Methods and Compositions for Controlling Root Lesion Nematodes

20200315181 ยท 2020-10-08

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure provides compositions comprising Root-Lesion Nematode (RLN)-inhibitory Methylobacterium sp., as well as cell-free culture supernatants, fractions, and concentrates obtained from the Root-Lesion Nematode (RLN)-inhibitory Methylobacterium sp. Also provided are related methods for controlling RLN infections of plants, and methods of making the compositions.

    Claims

    1. A method for reducing Pratylenchus sp. damage to a plant that comprises applying a composition comprising a Methylobacterium selected from the group consisting of NLS0934, derivatives thereof, and Methylobacterium related thereto to a plant part to obtain a treated plant part; and growing the plant from said treated plant part in the presence of Pratylenchus sp., wherein Pratylenchus sp. damage to the plant is reduced in comparison to a control plant from a control plant part that is not treated with the Methylobacterium and that is grown in the presence of Pratylenchus sp.

    2. The method of claim 1, wherein the Methylobacterium is present on said treated plant part in an amount of at least about 110.sup.3 colony forming units (CFU) of said Methylobacterium per treated plant part.

    3. The method of claim 1, wherein the NLS0934, derivative is obtained by mutagenizing or transforming Methylobacterium NLS0934.

    4. The method of claim 1, wherein the NLS0934 related Methylobacterium is characterized by having a gene encoding a 16S RNA that has at least 99.9%, or 100% sequence identity across the entire length of SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7, respectively.

    5. The method of claim 1, wherein the Methylobacterium is heterologous to the plant part.

    6.-7. (canceled)

    8. The method of claim 1, wherein the reduction in damage is evidenced by an increase in shoot weight, root weight, or the combination thereof in the plant in comparison to the control plant.

    9. The method of claim 1, wherein the plant part is a seed, leaf, tuber, or root.

    10. The method of claim 1, wherein the Pratylenchus sp. is selected from the group consisting of Pratylenchus brachyurus, Pratylenchus coffeae, P. neglectus, Pratylenchus penetrans, Pratylenchus scribneri, Pratylenchus thornei, Pratylenchus vulnus, and Pratylenchus zeae.

    11. The method of claim 1, wherein the plant part is selected from the group consisting of a Brassica sp. corn, wheat, rye, rice, alfalfa, rye, sorghum, millet, soybean, tobacco, potato, peanut, carrot, cotton, coffee, coconut, pineapple, sugar beet, strawberry, oat, barley, tomato, lettuce, pepper, pea, onion, green bean, and cucurbit plant part.

    12. A plant part that is at least partially coated with a composition comprising a Methylobacterium selected from the group consisting of NLS0934, derivatives thereof, and Methylobacterium related thereto and an agriculturally acceptable excipient and/or an agriculturally acceptable adjuvant, wherein said composition is provided on said plant part in an amount that reduces Pratylenchus sp. damage to a plant grown from the plant part in comparison to a control plant grown from a control plant part that is not treated with the Methylobacterium.

    13. The plant part of claim 12, wherein the amount of Methylobacterium present on said plant part is at least about 110.sup.3 colony forming units (CFU) of said Methylobacterium per plant part.

    14.-16. (canceled)

    17. The plant part of claim 12, wherein the Methylobacterium is heterologous to the seed, tuber, or seedling.

    18.-23. (canceled)

    24. The method of claim 1, wherein the Methylobacterium is grown in a culture comprising a liquid or an emulsion and the method further comprising separating the Methylobacterium from the culture supernatant, thereby obtaining a Pratylenchus-inhibitory cell-free culture supernatant.

    25.-26. (canceled)

    27. The method of claim 24, wherein the culture comprising a liquid or an emulsion further comprises a solid substance.

    28. (canceled)

    29. A method for controlling Root Lesion Nematode (RLN) damage to a plant comprising: (i) applying a composition comprising an RLN-inhibitory Methylobacterium sp. isolate selected from the group consisting of Methylobacterium NLS0934, derivatives thereof, and Methylobacterium related thereto to soil where a plant is growing or will be grown; and, (ii) growing a plant or a plant from seed in soil subjected to the application of the composition and in the presence of RLN, wherein RLN damage sustained by the plant grown in the presence of the RLN is reduced in comparison to a control plant grown in the presence of the RLN.

    30. The method of claim 29, wherein the composition comprises a solid substance with adherent RLN-inhibitory Methylobacterium grown thereon at a titer of about 510.sup.8, 110.sup.9, or 110.sup.10 colony-forming units per gram to about 510.sup.13 colony-forming units of Methylobacterium per gram, wherein the adherent RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0934, derivatives thereof, and Methylobacterium related thereto.

    31. The method of claim 29, wherein the composition comprises the RLN-inhibitory Methylobacterium sp. at a titer of about 110.sup.4 or 110.sup.5 colony-forming units per ml to about 110.sup.9, 110.sup.10, 110.sup.11, 510.sup.11, or 110.sup.12 colony-forming units of Methylobacterium per mL of a liquid or emulsion.

    32. (canceled)

    33. The method claim 29, wherein the composition is applied to the soil by broadcasting the composition, by drenching the soil with the composition, or by depositing the composition in furrow.

    34. The method of claim 33, wherein composition is deposited in furrow and wherein the depositing in furrow is performed prior to placing seed in the furrow, at the same time as placing seed in the furrow, or after placing seed in the furrow.

    35. The method claim 29, wherein the composition further comprises a nematicide that provides for inhibition of RLN growth, motility, and/or reproduction and/or reductions in RLN-mediated plant damage.

    36. The method of claim 35, wherein the nematicide is selected from the group consisting of an organophosphate, biological, and a carbamate nematicide.

    37.-43. (canceled)

    Description

    DESCRIPTION

    Definitions

    [0018] As used herein, the phrases adhered thereto and adherent refer to Methylobacterium that are associated with a solid substance by growing, or having been grown, on a solid substance.

    [0019] As used herein, the phrase agriculturally acceptable adjuvant refers to a substance that enhances the performance of an active agent in a composition for treatment of plants and/or plant parts. In certain compositions, an active agent can comprise a mono-culture or co-culture of Methylobacterium.

    [0020] As used herein, the phrase agriculturally acceptable excipient refers to an essentially inert substance that can be used as a diluent and/or carrier for an active agent in a composition for treatment of plants and/or plant parts. In certain compositions, an active agent can comprise a mono-culture or co-culture of Methylobacterium.

    [0021] As used herein, the term Methylobacterium refers to bacteria that are facultative methylotrophs of the genus Methylobacterium. The term Methylobacterium, as used herein, thus does not encompass species in the genera Methylobacter, Methylomonas, Methylomicrobium, Methylococcus, Methylosinus, Methylocystis, Methylosphaera, Methylocaldum, and Methylocella, which are obligate methanotrophs.

    [0022] As used herein, the phrase control plant refers to a plant that had not received treatment with a RLN-inhibitory Methylobacterium, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, any combination thereof, or composition comprising the same at either the seed or any subsequent stage of the control plant's development. Control plants include, but are not limited to, un-treated plants, plants treated with compositions lacking any RLN-inhibitory agents, non-transgenic plants, transgenic plants having a transgene-conferred RLN resistance trait, and plants treated with, or grown in soil treated with, an insecticidal compound or other agent that can protect a plant from RLN feeding.

    [0023] As used herein, the terms Root Lesion Nematodes and RLN are used interchangeable to refer to the juvenile or adult forms of any nematode of the genus Pratylenchus.

    [0024] As used herein, the phrase co-culture of Methylobacterium refers to a Methylobacterium culture comprising at least two strains of Methylobacterium or at least two species of Methylobacterium.

    [0025] As used herein, the phrase contaminating microorganism refers to microorganisms in a culture, fermentation broth, fermentation broth product, or composition that were not identified prior to introduction into the culture, fermentation broth, fermentation broth product, or composition.

    [0026] As used herein, the phrase derivatives thereof, when used in the context of a Methylobacterium isolate, refers to any strain that is obtained from the Methylobacterium isolate. Derivatives of a Methylobacterium isolate include, but are not limited to, variants of the strain obtained by selection, variants of the strain selected by mutagenesis and selection, and genetically transformed strains obtained from the Methylobacterium isolate.

    [0027] As used herein, the term emulsion refers to a colloidal mixture of two immiscible liquids wherein one liquid is the continuous phase and the other liquid is the dispersed phase. In certain embodiments, the continuous phase is an aqueous liquid and the dispersed phase is liquid that is not miscible, or partially miscible, in the aqueous liquid.

    [0028] As used herein, the phrase essentially free of contaminating microorganisms refers to a culture, fermentation broth, fermentation product, or composition where at least about 95% of the microorganisms present by amount or type in the culture, fermentation broth, fermentation product, or composition are the desired Methylobacterium or other desired microorganisms of pre-determined identity.

    [0029] As used herein, the term heterologous, when used in the context of Methylobacterium, cell-free culture supernatant, fraction thereof, or concentrate thereof that at least partially coats a plant or plant part, refers to a Methylobacterium, cell-free culture supernatant, fraction thereof, or concentrate thereof that is not naturally associated with a plant or plant part of the same species as the plant or plant part that is at least partially coated with the Methylobacterium, cell-free culture supernatant, fraction thereof, or concentrate thereof. In certain embodiments, the heterologous Methylobacterium that is used to at least partially coat a plant or plant part of a first plant species is a Methylobacterium that was isolated, or can be isolated, from a second and distinct plant species. In certain embodiments, the heterologous Methylobacterium cell-free culture supernatant, fraction thereof, or concentrate thereof that is used to at least partially coat a plant or plant part of a first plant species is obtained from a Methylobacterium that was isolated, or can be isolated, from a second and distinct plant species.

    [0030] As used herein, the phrase inanimate solid substance refers to a substance which is insoluble or partially soluble in water or aqueous solutions and which is either non-living or which is not a part of a still-living organism from which it was derived.

    [0031] As used herein, the phrase mono-culture of Methylobacterium refers to a Methylobacterium culture consisting of a single strain of Methylobacterium.

    [0032] As used herein, the phrase partially coated, when used in the context of a composition comprising a RLN-inhibitory Methylobacterium sp. and a plant part (e.g., a seed), refers to a plant part where at least 10%, 20%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the surface area of the plant part is coated with the composition.

    [0033] As used herein, the term peptide refers to any polypeptide of 50 amino acid residues or less.

    [0034] As used herein, the term protein refers to any polypeptide having 51 or more amino acid residues.

    [0035] As used herein, a pesticide refers to an agent that is insecticidal, fungicidal, nematocidal, bacteriocidal, or any combination thereof.

    [0036] As used herein, the phrase bacteriostatic agent refers to agents that inhibit growth of bacteria but do not kill the bacteria.

    [0037] As used herein, the phrase pesticide does not substantially inhibit growth of said Methylobacterium refers to any pesticide that when provided in a composition comprising a fermentation product comprising a solid substance wherein a mono-culture or co-culture of Methylobacterium is adhered thereto, results in no more than a 50% inhibition of Methylobacterium growth when the composition is applied to a plant or plant part in comparison to a composition lacking the pesticide. In certain embodiments, the pesticide results in no more than a 40%, 20%, 10%, 5%, or 1% inhibition of Methylobacterium growth when the composition is applied to a plant or plant part in comparison to a composition lacking the pesticide.

    [0038] As used herein, the term PPFM bacteria refers without limitation to bacterial species in the genus Methylobacterium other than M. nodulans.

    [0039] As used herein, the phrase solid substance refers to a substance which is insoluble or partially soluble in water or aqueous solutions.

    [0040] As used herein, the phrase solid phase that can be suspended therein refers to a solid substance that can be distributed throughout a liquid by agitation.

    [0041] As used herein, the term non-regenerable refers to either a plant part or processed plant product that cannot be regenerated into a whole plant.

    [0042] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.

    RLN-Inhibitory Methylobacterium, Compositions Comprising RLN-Inhibitory Methylobacterium and/or RLN-Inhibitory Cell Free Culture Supernatants, Fractions, or Concentrates Thereof, Methods of their Use, and Methods of Making

    [0043] Various RLN-inhibitory Methylobacterium isolates, compositions comprising these Methylobacterium, and/or RLN-inhibitory cell free culture supernatants, fractions, or concentrates thereof, methods of using the compositions to inhibit RLN growth, motility, or reproduction and/or reduce RLN damage to a plant, and methods of making the compositions are provided herein. As used herein, inhibition of the growth, motility, or reproduction of a RLN includes any measurable decrease in RLN growth, motility, and/or reproduction, where RLN growth, motility, and/or reproduction includes, but is not limited to, any measurable increase in the juvenile weight, any measurable movement, and/or any progression through juvenile development stages or from juvenile to adult development. As used herein, inhibition of RLN growth, motility, and/or reproduction and/or reduction of RLN damage to a plant are also understood to include any measurable decrease in RLN infection and/or the adverse effects or damage caused by RLN feeding on a plant. Adverse effects of RLN infection on a plant include, but are not limited to, deformation and/or reductions in root systems, reductions in top growth, any type of tissue damage or necrosis, increased incidence of fungal or bacterial disease, any type of yield reduction, and/or decreased water-deficit tolerance.

