, disorder or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and/or therapy is and/or has been administered.
(57) Treatment: As used herein, the term treatment (also treat or treating) refers to any administration of a substance that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition (e.g., neuropathy). Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition. Alternatively or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.
(58) Vector: As used herein, the term vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated to a viral genome or portion thereof. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication, episomal mammalian vectors, herpes simplex virus (HSV) vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as expression vectors.
(59) Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)), which is incorporated herein by reference for any purpose.
DETAILED DESCRIPTION
(60) Various aspects of the invention are described in detail in the following sections. The use of sections is not meant to limit the invention. Each section can apply to any aspect of the invention. In this application, the use of or means and/or unless stated otherwise or clear from context to be disjunctive.
(61) The present disclosure provides, among other things, compositions comprising HSV vectors and methods for use and production of the same. In particular, the present disclosure relates to HSV McKrae strain vectors for delivery of NT3 to a subject suffering from or susceptible to neuropathy.
(62) Chemotherapy-Induced Peripheral Neuropathy (CIPN)
(63) Peripheral neuropathy results from damage to peripheral nerves, which often causes weakness, numbness and pain, usually in the hands and feet, though it can also affect other areas of the body. Peripheral neurons send information from the central nervous system to the rest of the body (and vice versa). Peripheral neuropathy can result from traumatic injuries, diabetes mellitus, medications, infections, metabolic problems, inherited causes, and exposure to toxins. Peripheral neuropathy caused by chemotherapy medications is one of the most common side effects of chemotherapy and can be disabling. The most common symptoms of CIPN are pain (which may be present at all times or may come and go, like shooting or stabbing pain), a burning sensation, tingling (pins and needles feeling or electric/shock-like pain), loss of feeling (which can be numbness or a lessened ability of sense pressure, touch, heat or cold), trouble using fingers to pick up or hold things/dropping things, balance problems, trouble with tripping or stumbling while walking, increased sensitivity to cold or heat, increased sensitivity to touch or pressure, shrinking muscles, muscle weakness, trouble swallowing, constipation, difficulty passing urine, changes in blood pressure and decreased or no reflexes.
(64) When chemotherapy drugs are administered systemically, they typically spread throughout the body and certain types can damage different nerves CIPN symptoms tend to start farthest away from the head and move closer over time. In most cases, CIPN symptoms start in the feet, and then are later noticeable in the hands. Symptoms may start in the toes and then move to the feet, ankles and legs, or can start in the fingers and move to the hands, wrists and arms. CIPN can begin any time after chemotherapy treatment starts and symptoms often increase in severity as treatments continue.
(65) Particular chemotherapeutic agents are linked to CIPN. These agents include: taxanes (e.g. paclitaxel), platinum compounds (e.g. oxaliplatin), proteasome inhibitors (e.g. bortezomib), vinka alkaloids (e.g. vincristine), thalidomide, lenalidomide, epothilones, antimitotic agents (e.g., eribulin, monomethyl auristatin E), antibody drug conjugates (e.g., vedotin), and others. CIPN can occur for a short duration or it can occur over a long period of time. Factors that influence the duration of CIPN symptoms include: age, the presence of other medical conditions that cause neuropathy (e.g. diabetes or HIV infection), prescription drugs, family history of neuropathy, the chemotherapeutic agent or combination of chemotherapeutic agents used (including those used in the past), the dose of chemotherapeutic agent, frequency of dosing of chemotherapeutic agent(s), and the total amount of chemotherapeutic agent(s) given over time.
(66) Different chemotherapeutics affect different components of the nervous system, from the level of the sensory cell bodies in the dorsal root ganglion (DRG) to the distal axon. The DRG is a prominent target as it is less protected by the blood-nerve barrier and more vulnerable to neurotoxic damage. Disruption of microtubule dynamics is another common mechanism of neurotoxicity. Microtubules are central to axonal transport processes, and critical for energy and material delivery. In additional to energy deficiency, chemotherapeutics may damage the peripheral vasculature. Another target of neurotoxicity can include direct axonal toxicity at the distal terminals.
(67) Treatments that have been used for CIPN include vitamin E, calcium and magnesium, anti-seizure drugs (such as carbamazepine (Tegretol)), antidepressants (such as venlafaxine (Effexor)) and glutathione. The success of these treatments has been inconsistent.
(68) Diagnosis of CIPN can also be determined by sensory nerve action potentials (SNAP) (See Velasco & Bruna et al. (2013) Neurol Neurosurg Psychiatry doi:10.1136/jnnp-2013-305334, incorporated herein by reference in its entirety). An increased number of acute neuropathic symptoms and the amplitude decrease of a sensory nerve action potential (e.g., of radial and dorsal sural nerves) at mid-treatment are associated with a risk of developing a more severe chemotherapy induced neuropathy.
(69) Chemotherapeutic Agents
(70) As mentioned above, certain chemotherapeutic agents are more frequently associated with CIPN than others. These agents include: taxanes (e.g. paclitaxel), platinum compounds (e.g. oxaliplatin), bortezomib, vinka alkaloids (e.g. vincristine), thalidomide, lenalidomide, epothilones, antibody drug conjugates (e.g. MMAE-MAB), and others.
(71) Cisplatin
(72) Cisplatin is a chemotherapeutic agent that is classified as an alkylating agent. Cisplatin produces interstrand, intrastrand and monofunctional adduct cross-linking in DNA, the most prevalent form being a 1,2-intrastrand d(GpG) and d(ApG) crosslinks. Sensory polyneuropathy occurs at high frequency after exposure to amounts of cisplatin as low as 200 mg/m2. Cumulative doses of Cisplatin greater than 300 mg/m.sup.2 uniformly result in a severe sensory neuropathy, thereby limiting the maximum therapeutic dose possible. Rodent models of cisplatin treatment faithfully recapitulate aspects of the human disease.
(73) Cisplatin can be used to treat testicular, ovarian, bladder, head and neck, esophageal, small and non-small cell lung, breast, cervical, stomach and prostate cancers. Cisplatin can also be used to treat Hodgkin's and non-Hodgkin's lymphomas, neuroblastoma, sarcomas, multiple myeloma, melanoma and mesothelioma. Cisplatin can be administered intravenously. The usual cisplatin injection dose for the treatment of testicular cancer in combination with other approved chemotherapeutic agents is 20 mg/m.sup.2 intravenously (i.v.) daily for 5 days per cycle. As a single agent, the usual cisplatin injection for the treatment of metastatic ovarian tumors is a dose of 100 mg/m.sup.2 IV per cycle once every four weeks. The usual cisplatin injection dose for the treatment of metastatic ovarian cancer in combination with cyclophosphamide is 75 to 100 mg/m.sup.2 (i.v.) per cycle once every four weeks. As a single agent, the usual cisplatin injection for the treatment of advanced bladder cancer is a dose of 50 to 70 mg/m.sup.2 (i.v.) per cycle once every three to four weeks depending on the extent of prior exposure to radiation therapy and/or prior chemotherapy. For heavily pretreated patients an initial dose of 50 mg/m.sup.2 per cycle repeated every four weeks is recommended. The inorganic compound cis-diamminedichloroplatinum(II), commonly referred to as Cisplatin or cis-DDP, is commonly used in the treatment of cancer.
(74) Oxaliplatin
(75) Oxaliplatin is a chemotherapeutic agent that is classified as an alkylating agent. Oxaliplatin can be used to treat colon or rectal cancer that has metastasized and it is often administered with other chemotherapeutic agents. Oxaliplatin can be administered intravenously.
(76) The recommended administration of oxaliplatin is in combination with 5-fluorouracil/leucovorin every 2 weeks. For advanced disease, treatment is recommended until disease progression or unacceptable toxicity. For adjuvant use, treatment is recommended for a total of 6 months (12 cycles). In the recommended regimen, Day 1 of treatment involves administration of oxaliplatin 85 mg/m.sup.2 intravenous infusion in 250 to 500 mL 5% dextrose injection and leucovorin 200 mg/m.sup.2 intravenous infusion in 5% Dextrose Injection both given over 120 minutes at the same time in separate bags using a Y-line, followed by 5-fluorouracil 400 mg/m.sup.2 intravenous bolus given over 2 to 4 minutes, followed by 5-fluorouracil 600 mg/m.sup.2 intravenous infusion in 500 mL 5% dextrose injection (recommended) as a 22 hour continuous infusion. Day 2 of treatment involves administration of leucovorin 200 mg/m.sup.2 intravenous infusion over 120 minutes, followed by 5-fluorouracil 400 mg/m.sup.2 intravenous bolus given over 2 to 4 minutes, followed by 5-fluorouracil 600 mg/m.sup.2 intravenous infusion in 500 mL 5% dextrose injection (recommended) as a 22 hour continuous infusion.
(77) When used as adjuvant therapy in patients with Stage III colon cancer, a dose reduction of oxaliplatin to 75 mg/m.sup.2 is recommended for consideration in patients experiencing Grade 2 neurosensory events. When used in patients with advanced colon cancer, a dose reduction of oxaliplatin to 65 mg/m.sup.2 is recommended for consideration in patients experiencing Grade 2 neurosensory events. For patients with persistent Grade 3 neurosensory events, it is typically recommended that discontinuation of therapy should be considered.
(78) Paclitaxel
(79) Paclitaxel is a chemotherapeutic agent that is classified as a plant alkaloid, a taxane and an antimicrotubule agent. Paclitaxel can be used to treat breast, ovarian, lung, bladder, prostate, melanoma, esophageal, as well as other types of solid tumor cancers. It has also been used in Kaposi's sarcoma. Paclitaxel can be administered intravenously.
(80) Paclitaxel is an antimicrotubule agent that promotes the assembly of microtubules from tubulin dimers and stabilizes microtubules by preventing depolymerization. This stability results in the inhibition of the normal dynamic reorganization of the microtubule network that is essential for vital interphase and mitotic cellular functions. In addition, paclitaxel induces abnormal arrays or bundles of microtubules throughout the cell cycle and multiple asters of microtubules during mitosis.
