TRAIL-SECRETING MESENCHYMAL STEM CELLS AND USE THEREOF TO TREAT BRAIN TUMORS

Abstract

The invention relates to the field of genetic recombination and stein cell application. In particular, the invention provides a construct for expressing a soluble fragment of a secretory TRAIL, and a lentiviral expression vector comprising the construct. The present invention also provides a mesenchymal stein cell in which the construct is integrated into the genome, which can express and secrete the TRAIL fragment. The invention also provides the use of the construct or vector or mesenchymal stein cells for the treatment of brain tumors.

Claims

1. An isolated construct, wherein the construct comprises (1) a secretory signal peptide encoding region; (2) a TRAIL trimer stabilizing structure encoding region; and (3) a TRAIL fragment encoding region, wherein the TRAIL fragment has an amino acid sequence identical or substantially identical to the amino acid sequence of (a) or (b) below: (a) amino acid residues 114 to 281 of TRAIL; (b) having at least 90% identity with the amino acid sequence of (a), and having TRAIL activity.

2. The construct of claim 1, wherein the secretory signal peptide is a human fibrillin secretory signal peptide, a human growth hormone secretory signal peptide, a human immunoglobulin signal peptide, or a human interleukin 2 signal peptide.

3. The construct of claim 1, wherein the TRAIL trimer stabilizing structure encoding region is an isoleucine zipper structure or a leucine zipper structure.

4. The construct of claim 1, wherein the TRAIL fragment encoding region has the sequence of SEQ ID NO:1.

5. The construct of claim 1, which has the sequence of SEQ ID NO:4.

6. A vector comprising the construct of claim 1, wherein the vector is an animal cell expression vector.

7. A mammalian cell whose genome is integrated with the construct of claim 1 and which expresses and secretes the TRAIL or a fragment thereof.

8. The mammalian cell of claim 7, which is a mesenchymal stem cell, a bone marrow mesenchymal stem cell, or a fat mesenchymal stem cell.

9. The mammalian cell of claim 7, which is prepared by the method described below: a. providing a construct according to claim 1; b. Preparing a vector comprising the construct, wherein the vector is an animal cell expression vector; c. Infecting a mammalian cell with the vector.

10. A pharmaceutical composition for treating a brain tumor, such as a glioma, which comprises the construct of claim 1 or the vector of claim 6 or the mammalian cell of claim 7.

11. Use of the construct of claim 1 or the vector of claim 6 or the mammalian cell of claim 7 or the pharmaceutical composition of claim 10 for treating a brain tumor.

12. Use of the construct of claim 1 or the vector of claim 6 or the mammalian cell of claim 7 or the pharmaceutical composition of claim 10 in the manufacturing of a medicament for treating a brain tumor.

13. The construct of claim 2, wherein the secretory signal peptide is a human fibrillin secretory signal peptide and has the sequence of SEQ ID NO: 2.

14. The construct of claim 3, wherein the TRAIL trimer stabilizing structure encoding region has the sequence of SEQ ID NO: 3.

15. The vector of claim 6, wherein the vector is a lentiviral vector.

16. A mammalian cell of claim 7, wherein said mammalian cell is a stem cell of human, mouse, rat, pig or monkey.

17. A mammalian cell of claim 8, wherein said mammalian cell is an umbilical cord mesenchymal stem cell.

18. Use of claim 11, wherein said brain tumor is a glioma.

19. Use of claim 12, wherein said brain tumor is a glioma.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0037] FIG. 1 is an agarose gel electrophoresis pattern of a secretory TRAIL soluble fragment encoding gene recovered after double-enzyme digestion. On the right is the DNA band of interest, and on the left is Invitrogen's 1 Kb Plus DNA ladder molecular marker. The target nucleic acid fragment is approximately 711 bps.

[0038] FIG. 2 Electrophoresis map of lentiviral expression vector pCDH plasmid DNA recovered after double enzymes digestion. On the left is the DNA band of interest, and on the right is the Invitrogen 1 Kb Plus DNA ladder molecular marker. The target nucleic acid fragment is approximately 8,000 bps.