    [0044] Isolated RLN-inhibitory Methylobacterium sp. are provided herein. In certain embodiments, the RLN-inhibitory Methylobacterium isolate is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, NLS0089, derivatives thereof, and Methylobacterium related thereto. In certain embodiments, the RLN-inhibitory Methylobacterium isolate is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0069, and a derivative thereof. In certain embodiments, the RLN-inhibitory Methylobacterium provides for at least about 25%, at least about 50%, or at least about 75% reductions in RLN damage to a treated plant, plant arising from a treated seed, or plant grown in soil treated with the RLN in comparison to untreated control plants, plants arising from untreated seeds, or plants grown in untreated soils upon exposure to a RLN. In certain embodiments, the RLN-inhibitory Methylobacterium provides for increased yield, shoot weight, or root weight in the treated plant, plant part, or a plant derived therefrom relative to an untreated control plant, plant part, or a plant derived therefrom. In certain embodiments, a cell-free culture supernatant or active ingredient contained therein from an RLN-inhibitory Methylobacterium provides for decreased motility or viability of RLN obtained from the treated plant, plant part, or a plant derived therefrom relative to an untreated control plant, plant part, or a plant derived therefrom. In certain embodiments, the RLN-inhibitory Methylobacterium, a cell-free culture supernatant obtained therefrom, or an active ingredient contained in the cell-free culture supernatant provides for increased yield, shoot weight, or root weight in the treated plant, plant part, or a plant derived therefrom relative to an untreated control plant, plant part, or a plant derived therefrom. In certain embodiments, the RLN that is inhibited is selected from the group consisting of a Pratylenchus brachyurus, Pratylenchus coffeae, P. neglectus, Pratylenchus penetrans, Pratylenchus scribneri, Pratylenchus thornei, Pratylenchus vulnus, and Pratylenchus zeae.

    [0045] In certain embodiments, the RLN-inhibitory Methylobacterium, a cell-free culture supernatant obtained therefrom, fraction thereof, concentrate thereof, or an active ingredient contained in the cell-free culture supernatant provides for at least about 25%, at least about 50%, or at least about 75% reductions in RLN motility, viability, growth, and/or reproduction on a treated plant, plant arising from a treated seed, or plant grown in soil treated with the RLN-inhibitory Methylobacterium in comparison to a untreated control plants, plants arising from untreated seeds, or plants grown in untreated soils upon exposure to a RLN. In certain embodiments, the RLN-inhibitory Methylobacterium is a Methylobacterium that inhibits a Pratylenchus sp. is selected from the group consisting of a Pratylenchus brachyurus, Pratylenchus coffeae, P. neglectus, Pratylenchus penetrans, Pratylenchus scribneri, Pratylenchus thornei, Pratylenchus vulnus, and Pratylenchus zeae species. In certain embodiments of any of the aforementioned compositions, the composition comprises a solid substance wherein a mono-culture or co-culture of Methylobacterium is adhered thereto. In certain embodiments where the Methylobacterium is adhered to a solid substance, the composition comprises a colloid formed by the solid substance wherein a mono-culture or co-culture of Methylobacterium is adhered thereto and a liquid. In certain embodiments, the colloid is a gel. In certain embodiments of certain aforementioned compositions, composition is an emulsion that does not contain a solid substance. In certain embodiments of any of the aforementioned compositions, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, NLS0089, derivatives thereof, and Methylobacterium related thereto. In certain embodiments of any of the aforementioned compositions, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0069, and a derivative thereof.

    [0046] In certain embodiments, isolated RLN-inhibitory Methylobacterium sp., a cell-free culture supernatant obtained therefrom, fraction thereof, or concentrate thereof can be identified by treating a plant, a seed, soil in which the plant or a plant arising from the seed are grown, or other plant growth media in which the plant or a plant arising from the seed are grown and assaying for either reductions in RLN damage, RLN growth, RLN reproduction, RLN feeding activity, RLN motility, numbers of recovered RLN, and combinations thereof. In still other embodiments, the RLN-inhibitory Methylobacterium sp., compositions comprising the same, fermentation products comprising the same, cell free culture supernatants therefrom, fractions therefrom, concentrates therefrom, or compounds derived therefrom can be exposed to juvenile RLN and assayed for inhibition of juvenile growth, development, behavior, motility, or feeding activity. Various assays for determining quantity and/or activity of RLN that can be adapted for use in identifying RLN-inhibitory cell-free culture supernatants, fractions therefrom, or concentrates thereof, and RLN-inhibitory Methylobacterium sp. have been disclosed (Hollaway et al. Australasian Plant Pathology, 2003, 32(1):73-79; Kimura et al. Agric. Biol. Chem., 1981, 45 (1), 249-251).

    [0047] In certain embodiments, the RLN-inhibitory Methylobacterium sp. has a 16S RNA encoding sequence that has significant sequence identity to the 16S RNA encoding sequence of a RLN-inhibitory Methylobacterium sp. provided herein. In certain embodiments, the RLN-inhibitory Methylobacterium sp. has a 16S RNA encoding sequence that has at least 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity across the entire length of the 16S RNA encoding sequence of an RLN-inhibitory Methylobacterium sp. isolate NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, or NLS0089. A RLN-inhibitory Methylobacterium sp. that can be used in any of the composition, plants or plant parts that are coated or partially coated with the compositions, methods of using the compositions to control RLN damage to plants, plant parts, and plants derived therefrom, and methods of making the compositions can be RLN-inhibitory Methylobacterium sp. can be at least 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity across the entire length of the 16S RNA encoding sequences of SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7. The 16S RNA encoding sequence of SEQ ID NO: 1-7 are set forth in Table 1.