(81) For patients with carcinoma of the ovary, the following regimens have been recommended. For previously untreated patients with carcinoma of the ovary, one of the following recommended regimens may be given every 3 weeks. In selecting the appropriate regimen, differences in toxicities should be considered. One recommended regimen is paclitaxel administered intravenously over 3 hours at a dose of 175 mg/m.sup.2 followed by cisplatin at a dose of 75 mg/m.sup.2. Another recommended regimen is paclitaxel administered intravenously over 24 hours at a dose of 135 mg/m.sup.2 followed by cisplatin at a dose of 75 mg/m.sup.2. In patients previously treated with chemotherapy for carcinoma of the ovary, paclitaxel has been used at several doses and schedules; however, an optimal regimen is not yet clear. Another recommended regimen is paclitaxel 135 mg/m.sup.2 or 175 mg/m.sup.2 administered intravenously over 3 hours every 3 weeks.
(82) For patients with carcinoma of the breast, the following regimens have been recommended. For the adjuvant treatment of node-positive breast cancer, the recommended regimen is paclitaxel, at a dose of 175 mg/m.sup.2 intravenously over 3 hours every 3 weeks for 4 courses administered sequentially to doxorubicin-containing combination chemotherapy. After failure of initial chemotherapy for metastatic disease or relapse within 6 months of adjuvant chemotherapy, paclitaxel at a dose of 175 mg/m.sup.2 administered intravenously over 3 hours every 3 weeks has been reported to be effective. Another recommended regimen is 75 mg/mg.sup.2 every week for 12 weeks as part of adriamycin, cyclophosphamide, and a taxane.
(83) For patients with non-small cell lung carcinoma, the recommended regimen, given every 3 weeks, is paclitaxel administered intravenously over 24 hours at a dose of 135 mg/m.sup.2 followed by cisplatin, 75 mg/m.sup.2.
(84) For patients with AIDS-related Kaposi's sarcoma, the recommended regimen is paclitaxel administered at a dose of 135 mg/m.sup.2 given intravenously over 3 hours every 3 weeks or at a dose of 100 mg/m.sup.2 given intravenously over 3 hours every 2 weeks (dose intensity 45 to 50 mg/m.sup.2/week).
(85) Bortezomib
(86) Bortezomib is a chemotherapeutic agent that is classified as a proteasome inhibitor. Bortezomib can be used to treat multiple myeloma and mantle cell lymphoma in patients who have received at least one prior therapy. Paclitaxel can be administered intravenously or as a subcutaneous injection into the thigh or abdomen.
(87) The recommended starting dosage of bortezomib is 1.3 mg/m.sup.2 and it may be administered intravenously at a concentration of 1 mg/mL or subcutaneously at a concentration of 2.5 mg/mL. Retreatment with bortezomib may be considered for patients with multiple myeloma who had previously responded to treatment with bortezomib and who have relapsed at least 6 months after completing prior bortezomib treatment. Treatment may be started at the last tolerated dose. When administered intravenously, bortezomib is administered as a 3 to 5 second bolus intravenous injection.
(88) In patients with previously untreated multiple myeloma, bortezomib is administered in combination with oral melphalan and oral prednisone for nine 6-week treatment cycles. In cycles 1-4, bortezomib is administered twice weekly (days 1, 4, 8, 11, 22, 25, 29 and 32). In cycles 5-9, bortezomib is administered once weekly (days 1, 8, 22 and 29). It is typically recommended that at least 72 hours elapse between consecutive doses of bortezomib.
(89) In patients with previously untreated mantle cell lymphoma, bortezomib (1.3 mg/m.sup.2) may be administered intravenously in combination with intravenous rituximab, cyclophosphamide, doxorubicin and oral prednisone (VcR-CAP) for six 3-week treatment cycles. Bortezomib is administered first followed by rituximab. Bortezomib is administered twice weekly for two weeks (Days 1, 4, 8, and 11) followed by a 10-day rest period on Days 12-21. For patients with a response first documented at cycle 6, two additional VcR-CAP cycles are recommended.
(90) In patients who have relapsed multiple myeloma or relapsed mantle cell lymphoma, bortezomib (1.3 mg/m.sup.2/dose) is administered twice weekly for 2 weeks (Days 1, 4, 8, and 11) followed by a 10-day rest period (Days 12-21). For extended therapy of more than 8 cycles, bortezomib may be administered on the standard schedule or, for relapsed multiple myeloma, on a maintenance schedule of once weekly for 4 weeks (Days 1, 8, 15, and 22) followed by a 13-day rest period (Days 23 to 35). Patients with multiple myeloma who have previously responded to treatment with bortezomib (either alone or in combination) and who have relapsed at least 6 months after their prior bortezomib therapy may be started on bortezomib at the last tolerated dose. Retreated patients are administered bortezomib twice weekly (Days 1, 4, 8, and 11) every three weeks for a maximum of 8 cycles. At least 72 hours should elapse between consecutive doses of bortezomib. Bortezomib may be administered either as a single agent or in combination with dexamethasone.
(91) Starting bortezomib subcutaneously may be considered for patients with pre-existing or at high risk of peripheral neuropathy. Patients with pre-existing severe neuropathy should be treated with bortezomib only after careful risk-benefit assessment. Patients experiencing new or worsening peripheral neuropathy during bortezomib therapy may require a decrease in the dose and/or a less dose-intense schedule. The current dose or schedule modification guidelines for patients who experience bortezomib-related neuropathic pain and/or peripheral neuropathy are as follows. For patients with Grade 1 signs and symptoms of CIPN (with pain) or for patients with Grade 2 symptoms (moderate symptoms; limiting instrumental Activities of Daily Living (such as preparing meals, shopping for groceries or clothes, using telephone, managing money, etc.)), guidelines recommend that bortezomib is reduced to 1 mg/m.sup.2. For patients with Grade 2 symptoms (with pain) or Grade 3 (severe symptoms; limiting self-care Activities of Daily Living (such as bathing, dressing and undressing, feeding self, using the toilet, taking medications, and not bedridden)), guidelines recommend withholding bortezomib therapy until toxicity resolves and when re-starting therapy, treating with a reduced dose of bortezomib at 0.7 mg/m.sup.2 once per week. For patients with Grade 4 symptoms (life-threatening consequences; urgent intervention indicated), guidelines recommend discontinuing treatment with bortezomib.
(92) Vincristine
(93) Vincristine is a chemotherapeutic agent that is classified as a plant alkaloid. Vincristine can be used to treat acute leukemia, Hodgkin's and non-Hodgkin's lymphoma, neuroblastoma, rhabdomyosarcoma, Ewing's sarcoma, Wilms' tumor, multiple myeloma, chronic leukemia, thyroid cancer and brain tumors. Paclitaxel can be administered intravenously. The mechanism of action of vincristine has been related to the inhibition of microtubule formation in mitotic spindles, resulting in an arrest of dividing cells at the metaphase stage.
(94) The usual dose of vincristine for pediatric patients is 1.5 to 2 mg/m.sup.2. For pediatric patients weighing 10 kg or less, the starting dose is typically 0.05 mg/kg, administered once a week. The usual dose of vincristine for adults is 1.4 mg/m.sup.2. A 50% reduction in the dose of vincristine is recommended for patients having a direct serum bilirubin value above 3 mg/100 mL. The drug is typically administered intravenously at weekly intervals.
(95) Thalidomide
(96) Thalidomide is a chemotherapeutic agent that is classified as an immunomodulatory agent and an antiangiogenic agent. Thalidomide can be used to treat newly diagnosed multiple myeloma and is under investigation for use in treating renal cell carcinoma, glioblastoma multiforme and Waldenstrms macroglobulinemia. Thalidomide can be administered orally.
(97) The usual dosage of thalidomide for the treatment of multiple myeloma is administered in combination with dexamethasone in 28-day treatment cycles. The dose of thalidomide is 200 mg administered orally once daily with water, preferably at bedtime and at least 1 hour after the evening meal. The dose of dexamethasone is 40 mg daily administered orally on days 1-4, 9-12, and 17-20 every 28 days. Patients who develop adverse reactions such as constipation, somnolence, or peripheral neuropathy may benefit by either temporarily discontinuing the drug or continuing at a lower dose. With the abatement of these adverse reactions, the drug may be started at a lower dose or at the previous dose based on clinical judgment.
(98) Lenalidomide
(99) Lenalidomide is a chemotherapeutic agent that is classified as immunomodulatory agent and an antiangiogenic agent. Lenalidomide can be used to treat multiple myeloma (in combination with dexamethasone) and mantle cell lymphoma wherein the disease has relapsed or progressed after two prior therapies, one of which included bortezomib. Lenalidomide can be administered orally.
(100) The recommended starting dose of lenalidomide for the treatment of multiple myeloma is 25 mg orally once daily on Days 1-21 of repeated 28-day cycles in combination with dexamethasone. For patients >75 years old, the starting dose of dexamethasone may be reduced. The recommended starting dose of lenalidomide for the treatment of mantle cell lymphoma is 25 mg/day orally on Days 1-21 of repeated 28-day cycles for relapsed or refractory mantle cell lymphoma.
(101) Epothilones
(102) Epothilones, like taxanes, prevent cancer cells from dividing by interfering with tubulin, but in early trials epithilones have been reported to have better efficacy and milder adverse effects than taxanes. Several synthetic epothilone analogs are undergoing clinical development for treatment of various cancers. One analog that has been approved for the treatment of breast cancer is ixabepilone. Ixabepilone, in combination with capecitabine is indicated for the treatment of metastatic or locally advanced breast cancer in patients after failure of an anthracycline and a taxane. Ixabepilone as monotherapy is indicated for the treatment of metastatic or locally advanced breast cancer in patients after failure of an anthracycline, a taxane, and capecitabine. The recommended dosage of ixabepilone is 40 mg/m.sup.2 administered intravenously over 3 hours every 3 weeks. Doses for patients with body surface area (BSA) greater than 2.2 m.sup.2 should be calculated based on 2.2 m.sup.2.