[0039] FIG. 3. Fluorescence micrograph of HEK293 cells co-transfected with lentivirus-package plasmids for 48 hours. GFP is a photo under fluorescence, Light is a white light photo in the same field of view, and Merge is an integrated photo of two fields of view.

[0040] FIG. 4. Fluorescence and white light micrographs of MSC cells infected with lentiviral particles. GFP is a photo under fluorescence, Light is a white light photo in the same field of view, and Merge is an integrated photo of two fields of view.

[0041] FIG. 5 shows an ELISA standard curve for detecting TRAIL. The abscissa is the absorbance at 450 nm and the ordinate is the TRAIL standard concentration (pg/ml).

[0042] FIG. 6 MTS assay for the growth inhibition of U87 tumor cells by culture medium supernatant of MSC cells infected with lentivirus.

[0043] FIG. 7. Stability of TRAIL secreted by MSC cells infected with lentiviral vectors.

[0044] FIG. 8 MSC cells infected with lentiviral vectors inhibit U87 solid tumors in mice.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

EXAMPLE 1

Preparation of a Secretory-Type Construct Encoding a Secretory Fragment of TRAIL

[0045] (1) Synthesis of a double-strand nucleotide sequence having a sequence as shown in SEQ ID NO : 4

TABLE-US-00001 SEQIDNO:4: (SEQIDNO:4) tctagagccatgggtcgtcgagggcgtctgctggagatcgccctgggatt taccgtgcattttagcgtcctacacgagccatggggcggacgcccgtatg aaacagatcgaagacaaaattgaggagatccttagcaagatttaccatat agaaaacgagatcgctcgtattaaaaagcttatcggtgaacgtgaattcg tgagagaaagaggtcctcagagagtagcagctcacataactgggaccaga ggaagaagcaacacattgtcttctccaaactccaagaatgaaaaggctct gggccgcaaaataaactcctgggaatcatcaaggagtgggcattcattcc tgagcaacttgcacttgaggaatggtgaactggtcatccatgaaaaaggg attttactacatctattcccaaacatactttcgatttcaggaggaaataa aagaaaacacaaagaacgacaaacaaatggtccaatatatttacaaatac acaagttatcctgaccctatattgttgatgaaaagtgctagaaatagttg ttggtctaaagatgcagaatatggactctattccatctatcaagggggaa tatttgagcttaaggaaaatgacagaatttttgtttctgtaacaaatgag cacttgatagacatggaccatgaagccagttttttcggggccatttttag ttggctaaggatcc.

[0046] Said nucleotide sequence includes a Xba I restriction site sequence: tctaga, a Kozak sequence: gccatgggt,

[0047] and a secretory signal peptide encoding region with the sequence:

TABLE-US-00002 (SEQIDNO:2) cgtcgagggcgtctgctggagatcgccctgggatttaccgtgcttttagc gtcctacacgagccatggggcggacgcc,

[0048] and a trimer stabilizing structure encoding region with the sequence:

TABLE-US-00003 (SEQIDNO:3) cgtatgaaacagatcgaagacaaaattgaggagatccttagcaagattta ccatatagaaaacgagatcgctcgtattaaaaagcttatcggtgaacgt,

[0049] and the TRAIL 114-281 amino acid fragment encoding region with the sequence:

TABLE-US-00004 (SEQIDNO:1) gtgagagaaagaggtcctcagagagtagcagctcacataactgggaccag aggaagaagcaacacattgtcttctccaaactccaagaatgaaaaggctc tgggccgcaaaataaactcctgggaatcatcaaggagtgggcattcattc ctgagcaacttgcacttgaggaatggtgaactggtcatccatgaaaaagg gtttactacatctattcccaaacatactttcgatttcaggaggaaataaa agaaaacacaaagaacgacaaacaaatggtccaatatatttacaaataca caagttatcctgaccctatattgttgatgaaaagtgctagaaatagttgt tggtctaaagatgcagaatatggactctattccatctatcaagggggaat atttgagcttaaggaaaatgacagaatattgatctgtaacaaatgagcac ttgatagacatggaccatgaagccagttttttcggggcctttttagttgg c,

[0050] and a BamH I restriction site sequence: ggatcc.