    TABLE-US-00001 TABLE1 16SRNAencodingsequences Isolate SEQ DNAsequence (NLSNo.) IDNO: encodingthe16SRNA NLS0021 SEQID GAGTTTGATCCTGGCTCAGAGCGAACGCT NO:1 GGCGGCAGGCTTAACACATGCAAGTCGA ACGGGCTTCTTCGGAAGTCAGTGGCAGAC GGGTGAGTAACACGTGGGAACGTGCCCTT CGGTTCGGAATAACTCAGGGAAACTTGA GCTAATACCGGATACGCCCTTATGGGGAA AGGTTTACTGCCGAAGGATCGGCCCGCGT CTGATTAGCTTGTTGGTGGGGTAACGGCC TACCAAGGCGACGATCAGTAGCTGGTCTG AGAGGATGATCAGCCACACTGGGACTGA GACACGGCCCAGACTCCTACGGGAGGCA GCAGTGGGGAATATTGGACAATGGGCGC AAGCCTGATCCAGCCATGCCGCGTGAGTG ATGAAGGCCTTAGGGTTGTAAAGCTCTTT TGTCCGGGACGATAATGACGGTACCGGA AGAATAAGCCCCGGCTAACTTCGTGCCAG CAGCCGCGGTAATACGAAGGGGGCTAGC GTTGCTCGGAATCACTGGGCGTAAAGGGC GCGTAGGCGGCCGATTAAGTCGGGGGTG AAAGCCTGTGGCTCAACCACAGAATTGCC TTCGATACTGGTTGGCTTGAGACCGGAAG AGGACAGCGGAACTGCGAGTGTAGAGGT GAAATTCGTAGATATTCGCAAGAACACCA GTGGCGAAGGCGGCTGTCTGGTCCGGTTC TGACGCTGAGGCGCGAAAGCGTGGGGAG CAAACAGGATTAGATACCCTGGTAGTCCA CGCCGTAAACGATGAATGCCAGCCGTTGG TCTGCTTGCAGGTCAGTGGCGCCGCTAAC GCATTAAGCATTCCGCCTGGGGAGTACGG TCGCAAGATTAAAACTCAAAGGAATTGA CGGGGGCCCGCACAAGCGGTGGAGCATG TGGTTTAATTCGAAGCAACGCGCAGAACC TTACCATCCCTTGACATGGCATGTTACCT CGAGAGATCGGGGATCCTCTTCGGAGGC GTGCACACAGGTGCTGCATGGCTGTCGTC AGCTCGTGTCGTGAGATGTTGGGTTAAGT CCCGCAACGAGCGCAACCCACGTCCTTAG TTGCCATCATTCAGTTGGGCACTCTAGGG AGACTGCCGGTGATAAGCCGCGAGGAAG GTGTGGATGACGTCAAGTCCTCATGGCCC TTACGGGATGGGCTACACACGTGCTACAA TGGCGGTGACAGTGGGACGCGAAACCGC GAGGTTGAGCAAATCCCCAAAAGCCGTCT CAGTTCGGATTGCACTCTGCAACTCGGGT GCATGAAGGCGGAATCGCTAGTAATCGT GGATCAGCACGCCACGGTGAATACGTTCC CGGGCCTTGTACACACCGCCCGTCACACC ATGGGAGTTGGTCTTACCCGACGGCGCTG CGCCAACCGCAAGGGGGCAGGCGACCAC GGTAGGGTCAGCGACTGGGGTGAAGTCG TAACAAGGTAGCCGTAGGGGAACCTGCG GCTGGATCACCT NLS0038 SEQID GGTGATCCAGCCGCAGGTTCCCCTACGGC NO:2 TACCTTGTTACGACTTCACCCCAGTCGCT GACCCTACCGTGGTCGCCTGCCTCCTTGC GGTTGGCGCAGCGCCGTCGGGTAAGACC AACTCCCATGGTGTGACGGGCGGTGTGTA CAAGGCCCGGGAACGTATTCACCGTGGC GTGCTGATCCACGATTACTAGCGATTCCG CCTTCATGCACCCGAGTTGCAGAGTGCAA TCCGAACTGAGACGGTTTTTGGGGATTTG CTCCACCTCGCGGCTTCGCGTCCCACTGT CACCGCCATTGTAGCACGTGTGTAGCCCA TCCCGTAAGGGCCATGAGGACTTGACGTC ATCCACACCTTCCTCGCGGCTTATCACCG GCAGTCTCCCTAGAGTGCCCAACTGAATG ATGGCAACTAAGGACGTGGGTTGCGCTCG TTGCGGGACTTAACCCAACATCTCACGAC ACGAGCTGACGACAGCCATGCAGCACCT GTGTGCACGCCTCCGAAGAGGATCCCCGA TCTCTCGAGGTAACATGCCATGTCAAGGG ATGGTAAGGTTCTGCGCGTTGCTTCGAAT TAAACCACATGCTCCACCGCTTGTGCGGG CCCCCGTCAATTCCTTTGAGTTTTAATCTT GCGACCGTACTCCCCAGGCGGAATGCTTA ATGCGTTAGCGGCGCCACTGACCTGCAAG CAGGCCAACGGCTGGCATTCATCGTTTAC GGCGTGGACTACCAGGGTATCTAATCCTG TTTGCTCCCCACGCTTTCGCGCCTCAGCGT CAGAACCGGACCAGACAGCCGCCTTCGC CACTGGTGTTCTTGCGAATATCTACGAAT TTCACCTCTACACTCGCAGTTCCGCTGTCC TCTTCCGGTCTCAAGCCAACCAGTATCGA AGGCAATTCTGTGGTTGAGCCACAGGCTT TCACCCCCGACTTAATCGGCCGCCTACGC GCCCTTTACGCCCAGTGATTCCGAGCAAC GCTAGCCCCCTTCGTATTACCGCGGCTGC TGGCACGAAGTTAGCCGGGGCTTATTCTT CCGGTACCGTCATTATCGTCCCGGACAAA AGAGCTTTACAACCCTAAGGCCTTCATCA CTCACGCGGCATGGCTGGATCAGGCTTGC GCCCATTGTCCAATATTCCCCACTGCTGC CTCCCGTAGGAGTCTGGGCCGTGTCTCAG TCCCAGTGTGGCTGATCATCCTCTCAGAC CAGCTACTGATCGTCGCCTTGGTAGGCCG TTACCCCACCAACAAGCTAATCAGACGCG GGCCGATCCTTCGGCAGTAAACCTTTCCC CAAAAGGGCGTATCCGGTATTAGCTCAAG TTTCCCTGAGTTATTCCGAACCGAAGGGT ACGTTCCCACGTGTTACTCACCCGTCTGC CACTGACACCCGAAGGTGCCCGTTCGACT TGCATGTGTTAAGCCTGCCGCCAGCGTTC GCTCTGAGCCAGGATCAAACTCT NLS0042 SEQID GAGTTTGATCCTGGCTCAGAGCGAACGCT NO:3 GGCGGCAGGCTTAACACATGCAAGTCGA ACGGGCACCTTCGGGTGTCAGTGGCAGAC GGGTGAGTAACACGTGGGAACGTACCCTT CGGTTCGGAATAACTCAGGGAAACTTGA GCTAATACCGGATACGCCCTTTTGGGGAA AGGTTTACTGCCGAAGGATCGGCCCGCGT CTGATTAGCTTGTTGGTGGGGTAACGGCC TACCAAGGCGACGATCAGTAGCTGGTCTG AGAGGATGATCAGCCACACTGGGACTGA GACACGGCCCAGACTCCTACGGGAGGCA GCAGTGGGGAATATTGGACAATGGGCGC AAGCCTGATCCAGCCATGCCGCGTGAGTG ATGAAGGCCTTAGGGTTGTAAAGCTCTTT TGTCCGGGACGATAATGACGGTACCGGA AGAATAAGCCCCGGCTAACTTCGTGCCAG CAGCCGCGGTAATACGAAGGGGGCTAGC GTTGCTCGGAATCACTGGGCGTAAAGGGC GCGTAGGCGGCCGATTAAGTCGGGGGTG AAAGCCTGTGGCTCAACCACAGAATTGCC TTCGATACTGGTTGGCTTGAGACCGGAAG AGGACAGCGGAACTGCGAGTGTAGAGGT GAAATTCGTAGATATTCGCAAGAACACCA GTGGCGAAGGCGGCTGTCTGGTCCGGTTC TGACGCTGAGGCGCGAAAGCGTGGGGAG CAAACAGGATTAGATACCCTGGTAGTCCA CGCCGTAAACGATGAATGCCAGCCGTTGG CCTGCTTGCAGGTCAGTGGCGCCGCTAAC GCATTAAGCATTCCGCCTGGGGAGTACGG TCGCAAGATTAAAACTCAAAGGAATTGA CGGGGGCCCGCACAAGCGGTGGAGCATG TGGTTTAATTCGAAGCAACGCGCAGAACC TTACCATCCCTTGACATGGCATGTTACCT CGAGAGATCGGGGATCCTCTTCGGAGGC GTGCACACAGGTGCTGCATGGCTGTCGTC AGCTCGTGTCGTGAGATGTTGGGTTAAGT CCCGCAACGAGCGCAACCCACGTCCTTAG TTGCCATCATTCAGTTGGGCACTCTAGGG AGACTGCCGGTGATAAGCCGCGAGGAAG GTGTGGATGACGTCAAGTCCTCATGGCCC TTACGGGATGGGCTACACACGTGCTACAA TGGCGGTGACAGTGGGACGCGAAGCCGC GAGGTGGAGCAAATCCCCAAAAACCGTC TCAGTTCGGATTGCACTCTGCAACTCGGG TGCATGAAGGCGGAATCGCTAGTAATCGT GGATCAGCACGCCACGGTGAATACGTTCC CGGGCCTTGTACACACCGCCCGTCACACC ATGGGAGTTGGTCTTACCCGACGGCGCTG CGCCAACCGCAAGGAGGCAGGCGACCAC GGTAGGGTCAGCGACTGGGGTGAAGTCG TAACAAGGTAGCCGTAGGGGAACCTGCG GCTGGATCACCT NLS0934 SEQID GAGTTTGATCCTGGCTCAGAGCGAACGCT NO:4 GGCGGCAGGCTTAACACATGCAAGTCGA ACGCACCGCAAGGTGAGTGGCAGACGGG TGAGTAACACGTGGGAACGTGCCCTCCGG TCTGGGATAACCCTGGGAAACTAGGGCTA ATACCGGATACGTGCTTTGGCAGAAAGGT TTACTGCCGGAGGATCGGCCCGCGTCTGA TTAGCTTGTTGGTGGGGTAACGGCCTACC AAGGCGACGATCAGTAGCTGGTCTGAGA GGATGATCAGCCACACTGGGACTGAGAC ACGGCCCAGACTCCTACGGGAGGCAGCA GTGGGGAATATTGGACAATGGGCGCAAG CCTGATCCAGCCATGCCGCGTGAGTGATG ACGGCCTTAGGGTTGTAAAGCTCTTTTCT CCGGGACGATAATGACGGTACCGGAGGA ATAAGCCCCGGCTAACTTCGTGCCAGCAG CCGCGGTAATACGAAGGGGGCTAGCGTT GCTCGGAATCACTGGGCGTAAAGGGCGC GTAGGCGGCGTTTTAAGTCGGGGGTGAA AGCCTGTGGCTCAACCACAGAATGGCCTT CGATACTGGGACGCTTGAGTATGGTAGAG GTTGGTGGAACTGCGAGTGTAGAGGTGA AATTCGTAGATATTCGCAAGAACACCGGT GGCGAAGGCGGCCAACTGGACCATTACT GACGCTGAGGCGCGAAAGCGTGGGGAGC AAACAGGATTAGATACCCTGGTAGTCCAC GCCGTAAACGATGAATGCTAGCTGTTGGG GTGCATGCACCGCAGTAGCGCAGCTAAC GCATTAAGCATTCCGCCTGGGGAGTACGG TCGCAAGATTAAAACTCAAAGGAATTGA CGGGGGCCCGCACAAGCGGTGGAGCATG TGGTTTAATTCGAAGCAACGCGCAGAACC TTACCATCCTTTGACATGGCGTGTTACTG GGAGAGATTCCAGGTCCCCTTCGGGGGCG CGCACACAGGTGCTGCATGGCTGTCGTCA GCTCGTGTCGTGAGATGTTGGGTTAAGTC CCGCAACGAGCGCAACCCACGTCCTTAGT TGCCATCATTTGGTTGGGCACTCTAGGGA GACTGCCGGTGATAAGCCGCGAGGAAGG TGTGGATGACGTCAAGTCCTCATGGCCCT TACGGGATGGGCTACACACGTGCTACAAT GGCGGTGACAGTGGGACGCGAAGGGGTG ACCCGGAGCCAATCTCCAAAAGCCGTCTC AGTTCGGATTGCACGCTGCAACTCGCGTG CATGAAGGCGGAATCGCTAGTAATCGTG GATCAGCATGCCACGGTGAATACGTTCCC GGGCCTTGTACACACCGCCCGTCACACCA TGGGAGTTGGTCTTACCCGACGGCGCTGC GCCAACCAAATCGAGCTTGCTCGACTGGA GGCAGGCGACCACGGTAGGGTCAGCGAC TGGGGTGAAGTCGTAACAAGGTAGCCGT AGGGGAACCTGCGGCTGGATCACCT NLS0062 SEQID GGTGATCCAGCCGCAGGTTCCCCTACGGC NO:5 TACCTTGTTACGACTTCACCCCAGTCGCT GACCCTACCGTGGTCGCCTGCCTCCTTGC GGTTGGCGCAGCGCCGTCGGGTAAGACC AACTCCCATGGTGTGACGGGCGGTGTGTA CAAGGCCCGGGAACGTATTCACCGTGGC GTGCTGATCCACGATTACTAGCGATTCCG CCTTCATGCACCCGAGTTGCAGAGTGCAA TCCGAACTGAGACGGTTTTTGGGGATTTG CTCCACCTCGCGGCTTCGCGTCCCACTGT CACCGCCATTGTAGCACGTGTGTAGCCCA TCCCGTAAGGGCCATGAGGACTTGACGTC ATCCACACCTTCCTCGCGGCTTATCACCG GCAGTCTCCCTAGAGTGCCCAACTGAATG ATGGCAACTAAGGACGTGGGTTGCGCTCG TTGCGGGACTTAACCCAACATCTCACGAC ACGAGCTGACGACAGCCATGCAGCACCT GTGTGCACGCCTCCGAAGAGGATCCCCGA TCTCTCGAGGTAACATGCCATGTCAAGGG ATGGTAAGGTTCTGCGCGTTGCTTCGAAT TAAACCACATGCTCCACCGCTTGTGCGGG CCCCCGTCAATTCCTTTGAGTTTTAATCTT GCGACCGTACTCCCCAGGCGGAATGCTTA ATGCGTTAGCGGCGCCACTGACCTGCAAG CAGGCCAACGGCTGGCATTCATCGTTTAC GGCGTGGACTACCAGGGTATCTAATCCTG TTTGCTCCCCACGCTTTCGCGCCTCAGCGT CAGAACCGGACCAGACAGCCGCCTTCGC CACTGGTGTTCTTGCGAATATCTACGAAT TTCACCTCTACACTCGCAGTTCCGCTGTCC TCTTCCGGTCTCAAGCCAACCAGTATCGA AGGCAATTCTGTGGTTGAGCCACAGGCTT TCACCCCCGACTTAATCGGCCGCCTACGC GCCCTTTACGCCCAGTGATTCCGAGCAAC GCTAGCCCCCTTCGTATTACCGCGGCTGC TGGCACGAAGTTAGCCGGGGCTTATTCTT CCGGTACCGTCATTATCGTCCCGGACAAA AGAGCTTTACAACCCTAAGGCCTTCATCA CTCACGCGGCATGGCTGGATCAGGCTTGC GCCCATTGTCCAATATTCCCCACTGCTGC CTCCCGTAGGAGTCTGGGCCGTGTCTCAG TCCCAGTGTGGCTGATCATCCTCTCAGAC CAGCTACTGATCGTCGCCTTGGTAGGCCG TTACCCCACCAACAAGCTAATCAGACGCG GGCCGATCCTTCGGCAGTAAACCTTTCCC CAAAAGGGCGTATCCGGTATTAGCTCAAG TTTCCCTGAGTTATTCCGAACCGAAGGGT ACGTTCCCACGTGTTACTCACCCGTCTGC CACTGACACCCGAAGGTGCCCGTTCGACT TGCATGTGTTAAGCCTGCCGCCAGCGTTC GCTCTGAGCCAGGATCAAACTCT NLS0069 SEQID GGTGATCCAGCCGCAGGTTCCCCTACGGC NO:6 TACCTTGTTACGACTTCACCCCAGTCGCT GACCCTACCGTGGTCGCCTGCCTCCTTGC GGTTGGCGCAGCGCCGTCGGGTAAGACC AACTCCCATGGTGTGACGGGCGGTGTGTA CAAGGCCCGGGAACGTATTCACCGTGGC ATGCTGATCCACGATTACTAGCGATTCCG CCTTCATGCACCCGAGTTGCAGAGTGCAA TCCGAACTGAGACGGCTTTTGGGGATTTG CTCAACCTCGCGGTTTCGCGTCCCACTGT CACCGCCATTGTAGCACGTGTGTAGCCCA TCCCGTAAGGGCCATGAGGACTTGACGTC ATCCACACCTTCCTCGCGGCTTATCACCG GCAGTCTCCCTAGAGTGCCCAACTGAATG ATGGCAACTAAGGACGTGGGTTGCGCTCG TTGCGGGACTTAACCCAACATCTCACGAC ACGAGCTGACGACAGCCATGCAGCACCT GTGTGCAGGTCCCCGAAGGGAACGACCG ATCTCTCGGACAATCCTGCCATGTCAAGG GATGGTAAGGTTCTGCGCGTTGCTTCGAA TTAAACCACATGCTCCACCGCTTGTGCGG GCCCCCGTCAATTCCTTTGAGTTTTAATCT TGCGACCGTACTCCCCAGGCGGAATGCTT AATGCGTTAGCGGCGCCACTGACCTGCAA GCAGACCAACGGCTGGCATTCATCGTTTA CGGCGTGGACTACCAGGGTATCTAATCCT GTTTGCTCCCCACGCTTTCGCGCCTCAGC GTCAGAACCGGACCAGACAGCCGCCTTC GCCACTGGTGTTCTTGCGAATATCTACGA ATTTCACCTCTACACTCGCAGTTCCGCTGT CCTCTTCCGGTCTCAAGCTTTCCAGTATCG AAGGCAATTCTGTGGTTGAGCCACAGGCT TTCACCCCCGACTTAAAAAGCCGCCTACG CGCCCTTTACGCCCAGTGATTCCGAGCAA CGCTAGCCCCCTTCGTATTACCGCGGCTG CTGGCACGAAGTTAGCCGGGGCTTATTCT TCCGGTACCGTCATTATCGTCCCGGACAA AAGAGCTTTACAACCCTAAGGCCTTCATC ACTCACGCGGCATGGCTGGATCAGGCTTG CGCCCATTGTCCAATATTCCCCACTGCTG CCTCCCGTAGGAGTCTGGGCCGTGTCTCA GTCCCAGTGTGGCTGATCATCCTCTCAGA CCAGCTACTGATCGTCGCCTTGGTAGGCC GTTACCCCACCAACTAGCTAATCAGACGC GGGCCGATCCTTCGGCAGTAAACCTTTCC CCAAAAGGGCGTATCCGGTATTAGCTCAA GTTTCCCTGAGTTATTCCGAACCGAAGGG CACGTTCCCACGTGTTACTCACCCGTCTG CCGCTGACCCCGAAGGGCCCGCTCGACTT GCATGTGTTAAGCCTGCCGCCAGCGTTCG CTCTGAGCCAGGATCAAACTCT NLS0089 SEQID GAGTTTGATCCTGGCTCAGAGCGAACGCT NO:7 GGCGGCAGGCTTAACACATGCAAGTCGA ACGGGCTTCTTCGGAAGTCAGTGGCAGAC GGGTGAGTAACACGTGGGAACGTGCCCTT CGGTTCGGAATAACTCAGGGAAACTTGA GCTAATACCGGATACGCCCTTACGGGGAA AGGTTTACTGCCGAAGGATCGGCCCGCGT CTGATTAGCTTGTTGGTGGGGTAACGGCC TACCAAGGCGACGATCAGTAGCTGGTCTG AGAGGATGATCAGCCACACTGGGACTGA GACACGGCCCAGACTCCTACGGGAGGCA GCAGTGGGGAATATTGGACAATGGGCGC AAGCCTGATCCAGCCATGCCGCGTGAGTG ATGAAGGCCTTAGGGTTGTAAAGCTCTTT TGTCCGGGACGATAATGACGGTACCGGA AGAATAAGCCCCGGCTAACTTCGTGCCAG CAGCCGCGGTAATACGAAGGGGGCTAGC GTTGCTCGGAATCACTGGGCGTAAAGGGC GCGTAGGCGGCCGATTAAGTCGGGGGTG AAAGCCTGTGGCTCAACCACAGAATTGCC TTCGATACTGGTTGGCTTGAGACCGGAAG AGGACAGCGGAACTGCGAGTGTAGAGGT GAAATTCGTAGATATTCGCAAGAACACCA GTGGCGAAGGCGGCTGTCTGGTCCGGTTC TGACGCTGAGGCGCGAAAGCGTGGGGAG CAAACAGGATTAGATACCCTGGTAGTCCA CGCCGTAAACGATGAATGCCAGCCGTTGG TCTGCTTGCAGGTCAGTGGCGCCGCTAAC GCATTAAGCATTCCGCCTGGGGAGTACGG TCGCAAGATTAAAACTCAAAGGAATTGA CGGGGGCCCGCACAAGCGGTGGAGCATG TGGTTTAATTCGAAGCAACGCGCAGAACC TTACCATCCCTTGACATGGCATGTTACCT CGAGAGATCGGGGATCCTCTTCGGAGGC GTGCACACAGGTGCTGCATGGCTGTCGTC AGCTCGTGTCGTGAGATGTTGGGTTAAGT CCCGCAACGAGCGCAACCCACGTCCTTAG TTGCCATCATTCAGTTGGGCACTCTAGGG AGACTGCCGGTGATAAGCCGCGAGGAAG GTGTGGATGACGTCAAGTCCTCATGGCCC TTACGGGATGGGCTACACACGTGCTACAA TGGCGGTGACAGTGGGACGCGAAACCGC GAGGTTGAGCAAATCCCCAAAAGCCGTCT CAGTTCGGATTGCACTCTGCAACTCGGGT GCATGAAGGCGGAATCGCTAGTAATCGT GGATCAGCACGCCACGGTGAATACGTTCC CGGGCCTTGTACACACCGCCCGTCACACC ATGGGAGTTGGTCTTACCCGACGGCGCTG CGCCAACCGCAAGGGGGCAGGCGACCAC GGTAGGGTCAGCGACTGGGGTGAAGTCG TAACAAGGTAGCCGTAGGGGAACCTGCG GCTGGATCACCT