(103) Monomethyl Autistatin E (MMAE) Antibody Drug Conjugates
(104) Monomethyl auristatin E (MMAE) is a synthetic antineoplastic agent. Due to high toxicity, it has not been approved for use as a drug itself. However, it has been approved for use linked to a monoclonal antibody (MAB) which directs it to the cancer cells. MMAE has been tested with various monoclonal antibodies. Brentuximab vedotin targets the protein CD30, which is found on malignant cells in anaplastic large cell lymphoma and Hodgkin's lymphoma. Glembatumumab targets the glycoprotein GPNMB, which is found in aggressive melanoma, glioma, breast cancer and other tumors.
(105) Brentuximab vedotin is indicated for treatment of patients with classical Hodgkin lymphoma (HL) after failure of autologous hematopoietic stem cell transplantation (auto-HSCT) or after failure of at least two prior multi-agent chemotherapy regimens in patients who are not auto-HSCT candidates, classical HL at high risk of relapse or progression as post-auto-HSCT consolidation, and systemic anaplastic large cell lymphoma (sALCL) after failure of at least one prior multi-agent chemotherapy regimen.
(106) The usual administration of brentuximab vedotin is as an intravenous infusion over 30 minutes every 3 weeks until the disease progresses or there is unacceptable toxicity. For classical HL post-auto-HSCT consolidation treatment, brentuximab vedotin treatment is typically initiated within 4-6 weeks post-auto-HSCT or upon recovery from auto-HSCT. These patients typically continue treatment until a maximum of 16 cycles, until the disease progresses or there is unacceptable toxicity. The recommended starting dosage for patients with normal renal and hepatic function is 1.8 mg/kg up to 180 mg. The recommended starting dosage for patients with mild (creatinine clearance >50-80 mL/min) or moderate (creatinine clearance 30-50 mL/min) renal impairment is 1.8 mg/kg up to 180. It is typically recommended that if a patient has severe (creatinine clearance less than 30 mL/min), the patient should avoid use of brentuximab vedotin. The recommended starting dosage for patients with mild (Child-Pugh A) hepatic impairment is 1.2 mg/kg up to 120 mg, while it is typically recommended that if a patient has moderate (Child-Pugh B) or severe (Child-Pugh C) hepatic impairment, the patient should avoid use of brentuximab vedotin.
(107) Viral Vectors and HSV
(108) Viral vectors can be used to facilitate the transfer of nucleic acids into cells. Known viral vectors include those derived from retroviruses, adenoviruses, adeno-associated virus (AAV), vaccinia virus, and baculovirus. Vectors derived from herpes simplex viruses (HSV), such as herpes simplex virus 1 (HSV-1) and herpes simplex virus-2 (HSV-2) are particularly useful for delivery of agents (e.g., NT3) to specifically targeted tissues. Considerations for choosing a particular vector and delivery system include, for example, characteristics of target cells, desired longevity of expression, virulence and invasiveness of the vector; and, size of the genetic material to be transferred.
(109) HSV-1 vectors can typically accommodate up to 25 kb of foreign DNA sequences. HSV-1 has an approximate 152-kb double-stranded linear DNA genome that can be maintained episomally in the nucleus of cells. The HSV-1 virion is enveloped and approximately 110 nm in diameter. Viral infection is initiated in epithelial cells of the skin or mucosal membranes by binding of the viral envelope glycoproteins to heparin sulfate moieties on the plasma membrane. HSV is particularly well suited for the delivery of genes to the nervous system and possesses a natural tropism for sensory neurons. The virus can establish a latent state in which viral genomes persist for the life of the host as an intranuclear episomal element. The life-long persistence of latent genomes in human trigeminal ganglia without the development of sensory loss or histologic damage to the ganglia exemplifies the effectiveness of the latency mechanisms. Wild-type HSV virus may be reactivated from latency under the influence of a variety of stresses. However, recombinant viral vectors that are rendered replication defective retain the ability to establish a persistent quiescent state in neurons yet are unable to replicate (or reactivate) in the nervous system.
(110) Vectors based upon HSV-1 may have one or more HSV genes necessary for replication rendered nonfunctional (e.g., by deletion or disruption). HSV genes necessary for replication include, for example, immediate early genes such as ICP4 and ICP27. In some embodiments, the disclosure provides replication defective HSV vectors with one or more of ICP0, ICP4, ICP22, ICP27, and ICP47 deleted or disrupted. In some embodiments, the disclosure provides HSV vectors with a nonfunctional ICP4 gene. In some embodiments, the disclosure provides HSV vectors with nonfunctional ICP4, ICP22, and ICP47 genes. In some embodiments, the disclosure provides an HSV vector with ICP4 deleted and ICP22 and ICP47 disrupted. In some embodiments, the disclosure provides an HSV vector with ICP4 deleted and expression of ICP22 and ICP47 disrupted or delayed. In some embodiments, the disclosure provides an HSV vector with ICP4 deleted ICP0, ICP22, ICP27, and/or ICP47 not expressed as immediate early genes.
(111) HSV-1 vectors that have deleted HSV genes can be produced in cell lines that express the deficient protein in trans. In some embodiments, HSV-1 vectors are produced in a mammalian cell line. In some embodiments, HSV-1 vectors are produced in a mammalian cell line of Vero lineage. In some embodiments, the cell line expresses ICP4. In some embodiments, the cell line expresses one or more of ICP0, ICP4, ICP22, ICP27, and ICP47. In some embodiments, the cell line expresses ICP4 and at least one additional immediate early gene. In some embodiments, the cell line expresses ICP4, ICP22, and ICP 47. In some embodiments, the cell line expresses ICP4, ICP22, and UL55. In some embodiments, the cell line expresses ICP4, ICP27 and UL55. In some embodiments, the cell line comprises a nucleic acid molecule having a simian virus 40 polyadenylation signal (SV40 pA). In some embodiments, viral vectors are produced in Vero 6-5C cells. In some embodiments, viral vectors are produced in Vero D cells.
(112) McKrae Strain
(113) At least 17 strains of HSV-1 have been isolated, including but not limited to, McKrae, strain 17, strain F, H129, HF10, MacIntyre, Strain HF, ATCC 2011 and KOS (for review, see Watson et al., Virology (2012)). A McKrae strain was isolated from a patient with herpes simplex keratitis and subsequently passaged in tissue culture. A partial genome sequence of McKrae is shown in
(114) Inter-strain differences in HSV-1 peripheral replication and virulence are observed after injection into animals. McKrae undergoes spontaneous or induced reactivation at a higher frequency than other known strains and is among the most virulent HSV-1 strains. McKrae is also more neuroinvasive than other known strains, such as strain 17, KOS, F, and H129. In one study, KOS or McKrae was injected into the cornea and genital tract of mice to compare pathogenesis (Wang et al. (2013) Virus Res. 173(2):436-440. Each was found to replicate to a similar extent in the corneal epithelium and trigeminal ganglia; however. McKrae titers were over 100 fold higher in brainstem. Upon intravaginal injection, McKrae and KOS replicated to a similar extent except for a transient spike in McKrae titer at four days. McKrae, but not KOS, elicited significant inflammation of external genitalia along with weight loss in the animals. KOS was not detected in neural tissue and McKrae was rarely detected.
(115) In some embodiments, the disclosure provides HSV viral vectors with deletion of genes that render HSV replication defective, but do not reduce HSV neuroinvasiveness. Thus, the HSV vectors are able to traverse the peripheral nervous system to reach neurons in the dorsal root ganglion upon administration to the skin.
(116) HSV genes influence viral characteristics and phenotype. There are at least 9 genes and several non-coding sequences unique to McKrae strain. In addition to those associated with pathogenesis and latency reactivations, such as RL1, RS1, and RL2, three UL genes (UL36, UL49A, UL56) and three US genes (US7, US10, and US1) are unique for McKrae strain. In addition to gene variations, non-coding sequences such as LAT, a sequence, and miRNAs contain variations unique to McKrae.
(117) One or more of following gene and non-coding sequences can be considered characteristic of McKrae strain. In McKrae, RL1 (ICP34.5) has an extended P-A-T repeat between residues 159 and 160 that results in 8 iterations, while other strains contain only 3-5 iterations. The P-A-T repeat is thought to influence cellular localization of the ICP34.5 protein. (Mao & Rosenthal, J. Biol. Chem. 277(13):11423-31 (2012). ICP34.5 is thought to be a neurovirulence factor involved in viral replication and anti-host response.
(118) McKrae strain also contains an extended repeat element of six iterations of the internal tandem repeat STPSTTT (SEQ ID NO: 11) located within the coding sequence of US07 (gI). Additionally in McKrae, UL 36 contains a premature stop codon introduced due to a G nucleotide deletion in a mononucleotide string encoding amino acid residue 2453 (nt 72,535) and UL 56 (180 aa) contains a single base pair insertion at nucleotide 115,992 (amino acid 97). McKrae strain also contains an extended ORF in US10 resulting from a single bp insertion at nucleotide 143,416 and the frameshift causes a stop codon loss in McKrae and a unique C-terminal protein sequence. McKrae has amino acid differences at UL49A at residues 28 and 51 compared to other strains. McKrae has histidine and threonine at residues 28 and 51, respectively, whereas strain 17 has arginine and threonine and other strains (e.g., KOS) have histidine and alanine. Also, McKrae strain contains reduced tandem repeats found at the UL-RI, junction (49 bp in McKrae as opposed to 181 bp in strain 17 and KOS) and approximately 330 nucleotides missing immediately following the UL-RL junction repeat. McKrae also contains unique variation within the a sequence direct repeat 2 (DR2) array. Instead of a series of unbroken tandem repeats, the McKrae DR2 repeats are interrupted twice by identical guanine-rich sequences.