[0051] (2) double-enzyme digestion of double-strand nucleotide sequence and agarose gel electrophoresis recovery

[0052] The synthesized double-strand DNA molecule was subjected to complete double-enzyme digestion with Xba I and BamH I (NEB Inc.) The digested product was analysis by agarose gel electrophoresis (as shown in FIG. 1). The 711 bp fragment was recovered with a gel-re

[0053] The synthesized double-stranded DNA molecules were fully double-digested with restriction endonucleases Xba I and BamH I (NEB Inc.). The digested products were analyzed by 1% agarose gel electrophoresis (Result shown in FIG. 1). The 711 bp nucleic acid fragment was purified by Qiagen gel recovery kit.

EXAMPLE 2

Preparation of a Secretory-Type Lentiviral Expression Vector pCDH-seTRAIL Encoding Secretory Fragment of TRAIL

[0054] (1) Double digestion of pCDH vector: The pCDH vector plasmid (System Biosciences Catalog: CD513B-1) were fully double-digested with restriction endonucleases Xba I and BamH I (NEB Inc.). The digested products were analyzed by 0.8% agarose gel electrophoresis (Result shown in FIG. 2). The 8000 bp nucleic acid fragment was purified by Qiagen gel recovery kit.

[0055] (2) Ligation and transformation of the digested product: The expression vector pCDH-seTRAIL was constructed by mixing the 711 bps encoding DNA fragment being digested and recovered in Example 1 and the 8,000 bps pCDH plasmid DNA digested with the same enzymes at a molar ratio of 5:1, using T4 DNA ligase (NEB) for ligation overnight at 16 C.

[0056] The ligation product was transformed into E. coli stbls competent cells (stbls competent cells were purchased from Genecopoeia), and the transformation was performed using the method described in F. Osbourne, R. Brent, R E Kingston, D D Moore, J G Seidman, J A Smith K. Straer, Guidelines for Editing Molecular Biology, John Wiley & Sons, New York, 1995, Third Edition, P 39-40. Transformants were achieved after screening with ampicillin resistance.

[0057] (3) Verification of the expression vector pCDH-seTRAIL: the selected positive transformants were cultured and plasmid DNA was extracted using plasmid DNA extraction method according to J. Sambrook, E F Ferric, T. Maniartis, Molecular Cloning: A Laboratory Manual, New York, Cold Spring Harbor Press, 2001, third edition, P 27-30. The vector was subjected to DNA sequencing for confirmation of the correct sequence.

EXAMPLE 3

Packaging and Transfection of Lentiviral Particles Encoding a Secretory Fragment of TRAIL

[0058] (1) Determination of concentration and purity of expression plasmid pCDH-seTRAIL and helper plasmids Using the third generation lentiviral packaging system, in addition to the expression plasmid pCDH-seTRAIL, the packaging plasmid pMDLg/pRRE (purchased from Addgene, Catalog: 12251) , the packaging plasmid pRSV-REV (purchased from Addgene, Catalog: 12253), the shell protein packaging plasmid pMD2G (purchased from Addgene, Catalog: 12259) were also needed to achieve the packaging of the virus particles. The purity and concentration of each plasmid DNA were analyzed using a NanoDrop spectrophotometer. The results are shown in Table 1.

TABLE-US-00005 TABLE 1 Concentration and purity of plasmids. plasmid Conc. (ng/l) OD 260/280 OD 260/230 pCDH-seTRAIL 1573 1.94 2.09 blank plasmid pCDH 1771 1.90 2.13 pMDLg/pRRE 360 1.87 2.27 pRSV-REV 395 1.85 2.15 pMD2G 376 1.98 2.36

[0059] (2) Co-transfection of HEK293 cell line with the plasmids

[0060] Mixing the following (every 15-cm culture plate):

TABLE-US-00006 pMD2G 9 g pMDLg/pRRE 12.5 g pRSV-REV 6.25 g pCDH-seTRAIL/pCDH 32 ug (blank control) 2.5M CaCl.sub.2 125 l 0.1 X TE buffer* 1000 l 2 X HBS.sup.# 1250 l *TE buffer (10 mM Tirs pH 8.0, 1 mM EDTA) .sup.#HBS (280 mM NaCl, 50 mM HEPES, 1.5 mM Na.sub.2HPO.sub.4H.sub.2O, 10 mM KCl, 12 mM Dextrose)