    [0048] Various Methylobacterium sp. isolates provided herein are disclosed in Table 2.

    TABLE-US-00002 TABLE 2 Methylobacterium sp. Isolates NLS Plant host of original USDA ARS No. isolate NRRL No..sup.1 NLS0021 lettuce NRRL B-50939 NLS0038 tomato NRRL B-50942 NLS0042 soybean NRRL B-50932 NLS0934 soybean NRRL B-67341 custom-character custom-character custom-character NLS0062 corn NRRL B-50937 NLS0069 corn NRRL B-50936 NLS0089 broccoli NRRL B-50933 NLS0037 NRRL B-50941 NLS0064 NRRL B-50938 NLS0017 NRRL B-50931 NLS0065 NRRL B-50935 NLS0068 NRRL B-50934 .sup.1Deposit number for strains deposited with the AGRICULTURAL RESEARCH SERVICE CULTURE COLLECTION (NRRL) of the National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604 U.S.A. under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Subject to 37 CFR 1.808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of any patent from this patent application.

    [0049] Also provided herein are methods for controlling RLN that comprise applying any of the aforementioned compositions provided herein to a plant or a plant part in an amount that provides for inhibition of RLN damage in the plant, plant part, or a plant obtained therefrom relative to infection of, or damage in, a control plant, plant part, or plant obtained therefrom that had not received an application of the composition. In certain embodiments, application of the composition provides for at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 85%, or at least about 95% reduction of RLN damage in the plant, plant part, or a plant derived therefrom relative to RLN damage of the control plant, plant part, or plant obtained therefrom. In certain embodiments, application of the composition provides for at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 85%, or at least about 95% reduction of RLN reproduction, viability, or motility in the plant, plant part, or a plant derived therefrom relative to RLN reproduction, viability, or motility in the control plant, plant part, or plant obtained therefrom. In certain embodiments, application of the composition provides for at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 85%, or at least about 95% reduction of RLN recovered from the plant, plant part, or a plant derived therefrom relative to RLN recovered from the control plant, plant part, or plant obtained therefrom. In certain embodiments, the methods provide for a decrease in numbers of RLN obtained from the treated plant, plant part, or a plant derived therefrom relative to an untreated control plant, plant part, or a plant derived therefrom. In certain embodiments, application of the composition provides for at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 85%, or at least about 95% reduction of RLN populations in soil. In certain embodiments, the plant part is selected from the group consisting of a leaf, a stem, a flower, a root, a tuber, a pollen grain, and a seed. In certain embodiments, the method further comprises the step of harvesting at least one plant part selected from the group consisting of a leaf, a stem, a flower, a root, a tuber, a pollen grain, or a seed from the plant or plant part. In certain embodiments of any of the aforementioned methods, the methods further comprise obtaining a processed food or feed composition from the plant or plant part. In certain embodiments, the processed food or feed composition is a meal or a paste. In certain embodiments of any of the aforementioned methods, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, NLS0089, derivatives thereof, and Methylobacterium related thereto. In certain embodiments, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0069, and a derivative thereof.

    [0050] Also provided are methods of making the compositions useful for controlling RLN that comprise combining at least one of a RLN-inhibitory Methylobacterium, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof with an agriculturally acceptable excipient and/or with an agriculturally acceptable adjuvant. In certain embodiments of the methods, the Methylobacterium is adhered to a solid substance. In certain embodiments of the methods, the Methylobacterium is adhered to the solid substance is combined with a liquid to form a composition that is a colloid. In certain embodiments of the methods, the colloid is a gel. In certain embodiments of the methods, the Methylobacterium adhered to the solid substance is provided by culturing the Methylobacterium in the presence of the solid substance. In certain embodiments of the methods, the composition comprises an emulsion. In certain embodiments of the methods, the Methylobacterium is provided by culturing the Methylobacterium in an emulsion. In certain embodiments of any of the aforementioned methods, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, NLS0089, derivatives thereof, and Methylobacterium related thereto. In certain embodiments, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0069, and a derivative thereof.

    [0051] Methods where Methylobacterium are cultured in biphasic media comprising a liquid phase and a solid substance have been found to significantly increase the resultant yield of Methylobacterium relative to methods where the Methylobacterium are cultured in liquid media alone. In certain embodiments, the methods can comprise growing the Methylobacterium in liquid media with a particulate solid substance that can be suspended in the liquid by agitation under conditions that provide for Methylobacterium growth. In certain embodiments where particulate solid substances are used, at least substantially all of the solid phase can thus be suspended in the liquid phase upon agitation. Such particulate solid substances can comprise materials that are about 1 millimeter or less in length or diameter. In certain embodiments, the degree of agitation is sufficient to provide for uniform distribution of the particulate solid substance in the liquid phase and/or optimal levels of culture aeration. However, in other embodiments provided herein, at least substantially all of the solid phase is not suspended in the liquid phase, or portions of the solid phase are suspended in the liquid phase and portions of the solid phase are not suspended in the liquid phase. Non-particulate solid substances can be used in certain biphasic media where the solid phase is not suspended in the liquid phase. Such non-particulate solid substances include, but are not limited to, materials that are greater than about 1 millimeter in length or diameter. Such particulate and non-particulate solid substances also include, but are not limited to, materials that are porous, fibrous, or otherwise configured to provide for increased surface areas for adherent growth of the Methylobacterium. Biphasic media where portions of the solid phase are suspended in the liquid phase and portions of the solid phase are not suspended in the liquid phase can comprise a mixture of particulate and non-particulate solid substances. Such particulate and non-particulate solid substances used in any of the aforementioned biphasic media also include, but are not limited to, materials that are porous, fibrous, or otherwise configured to provide for increased surface areas for adherent growth of the Methylobacterium. In certain embodiments, the media comprises a colloid formed by a solid and a liquid phase. A colloid comprising a solid and a liquid can be pre-formed and added to liquid media or can be formed in media containing a solid and a liquid. Colloids comprising a solid and a liquid can be formed by subjecting certain solid substances to a chemical and/or thermal change. In certain embodiments, the colloid is a gel. In certain embodiments, the liquid phase of the media is an emulsion. In certain embodiments, the emulsion comprises an aqueous liquid and a liquid that is not miscible, or only partially miscible, in the aqueous liquid. Liquids that are not miscible, or only partially miscible, in water include, but are not limited to, any of the following: (1) liquids having a miscibility in water that is equal to or less than that of pentanol, hexanol, or heptanol at 25 degrees C.; (2) liquids comprising an alcohol, an aldehyde, a ketone, a fatty acid, a phospholipid, or any combination thereof; (3) alcohols selected from the group consisting of aliphatic alcohols containing at least 5 carbons and sterols; (4) an animal oil, microbial oil, synthetic oil, plant oil, or combination thereof; and/or, (5) a plant oil is selected from the group consisting of, soybean, cotton, peanut, sunflower, olive, flax, coconut, palm, rapeseed, sesame seed, safflower, and combinations thereof. In certain embodiments, the immiscible or partially immiscible liquid can comprises at least about 0.02% to about 20% of the liquid phase by mass. In certain embodiments, the methods can comprise obtaining a biphasic culture media comprising the liquid, the solid, and Methylobacterium and incubating the culture under conditions that provide for growth of the Methylobacterium. Biphasic culture medias comprising the liquid, the solid, and Methylobacterium can be obtained by a variety of methods that include, but are not limited to, any of: (a) inoculating a biphasic media comprising the liquid and the solid substance with Methylobacterium; (b) inoculating the solid substance with Methylobacterium and then introducing the solid substance comprising the Methylobacterium into the liquid media; (c) inoculating the solid substance with Methylobacterium, incubating the Methylobacterium on the solid substance, and then introducing the solid substance comprising the Methylobacterium into the liquid media; or (d) any combination of (a), (b), or (c). Methods and compositions for growing Methylobacterium in biphasic media comprising a liquid and a solid are disclosed in co-assigned U.S. Pat. No. 9,181,541, issued Nov. 10, 2015, which is incorporated herein by reference in its entirety. Compositions comprising dried formulations of Methylobacterium that are adhered to solid substances, methods for making such compositions, and methods of applying those compositions to plants and plant parts including seeds are disclosed in co-assigned U.S. patent application Ser. No. 14/856,020, filed Sep. 16, 2015, and which is incorporated herein by reference in its entirety.

    [0052] Methods where Methylobacterium are cultured in media comprising an emulsion have also been found to significantly increase the resultant yield of Methylobacterium relative to methods where the Methylobacterium are cultured in liquid media alone. In certain embodiments, the methods for making the compositions provided herein can comprise growing the RLN-inhibitory Methylobacterium agent in an emulsion under conditions that provide for Methylobacterium growth. Media comprising the emulsion and RLN-inhibitory Methylobacterium can be obtained by a variety of methods that include, but are not limited to, any of: (a) inoculating a media comprising the emulsion with Methylobacterium; (b) inoculating the aqueous liquid with the Methylobacterium, introducing the non-aqueous liquid, and mixing to form an emulsion; (c) inoculating the aqueous liquid with the Methylobacterium, introducing the non-aqueous liquid, and mixing to form an emulsion; or (d) any combination of (a), (b), or (c). In certain embodiments, the emulsion comprises an aqueous liquid and a liquid that is not miscible, or only partially miscible, in the aqueous liquid. Non-aqueous liquids that are not miscible, or only partially miscible, in water include, but are not limited to, any of the following: (1) liquids having a miscibility in water that is equal to or less than that of n-pentanol, n-hexanol, or n-heptanol at 25 degrees C.; (2) liquids comprising an alcohol, an aldehyde, a ketone, a fatty acid, a phospholipid, or any combination thereof (3) alcohols is selected from the group consisting of aliphatic alcohols containing at least 5, 6, or 7 carbons and sterols; (4) an animal oil, microbial oil, synthetic oil, plant oil, or combination thereof and/or, (5) a plant oil is selected from the group consisting of, soybean, cotton, peanut, sunflower, olive, flax, coconut, palm, rapeseed, sesame seed, safflower, and combinations thereof. In certain embodiments, the immiscible or partially immiscible non-aqueous liquid can comprise at least about 0.02% to about 20% of the emulsion by mass. In certain embodiments, the immiscible or partially immiscible non-aqueous liquid can comprise at least about any of about 0.05%, 0.1%, 0.5%, or 1% to about 3%, 5%, 10%, or 20% of the emulsion by mass. Methods and compositions for growing Methylobacterium in media comprising an emulsion are disclosed in co-assigned International Patent Application PCT/US14/40218, filed May 30, 2014, and US Patent Application Publication No. 20160120188, which is incorporated herein by reference in its entirety.