(119) Major variation within the LAT intron between strains is due to differences in a repeat element (GCACCCCCACTCCCAC) (SEQ ID NO: 12) that varies in iteration number beginning at nucleotide 119,482 in McKrae strain, with McKrae containing 13 repeats while strains F, H129 and 17 contain 9 repeats and KOS contains 15 repeats. Also, tandem repeat variation between strains is found beginning in McKrae at base 125,520. McKrae repeat elements include twelve iterations of CCCCAGCCCTCCCCAG (SEQ ID NO: 13) and eight iterations of CCCCTCGCCCCCTCCCG (SEQ ID NO 14). The first repeat unit is unique from other strains in that it contains a G-A transition, and strain McKrae contains three iterations more than any other strain. The McKrae strain second repeat element is collapsed, missing 188 nucleotides relative to all other strains, and separated from the upstream repeat by a 100% conserved sequence of 105 bp containing miR-H5.
(120) McKrae further contains a unique coding sequence for ICP4 that is not found in other known strains. (Watson et al., Virology (2012)). ICP4 is an immediate early transcriptional regulator and has been implicated in reactivation. Whereas other strains contain an alanine rich region (AASAPDAADALAAA) (SEQ ID NO: 15) between residues 707 and 720, in McKrae the alanine rich region is replaced by a serine rich sequence [GPRRSSSSSGVAA] (SEQ ID NO: 16). The serine rich block of substitutions present in McKrae is adjacent to the nuclear localization signal (NLS) (amino acid 728-734). A change in conformation of this region may alter the NLS and in turn affect localization of not only ICP4, but also other viral proteins (e.g. ICP0, ICP8) that are affected by ICP4 localization (Knipe and Smith, 1986). Thus, this region may influence viral phenotype in part by altering the localization of proteins to the nucleus.
(121) Replication Defective McKrae Vector
(122) McKrae Backbone
(123) Viral genes are expressed in a tightly regulated, ordered cascade, which begins with the production of the immediate-early (IE) genes. The resulting IE proteins, which include infected cell proteins ICP0, ICP4, ICP22, ICP27, and ICP47, are responsible for regulating viral gene expression during subsequent phases of the replication cycle. Replication-defective variant viruses are defective for one or more functions that are essential for viral genome replication or synthesis and assembly of viral particles. Such viruses can be propagated in complementing cell lines expressing the missing gene product(s), however, in normal (i.e., non-complementing) cells, the viruses express viral gene products but do not replicate to form progeny virions.
(124) Replication-defective viruses can be created through various methods known in the art for modifying genes. In some embodiments, one or more nucleotides are rendered different relative to the wild-type sequence. In some embodiments, one or more nucleotides are deleted. In some embodiments, the deletion of one or more nucleotides creates a premature stop codon. In some embodiments, the deletion of one or more nucleotides creates a gene encoding a truncated polypeptide. In some embodiments, the deletion of one or more nucleotides creates a gene encoding a nonfunctional polypeptide. In some embodiments, the deletion of one or more nucleotides renders a gene nonfunctional by disruption. In some embodiments, a gene is disrupted by deletion of its promoter.
(125) In some embodiments, one or more genes are deleted to render a virus replication defective. In some embodiments, the gene encoding ICP0 is fully or partially deleted. In some embodiments, the gene encoding ICP4 is fully or partially deleted. In some embodiments, the gene encoding ICP22 is fully or partially deleted. In some embodiments, the gene encoding ICP27 is fully or partially deleted. In some embodiments, the gene encoding ICP47 is fully or partially deleted. In some embodiments, the gene encoding ICP 4 is fully or partially deleted, without disrupting expression of any additional immediate early genes. In some embodiments, the gene encoding ICP4 is fully or partially deleted, and one or more other immediate early (IE) genes are disrupted. In some embodiments, the gene encoding ICP4 is deleted and ICP22 and ICP47 are disrupted.
(126) HSV-1 IE promoters contain one or more copies of an IE-specific regulatory sequence of consensus TAATGARAT (SEQ ID NO: 19) (where R is a purine). These motifs are normally located within a few hundred base pairs of the proximal IE promoter sequences, but in conjunction with their flanking sequences they are discrete functional entities which can confer IE-specific regulation to other proximal promoter elements of different temporal class. In some embodiments, replication-defective viruses are created by deleting nucleotides in an IE-specific regulatory sequence. In some embodiments, an TE-specific regulatory sequence contains an internal deletion. In some embodiments, an IE-specific regulatory sequence contains a terminal deletion. In some embodiments, an IE-specific regulatory sequence is completely deleted.
(127) A schematic of an exemplary replication defective McKrae strain viral vector is depicted
(128) Payload
(129) Viral vectors in accordance with the present disclosure contain a nucleic acid molecule comprising the payload of the vector. In some embodiments, a payload comprises a nucleic acid molecule that encodes a protein. In some embodiments, a payload comprises a nucleic acid molecule that comprises a sequence complementary to a nucleic acid sequence that encodes a protein. In some embodiments, a payload encodes a nucleic acid molecule that is regulatory. In some embodiments, a payload encodes a small interfering RNA (siRNA) polynucleotide. In some embodiments, a payload encodes a micro RNA (miRNA) polynucleotide.
(130) In some embodiments, the payload is a nucleic acid molecule that encodes a protein that is exogenous to the target tissue or subject to which the vector is administered. In some embodiments, the payload is a nucleic acid molecule that encodes a protein that is endogenous to the target tissue or subject to which the vector is administered. In some embodiments, a nucleic acid molecule is codon optimized. In some embodiments, the payload comprises a neuroptrophin. In some embodiments, the payload comprises a plurality of neurotrophins. In some embodiments, the payload comprises an NT3 polypeptide.
(131) Neuroptrophins
(132) Neurotrophins (NTFs) are a class of small target-derived trophic factor proteins that were initially identified by their ability to prevent programmed cell death of neurons during development. Nerve growth factor (NGF) is an NTF that has been reported to be required for survival of sympathetic peripheral nervous system (PNS) and sensory central nervous system (CNS) neurons during development. In addition to NGF, there exist other NTFs that share approximately 50% amino acid homology with NGF including brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT3), and neurotrophin-4/5 (NT-4). The NTFs bind to two types of post-synaptic receptors; a high affinity (KD=10.sup.11 M) tropomyosin-related tyrosine kinase (irk) receptor and the low affinity (KD=10.sup.9 M) p75.sup.NTR receptor (a member of the tumor necrosis factor receptor family). In the adult, NTFs can promote both neuron cell survival and cell death, aid in the preservation and regrowth of axonal networks, and modulate synapses. These different functions appear to result from the interactions between the pro-form and the processed mature form of the peptides, which are both released from target tissues, with the Irk and/or p75 receptors.
(133) Although studies have reported that systemic treatment with neurotrophins can protect against the progression of peripheral neuropathy from causes such as diabetes, clinical trials using recombinant human NGF failed to effectively treat neuropathy in human subjects. It is believed herein that such studies failed at least in part due to the inability to provide an adequate local target concentration of these short-lived bioactive peptides through systemic delivery. HSV-based gene transfer can provide adequate local concentrations of NTFs directly to peripheral nerves, while sparing potential off site effects by targeted gene delivery and expression.
(134) Neurotrophin 3
(135) Neurotrophin 3 (NT3) is produced by the NTF3 gene. NT3 has been localized to peripheral and central nerves in humans. NT3 is believed to support the survival and differentiation of new and existing neurons. A representative amino acid sequence of human NT3 is:
(136) TABLE-US-00001 (SEQIDNO:20) MSILFYVIFLAYLRGIQGNNMDQRSL PEDSLNSLIIKLIQADILKNKLSKQM VDVKENYQSTLPKAEAPREPERGGPA KSAFQPVIAMDTELLRQQRRYNSPRV LLSDSTPLEPPPLYLMEDYVGSPVVA NRTSRRKRYAEHKSHRGEYSVCDSES LWVTDKSSAIDIRGHQVTVLGEIKTG NSPVKQYFYETRCKEARPVKNGCRGI DDKHWNSQCKTSQTYVRALTSENNKL VGWRWIRIDTSCVCALSRKIGRT.