[0061] transfection:

[0062] A. One day before transfection, HEK293 cells (Clontech, Cat. No 632180) were inoculated into a 15-cm cell culture dish, the cell density was controlled to be about 80% on the inoculation day;

[0063] B. Each plasmid, CaCl.sub.2 solution, TE buffer was thoroughly mixed in a 50 ml centrifuge tube, and the mixture was slowly added to another centrifuge tube in which the HBS solution was added;

[0064] C. Mixed at medium speed and added to each cell culture plate; the cells were incubated in a cell culture incubator;

[0065] D. 16 hours after transfection, the medium was carefully aspirated and replaced with DMEM medium containing 10% FBS;

[0066] E. The cells were cultured for 48 hours. The fluorescence signal of the cells was observed by a fluorescence microscope. The result is shown in FIG. 3. FIG. 3 is a fluorescence micrograph of a HEK293 cell line co-transfected with the four plasmids. GFP: a photo under fluorescence, Light: a white light photo in the same field of view, Merge: an integrated photo of two fields of view.

[0067] (3) Virus particle collection

[0068] A. collected the above cell culture supernatant;

[0069] B. Being centrifuged at 800 g for 10 min at 4 C. , collected the supernatant;

[0070] C. The supernatant is passed through a 0.45 m microporous membrane and the filtrate is retained;

[0071] D. For each four volumes of filtrate, add one volume of pre-cooled PEG-it Virus Precipitation Solution (System Biosciences Catalog: LV810A-1), mixed well, standed at 4 C. overnight, centrifuged at 1,500 g 30 min, virus particles precipitation were obtained;

[0072] E. Viral particles were resuspended as virus particle stocks with appropriate amount of TBS solution (800 mg NaCl, 20 mg KCl, 300 mg Tris base in 100 ml deionized water, pH 8.0), dispensed and stored at 80 C.

EXAMPLE 4

Titration of a Lentivirus Expressing Secretory Fragment of TRAIL

[0073] 1. HEK293 cells were seeded in 96-well plates at a density of 4,000 cells per well, and placed in a cell culture incubator overnight;

[0074] 2. Prepared 10-fold gradient dilutions of virus using in DMEM medium (10% FBS) containing 8 g/ml of polybrene to dilute the virus particle stocks;

[0075] 3. Carefully aspirated the medium in the 96-well plate and added each well the medium containing the gradient dilutions of the virus particles. Three Repeats for each concentration treatment group.

[0076] 4. Incubated for 48 hours. HEK293 cells with green fluorescence signal were observed under a fluorescence microscope. The fluorescence signal of the lowest dilution was recorded (Table 2), and the titer of the virus particle stock was calculated as follows:

Titer (TU/l)=1/1010.sup.(n1)

[0077] n is the gradient dilution factor.

TABLE-US-00007 TABLE 2 Fluorescence signal detection result of the titration ( indicates fluorescence, x indicates no fluorescence) dilution factor 1 2 3 4 5 6 7 8 9 10 pCDH-seTRAIL x x pCDH (control) x x

[0078] Calculated from the results as shown in Table 2 and the above formula

[0079] pCDH-seTRAIL lentivirus titration is 110.sup.6 TU/l

[0080] pCDH (blank vector control) lentivirus titration is 110.sup.6 TU/l

EXAMPLE 5

Transfection of Human Mesenchymal Stein Cells with a Lentivirus Expressing Secretory Fragment of TRAIL