    [0053] In certain embodiments, compositions that comprise at least one of a RLN-inhibitory Methylobacterium, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof can further comprise one or more introduced microorganisms of pre-determined identity other than Methylobacterium. Other microorganisms that can be added include, but are not limited to, microorganisms that are biopesticidal or provide some other benefit when applied to a plant or plant part. Biopesticidal or otherwise beneficial microorganisms thus include, but are not limited to, various Bacillus sp., Pseudomonas sp., Coniothyrium sp., Pantoea sp., Streptomyces sp., and Trichoderma sp. Microbial biopesticides can be a bacterium, fungus, virus, or protozoan. Particularly useful biopesticidal microorganisms include various Bacillus subtilis, Bacillus thuringiensis, Bacillus pumilis (e.g., Bacillus pumilis strain QST2808), Pseudomonas syringae, Trichoderma harzianum, Trichoderma vixens, and Streptomyces lydicus strains. Biopesticidal microorganisms that can be used include, but are not limited to, the Bacillus pumilis strains described in U.S. Pat. No. 9,023,339, and the Bacillus cereus and Bacillus firmus strains disclosed in U.S. Pat. No. 6,406,690, each of which are incorporated herein by reference in their entireties. Other microorganisms that are added can be genetically engineered or other isolates that are available as pure cultures. In certain embodiments, it is anticipated that the bacterial or fungal microorganism can be provided in the fermentation broth, fermentation broth product, or composition in the form of a spore.

    [0054] In certain embodiments, a RLN-inhibitory Methylobacterium, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof that are provided herein can be used in conjunction with transgenic plants that express gene products that are inhibitory to growth of certain RLN. Such transgenic plants include, but are not limited to, those expressing interfering RNA molecules that suppress endogenous RLN genes such as those disclosed in U.S. Patent Appl. Publication No. US 20150135363, which is incorporated herein by reference in its entirety.

    [0055] In certain embodiments, the compositions comprising at least one of a RLN-inhibitory Methylobacterium, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof that are provided herein can be used in conjunction with plants that comprise one or more genetic loci that can confer resistance to RLN. Such RLN resistant plants include, but are not limited to, wheat plants comprising the Rlnn1 gene (Theoretical and Applied Genetics, 2002, 104 (5): 874-879) or alfalfa plants (Baldridge et al. Plant Molecular Biology, 1998, 38(6): 999-1010).

    [0056] In certain embodiments, the compositions comprising at least one of a RLN-inhibitory Methylobacterium, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof that are provided herein can be used in conjunction with, or comprise, nematicides that also provide for inhibition of RLN growth and/or reproduction and/or reductions in RLN-mediated plant damage. Such nematicides can be used in soil treatments (drenches, in furrow deposits, and the like) and/or in seed treatments. In certain embodiments, the nematicide is selected from the group consisting of organophosphate, biological, and carbamate nematicides. In certain embodiments, the seed is treated with one or more of the aforementioned nematicides (U.S. Pat. Nos. 6,660,690 and 8,080,496, each incorporated herein by reference in their entireties). Commercial soil applied nematicide formulations that can be used in conjunction with the RLN-inhibitory Methylobacterium sp. provided herein include, but are not limited to, formulations containing the carbamates aldicarb, aldoxycarb, oxamyl, carbofuran, and cleothocarb, and/or the organophosphates thionazin, ethoprophos, fenamiphos, fensulfothion, and/or terbufos formulations. Combinations of the aforementioned nematicides and the aforementioned transgenic plants that provide for inhibition of RLN growth and/or reproduction and/or reductions in RLN-mediated plant damage can also be used in conjunction with the RLN-inhibitory Methylobacterium sp. provided herein.

    [0057] In certain embodiments, any of the aforementioned compositions comprising RLN-inhibitory Methylobacterium sp., a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof that are provided herein are selectively applied to plant parts or to soil or other media in which a plant is or is to be grown, or plant parts subjected to such applications are used in soil or media, following a determination that RLN levels in the soil or other media in which the plants are grown are above levels that would result in RLN damage in the absence of such applications or use. Soil or media in which the plant is to be grown can be surveyed for the presence of RLN and the composition is applied to the plant part, soil, or media when the RLN are present in the soil or media at a level that can result in reductions in plant growth, yield, water-deficit tolerance, chlorosis, produce quality, and combinations thereof to an untreated control plant. In certain embodiments, the composition is not applied to the plant part, soil, or media when the RLN are present in the soil or media below levels that can result in reductions in plant growth, yield, water-deficit tolerance, chlorosis, produce quality, and combinations thereof to an untreated control plant. Any survey method that provides for a determination of RLN levels that result in plant damage can be used. In certain embodiments, plants having yellow lower leaves and loss of secondary branching in the root system that are found in patches in a field can indicate that RLN are present (Johnson et al. Root Lesion Nematodes in Wheat, Montana State University Extension Publication MT200801AG, February 2008) and prompt use of the compositions provided herein. In other embodiments, samples are taken from the soil or media in which the plants are to be grown and levels of RLN are determined (Todd et al. Plant Health Progress 15(3):112, 2014). In certain embodiments where the RLN are present in soil above threshold levels that result in yield loss, the compositions provided herein are used.

    [0058] In certain embodiments, the liquid medium that can be used in the methods and compositions that provide for the efficient growth of Methylobacterium is prepared from inexpensive and readily available components, including, but not limited to, inorganic salts such as potassium phosphate, magnesium sulfate and the like, carbon sources such as glycerol, methanol, glutamic acid, aspartic acid, succinic acid and the like, and amino acid blends such as peptone, tryptone, and the like. Non-limiting examples of liquid media that can be used include, but are not limited to, ammonium mineral salts (AMS) medium (Whittenbury et al., 1970), Vogel-Bonner (VB) minimal culture medium (Vogel and Bonner, 1956), and LB broth (Luria-Bertani Broth).

    [0059] In general, the solid substance that can in certain embodiments be used in the methods and compositions that provide for the efficient growth of Methylobacterium can be any suitable solid substance which is insoluble or only partially soluble in water or aqueous solutions. Such suitable solid substances are also non-bacteriocidal or non-bacteriostatic with respect to RLN-inhibitory Methylobacterium sp. when the solid substances are provided in the liquid culture media. In certain embodiments, such suitable solid substances are also solid substances that are readily obtained in sterile form or rendered sterile. Solid substances used herein can be sterilized by any method that provides for removal of contaminating microorganisms and thus include, but are not limited to, methods such as autoclaving, irradiation, chemical treatment, and any combination thereof. These solid substances include substances of animal, plant, microbial, fungal, or mineral origin, manmade substances, or combinations of substances of animal, plant, microbial, fungal, or mineral origin and manmade substances. In certain embodiments, the solid substances are inanimate solid substances. Inanimate solid substances of animal, plant, microbial, or fungal origin can be obtained from animals, plants, microbes, or fungi that are inviable (i.e. no longer living) or that have been rendered inviable. Diatom shells are thus inanimate solid substances when previously associated diatom algae have been removed or otherwise rendered inviable. Since diatom shells are inanimate solid substances, they are not considered to be photosynthetic organisms or photosynthetic microorganisms. In certain embodiments, solid substances include, but are not limited to, sand, silt, soil, clay, ash, charcoal, diatomaceous earth and other similar minerals, ground glass or glass beads, ground ceramic materials, ceramic beads, bentonite, kaolin, talc, perlite, mica, vermiculite, silicas, quartz powder, montmorillonite, and combinations thereof. In certain embodiments, the solid substance can be a polymer or polymeric beads. Polymers that can be used as a solid substance include, but are not limited to, various polysaccharides such as cellulosic polymers and chitinous polymers which are insoluble or only partially soluble in water or aqueous solutions, agar (i.e. galactans), and combinations thereof. In certain embodiments, the solid substance can be an insoluble or only partially soluble salt crystal. Salt crystals that can be used include, but are not limited to, insoluble or only partially soluble carbonates, chromates, sulfites, phosphates, hydroxides, oxides, and sulfides. In certain embodiments, the solid substance can be a microbial cell, fungal cell, microbial spore, or fungal spore. In certain embodiments, the solid substance can be a microbial cell or microbial spore wherein the microbial cell or microbial spore is not a photosynthetic microorganism. In still other embodiments, the solid substance can be an inactivated (i.e. inviable) microbial cell, fungal cell, microbial spore, or fungal spore. In still other embodiments, the solid substance can be a quiescent (i.e. viable but not actively dividing) microbial cell, fungal cell, microbial spore, or fungal spore. In still other embodiments, the solid substance can be cellular debris of microbial origin. In still other embodiments, the solid substance can be particulate matter from any part of a plant. Plant parts that can be used to obtain the solid substance include, but are not limited to, cobs, husks, hulls, leaves, roots, flowers, stems, barks, seeds, and combinations thereof. Products obtained from processed plant parts including, but not limited to, bagasse, wheat bran, soy grits, crushed seed cake, stover, and the like can also be used. Such plant parts, processed plants, and/or processed plant parts can be milled to obtain the solid material in a particulate form that can be used. In certain embodiments, wood or a wood product including, but not limited to, wood pulp, sawdust, shavings, and the like can be used. In certain embodiments, the solid substance can be a particulate matter from an animal(s), including, but not limited to, bone meal, gelatin, ground or powdered shells, hair, macerated hide, and the like.

    [0060] In certain embodiments, the solid substance is provided in a particulate form that provides for distribution of the solid substance in the culture media. In certain embodiments, the solid substance is comprised of particle of about 2 microns to about 1000 microns in average length or average diameter. In certain embodiments, the solid substance is comprised of particle of about 1 microns to about 1000 microns in average length or average diameter. In certain embodiments, the solid substance is a particle of about 1, 2, 4, 10, 20, or 40 microns to any of about 100, 200, 500, 750, or 1000 microns in average length or average diameter. Desirable characteristics of particles used in the methods and compositions provided herein include suitable wettability such that the particles can be suspended throughout the media upon agitation.

    [0061] In certain embodiments, the solid substance is provided in the media as a colloid wherein the continuous phase is a liquid and the dispersed phase is the solid. Suitable solids that can be used to form colloids in liquid media used to grow RLN-inhibitory Methylobacterium sp. include, but are not limited to, various solids that are referred to as hydrocolloids. Such hydrocolloids used in the media, methods and compositions provided herein can be hydrophilic polymers, of plant, animal, microbial, or synthetic origin. Hydrocolloid polymers used in the methods can contain many hydroxyl groups and/or can be polyelectrolytes. Hydrocolloid polymers used in the compositions and methods provided herein include, but are not limited to, agar, alginate, arabinoxylan, carrageenan, carboxymethylcellulose, cellulose, curdlan, gelatin, gellan, -glucan, guar gum, gum arabic, locust bean gum, pectin, starch, xanthan gum, and mixtures thereof. In certain embodiments, the colloid used in the media, methods, and compositions provided herein can comprise a hydrocolloid polymer and one or more proteins.