(137) In humans, an endogenous nucleic acid sequence that encodes NT3 is:
(138) TABLE-US-00002 (SEQIDNO:21) taacacagactcagctgccagagcctgctcttaacacctg tgtttccttttcagatcttacaggtgaacaaggtgatgtc catcttgttttatgtgatatttctcgcttatctccgtggc atccaaggtaacaacatggatcaaaggagtttgccagaag actcgctcaattccctcattattaagctgatccaggcaga tattttgaaaaacaagctctccaagcagatggtggacgtt aaggaaaattaccagagcaccctgcccaaagctgaggctc cccgagagccggagcggggagggcccgccaagtcagcatt ccagccggtgattgcaatggacaccgaactgctgcgacaa cagagacgctacaactcaccgcgggtcctgctgagcgaca gcacccccttggagcccccgcccttgtatctcatggagga ttacgtgggcagccccgtggtggcgaacagaacatcacgg cggaaacggtacgcggagcataagagtcaccgaggggagt actcggtatgtgacagtgagagtctgtgggtgaccgacaa gtcatcggccatcgacattcggggacaccaggtcacggtg ctgggggagatcaaaacgggcaactctcccgtcaaacaat atttttatgaaacgcgatgtaaggaagccaggccggtcaa aaacggttgcaggggtattgatgataaacactggaactct cagtgcaaaacatcccaaacctacgtccgagcactgactt cagagaacaataaactcgtgggctggcggtggatacggat agacacgtcctgtgtgtgtgccttgtcgagaaaaatcgga agaacatgaattggcatctctccccatatataaattatta ctttaaattatatgatatgcatgtagcatataaatgttta tattgtttttatatattataagttgacctttatttattaa acttcagcaaccctacagtatataagcttttttctcaata aaatcagtgtgcttgccttc
(139) In some embodiments, the disclosure provides nucleic acid molecules having a codon optimized sequence for encoding an NT3 polypeptide. In some embodiments, a codon optimized sequence is according to the following nucleic acid sequence (including flanking BamHI restriction sites (ggatcc, (SEQ ID NO: 22)):
(140) TABLE-US-00003 (SEQIDNO:23) GGATCCATGGTCACTTTCGCAACTATTCTGCAGGTCAACAAGGTCATGTCT ATTCTGTTCTATGTCATCTTTCTGGCTTATCTGAGAGGCATTCAGGGGAAC AATATGGACCAGAGAAGCCTGCCAGAAGATTCCCTGAACTCTCTGATCATT AAGCTGATCCAGGCAGACATTCTGAAGAACAAACTGTCAAAGCAGATGGTG GATGTCAAAGAAAATTACCAGAGCACACTGCCAAAGGCAGAGGCTCCACGA GAGCCTGAACGAGGAGGACCAGCAAAATCCGCCTTCCAGCCCGTGATCGCT ATGGACACAGAGCTGCTGCGGCAGCAGCGGAGATATAACTCTCCTAGAGTG CTGCTGTCTGACAGTACTCCACTGGAACCCCCTCCACTGTACCTGATGGAG GATTATGTGGGCTCTCCTGTGGTCGCTAATCGCACCAGTAGGCGCAAGCGA TACGCAGAGCACAAAAGCCATCGAGGGGAATATTCCGTGTGCGATTCAGAG AGCCTGTGGGTCACAGACAAGAGCTCCGCCATCGATATTCGOGGACACCAA GTGACTGTCCTGGGGGAAATCAAGACCGGAAATAGTCCCGTGAAACAGTAC TTTTATGAGACTAGATGCAAGGAAGCCAGGCCTGTCAAAAACGGATGTCGG GGCATTGACGATAAGCATTGGAATAGTCAGTGTAAAACCTCACAGACATAC GTGAGGGCTCTGACCAGCGAGAACAACAAGCTGGTCGGCTGGCGCTGGATT AGAATTGACACTAGCTGCGTCTGCGCCCTGAGTAGGAAGATTGGAAGAACT TAAATTGGCATCTCTGGATCC
(141) In some embodiments, a codon optimized sequence is according to the following nucleic acid sequence (including a 43 bp leader sequence
(142) TABLE-US-00004 (SEQIDNO:24): GCGGAGGACTCTGGACAGTAGAGGCCCCGGGACGACCGAGCTG, (SEQIDNO:25) CGCGGATCCGCGGAGGACTCTGGACAGTAGAGGCCCCGGGACGACCGAGCT GATGGTCACCTTTGCCACCATCCTGCAAGTGAACAAAGTGATGAGCATCCT GTTCTACGTGATCTTCCTGGCCTACCTGCGGGGCATCCAGGGCAACAACAT GGACCAGAGAAGCCTGCCCGAGGACAGCCTGAACTCCCTGATCATCAAGCT GATCCAGGCCGACATCCTGAAGAACAAGCTGAGCAAGCAGATGGTGGACGT GAAAGAGAACTACCAGAGCACCCTGCCCAAGGCCGAGGCCCCTAGAGAACC TGAAAGAGGCGGCCCTGCCAAGAGCGCCTTCCAGCCTGTGATCGCCATGGA TACCGAGCTGCTGAGACAGCAGCGGCGGTACAACAGCCCCAGAGTGCTGCT GAGCGACAGCACCCCTCTGGAACCTCCCCCCCTGTACCTGATGGAAGATTA CGTGGGCAGCCCCGTGGTGGCCAACCGGACCAGCAGAAGAAAGAGATACGC CGAGCACAAGAGCCACCGGGGCGAGTACAGCGTGTGCGATAGCGAGAGCCT GTGGGTCACCGACAAGAGCAGCGCCATCGACATCAGAGGCCACCAAGTGAC CGTGCTGGGCGAGATCAAGACCGGCAACTCCCCCGTGAAGCAGTACTTCTA CGAGACACGGTGCAAAGAGGCCAGACCCGTGAAGAACGGCTGCCGGGGCAT CGACGACAAGCACTGGAACAGCCAGTGCAAGACCAGCCAGACCTACGTGCG GGCCCTGACCAGCGAGAACAACAAGCTCGTGGGCTGGCGGTGGATCAGAAT CGACACCAGCTGCGTGTGCGCCCTGAGCCGGAAGATCGGCAGAACATAAGT TTAAACCGCGGGATCCGCGC
(143) Regulatory Elements
(144) The inclusion of non-native regulatory sequences, gene control sequences, promoters, non-coding sequences, introns, or coding sequences in a nucleic acid of the present disclosure is contemplated herein. The inclusion of nucleic acid tags or signaling sequences, or nucleic acids encoding protein tags or protein signaling sequences, is further contemplated herein. Typically, the coding region is operably linked with one or more regulatory nucleic acid components.
(145) A promoter included in a nucleic acid of the present disclosure can be a tissue- or cell type-specific promoter, a promoter specific to multiple tissues or cell types, an organ-specific promoter, a promoter specific to multiple organs, a systemic or ubiquitous promoter, or a nearly systemic or ubiquitous promoter. Promoters having stochastic expression, inducible expression, conditional expression, or otherwise discontinuous, inconstant, or unpredictable expression are also included within the scope of the present disclosure. A promoter of the present disclosure may include any of the above characteristics or other promoter characteristics known in the art.
(146) Examples of known promoters include, but are not limited to, the cytomegalovirus (CMV) promoter CMV/human beta 3 globin promoter GFAP promoter, chicken beta actin (CBA) promoter the 3-glucuronidase (GUSB) promoter and ubiquitin promoters such as those isolated from human ubiquitin A, human ubiquitin B, and human ubiquitin C.
(147) In some embodiments, a promoter is a neuron specific promoter in that it is a promoter having specific expression in neurons, preferential expression in neurons, or that typically drives expression of an associated coding sequence in neurons or a subset of neurons but not in one or more other tissues or cell types. Examples of such promoters include calcitonin gene-related peptide (CGRP), synapsin I (SYN), calcium/calmodulin-dependent protein kinase II, tubulin alpha I, neuron-specific enolase, microtubule-associated protein 1B (MAP1B), and platelet-derived growth factor beta chain promoters, as well as derivatives thereof. In some embodiments, the promoter is a calcitonin gene-related peptide (CGRP) promoter or derivative thereof.
(148) Other regulatory elements may additionally be operatively linked to the payload, such as an enhancer and a polyadenylation site. In some embodiments, an enhancer comprises a human cytomegalovirus (HCMV) sequence. In some embodiments, a polyadenylation site comprises a bovine growth hormone (BGH) polyadenylation signal.
(149) In some embodiments, a promoter is a chimeric of one or more promoters or regulatory elements found in nature. In some embodiments, the viral vectors comprise a payload whose expression is driven by a CGRP promoter with an HCMV enhancer sequence.
(150) Preparation of Vectors
(151) The present disclosure relates particularly to McKrae strain viral vectors that are replication defective. In some embodiments, viral vectors are generated by deletion or disruption of one or more immediate early genes. Viral genes may be deleted or disrupted using methods of recombinant technology known in the art. In some embodiments a viral vector of the present disclosure may be rendered replication defective as a result of a homologous recombination event. In some embodiments, replication defective viral vectors are generated by deletion of an ICP4 gene. In some embodiments, replication defective viral vectors are generated by deletion of an ICP4 gene and deletion of a promoter for one or more other immediate early genes (e.g., ICP22 and/or ICP47).
(152) In some embodiments, viral vectors of the present disclosure are generated by deletion of loci encoding one or more ICPs (e.g., ICP4) through homologous recombination. In some embodiments, generation of a viral vector of the present disclosure includes a step of homologous recombination of a first plasmid with a second plasmid. In some embodiments, the first plasmid contains nucleic acid sequences homologous to regions of an HSV genome that are adjacent to a nucleic acid region of an HSV genome that is intended to be replaced. In some embodiments, the second plasmid contains an HSV genome, or fragment thereof. In some embodiments, the first plasmid contains nucleic acid sequence encoding a polypeptide of interest (e.g., NT3) between the homologous nucleic acid sequences. In some embodiments, the polypeptide of interest may be or include a marker protein that is detectable by fluorescence, chemiluminescence, or other property, which can be used to select for vectors resulting from successful homologous recombination.
(153) In some embodiments, a viral vector of the present disclosure is generated by homologous recombination of a first plasmid containing a nucleic acid sequence homologous to regions upstream of the ICP4 promoter including the viral origin contained within the short inverted repeat regions of HSV, with a second plasmid containing an HSV McKrae strain genome.
(154) In some embodiments, a vector is made by first replacing both copies of the ICP 4 loci by homologous recombination using plasmid SASB3 and screening for green fluorescent protein (GFP)-expressing plaques. In some embodiments, a plasmid is constructed by cloning the Sph I to Afl HIII (Sal I linkere) fragment (1928 bp) of the HSV-1 KOS strain genome (nucleotides 124485-126413) into Sph 1/Sal I digested pSP72 followed by insertion of the 695 bp Bgl II to BamH I fragment (nucleotides 131931 to 132626) containing regions upstream of the ICP4 promoter including the viral origin contained within the short inverted repeat regions into the Bgl H to BamH I sites of the vector plasmid. In some embodiments, a plasmid is constructed by cloning a HCMV-eGFP fragment in the BamHI site of a plasmid as described above. In some embodiments, a plasmid as described above is then recombined into a specific locus of a wild-type McKrae virus. In some embodiments, the resulting vector is isolated using a stable cell line that expresses one or more genes deleted or disrupted in the HSV genome that are required for replication.