[0081] 1. Preparation of umbilical cord-derived human mesenchymal stem cell

[0082] Immediately after the delivery of the fetus, the umbilical cord was cut by routine obstetric ligature method; the umbilical cord was washed with saline, and then disinfected with medical alcohol; and the umbilical cord was placed in the umbilical cord preservation solution at a constant temperature of 2-8 C. The obtained umbilical cord was washed with 0.9% sodium chloride solution and repeated 2 to 3 times to remove blood stains. The entire umbilical cord was immersed in 75% ethanol for sterilization. Washing by sodium chloride solution repeatedly to remove residual ethanol. The umbilical cord was then cut into pieces of about 2 to 5 cm in length with a sterile surgical scissors, and removed congestion and clots in the small blood vessels of the umbilical cord. The white connective tissue between the amniotic membrane and the blood vessel was Wharton's jelly, which was torn off with a gingival sputum and then placed in a sterile dish. An appropriate amount of 0.9% sodium chloride solution was added to wash the colloid. Weighed Wharton's jelly was then cut into tissue pieces of 1 to 4 mm.sup.3 in size with a sterile tissue scissors, and 0.9% sodium chloride solution was added to wash it. The mixture was centrifuged at 800 to 900 g for 5 minutes. According to the weight of the colloid, appropriate medium was added, and the concentration of the tissue pieces was about 04-0.7 g/ml. After making the tissue pieces distributing evenly by pipetting, the tissue pieces were inoculated into a T75 flask, and the medium was added. The culture flask was placed flatly to make the tissue pieces being distributed as evenly as possible at the bottom surface. The flask was placed in a CO.sub.2 incubator of constant temperature for cell culture. The Culture conditions: 37.00.5 C., carbon dioxide volume fraction 5.00.2%.

[0083] The first medium change: the tissue was cultured till the 5th to 7th day and the whole medium was changed. The unattached tissue pieces in the culture flask were combined with the old medium and transferred to a centrifuge tube, centrifuged 800-900 g for 5 min, the supernatant was removed, and the residual tissue pieces after centrifugation were added with the appropriate amount of fresh medium. After making the tissue distributing evenly by pipetting, the solution were inoculated into the original flask, and the medium was added for cell culture. The culture flask was placed flatly to make the tissue pieces being distributed as evenly as possible at the bottom surface. The flask was placed in a CO.sub.2 incubator of constant temperature for continued cell culture.

[0084] The second medium change: the tissue was cultured till the 10th to 13th day and partial of the medium was changed. The flask was slightly tilted and half amount of the old medium was removed, and an equal amount of fresh medium was added. The culture was continued in the CO.sub.2 incubator.

[0085] On the 14th to 18th day of the tissue pieces culture, when the area percentage of the cell clones reaches 70% to 80%, the cell culture was digested and harvested. The medium supernatant was removed and the cells were washed with 0.9% sodium chloride solution. Appropriate amount of digestive enzyme was added to the culture flask until the bottom of the culture flask was immerged. After standing for 1 min, the culture flask was inverted and observed under an microscope. The cells were round, and most of the adherent tissue blocks and cells fell off, and the digestion was then terminated (digestion time was less than 5 min). The cell suspension was transferred into a centrifuge tube, and a small amount of 0.9% sodium chloride solution was used to rinse the bottle wall. The washing liquid was transferred into a centrifuge tube and suspended for 30 seconds, filtered through a 100 m sterile filter, and the filtrate was centrifuged, 300 g, 10 min. The washing supernatant was discarded and the cells were resuspended in 0.9% sodium chloride solution.

[0086] 2. The cell culture was inoculate in cell culture dishes at a cell density of 60%, and incubated in a cell culture incubator overnight;

[0087] 3. Carefully aspirated the medium from the cell culture dish, and carefully added DMEM medium (10% FBS) containing 8 g/ml of polybrene.

[0088] 4. pCDH-seTRAIL- or pCDH- (blank vector control) containing lentivirus were added to the cell culture respectively. The MOI (the ratio of virus TU to the number of target cells) was about 10. The cells were continued for culture for 24 hours in the cell culture incubator;

[0089] 5. Carefully aspirated the medium in the cell culture dish; -MEM medium containing 10% FBS was added to each cell culture dish and continued to culture for 48 hours;

[0090] 6. MSC cells with green fluorescence signals were observed with fluorescence microscopy. Cell culture supernatants were collected. Results were shown in FIG. 4, GFP: a photo under fluorescence, Light: a white light photo in the same field of view, Merge: an integrated photo of two fields of view.