    [0062] In certain embodiments, the solid substance can be a solid substance that provides for adherent growth of the RLN-inhibitory Methylobacterium sp. on the solid substance. RLN-inhibitory Methylobacterium sp. that are adhered to a solid substance are Methylobacterium that cannot be substantially removed by simply washing the solid substance with the adherent RLN-inhibitory Methylobacterium sp. with growth media whereas non-adherent Methylobacterium can be substantially removed by washing the solid substance with liquid growth media. In this context, substantially removed means that at least about 30%, 40%, 50%, 60%, 70%, or 80% the Methylobacterium present are removed when the solid substance is washed with three volumes of liquid growth media. Such washing can be effected by a variety of methods including, but not limited to, decanting liquid from a washed solid phase or passing liquid through a solid phase on a filter that permits flow through of bacteria in the liquid. In certain embodiments, the adherent RLN-inhibitory Methylobacterium sp. that are associated with the solid can include both Methylobacterium that are directly attached to the solid and/or Methylobacterium that are indirectly attached to the solid substance. Methylobacterium that are indirectly attached to the solid substance include, but are not limited to, Methylobacterium that are attached to another Methylobacterium or to another microorganism that is attached to the solid substance, Methylobacterium that are attached to the solid substance by being attached to another substance that is attached to the solid substance, and the like. In certain embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.5% or 99.9% of the Methylobacterium in the fermentation broth, fermentation broth product, or compositions are Methylobacterium that are adhered to the solid substance. In certain embodiments, adherent RLN-inhibitory Methylobacterium sp. can be present on the surface of the solid substance in the fermentation broth, fermentation broth product, or composition at a density of at least about 1 Methylobacterium/20 square micrometers, of at least about 1 Methylobacterium/10 square micrometers, of at least about 1 Methylobacterium/10 square micrometers, of at least about 1 Methylobacterium/5 square micrometers, of at least about 1 Methylobacterium/2 square micrometers, or of at least about 1 Methylobacterium/square micrometer. In certain embodiments, adherent RLN-inhibitory Methylobacterium sp. can be present on the surface of the solid substance in the fermentation broth, fermentation broth product, or composition at a density of at least about 1 Methylobacterium/20 square micrometers to about 1 Methylobacterium/square micrometer, of at least about 1 Methylobacterium/10 square micrometers to about 1 Methylobacterium/square micrometer, of at least about 1 Methylobacterium/10 square micrometers to about 1 Methylobacterium/square micrometer, of at least about 1 Methylobacterium/5 square micrometers to about 1 Methylobacterium/square micrometer, or of at least about 1 Methylobacterium/2 square micrometers to about 1 Methylobacterium/square micrometer. In certain embodiments, adherent RLN-inhibitory Methylobacterium sp. can be present on the surface of the solid substance in the fermentation broth, fermentation broth product, or composition at a density of at least about 1 Methylobacterium/20 square micrometers to about 1 Methylobacterium/2 square micrometers, of at least about 1 Methylobacterium/10 square micrometers to about 1 Methylobacterium/2 square micrometers, of at least about 1 Methylobacterium/10 square micrometers to about 1 Methylobacterium/2 square micrometers, or of at least about 1 Methylobacterium/5 square micrometers to about 1 Methylobacterium/2 square micrometers. Biphasic fermentation broths provided herein can comprise a liquid phase that contains non-adherent Methylobacterium. In certain embodiments, titers of non-adherent Methylobacterium in the liquid phase can be less than about 100,000, 10,000, or 1,000 CFU/ml. In certain embodiments, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, NLS0089, derivatives thereof, and Methylobacterium related thereto. In certain embodiments, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0037 and a derivative thereof.

    [0063] Biphasic culture methods provided can yield fermentation broths with RLN-inhibitory Methylobacterium sp. at a titer of greater than about 510.sup.8 colony-forming units per milliliter, at a titer of greater than about 110.sup.9 colony-forming units per milliliter, at a titer of greater than about 110.sup.10 colony-forming units per milliliter, at a titer of at least about 310.sup.10 colony-forming units per milliliter. In certain embodiments, fermentation broths provided herein can comprise RLN-inhibitory Methylobacterium sp. at a titer of at least about 510.sup.8 colony-forming units per milliliter to at least about 310.sup.10 colony-forming units per milliliter, at least about 510.sup.8 colony-forming units per milliliter to at least about 410.sup.10 colony-forming units per milliliter, or at least about 510.sup.8 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter. In certain embodiments, fermentation broths provided herein can comprise RLN-inhibitory Methylobacterium sp. at a titer of at least about 110.sup.9 colony-forming units per milliliter to at least about 310.sup.10 colony-forming units per milliliter, at least about 110.sup.9 colony-forming units per milliliter to at least about 410.sup.10 colony-forming units per milliliter, or at least about 110.sup.9 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter. In certain embodiments, fermentation broths provided herein will comprise RLN-inhibitory Methylobacterium sp. at a titer of at least about 110.sup.10 colony-forming units per milliliter to at least about 310.sup.10 colony-forming units per milliliter, at least about 110.sup.10 colony-forming units per milliliter to at least about 410.sup.10 colony-forming units per milliliter, or at least about 110.sup.10 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter. In certain embodiments, fermentation broths provided herein will comprise RLN-inhibitory Methylobacterium sp. at a titer of, at least about 310.sup.10 colony-forming units per milliliter to at least about 410.sup.10 colony-forming units per milliliter, or at least about 310.sup.10 colony-forming units per milliliter to at least about 610.sup.10 colony-forming units per milliliter. In certain embodiments, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, NLS0089, derivatives thereof, and Methylobacterium related thereto. In certain embodiments, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0069, and a derivative thereof.

    [0064] Solid substances with adherent RLN-inhibitory Methylobacterium sp. obtained as fermentation products can be used to make various compositions useful for treating plants or plant parts to inhibit RLN growth and/or reproduction or reduce RLN damage to a plant. Such compositions can comprise at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof. Compositions provided herein comprising RLN-inhibitory Methylobacterium sp., solid substances with RLN-inhibitory Methylobacterium sp. grown thereon, or comprising emulsions with RLN-inhibitory Methylobacterium sp. grown therein can be used to treat plants or plant parts. Plants, plant parts, and, in particular, plant seeds that have been at least partially coated or coated with the aforementioned compositions are thus provided. Also provided are processed plant products that contain any of the aforementioned compositions. Solid substances with adherent RLN-inhibitory Methylobacterium sp. can be used to make various compositions that are particularly useful for treating plant seeds. Seeds that have been at least partially coated with any of the aforementioned compositions are thus provided. Also provided are processed seed products, including, but not limited to, meal, flour, feed, and flakes that contain the fermentation broth products or compositions provided herein. In certain embodiments, the processed plant product will be non-regenerable (i.e. will be incapable of developing into a plant). In certain embodiments, the solid substance used in the fermentation product or composition that at least partially coats the plant, plant part, or plant seed or that is contained in the processed plant, plant part, or seed product comprises a solid substance and associated or adherent RLN-inhibitory Methylobacterium sp. that can be readily identified by comparing a treated and an untreated plant, plant part, plant seed, or processed product thereof. In certain embodiments, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, NLS0089, derivatives thereof, and Methylobacterium related thereto. In certain embodiments, the RLN-inhibitory Methylobacterium is selected from the group consisting of Methylobacterium NLS0021, NLS0038, NLS0069, and a derivative thereof.

    [0065] Compositions useful for treating plants or plant parts that comprise at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof, can also further comprise an agriculturally acceptable adjuvant or an agriculturally acceptable excipient. Such compositions can be in a liquid or dry form. An agriculturally acceptable adjuvant or an agriculturally acceptable excipient is typically an ingredient that does not cause undue phytotoxicity or other adverse effects when exposed to a plant or plant part. In certain embodiments, the solid substance can itself be an agriculturally acceptable adjuvant or an agriculturally acceptable excipient so long as it is not bacteriocidal or bacteriostatic to the Methylobacterium. In other embodiments, the composition further comprises at least one of an agriculturally acceptable adjuvant or an agriculturally acceptable excipient. Any of the aforementioned compositions can also further comprise a pesticide. Pesticides used in the composition include, but are not limited to, a nematicide, a fungicide, and a bacteriocide. In certain embodiments, the pesticide used in the composition is a pesticide that does not substantially inhibit growth of the Methylobacterium. As Methylobacterium are gram negative bacteria, suitable bacteriocides used in the compositions can include, but are not limited to, bacteriocides that exhibit activity against gram positive bacteria but not gram negative bacteria. Compositions provided herein can also comprise a bacteriostatic agent that does not substantially inhibit growth of the Methylobacterium. Bacteriostatic agents suitable for use in compositions provided herein include, but are not limited to, those that exhibit activity against gram positive bacteria but not gram negative bacteria. Any of the aforementioned compositions can also be an essentially dry product (i.e. having about 5% or less water content), a mixture of the composition with an emulsion, or a suspension.

    [0066] Agriculturally acceptable adjuvants used in the compositions that comprise at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof include, but are not limited to, components that enhance product efficacy and/or products that enhance ease of product application. Adjuvants that enhance product efficacy can include various wetters/spreaders that promote adhesion to and spreading of the composition on plant parts, stickers that promote adhesion to the plant part, penetrants that can promote contact of the active agent with interior tissues, extenders that increase the half-life of the active agent by inhibiting environmental degradation, and humectants that increase the density or drying time of sprayed compositions. Wetters/spreaders used in the compositions can include, but are not limited to, non-ionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, organo-silicate surfactants, and/or acidified surfactants. Stickers used in the compositions can include, but are not limited to, latex-based substances, terpene/pinolene, and pyrrolidone-based substances. Penetrants can include mineral oil, vegetable oil, esterified vegetable oil, organo-silicate surfactants, and acidified surfactants. Extenders used in the compositions can include, but are not limited to, ammonium sulphate, or menthene-based substances. Humectants used in the compositions can include, but are not limited to, glycerol, propylene glycol, and diethyl glycol. Adjuvants that improve ease of product application include, but are not limited to, acidifying/buffering agents, anti-foaming/de-foaming agents, compatibility agents, drift-reducing agents, dyes, and water conditioners. Anti-foaming/de-foaming agents used in the compositions can include, but are not limited to, dimethopolysiloxane. Compatibility agents used in the compositions can include, but are not limited to, ammonium sulphate. Drift-reducing agents used in the compositions can include, but are not limited to, polyacrylamides, and polysaccharides. Water conditioners used in the compositions can include, but are not limited to, ammonium sulphate.

    [0067] Methods of treating plants and/or plant parts with the compositions comprising at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof are also provided herein. Treated plants, and treated plant parts obtained therefrom, include, but are not limited to, Brassica sp. (e.g., B. napus, B. rapa, B. juncea), corn, wheat, rye, rice, alfalfa, rice, rye, sorghum, millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana), sunflower, safflower, soybean, tobacco, potato, peanuts, carrot, cotton, sweet potato (Ipomoea batatus), cassava, coffee, coconut, pineapple, citrus trees, cocoa, tea, banana, avocado, fig, guava, mango, olive, papaya, cashew, macadamia, almond, sugar beets, sugarcane, strawberry, oats, barley, tomato, lettuce, pepper, green beans, lima beans, peas, cucurbits such as cucumber, cantaloupe, and musk melon, turf, ornamentals, and conifers. Plant parts that are treated include, but are not limited to, leaves, stems, flowers, roots, seeds, fruit, tubers, coleoptiles, and the like. Ornamental plants and plant parts that can be treated include, but are not limited to azalea, hydrangea, hibiscus, roses, tulips, daffodils, petunias, carnation, poinsettia, and chrysanthemum. Seeds or other propagules of any of the aforementioned plants can be treated with the fermentation broths, fermentation broth products, fermentation products, and/or compositions provided herein.

    [0068] In certain embodiments, plants and/or plant parts are treated by applying compositions that comprise at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof as a spray. Such spray applications include, but are not limited to, treatments of a single plant part or any combination of plant parts. Spraying can be achieved with any device that will distribute the fermentation broths, fermentation broth products, fermentation products, and compositions to the plant and/or plant part(s). Useful spray devices include a boom sprayer, a hand or backpack sprayer, crop dusters (i.e. aerial spraying), and the like. Spraying devices and or methods providing for application of the fermentation broths, fermentation broth products, fermentation products, and compositions to either one or both of the adaxial surface and/or abaxial surface can also be used. Plants and/or plant parts that are at least partially coated with any of the aforementioned compositions are also provided herein. Also provided herein are processed plant products that comprise any of the aforementioned compositions.

    [0069] In certain embodiments, plants and/or plant parts are treated by applying compositions that comprise at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof as a soil drench, soil injection, and/or in-furrow deposit. Such soil drench, soil injections, and/or in-furrow deposit applications include, but are not limited to, treatments of a single plant part or any combination of plant parts. Soil drench, soil injections and/or in-furrow deposits can be achieved with any device that will distribute the compositions to the plant and/or plant part(s) and/or to the soil that the plant or plant parts have or will contact. Useful devices include, but are not limited to, soil injectors, in-furrow applicators, and the like.