(155) Characterization of Vectors
(156) Viral vectors in accordance with the present disclosure can be characterized by genomic sequencing in order to determine if the expected vector was successfully created. Any method of sequencing known in the art is acceptable for this purpose. Methods of sequencing include, for example, nanopore sequencing, single molecule real time sequencing (SMRT), DNA nanoball (DNB) sequencing, pyrosequencing and using DNA arrays.
(157) The expression of a payload from a viral vector can be detected by any method known in the art for detecting proteins or nucleic acids. Methods of detecting protein expression include immunohistochemistry, flow cytometry, Western blotting, enzyme-linked immunosorbent assay (ELISA), immune-electron microscopy, individual protein immunoprecipitation (IP), protein complex immunoprecipitation (Co-IP), chromatin immunoprecipitation (ChIP), RNA immunoprecipitation (RIP), immunoelectrophoresis, spectrophotometry, and bicinchoninic acid assay (BCA). Methods of detecting nucleic acid expression include Southern blotting, Northern blotting, polymerase chain reaction (PCR), quantitative PCR, and RT-PCR.
(158) In some embodiments, the present disclosure provides methods for testing the ability of viral vectors to transduce neurons. In some embodiments, the neurons are peripheral neurons. In some embodiments, the neurons are sensory neurons. In some embodiments, the neurons comprise dorsal root ganglia (DRG).
(159) In some embodiments, a viral vector preparation may be injected into the one or more dermatomes corresponding to a section of DRG for example, the left and right L4, L5, and L6 DRG. DRG are removed are removed and DNA is isolated from the DRG and analyzed for vector genome copies using a qPCR assay that targets a sequence within HSV-1. In some embodiments, a qPCR assay targets a sequence within the HSV-1 glycoprotein (UL-22) gene.
(160) Applications/Uses
(161) Viral vectors in accordance with the present disclosure are useful for a wide variety of therapeutic applications. In some embodiments, vectors as described herein are useful to deliver one or more payloads to one or more target cells. In some embodiments, target cells reside in tissues that are poorly vascularized and difficult to reach by systemic circulation. In some embodiments, target cells are cells susceptible to infection by HSV. In some embodiments, target cells are particularly susceptible to infection by a McKrae strain of HSV. In some embodiments, target cells are or include one or more of neuronal cells. In some embodiments, target cells are dorsal root ganglion (DRG) cells.
(162) Gene Therapy
(163) Viral vectors in accordance with the present disclosure are useful in any context in which gene therapy is contemplated. For example, viral vectors comprising a heterologous nucleic acid segment operably linked to a promoter are useful for any disease or clinical condition associated with reduction or absence of the protein encoded by the heterologous nucleic acid segment, or any disease or clinical condition that can be effectively treated by expression of the encoded protein within the subject. Viral vectors that contain an expression cassette for synthesis of an RNAi agent (e.g., one or more siRNAs or shRNAs) are useful in treating any disease or clinical condition associated with overexpression of a transcript or its encoded protein in a subject, or any disease or clinical condition that may be treated by causing reduction of a transcript or its encoded protein in a subject. Viral vectors that comprise an expression cassette for synthesis of one or more RNAs that self-hybridize or hybridize with each other to form an RNAi agent targeted to a transcript encoding a cytokine may be used to regulate immune system responses (e.g., responses responsible for organ transplant rejection, allergy, autoimmune diseases, inflammation, etc.). Viral vectors that provide a template for synthesis of one or more RNAs that self-hybridize or hybridize with each other to form an RNAi agent targeted to a transcript of an infectious agent or targeted to a cellular transcript whose encoded product is necessary for or contributes to any aspect of the infectious process may be used in the treatment of infectious diseases.
(164) Administration
(165) Compositions comprising viral vectors as described herein may be formulated for delivery by any available route including, but not limited to parenteral (e.g., intravenous), intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, rectal, and vaginal. Preferred routes of delivery include intradermal. In some embodiments, pharmaceutical compositions include a viral vector in combination with a pharmaceutically acceptable carrier. As used herein the language pharmaceutically acceptable carrier includes solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions. In some embodiments, viral vectors are formulated in glycerol. In some embodiments, viral vectors are formulated in approximately 10% glycerol in phosphate buffered saline.
(166) It is advantageous to formulate compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of a viral vector calculated to produce the desired therapeutic effect in association with a pharmaceutical carrier.
(167) The pharmaceutical composition can be administered at various intervals and over different periods of time as required, e.g., one time per week for between about 1 to 10 weeks, between 2 to 8 weeks, between about 3 to 7 weeks, about 4, 5, or 6 weeks, etc. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Treatment of a subject with a viral vector can include a single treatment or, in many cases, can include a series of treatments.
(168) Compositions
(169) In some embodiments, the active agents, i.e., a viral vector of the disclosure and/or other agents to be administered together with a viral vector of the disclosure, are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such compositions will be apparent to those skilled in the art. In some embodiments the composition is targeted to particular cell types or to cells that are infected by a virus.
(170) Combination Therapy
(171) According to the present disclosure, provided compositions may be administered in combination with one or more other active agents and/or therapeutic modalities, such as known therapeutic agents and/or independently active biologically active agents. In some embodiments, provided compositions include one or more such other active agents; in some embodiments, such other active agents are provided as part of distinct compositions. In some embodiments, combination therapy involves simultaneous administration of one or more doses or units of two or more different active agents and/or therapeutic modalities; in some embodiments, combination therapy involves simultaneous exposure to two or more different active agents and/or therapeutic modalities, for example through overlapping dosing regimens.
(172) In some embodiments, provided compositions include or are administered in combination with one or more other active agents useful for the treatment of the relevant disease, disorder and/or condition. In some embodiments, provided compositions are administered in combination with (e.g., prior to, simultaneously with, and/or subsequently to) chemotherapeutics.
EXAMPLES
Example 1: Preparation of Vectors
(173) This example describes methods of preparing and formulating exemplary vectors for gene therapy.
(174) Genetic Structure of Vector
(175) A vector is made by first replacing both copies of the ICP4 loci by homologous recombination using a plasmid and screening for marker element expressing plaques. A plasmid is constructed by cloning a fragment of a HSV-1 genome comprising regions upstream of the ICP4 promoter including the viral origin contained within the short inverted repeat regions. The plasmid is further modified by cloning a marker element, for example HCMV-eGFP, fragment into the plasmid. This plasmid is then recombined into the ICP4 locus of a wild-type HSV virus. The resulting vector is isolated using a stable ICP4 expressing Vero cell line, such as 6-5C. Vero 6-5C cells are complementing cells that express ICP4.
(176) In order to replace the marker element (e.g., GFP) with a gene of interest (GOI) in the vector described above, a plasmid is constructed by cloning HCMV-GOI-pA into the plasmid. Plaques which do not express the marker element are isolated and tested by ELISA for GOI expression.
(177) Production of Crude Vector
(178) ICP4 complementing Vero cells are cultured in tissue culture flasks using complete media (DMEM supplemented with FBS, HEPES, and Pen Strep) and expanded into 6-12T175 flasks at a seeding density of 3-410.sup.4 cells/cm.sup.2. The culture flasks are incubated at 37 C./7.5% CO.sub.2 for 3-4 days.
(179) When cells are 1-2 days over confluent, they are infected at a multiplicity of infection (MOI) of 0.1 with a virus stock of known concentration. The infection is initiated by removing the culture supernatant from each flask and infecting with complete media containing the appropriate amount of a virus stock. The virus is adsorbed on the cell monolayers by incubating the cultures for 1.5-2 hours, shaking and rotating the flasks every 15-20 minutes. After the adsorption step, an additional complete medium is added to each flask and the cultures are incubated again at 37 C./7.5% CO.sub.2.
(180) Approximately 48 hours after initiating the infection, the flasks are viewed by microscope to confirm cells show signs of cytopathogenic effect and detachment from the flask surface. At that point the cells and supernatant are harvested, pooled together, and centrifuged at 1500g for 10 min. The supernatant is removed from the cell pellet and held separately for later processing.
(181) The cell pellet is resuspended in 4-5 mL of complete media, homogenized, and then frozen at 80 C. After the cell suspension has been frozen for >20 minutes, it is thawed and centrifuged at 1500g for 10 min. This second cell pellet supernatant is removed and combined with the first collected supernatant.
(182) The pooled supernatant is aliquoted into centrifuge tubes. The virus is then centrifuged at 40,000g for 30 minutes at 2-8 C. in order to pellet the virus. After the centrifugation step is completed, the supernatant from the tubes is removed and discarded. The following day the virus pellets are homogenized by pipetting and pooled together. The resuspended virus stock is then aliquoted into cryovials typically at volumes of 120 L per vial. Complete medium (200-300 L) is added to the virus pellets in order to cover them with liquid and are stored at 2-8 C. overnight to loosen the virus particles. The vials are labeled and frozen at 80 C. Later, a frozen vial is thawed in order to perform a virus plaque titration assay to determine the concentration of the prepared virus stock prior to using in any in vivo or in vitro studies.
(183) Manufacture of Clarified Vector
(184) Cell Thaw and Expansion
(185) Vero cells (e.g., Vero 6-5, VeroD cells) from a working cell bank are thawed at 37 C. and transferred to a conical tube and pooled. VeroD cells are complementing cells that express or ICP4, ICP27, and UL55. The cells are vialed at approximately 1.010.sup.7 viable cells/mL/tube. The cells are gradually diluted with complete medium and a sample is removed to obtain viable cell counts. The cells are plated in tissue culture flasks at a density of 3.0-5.010.sup.4 cells/cm.sup.2.