EXAMPLE 6

Activity of MSC Cells Infected By Lentiviral Vector to Express and Secrete TRAIL

[0091] The collected cell culture supernatant was analyzed for the TRAIL content by using Abcam's TRAIL Human ELISA Kit (Catalog: ab46074) according to the kit's instructions. The recombinant human TRAIL provided in the kit was used to provide a standard curve.

[0092] The results of the measurement are shown in FIG. 5:

[0093] The concentration of TRAIL in the supernatant of MSC medium infected with lentivirus pCDH-seTRAIL was approximately 634.93 pg/ml.

[0094] The concentration of TRAIL in the supernatant of MSC medium infected with the control vector lentiviral pCDH was approximately 32.96 pg/ml. This amount is within the test error and the instrument reading background error range.

EXAMPLE 7

Inhibition of Human Glioma Cell Line U87 Cells By MSC Cells Secreting TRAIL

[0095] 1. The collected cell culture supernatant of the MSC infected with the virus particles was centrifuged at 1,000 rpm for 10 minutes to remove the remaining cells, and the supernatant was aspirated as a conditioned medium;

[0096] 2. The conditioned medium was 2-fold concentration gradient diluted with -MEM medium (comprising 10% FBS); medium of concentrations of 1, 0.5, 0.25, and 0.125-fold dilution were prepared;

[0097] 3. Human glioma cell line U87 cells (purchased from ATCC, Cat. No. HTB-14) cultured in -MEM medium containing 10% FBS were seeded in 96-well plates at a density of 3,000 cells per well. Incubated overnight in a cell culture incubator;

[0098] 4. Carefully removed the culture supernatant from each well;

[0099] 5. Added 200 ul of each concentration of conditioned medium to each well, and set a blank control well (-MEM medium containing 10% FBS was added) and continued to culture for 72 hours;

[0100] 6. Added 20 ul of preset MTS solution (Promega) to each well and continued to culture for 3 hours.

[0101] 7. Measured the absorbance of each well using a Thermo Scientific Mulitiskan microplate reader at a wavelength of 490 nm and a reference wavelength of 690 nm;

[0102] 8. Calculated the tumor inhibition rate according to the following formula:

tumor inhibition rate (%)=(blank control absorbance valueconditioned medium treatment absorbance value)/blank control absorbance value100

[0103] The result was shown in FIG. 6: after the lentiviral vector expressing the secretory TRAIL of the present invention infected MSCs, MSCs expressed and secreted a large amount of biologically active TRAIL into the cell culture medium, and significantly inhibited the growth of U87 cells.

EXAMPLE 8

Stability of TRAIL Secreted By MSCs Infected with Lentiviral Vector

[0104] 1. The conditioned medium supernatant of the MSCs infected with the lentivirus pCDH-seTRAIL obtained in Example 6 (the TRAIL concentration in the supernatant was detected as: 634.93 pg/ml) was set as the object of test;

[0105] The conditioned medium supernatant of the MSCs infected with the control vector lentiviral pCDH was set as the first control medium;

[0106] The fresh medium supernatant was set as the second control medium (the concentration of TRAIL in the supernatant was detected to be around 0);

[0107] Commercially available recombinant human rhTRAIL protein (Peprotech, Cat. No. 310-04) was used as reference. The commercially available recombinant human rhTRAIL protein was dissolved in the first control medium and the second control medium, respectively, to a final concentration of 650 pg/ml.

[0108] The conditioned medium of MSCs infected with lentivirus pCDH-seTRAIL, the supernatant of the first control medium in which rhTRAIL was dissolved, and the supernatant of the second control medium in which rhTRAIL was dissolved were placed in a 37 C. warm bath. A small amount of supernatant samples were taken therefrom at different times (0, 3, 6, 12, 24, 48 h) and stored in a refrigerator at 70 C.

[0109] After samples at all time points were collected, the TRAIL content of each sample was determined by the ELISA method mentioned in Example 6.

[0110] The protein content at 0 h of each treatment group was 100%, and the residual rate of TRAIL at each time point of each treatment group was calculated according to the following formula:

Residual rate=(TRAIL concentration at each time point/TRAIL concentration at 0 h time point)100%

[0111] The results are shown in FIG. 7. The results proved that was confirmed that the secretory TRAIL fragment produced and secreted by the MSC cells carrying the lentiviral vector the present invention has higher stability than the commercially available recombinant human rhTRAIL protein.