    [0070] In certain embodiments, seeds are treated by exposing the seeds to compositions that comprise at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof. Seeds can be treated with the compositions provided herein by methods including, but not limited to, imbibition, coating, spraying, and the like. Seed treatments can be effected with both continuous and/or a batch seed treaters. In certain embodiments, the coated seeds can be prepared by slurrying seeds with a coating composition containing at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof and air drying the resulting product. Air drying can be accomplished at any temperature that is not deleterious to the seed or the Methylobacterium, but will typically not be greater than 30 degrees Centigrade. The proportion of coating that comprises a solid substance and RLN-inhibitory Methylobacterium sp. includes, but is not limited to, a range of 0.1 to 25% by weight of the seed, 0.5 to 5% by weight of the seed, and 0.5 to 2.5% by weight of seed. In certain embodiments, a solid substance used in the seed coating or treatment will have RLN-inhibitory Methylobacterium sp. adhered thereon. In certain embodiments, a solid substance used in the seed coating or treatment will be associated with RLN-inhibitory Methylobacterium sp. and will be a fermentation broth, fermentation broth product, or composition obtained by the methods provided herein. Various seed treatment compositions and methods for seed treatment disclosed in U.S. Pat. Nos. 5,106,648, 5,512,069, and 8,181,388 are incorporated herein by reference in their entireties and can be adapted for use with an active agent comprising the compositions provided herein. In certain embodiments, the composition used to treat the seed can contain agriculturally acceptable excipients that include, but are not limited to, woodflours, clays, activated carbon, diatomaceous earth, fine-grain inorganic solids, calcium carbonate and the like. Clays and inorganic solids that can be used with the fermentation broths, fermentation broth products, or compositions provided herein include, but are not limited to, calcium bentonite, kaolin, china clay, talc, perlite, mica, vermiculite, silicas, quartz powder, montmorillonite and mixtures thereof. Agriculturally acceptable adjuvants that promote sticking to the seed that can be used include, but are not limited to, polyvinyl acetates, polyvinyl acetate copolymers, hydrolyzed polyvinyl acetates, polyvinylpyrrolidone-vinyl acetate copolymer, polyvinyl alcohols, polyvinyl alcohol copolymers, polyvinyl methyl ether, polyvinyl methyl ether-maleic anhydride copolymer, waxes, latex polymers, celluloses including ethylcelluloses and methylcelluloses, hydroxy methylcelluloses, hydroxypropylcellulose, hydroxymethylpropylcelluloses, polyvinyl pyrrolidones, alginates, dextrins, malto-dextrins, polysaccharides, fats, oils, proteins, karaya gum, jaguar gum, tragacanth gum, polysaccharide gums, mucilage, gum arabics, shellacs, vinylidene chloride polymers and copolymers, soybean-based protein polymers and copolymers, lignosulfonates, acrylic copolymers, starches, polyvinylacrylates, zeins, gelatin, carboxymethylcellulose, chitosan, polyethylene oxide, acrylamide polymers and copolymers, polyhydroxyethyl acrylate, methylacrylamide monomers, alginate, ethylcellulose, polychloroprene and syrups or mixtures thereof. Other useful agriculturally acceptable adjuvants that can promote coating include, but are not limited to, polymers and copolymers of vinyl acetate, polyvinylpyrrolidone-vinyl acetate copolymer and water-soluble waxes. Various surfactants, dispersants, anticaking-agents, foam-control agents, and dyes disclosed herein and in U.S. Pat. No. 8,181,388 can be adapted for use with an active agent comprising the fermentation broths, fermentation broth products, or compositions provided herein.

    [0071] Provided herein are compositions that comprise at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof that provide control of RLN damage to plants, plant parts, and plants obtained therefrom relative to untreated plants, plant parts, and plants obtained therefrom that have not been exposed to the compositions. In certain embodiments, plant parts, including, but not limited to, a seed, a leaf, a fruit, a stem, a root, a tuber, a pollen grain, or a coleoptile can be treated with the compositions provided herein to inhibit of RLN growth and/or reproduction and/or reduce of RLN damage to a plant. Treatments or applications can include, but are not limited to, spraying, coating, partially coating, immersing, and/or imbibing the plant or plant parts with the compositions provided herein. In certain embodiments, a seed, a leaf, a fruit, a stem, a root, a tuber, or a coleoptile can be immersed and/or imbibed with a liquid, semi-liquid, emulsion, or slurry of a composition provided herein. Such seed immersion or imbibition can be sufficient to provide for inhibition of RLN growth and/or reductions in RLN damage in a treated plant or plant part in comparison to an untreated plant or plant part. Such inhibition of RLN growth and/or reductions in RLN damage includes, but is not limited to inhibition of RLN development and/or reproduction, disruption of RLN feeding behaviors, inhibition of motility, and/or reductions in damage to roots, tubers, or other plant parts relative to untreated plants. In certain embodiments, plant seeds can be immersed and/or imbibed for at least 1, 2, 3, 4, 5, or 6 hours. Such immersion and/or imbibition can, in certain embodiments, be conducted at temperatures that are not deleterious to the plant seed or the Methylobacterium. In certain embodiments, the seeds can be treated at about 15 to about 30 degrees Centigrade or at about 20 to about 25 degrees Centigrade. In certain embodiments, seed imbibition and/or immersion can be performed with gentle agitation.

    [0072] Amounts of the compositions that comprise at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof sufficient to provide for a reduction in RLN damage of a plant or plant part can thus be determined by measuring any or all of changes in RLN feeding behavior, RLN growth, RLN reproduction, RLN motility, numbers of recovered RLN, numbers of viable RLN, and/or the adverse effects of RLN feeding in treated plants or plant parts relative to untreated plants or plant parts. Adverse effects of RLN growth and/or reproduction in a plant that can be measured include any type of plant tissue damage or necrosis (e.g., damage of plant parts including but not limited to roots and tubers), any type of plant yield reduction, any reduction in the value of the crop plant product, and/or increases in fungal disease incidence. In certain embodiments, an RLN damage rating scale can be used to assess inhibition of RLN growth and/or reproduction and/or reductions in damage to a plant or plant part.

    [0073] Compositions provided herein comprising at least one of a RLN-inhibitory Methylobacterium sp., a solid substance with adherent RLN-inhibitory Methylobacterium sp., emulsions with RLN-inhibitory Methylobacterium sp. grown therein, a RLN-inhibitory cell-free culture supernatant, fraction thereof, concentrate thereof, or any combination thereof are therefore expected to be useful in inhibiting RLN growth, motility, and/or reproduction and/or reducing RLN damage in a wide variety of plants, including, but not limited to: Brassica sp. (e.g., B. napus, B. rapa, B. juncea), corn, wheat, rye, rice, alfalfa, rice, rye, sorghum, millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana), sunflower, safflower, soybean, tobacco, potato, peanuts, carrot, cotton, sweet potato (Ipomoea batatus), cassava, coffee, coconut, pineapple, citrus trees, cocoa, tea, banana, avocado, fig, guava, mango, olive, papaya, cashew, macadamia, almond, sugar beets, sugarcane, strawberry, oats, okra, onion, barley, tomato, lettuce, pepper, green beans, lima beans, peas, cucurbits such as cucumber, cantaloupe, and musk melon, turf, ornamentals, and conifers. Compositions provided herein are also expected to be useful in inhibiting growth and/or reducing damage caused by Pratylenchus brachyurus, Pratylenchus coffeae, P. neglectus, Pratylenchus penetrans, Pratylenchus scribneri, Pratylenchus thornei, Pratylenchus vulnus, and Pratylenchus zeae.

    [0074] In certain embodiments, an amount of a composition provided herein that is sufficient to provide for inhibition of RLN damage in a plant or plant part can be a composition with RLN-inhibitory Methylobacterium sp. at a titer of at least about 110.sup.4 colony-forming units per milliliter, at least about 110.sup.5 colony-forming units per milliliter, at least about 110.sup.6 colony-forming units per milliliter, at least about 510.sup.6 colony-forming units per milliliter, at least about 110.sup.7 colony-forming units per milliliter, at least about 510.sup.8 colony-forming units per milliliter, at least about 110.sup.9 colony-forming units per milliliter, at least about 110.sup.10 colony-forming units per milliliter, or at least about 310.sup.10 colony-forming units per milliliter. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for inhibition of RLN growth and/or reproduction and/or reduction of RLN damage to a plant or plant part can be a composition with RLN-inhibitory Methylobacterium sp. at a titer of at least about 110.sup.4 colony-forming units per milliliter, at least about 110.sup.5 colony-forming units per milliliter, about least about 110.sup.6 colony-forming units per milliliter, at least about 510.sup.6 colony-forming units per milliliter, at least about 110.sup.7 colony-forming units per milliliter, or at least about 510.sup.8 colony-forming units per milliliter to at least about 610.sup.10, 110.sup.11, 510.sup.11, or 110.sup.12 colony-forming units per milliliter of a liquid or an emulsion. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for inhibition of RLN growth and/or reproduction and/or reduction of RLN damage to a plant or plant part can be a fermentation broth product with a RLN-inhibitory Methylobacterium sp. titer of a solid phase of that product is at least about 110.sup.4 colony-forming units per gram, at least about 110.sup.5 colony-forming units per gram, at least about 110.sup.6 colony-forming units per gram, at least about 510.sup.6 colony-forming units per gram, at least about 110.sup.7 colony-forming units per gram, or at least about 510.sup.8 colony-forming units per gram to at least about 610.sup.10 colony-forming units of Methylobacterium per gram, at least about 110.sup.11 colony-forming units of Methylobacterium per gram, at least about 110.sup.12 colony-forming units of Methylobacterium per gram, at least about 110.sup.13 colony-forming units of Methylobacterium per gram, or at least about 510.sup.13 colony-forming units of Methylobacterium per gram of the solid phase. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for inhibition of RLN growth, motility, and/or reproduction and/or reduction of RLN damage to a plant or plant part can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per gram, at least about 510.sup.6 colony-forming units per gram, at least about 110.sup.7 colony-forming units per gram, or at least about 510.sup.8 colony-forming units per gram to at least about 610.sup.10 colony-forming units of Methylobacterium per gram, at least about 110.sup.11 colony-forming units of Methylobacterium per gram, at least about 110.sup.12 colony-forming units of Methylobacterium per gram, at least about 110.sup.13 colony-forming units of Methylobacterium per gram, or at least about 510.sup.13 colony-forming units of Methylobacterium per gram of particles in the composition containing the particles that comprise a solid substance wherein a mono-culture or co-culture of RLN-inhibitory Methylobacterium sp. is adhered thereto. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for inhibition of RLN growth, motility, and/or reproduction and/or reduction of RLN damage to a plant or plant part can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per mL, at least about 510.sup.6 colony-forming units per mL, at least about 110.sup.7 colony-forming units per mL, or at least about 510.sup.8 colony-forming units per mL to at least about 610.sup.10 colony-forming units of Methylobacterium per mL in a composition comprising an emulsion wherein a mono-culture or co-culture of a RLN-inhibitory Methylobacterium sp. adhered to a solid substance is provided therein or grown therein. In certain embodiments, an amount of a composition provided herein that is sufficient to provide for inhibition of RLN growth motility, and/or reproduction and/or reduction of RLN damage to a plant or plant part can be a composition with a Methylobacterium titer of at least about 110.sup.6 colony-forming units per mL, at least about 510.sup.6 colony-forming units per mL, at least about 110.sup.7 colony-forming units per mL, or at least about 510.sup.8 colony-forming units per mL to at least about 610.sup.10 colony-forming units of Methylobacterium per mL of in a composition comprising an emulsion wherein a mono-culture or co-culture of a RLN-inhibitory Methylobacterium sp. is provided therein or grown therein.

    EXAMPLES

    [0075] The following examples are included to demonstrate certain embodiments. It will be appreciated by those of skill in the art that the techniques disclosed in the following examples represent techniques determined by the Applicants to function well in the practice of the disclosure. However, those of skill in the art should, in light of the instant disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed, while still obtaining like or similar results, without departing from the scope of the invention.

    Example 1. Root Lesion Nematodes (RLN) In Vitro Assay

    [0076] Pratylenchus penetrans (WI isolate) in all vermiform stages were purchased from the MacGuidwin Nematology Lab, University of Wisconsin-Madison. (available on the http internet site labs.russell.wisc.edu/macguidwinlab/category/uncategorized).

    [0077] The growth medium was a liquid base medium amended with a solid substance. Thus, the medium was comprised of both a liquid phase and a solid phase.

    [0078] The liquid base medium was Ammonium Mineral Salts (AMS) containing peptone, glutamate as the carbon source, and diatomaceous earth as the solid substance.

    [0079] To prepare this medium, three stock solutions were made as follows.

    [0080] Stock solution I was made by dissolving 35 grams of anhydrous dibasic potassium phosphate and 27 grams of anhydrous monobasic potassium phosphate in a final volume of 1 liter of distilled water. Stock solution I was at a 50 concentration.

    [0081] Stock solution II was made by dissolving 50 grams of magnesium sulfate heptahydrate and 25 grams of anhydrous ammonium chloride in a final volume of 1 liter of distilled water. Stock Solution II was at a 50 concentration.

    [0082] Stock solution III was made by dissolving 10 grams calcium chloride dihydrate in one liter of distilled water. Stock Solution III was at 50 concentration.

    [0083] Iron (II) sulfate stock solution was made by dissolving 5 g iron (II) sulfate heptahydrate in one liter of distilled water. Iron (II) sulfate stock solution was at 1000 concentration.

    [0084] To prepare one liter of growth medium, 20 ml of stock solution I, 20 ml of stock solution II, 20 ml of stock solution III, 1 ml iron (II) stock solution, 10 grams of peptone, 15 grams of sodium glutamate, and 2 grams of diatomaceous earth were added to 940 ml of distilled water. The growth medium was autoclaved before use.

    [0085] Single PPFM colonies were used to inoculate cultures. The cultures were grown for 4 days at 30 degrees centigrade with shaking at 200 rpm to titer of 110.sup.7 to 110.sup.8 CFU/ml.

    [0086] Two ml of each culture was spun down at 10,000g for 5 min, and the supernatant was passed through a 0.2 micron acrodisc syringe filter (Pall Corporation, Port Washington, N.Y.) to obtain a cell-free culture supernatant. An antibiotic solution with final concentrations of 0.025 mg/ml chlorotetracycline (Sigma-Aldrich, St. Louis, Mo.), 0.025 mg/ml chloramphenicol (Sigma-Aldrich, St. Louis, Mo.), 0.05 mg/ml Nystatin (Sigma-Aldrich, St. Louis, Mo.), and 2.5% ethanol was used to control growth of microorganisms over the course of the experiment. 2:1:1 supernatant: antibiotic solution: 200 P. penetrans nematodes in water were added to each well of a 96 well plate. Each plate was divided into 5 complete randomized blocks, with each isolate and control repeated once per block. The activity of the P. penetrans nematodes was rated after 3 days under a dissecting microscope. The rating system was 1=no movement, nematodes mostly straight; 2=some moving, curly; 3=most/all moving, curly.

    [0087] The experiment was repeated twice. A linear mixed model was fitted using the lmer function in the lme4 package (Bates, D., Maechler, M., Bolker, B., & Walker, S. (2014). lme4: Linear mixed-effects models using Eigen and S4. R package version 1.1-7, Available on the http internet site CRAN.R-project.org/package=lme4)) in R (R Core Team (2013). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria, available on the world wide web internet site R-project.com) with random effect of experiment. P values were estimated using a normal distribution. Results are shown in Table 3.

    TABLE-US-00003 TABLE 3 Effect of PPFM cell-free culture supernatants on RLN activity. Average Difference from Strain Activity Score Control (%) p value Control 1.550 NLS0017 1.500 3% 0.778 NLS0020 1.833 18% 0.120 NLS0021 1.000 35% 0.002 NLS0037 1.611 4% 0.738 NLS0038 1.100 29% 0.011 NLS0042 1.000 35% 0.002 NLS0934 1.150 26% 0.024 NLS0046 1.889 22% 0.063 NLS0062 1.200 23% 0.049 NLS0064 1.450 6% 0.573 NLS0065 1.250 19% 0.091 NLS0066 1.650 6% 0.573 NLS0068 1.300 16% 0.159 NLS0069 1.100 29% 0.011 NLS0089 1.150 26% 0.024

    [0088] Each line in the table is the results of 5 replicates in each of two separate experiments. A linear mixed model was fitted with the random effect of experiment.

    [0089] Each line in the table is the results of inverse variance meta-analysis combining the results of six independent experiments. Each strain was tested in at least three separate experiments.

    [0090] Cell-free culture supernatants from strains NLS0021, NLS0038, NLS0042, NLS0934, NLS0062, NLS0069, and NLS0089 show significant decreases in activity scores for P. penetrans. Cell-free culture supernatants from strains NLS0017, NLS0037, NLS0064, and NLS0066 showed negligible effects on activity scores for P. penetrans.

    Example 2. Root Lesion Nematodes (RLN) In Planta Assay

    [0091] Pratylenchus penetrans (WI isolate) in all vermiform stages were purchased from the MacGuidwin Nematology Lab, University of Wisconsin-Madison. (available on the http internet site labs.russell.wisc.edu/macguidwinlab/category/uncategorized).

    [0092] Tomato seeds (Solanum lycopersicum variety Charger or Sweet Olive, Johnny's Selected Seeds, Winslow, Me.) in horticubes were treated with 0.25 ml PPFM solution in water at concentration of 110.sup.7 to 110.sup.8 CFU/ml. This treatment simulates an in-furrow treatment applied at planting. Control seeds were treated with 0.25 ml water. Plants were grown for approximately two weeks in the greenhouse before transplanting to autoclaved 9:1 sand:soil mixture in pots. Plants were watered as needed with 2.5 g/L Jack's Professional 15-16-17 Peat-Lite Fertilizer. Plants were grown for approximately one additional week before inoculation with P. penetrans nematodes. Inoculum was prepared by diluting the purchased nematode solution to concentration of 100 nematodes/ml and adding 5 ml to holes around the roots in each pot (500 nematodes/pot total). Plants were grown approximately 6 additional weeks before harvest.

    [0093] At harvest, the plant height was measured. Shoots were dried 2-3 days and dry weights were measured. Roots were extracted from the sandy soil, rinsed, and blotted dry. Root fresh and dry weights were measured. 250 ml of sandy soil was soaked in 800 ml water for approximately 1 hour with occasional stirring. The mixture was stirred and allowed to settle 1 min before decanting the water through #40 sieve. The flowthrough was stirred and allowed to settle before decanting through #170 sieve. The material caught on the #170 screen was backwashed into a clean beaker. The flowthrough was decanted through #325 sieve, and the material caught on the #325 screen was backwashed into the same clean beaker. The volume of this solution was measured and the number of nematodes in 10 microliters was counted three times under a dissecting microscope to calculate the total number of nematodes.

    [0094] Each experiment contained 6 replicates per isolate arranged in 3 randomized complete blocks. The values obtained from each experiment were normalized to the average values obtained from the control plants. A linear mixed model was fitted using the lmer function in the lme4 package (Bates, D., Maechler, M., Bolker, B., & Walker, S. (2014). lme4: Linear mixed-effects models using Eigen and S4. R package version 1.1-7, available on the http internet site CRAN.R-project.org/package=lme4) in R (R Core Team (2013). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria, available on the world wide web internet site R-project.com) with random effect of block. An effect size and p value for each strain was calculated from results of at least three separate experiments in a total of five separate experiments using the inverse variance meta-analysis method (Lipsey, M. W., & Wilson, D. B. (2001). Practical meta-analysis. Thousand Oaks, Calif.: Sage Publications, available on the http internet site mason.gmu.edu/dwilsonb/ma.html.). Results are shown in Table 4.

    TABLE-US-00004 TABLE 4 Effects of seed treatments (simulated in-furrow treatment) on tomato growth parameters and RLN counts. Fresh Root RLN/mg Shoot Weight Weight Total RLN Fresh Root Effect p Effect p Effect p Effect p Strain Size value Size value Size value Size value NLS0021 4% 0.326 14% 0.056 9% 0.218 13% 0.088 NLS0037 1% 0.469 3% 0.358 4% 0.384 15% 0.101 NLS0038 11% 0.227 24% 0.064 10% 0.224 39% 0.001 NLS0069 24% 0.054 28% 0.038 11% 0.211 21% 0.048

    [0095] Each line in the table is the results of inverse variance meta-analysis combining the results of five independent experiments. Each strain was tested in at least three separate experiments.

    [0096] Treatment with NLS0069 produces a statistically significant increase in both shoot weight and fresh root weight, while treatment with NLS0021 and NLS0038 have statistically significant increases on fresh root weight. NLS0038 and NLS0069 also significantly reduce the amount of RLN per mg root. NLS0037 does not have an inhibitory effect on the amount of RLN. These results are in agreement with the results of the RLN in vitro assay presented in Table 1.

    Example 3. Field Tests

    [0097] A field trial was conducted during the summer of 2016 to determine the ability of PPFMs to suppress root lesion nematode (RLN; Pratylenchus penetrans) on spring wheat (Triticum aestivum L.; var. RB07, supplied by Johnson Grain Inc.). The trial was planted on May 30, 2016 and harvested on Oct. 11, 2016. Metrics collected include: Stand, vigor at 7-days post planting, vigor at 21-days post planting, plot height at Feekes 10.5 growth stage, flowering at Feekes 10.5, lodging, yield, pre-plant nematode counts and in-season nematode counts for RLN, stunt nematode (Tylenchorhynchus spp.), and total plant parasitic nematodes. The experiment was designed as a randomized complete block with five treatments (Table 5) and four replications. Each experimental plot consisted of four 10-foot rows, with 50 grams of seed planted per plot. The entire experiment was surrounded by two border rows to mitigate edge effects.

    [0098] Wheat seed for the trial was treated at NewLeaf Symbiotics' laboratory facilities in St. Louis, Mo. and shipped to Moccasin, Mont., where the field trial was conducted. All PPFM treatments were applied at a rate of 14 mL PPFM culture concentrate per pound of seed. PPFM culture concentrates had a concentration in the range of 110.sup.9 to 110.sup.10 colony forming units (CFUs) per mL of concentrate. A portion of treated seed was retained at the NewLeaf Symbiotic's facilities for PPFM enumeration. Enumeration confirmed that treatment was successful, with on-seed concentrations remaining at or above 110.sup.6 colony forming units per seed until weeks after the treatment date.

    TABLE-US-00005 TABLE 5 2016 Spring Wheat Lesion Nematode Trial Treatments Treatment Number Treatment Application Timing Rate 1 Untreated control N/A N/A 2 NLS0021 Seed treatment 14 mL/lb 3 NLS0038 Seed treatment 14 mL/lb 4 NLS0066 Seed treatment 14 mL/lb 5 NLS0069 Seed treatment 14 mL/lb

    [0099] Prior to planting, root lesion and stunt nematode populations were enumerated for each repetition by collecting 4 soil cores of 25 g wet weight and counting the number of nematodes within each core. The average count from the four cores collected per block was calculated to provide baseline estimates for root lesion, stunt, and total plant parasitic nematode populations (Table 6). Root and stunt nematode population were again enumerated after planting, at the Feekes 3 and Feekes 7 growth stages. Multiple 25 g subsamples were collected per plot and the counts in these subsamples were averaged and used to calculate number of nematodes per kg of soil within the plot (Table 7). Throughout the growing season, various data were collected, including stand, vigor, plant height, flowering, time, and yield (Table 8).

    TABLE-US-00006 TABLE 6 2016 Spring Wheat Plant Parasitic Nematode Pre-Plant Counts Repetition Root lesion/kg soil Stunt/kg soil Total PP.sup.1 Nem/kg soil Rep 1 274 704 978 Rep 2 588 1412 2001 Rep 3 2359 580 2939 Rep 4 1056 313 1369 Average 1069 752 1822 .sup.1PP Nem = Plant Parasitic Nematode (Root lesion + stunt)

    TABLE-US-00007 TABLE 7 2016 Spring Wheat Root Lesion Nematode Trial In-season Counts Treatment Pre-Plant Feekes 3 Feekes 7 UTC 1069.00 2930.00 4300.00 A.sup.2 NLS0021 1069.00 500.00 2330.00 B NLS0038 1069.00 2890.00 1980.00 B NLS0066 1069.00 3110.00 2840.00 AB NLS0069 1069.00 2070.00 1430.00 B .sup.2Counts followed by the same letter do not differ significantly from one-another by Fisher's LSD; No significant differences were found between counts taken at the Feekes 3 growth stage.

    TABLE-US-00008 TABLE 8 2016 Spring Wheat Root Lesion Nematode Trial Data Summary Height Flowering 7DAE 21DAE 7DAE 21DAE Feekes Feekes Yield Stand Stand Vigor Vigor 10.5 10.5 (kg/A) Trt (SEM) (SEM) (SEM) (SEM) (SEM) (SEM (SEM) NLS0021 21.38 46.25 8.25 8.5 45.6 45.60 205.50 (1.09) (5.13) (0.75) (0.29) (0.29) (0.29) (29.58) NLS0038 24.63 46.50 8.25 8.50 44.25 44.25 203.85 (0.80) (2.89) (0.25) (0.50) (0.99) (0.99) (25.86) NLS0066 18.50 34.13 7.75 8.75 47.25 47.25 230.35 (4.46) (1.84) (0.25) (0.25) (2.08) (2.08) (30.23) NLS0069 20.88 38.88 8.00 8.50 44.60 44.60 209.45 (2.60) (1.91) (0.82) (0.29) (0.37) (0.37) (13.64) UTC 20.63 42.13 7.50 9.0 45.85 45.85 213.42 (3.79) (3.07) (0.29) (0.00) (1.37) (1.37) (15.57)

    [0100] Three of four PPFM treatments applied to plants in this trial, NLS0021, NLS0038, and NLS0069, significantly suppressed root lesion nematode populations in spring wheat at growth stage Feekes 7. Data were analyzed using the JMP statistical analysis software package (version 12.0; SAS Institute, Cary, N.C., 1989-2016). A mixed model was fit in the Fit Model functionality with Repetition as a random factor and treatment as a fixed factor. Treatment means and post-hoc means comparisons were extracted from this analysis. The finding that NLS0021, NLS0038, and NLS0069 significantly reduced root lesion nematode populations while NLS0066 did not is consistent with findings from in vitro assays reported in Example 1 and supports the positive data for isolates NLS0021, NLS038, and NLS0069 reported in Example 2. Stunt nematodes were present in the soil but their populations were not significantly affected by the PPFM treatments.

    [0101] Of the four strains tested, none significantly impacted yield or other growth parameters measured. This indicates that seed treatment with PPFMs presents no deleterious effects on germination, vigor, or yield of spring wheat. The trial was planted later than is ideal for spring wheat in this region of Montana. As a result, possible benefits from PPFM application to seeds may have been masked by the late planting date.

    [0102] Having illustrated and described the principles of the present disclosure, it should be apparent to persons skilled in the art that the disclosure can be modified in arrangement and detail without departing from such principles.

    [0103] Although the materials and methods of this disclosure have been described in terms of various embodiments and illustrative examples, it will be apparent to those of skill in the art that variations can be applied to the materials and methods described herein without departing from the concept, spirit and scope of the disclosure. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.