(186) The cells are incubated at 37 C., 7.5% CO.sub.2 and examined periodically by phase microscopy. The cells are passaged while subconfluent. The complete medium is removed, rinsed with PBS, and the cells are dissociated. The flasks are incubated until the cells detach, then they are re-suspended in complete medium, pooled, counted and seeded into new flasks at a density between 1.0-4.010.sup.4 cells/cm.sup.2. The cells are expanded and allowed to extend to 1-2 days post-confluence prior to infection.
(187) Infection with Vector
(188) When the cells reach the desired confluence, a model flask is subcultured and the cells are counted to estimate the number of cells per cell factory. A master virus bank vector inoculum is prepared by thawing the appropriate volume required to obtain a multiplicity of infection (MOI) of 0.1 and diluting the stock with complete medium up to the target volume desired for the infection. The cell factories are infected by an initial adsorption period followed by incubation for the first day of infection in complete medium After approximately 24 hours, the culture medium is removed and replaced with an equal volume of serum-free medium. The cell factories are placed in the incubator and the temperature is reduced to 33 C./with 7.5% CO.sub.2. The cultures are monitored daily and the percent cytopathic effect estimated by visual inspection.
(189) Crude Viral Harvest and Clarification
(190) The infection is stopped by placing the cell factories in a biosafety cabinet and pooling the supernatant and cell debris into a sterile bag. This bulk unclarified harvest is sampled for adventitious agents. After sampling, the sodium chloride level of the harvest is increased and then it is mixed. The harvest is then aliquoted into centrifuge tubes and the cell debris removed by centrifugation. The supernatant is pooled into a sterile bag. After pre-treatment of a clarification filter capsule with sterile water, the virus-containing supernatant is then pumped through the filter capsule into another sterile bag, followed by sterile water to recover remaining virus in the capsule. The bag is mixed and the filtrate is stored overnight at 4 C.
(191) Afterwards, the filtrate is warmed and adjusted to 2 mM MgCl.sub.2 by addition of 2 volumes of 3 mM MgCl.sub.2 in sterile water. The diluted filtrate is mixed and treated with an endonuclease.
(192) Cation Exchange Column Chromatography
(193) A BPG 400 column is packed with SP high performance resin, sanitized with 0.5N NaOH and equilibrated with wash buffer (PBS pH 7.0) and strip buffer (1M NaCl-PBS pH 7.0) before loading endonuclease treated virus.
(194) The process bag containing the endonuclease-treated filtrate is connected to the inlet using a tubing welder and the virus is loaded onto the column. The flow through is collected in a sterile bag. The virus capture step is followed by washing with PBS until the UV absorbance returns to baseline. The pump is stopped and a process bag containing 0.45 M NaCl-PBS (pH 7.0) is connected to the inlet. The outlet tubing is transferred to a sterile container in a biosafety cabinet. The buffer is pumped into the column and when the UV absorbance begins to increase sharply, the column outlet is transferred to a new sterile container to collect the eluted virus. The collection is stopped after the UV absorbance returns to near baseline. This is the purified viral elute fraction. A process bag containing strip buffer is connected to the inlet and the end of the outlet tubing is transferred into a sterile bottle to collect the strip fraction. The buffer is pumped through the column until UV absorbance reaches a peak and returns to near baseline. The collected elute is stored at 4 C. overnight.
(195) Tangential Flow Filtration
(196) The tangential-flow filtration system, using a 0.1 micrometer pore size hollow fiber filter cartridge is prepared by assembling the tubing and cartridge and sterilizing the system by autoclaving. The system is flushed with sterile PBS (pH 7.0) and the virus eluate fraction is added to the system reservoir and equilibrated by recirculation. After equilibration, the permeate collection pump is turned on and filtrate is collected. The system is run until the loaded volume is reduced to approximately 500 ml. The retentate in the reservoir is diluted with DPBS (pH 7.0) with continuous constant volume diafiltration, and the product in the retentate is recovered when the permeate conductivity is within 10% of the diafiltering buffer (DPBS pH 7.0).
(197) Formulation, Final Filtration and Packaging
(198) The recovered retentate is adjusted to 10% final volume with sterile glycerol and mixed well prior to filtering through a 0.45 m disc filter unit. The product is dispensed into labeled cryovials for storage at 65 C.
Example 2: Prevention of CIPN (Paclitaxel) with Vector Comprising NT3
(199) This example shows exemplary data for the prevention of CIPN caused by paclitaxel with a McKrae strain HSV vector comprising NT3. A replication-defective HSV-1 vector as described above was injected into the footpad of rats. As shown in
Example 3: Prevention of CIPN (Paclitaxel) with Vector Comprising NT3
(200) This example shows exemplary data for the prevention of CIPN caused by paclitaxel with a McKrae strain HSV vector comprising NT3.
(201) Taxanes (paclitaxel, docetaxel, cabazitaxel) are a group of antineoplastic drugs derived from yew trees (Taxus sp.) that are commonly used for the treatment of a wide variety of cancers. The mechanisms by which taxanes work are distinct from the platin drugs. Taxanes are plant alkaloids that stabilize microtubules by inhibiting the depolymerization of tubulin resulting in large and dysfunctional microtubules. Microtubules are essential for cell division, thus taxanes are potent mitotic inhibitors. Vincristine, another plant alkaloid derived neoplastic drug, inhibits mitosis by impeding the assembly of microtubules. Apart from their role in mitosis, microtubules are also necessary for axonal transport in neurons, thus chemotherapeutic agents, such as the taxanes, which interfere with the proper functioning of microtubules, cause neuropathy by interfering with normal axonal transport.
(202) Four groups of animals were treated with a replication-defective HSV-1 vector or vehicle control prior to receiving paclitaxel. Administration of the vector or vehicle control was injected into the footpad of rats. Animals treated with a replication-defective HSV-1 vector were administered a KOS strain vector comprising NT3, a McKrae strain vector comprising NT3 or a McKrae strain vector comprising green fluorescent protein (GFP). As shown in
(203) In another study, animals were administered a replication-defective HSV-1 vector comprising either NT3 or GFP, and then were administered multiple dosings of paclitaxel or vehicle. As shown in
(204) In another study, female BALB/c mice were injected subcutaneously into the plantar surface of both hind paws with 25 l containing 110.sup.10 PFU/mL of either a NT3 vector or a GFP vector. Three days following vector inoculation the mice began paclitaxel treatment consisting of 30 mg/kg paclitaxel intraperitoneally (i.p.) three times per week for two weeks (M-W-F, M-W-F). On days 3, 10, 24, 41, 61, and 116 following the final paclitaxel dose, neuropathy was assessed by NCS.
(205) As shown in
Example 4: Dose-Down Study for Protection Against Paclitaxel-Induced Peripheral Neuropathy
(206) This example shows exemplary data for determining the lowest effective dose of a replication-defective McKrae strain HSV-1 vector to protect against paclitaxel-induced peripheral neuropathy.
(207) Five groups of mice (N=6) were injected with a replication-defective McKrae strain HSV-1 vector in doses ranging from 510.sup.4 to 510.sup.8 total PFU. Three days later the mice began paclitaxel treatments. At 24 days post paclitaxel, nerve conduction analysis was performed on these mice and the results compared to a group of mice that received a GFP vector (510.sup.8 total PFU) and intact control mice that received vehicle injections.
(208) As shown in
Example 5: Analysis of Expression of Payload after Treatment with Paclitaxel
(209) This example shows exemplary data for the expression of transcripts relative to the number of HSV-1 genomes after administration of a replication-defective HSV-1 vector and paclitaxel. As shown in
(210) The same experiment was also performed with animals that were administered paclitaxel and a replication-defective HSV-1 vector comprising GFP. As shown in
Example 6: Analysis of Expression of Payload after Treatment with Vincristine
(211) This example shows exemplary data for the expression of transcripts relative to the number of HSV-1 genomes after administration of a replication-defective HSV-1 vector and vincristine. As shown in
(212) The same experiment was also performed with animals that were administered vincristine and a replication-defective HSV-1 vector comprising GFP. As shown in
Example 7: Prevention of CIPN (Oxaliplatin) with Vector Comprising NT3
(213) This example shows exemplary data for the prevention of CIPN caused by oxaliplatin with a HSV vector comprising NT3.
(214) The cytotoxicity of oxaliplatin, like other platinum compounds (cisplatin, carboplatin), is thought to result from inhibition of DNA synthesis in cells. In particular, oxaliplatin forms both inter- and intra-strand cross links in DNA, which prevent DNA replication and transcription, causing cell death. Oxaliplatin is used for treatment of colorectal cancer, typically along with folinic acid and 5-fluorouracil in a combination known as FOLFOX. Both an acute and a persistent neuropathy can occur with oxaliplatin use. The acute, reversible neuropathy (e.g., acute transient paresthesia, dysesthesia, and hypoesthesia in hands, feet, perioral area, or throat, jaw spasm, abnormal tongue sensation, dysarthria, ocular pain, a feeling of chest pressure) may occur within hours or 1-2 days following oxaliplatin administration and generally resolves within 14 days; it frequently recurs with further administration of the drug. A persistent sensory neuropathy (e.g., paresthesias, dysesthesias, hypoesthesias, impaired proprioception) can occur without any prior acute neuropathic event and typically persists for weeks to months following oxaliplatin administration.
(215) Female BALB/c mice were injected subcutaneously into the plantar surface of both hind paws with 25 l containing 110.sup.10 PFU/mL of either a NT3 vector or a GFP vector. Three days following vector inoculation the mice began oxaliplatin treatment consisting of 3.5 mg/kg oxaliplatin (i.v.) biweekly for six weeks. On days 3, 17, 35, 41, 56, and 111 days following the final oxaliplatin dose, neuropathy was assessed by NCS.
(216) As shown in
Example 8: Prevention of CIPN (Bortezomib) with Vector Comprising NT3
(217) This example shows exemplary data for the prevention of CIPN caused by bortezomib with a HSV vector comprising NT3.