EXAMPLE 9

Inhibition of Human Glioma Cells in Nude Mice By MSC Cells Secreting TRAIL in an Animal Model

[0112] The experimental animals were male nude mice of 4-6 weeks (BALB/C nude mice, Chinese University of Hong Kong Experimental Animal Center). Breeding under standard experimental conditions: 12 hours light-12 hours dark cycle, free access to water and food.

[0113] MSCs infected with lentivirus pCDH-seTRAIL, MSCs infected with control vector lentivirus pCDH, and human glioma cell line U87 cells were cultured respectively in -MEM medium containing 10% FBS, under 37 C. , 5% CO.sub.2 saturated humidity conditions. Four days after the animals were adapted to the culture environment, U87 cells were injected subcutaneously into nude mice, and each animal was inoculated with U87 cells into two positions, which were the left side of the back and the symmetry site at the right side. The inoculation amount of U87 was 210.sup.6 cells and the injection volume was 100 ul. The entire operation is done in a Bechtop bench. The health status of the mice and the growth of the tumor were monitored after the completion of the inoculation. After all the mice developed obvious solid tumor, 8 mice with similar tumor size on the left and right sides (the diameter of the tumor was about 5 mm using a vernier caliper for measurement) were selected according to the tumor volume of the animals. 210.sup.6 MSCs infected with lentivirus pCDH-seTRAIL were injected into the left tumor, while 210.sup.6 MSCs infected with the vector lentivirus pCDH were injected into the right tumor, and the injection volume were 100 ul. The tumor size was measured with a vernier caliper every 4 days, and the tumor volume was calculated according to the following formula: tumor volume (mm.sup.3)=1/2 ab.sup.2, a is long diameter of the tumor, and b is short diameter of the tumor.

[0114] Data analysis between groups was statistically analyzed using ANOVA statistical methods, and P<0.05 was considered to be significantly different.

[0115] FIG. 8 shows the average tumor volume measurement results of the two groups (volume unit mm.sup.3)

[0116] After injection of lentiviral-infected MSCs, tumor volume began to differentiate between the two groups. The tumor volume of the MSCs injected with lentivirus pCDH-seTRAIL was gradually smaller than that of the control group injected with MSCs infected with the control vector pCDH. And on the 12th day and the 16th day, there was a significant difference (P<0.05). The experimental results demonstrate that the MSC cells of the present invention infected with a lentiviral vector bearing a secretory TRAIL encoding insert have a significant therapeutic effect on human glioma in vivo.

[0117] The inventors of the present invention have unexpectedly found that umbilical cord mesenchymal stein cells prepared by the method of the present invention are effective in inhibiting brain tumors, particularly gliomas, in vivo. One of the reasons for this unexpected discovery is the construct encoding a secretory TRAIL soluble fragment of the present invention and a lentiviral expression vector containing said construct.

[0118] In said construct of the present invention, an amino acid sequence which can promote the formation of a trimer structure of TRAIL is added to the encoding region of the soluble fragment of the TRAIL, which contributes to the stability and activity of the expressed TRAIL soluble fragment. In addition, the secretory TRAIL soluble fragment expression vector of the present invention has a highly efficient secretory signal peptide sequence at the upstream region of the soluble TRAIL fragment encoding sequence, so that the TRAIL fragment cloned downstream can be expressed and secreted into the extracellular medium, which significantly increases the efficiency of protein expression. The stability of the soluble fragment of the produced TRAIL is unexpectedly increased. In particular, by using a lentiviral vector, the insert encoding a soluble fragment of secretory TRAIL can be stably integrated into the genome of a host cell, which is not easily lost, and reduce the risk of insertional tumor formation, thus is more safe and reliable.

[0119] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of biotechnology, organic chemistry, inorganic chemistry, and the like. Other aspects and modifications within the scope of the invention will be apparent to those skilled in the art. Variations and modifications are possible in light of the teachings of the invention and are therefore within the scope of the invention. All patents, patent applications, and scientific papers referred to herein are hereby incorporated by reference.