(218) Bortezomib is FDA approved drug in a class of anticancer agents known as proteasome inhibitors. The cytotoxicity of these compounds is likely due to the disruption of critical cell signaling pathways, such as cell cycle regulation and gene transcription leading to cell cycle arrest and apoptosis. Bortezomib is usually used in the treatment of multiple myeloma and recurrent mantle cell lymphoma, though is also used for solid tumors. Like the taxanes and platins, the major clinically significant dose-limiting side effect is peripheral neuropathy, which is characterized by numbness and tingling that occurs in a distal stocking-and-glove pattern. Severe neuropathic pain frequently develops after the first treatment cycle.
(219) Female BALB/c mice were injected subcutaneously into the plantar surface of both hind paws with 25 l containing 110.sup.10 PFU/mL of either a NT3 vector or a GFP vector. Three days following vector inoculation the mice began bortezomib treatment consisting of 0.8 mg/kg bortezomib (in 5%/5%/90% ethanol/tween80/saline) (i.v.) biweekly for four weeks. On days 12 and 26 days following the final bortezomib dose neuropathy was assessed by NCS.
(220) As shown in
Example 9: HSV McKrae Strain Vector Expressing NT3 (NET-NT3) Clinical Trial
(221) A Phase I/II randomized, double-blind, placebo-controlled clinical trial of NET-NT3 is performed. NET-NT3 is a replication defective HSV vector expressing human NT-3 for the prevention or treatment of chemotherapy induced peripheral neuropathy (CIPN). The population for the proposed clinical trial is composed of breast cancer patients who are scheduled to receive 12 weekly doses of adjuvant paclitaxel treatment.
(222) The clinical trial includes an escalating dose, randomized, double-blind, placebo-controlled experiment evaluating the safety and efficacy of intradermal administration of NET-NT3 to prevent chemotherapy-induced peripheral neuropathy in patients treated with paclitaxel in the adjuvant setting for breast cancer.
(223) Within 28 days following a screening visit, subjects that meet all inclusion and exclusion criteria will be scheduled to receive NET-NT3 or placebo delivered as a series of approximately 10 intradermal injections on one leg below the knee and 10 injections below the elbow and on the back of the hand for the Phase I/II study on Day 0. NET-NT3 dosing will be scheduled to occur 3-14 days before initiation of chemotherapy. After 2 hours of observation in the clinical research center following dosing, after Day 0 post-dosing assessments, subjects will be discharged. Subjects that receive adjuvant paclitaxel (weekly for 12 weeks) will be followed every two weeks for 16 weeks and then a safety follow up visit at 28 weeks post dosing.
(224) Primary objectives include:
(225) (1) Evaluation of the safety of NET-NT3 delivered intradermally in three escalating dose cohorts, 210.sup.8, 210.sup.9, and 210.sup.10 plaque forming units (PFU), in subjects scheduled to receive adjuvant paclitaxel for breast cancer; and
(226) (2) Determination of the efficacy of CIPN prevention of NET-NT3 vs. placebo in subjects scheduled to receive adjuvant paclitaxel for breast cancer. Efficacy measurements will include sensory nerve action potential and nerve conduction velocities, clinical total neuropathy score (TNSc), and EORTC-CIPN20.
(227) A primary efficacy variable is a change in sensory nerve action potential (sural and ulnar) between baseline and end of adjuvant paclitaxel treatment visit on week 12.
(228) Secondary objectives include: (1) Evaluation of improvement in general and disease-related quality of life (NCI-CTC and ECOG) scores of NET-NT3 vs. placebo; and (2) Evaluation of the total dose of paclitaxel received in subjects that received NET-NT3 vs. placebo.
(229) Secondary efficacy variables include: (1) EORTC CIPN20 between baseline each biweekly visit up to week 12; (2) Changes in the average EORTC CIPN20 at the 4 weeks post chemotherapy dosing visit. Paclitaxel: 16 weeks; (3) Changes in the average EORTC CIPN20 at the safety follow-up visit. Paclitaxel: 28 weeks; (4) Differences in the average development of neuropathy, as measured by the Total Neuropathy Score (TNS) from baseline compared to week 12 for paclitaxel subjects; (5) Change in sural and ulnar nerve conduction velocity between baseline and end of chemotherapy treatment at week 12 for paclitaxel subjects; (6) Changes in the average TNS at the 4 weeks post chemotherapy dosing visit. Paclitaxel: 16 weeks; (7) Changes in the average TNS at the safety follow-up visit. Paclitaxel: 28 weeks; (8) Changes in the National Cancer Institute-Common Toxicity Criteria (NCI-CTC) in subjects that received NET-NT3 vs. placebo at each visit; (9) Eastern Cooperative Oncology Group (ECOG) scores in subjects that received NET-NT3 vs. placebo at each visit; and (10) Cumulative total dose of chemotherapy for paclitaxel subjects between Day 0 and the 16 week visit.
(230) Safety variables include: (1) Physical examination including a neurological exam (sharp, warm, and vibratory sensations, and deep tendon reflexes); (2) Adverse events (AEs); (3) Serious Adverse Events (SAEs); (4) Vital signs; and (5) Clinical laboratory results.
(231) Dosage and Administration:
(232) NET-NT3 will be delivered at doses of 210.sup.8 PFU, 210.sup.9 PFU, and 210.sup.10 PFU (total dose per subject) in 2.0 milliliters. The drug will be injected intradermally into approximately 20 sites made up of 10 sites distributed over the skin surface below one knee and 10 sites on the back of the ipsilateral hand. If all of the first three doses show a similar level of efficacy a fourth dose cohort will be added (210.sup.7 PFU) with the same number of patients and study performance.
(233) The study is designed to dose three subjects at each dose level in order to assess safety. After one month of safety data has been collected for each patient within the dose cohort it will be determined if the study should advance to the next dose level. Once a dose level has been approved an additional 23 subjects will be recruited at that dose level. Of the 23 subjects 17 will be administered the same dose as the safety cohort and six subject will receive placebo. This dosing regimen will be completed for the three dose levels unless a dose level is not approved for advancement.
(234) The order of dosing will begin with three subjects in the 210.sup.8 cohort that will comprise the first dose and will advance until either the maximum tolerated dose (MTD) or the highest dose level (210.sup.10 PFU) is attained. There will be a one month review period after each cohort is filled in order to assess safety before a DSMB will be asked to approve escalation to the next dose level. In order to confirm that the dose chosen for the Phase II is the minimum effective dose an extra 17 subjects will be dosed at each dosing level after the one month safety review is complete for that dose. Precedence for treatment in the study will be given to the three subjects in each dose group before the extra 17 subjects are dosed. Assuming a DLT does not occur the dosing of the three subject safety cohorts and the expansion cohorts will be performed as follows.
(235) 1. At the start of the study three subjects will be dosed with 210.sup.8 PFU and no further treatment will be administered until those three subjects have completed one month post-dosing.
(236) 2. Once the DSMB has reviewed the safety data and given an approval to advance to the next dose three subjects will be dosed with 210.sup.9 PFU. While the one month follow-up period for the 210.sup.9 PFU cohort is underway additional subjects will be treated with 210.sup.8 PFU until the DSMB has reviewed the 210.sup.9 PFU cohort data.
(237) 3. Once the DSMB has given approval to advance three subjects will be dosed at 210.sup.10 PFU for the final cohort. While the one month follow-up period for the 210.sup.10 PFU is underway additional subjects will be treated with 210.sup.8 PFU until the expansion cohort is filled and then additional subjects will be treated with 210.sup.9 until that cohort is filled.
(238) 4. After the safety follow-up period for the three subject 210.sup.10 PFU cohort is completed any remaining subjects that are needed to complete the 17 subject expansion group for the 210.sup.8, 210.sup.9, or 210.sup.10 PFU dose level will be recruited.
(239) In the event that all doses are equally effective in preventing CIPN a fourth dose cohort of 210.sup.7 PFU will be added and study performance for the fourth cohort will be the same as the previous three cohorts.
(240) TABLE-US-00005 Safety Expansion Dose Cohort Cohort 2 10.sup.8 PFU total 3 subjects 17 subjects (1 10.sup.8 on one hand, 1 10.sup.8 on one foot) 2 10.sup.9 PFU total 3 subjects 17 subjects (1 10.sup.9 on one hand, 1 10.sup.9 on one foot) 2 10.sup.10 PFU total 3 subjects 17 subjects (1 10.sup.11 on one hand, 1 10.sup.10 on one foot)
Rules for Dose Escalation in Three Safety Subjects:
(241) There will be a minimum one-month observation period from the end of dosing in one dose cohort before initiation of dosing in a subsequent cohort. Dosing will advance until either the maximum tolerated dose (MTD) is attained or the highest dose is reached. The MTD is defined as the highest dose with NET-NT3 treated subjects having dose limiting toxicity (DLT). A DLT is defined as a probable or definite active NET-NT3 treatment-related grade 2 or higher adverse event. With respect to the three subjects in each cohort that will be assessed to allow advancement to the next higher dose the following rules shall apply.
(242) Dose escalation to the next higher dose, de-escalation to the previous lower dose, or additional testing at the current dose will be based upon the following rules: 1. If 0 of the 3 NET-NT3 treated subjects in the cohort have a DLT, escalate to the next higher dose cohort of 3 active NET-NT3 subjects. 2. If 1 or more of the 3 subjects have DLTs, enroll 3 more subjects at the same dose: a. If <2 of the 6 NET-NT3 treated subjects in the dosing cohort have DLTs, escalate to the next higher dose; b. If >2 of the 6 NET-NT3 treated subjects have DLTs, de-escalate to previous dose; 3. If de-escalation is indicated at the lowest dose level, the study will be discontinued and a new protocol will be submitted to test a lower dose range.
(243) Subjects who drop out prior to the Day 28 visit for reasons other than toxicity will be replaced.
EQUIVALENTS
(244) Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the following claims: