Cornus florida Tree Named 'Erica's Appalachian Sunrise'

20200323117 ยท 2020-10-08

    Inventors

    Cpc classification

    International classification

    Abstract

    A new and distinct cultivar of flowering dogwood tree, which produces both fully dark red bracts and lighter red to pink bracts is provided. This dogwood tree is botanically known as Cornus florida and referred to by the following cultivar name: Erica's Appalachian Sunrise.

    Claims

    1. A new and distinct cultivar of Dogwood tree, Cornus Florida, named ERICA'S APPALACHIAN SUNRISE, as illustrated and described.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0005] FIG. 1. Photograph of one type of bracts and flowers of the dogwood cultivar Erica's Appalachian Sunrise. This bract has fully dark red coloration and is less than about 5% of the bracts produced by the cultivar. Colors in the photograph may differ from actual colors due to lighting and light reflectance.

    [0006] FIG. 2. Photograph of Erica's Appalachian Sunrise dogwood cultivar showing the other type of bract and flowers produced more than about 95% of the time on the dogwood tree, which has lighter red or more pink bracts. Colors in the photograph may differ from actual colors due to lighting and light reflectance.

    [0007] FIG. 3. Photograph of new leaf growth on Erica's Appalachian Sunrise. Colors in the photograph may differ from actual colors due to lighting and light reflectance.

    [0008] FIG. 4. Photographs of the bracts and flowers of dogwood cultivars Cherokee Brave and Karen's Appalachian Blush, (U.S. Plant Pat. No. 13,165), which were initially crossed. Results show that the resulting F1 cultivar, Erica's Appalachian Sunrise, is not, as was expected, related to Karen's Appalachian Blush, but is the result of self-pollination of Cherokee Brave (U.S. Plant Pat. No. 10,166). It can be seen that the lighter red or pink bracts of Erica's Appalachian Sunrise (shown in FIG. 2) closely resemble the bracts of the parent, Cherokee Brave.

    [0009] FIG. 5. Photograph of the less commonly produced bracts and flowers, less than about 5%, of the dogwood cultivar Erica's Appalachian Sunrise (topfully dark, red bracts), and those of Karen's Appalachian Blush (bottom left) and Cherokee Brave (bottom right).

    DETAILED DESCRIPTION OF THE NEW VARIETY

    [0010] A new and distinct cultivar of flowering dogwood tree producing both fully dark red bracts and lighter red or pink bracts. Both types of bracts are significantly smaller than the bracts of the parent cultivar, Cherokee Brave. This dogwood tree cultivar is botanically known as Cornus florida and referred to by the following cultivar name: Erica's Appalachian Sunrise. This cultivar appears to be highly resistant to powdery mildew caused by Erisphe pulchra.

    [0011] This new and distinct dogwood tree cultivar is a product of self-pollination of the dogwood cultivar Cherokee Brave. The subject dogwood tree cultivar differs from Cherokee Brave in that the instant cultivar produces significantly smaller and both fully dark red bracts and lighter red bracts and also exhibits greater resistance to powdery mildew.

    DETAILED BOTANICAL DESCRIPTION

    [0012] The following observations, measurements and comparisons describe this cultivar grown in Maryville, Tenn. Trees used for this description were about ten (10) years old. Both the fully dark red bracts and lighter red to pink bracts are substantially the same size, though significantly smaller than the bracts produced by the parent cultivar. Plant hardiness is expected to be zones 4-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart, The Royal Horticultural Society, London, UK, 4.sup.th Edition, 2001, except where general terms of ordinary dictionary significance are used.

    [0013] A bee-mediated pollination between the dogwood cultivars Cherokee Brave and Karen's Appalachian Blush was conducted in April of 2009. Seeds were collected from both cultivars and planted in a greenhouse in Knoxville, Tenn. This new and distinct dogwood tree cultivar was discovered among the planting and germination of the seeds harvested from Cherokee Brave. The following Table 1 shows the alleles at nine (9) loci compared between the cultivars Karen's Appalachian Blush (U.S. Plant Pat. No. 13,165), Cherokee Brave, and the new cultivar Erica's Appalachian Sunrise. As seen in Table 1, the alleles for Erica's Appalachian Sunrise are identical at all nine (9) loci to those of Cherokee Brave and have no alleles that match Karen's Appalachian Blush. This demonstrates conclusively that dogwood cultivar Erica's Appalachian Sunrise was the result of self-pollination of Cherokee Brave. Asexual reproduction of Erica's Appalachian Sunrise by grafting of axillary buds onto seedling rootstocks has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetatively propagated generations.

    TABLE-US-00001 TABLE 1 Allelic Comparisons at Nine (9) loci for dogwood cultivars Karen's Appalachian Blush (KAB), Cherokee Brave (CB), and Erica's Appalachian Sunrise (EAS) Loci/Primer Cultivar CF213 CF191 CF273 CF322 CF585 CF597 CF634 CF713 CF562 KAB 270:270 132:169 140:144 137:173 167:187 114:126 120:126 154:154 208:208 (as base- pair size) CB 267:278 144:144 133:142 154:154 174:174 105:120 113:113 144:144 212:225 (female) (as base- pair size) EAS 267:278 144:144 133:142 154:154 174:174 105:120 113:113 144:144 212:225 (F1) (as base- pair size)

    TABLE-US-00002 TABLE2 SimpleSequenceRepeatsandAssociatedPrimers forNineLocisharedbytheDogwoodCultivars Erica'sAppalachianSunriseandCherokeeBrave GenBank Forwardand Re- acces- ReversePrimer peated sionno. Locus Sequences(5-3) Seq. ED651856 CF191 F:AACCTGCATCTTCCCCAAGT (AG).sub.20 (SEQIDNO:1) T(GA).sub.12 R:CCTTTTACCAACCCAACACG (GAA).sub.4 (SEQIDNO:2) ED651874 CF213 F:TGCAAATGGTTATTGATTGCT (CT).sub.9 CTC(SEQIDNO:3) (GT).sub.12 R:ATTTGTTTCCCATGACCTGAA AGA(SEQIDNO:4) ED651920 CF273 F:TCATATTTATGCTTTCCTTGC (AC).sub.14 CGT(SEQIDNO:5) R:GTGATCCTCTCCTAAGGACTT CCA(SEQIDNO:6) ED651957 CF322 F:CTAACCTGCATCTTCCCCAAG (AG).sub.20 (SEQIDNO:7) TG(AG).sub.12 R:TTTACCAACCCAACACGACAC (SEQIDNO:8) ER870584 CF562 F:CCAGAGGTATGAATTCTGTGT (GT).sub.16 (SEQIDNO:9) R:CTTGCAAATTGTTGTAATGAA (SEQIDNO:10) ER870607 CF585 F:AACGAAGCAAGCAAAACAATC (AT).sub.7 (SEQIDNO:11) (GT).sub.11 R:ACCCCACCACTTCATCTCTC (SEQIDNO:12) ER870619 CF597 F:AAGTCAGATCATTTCAGATTA (AC).sub.13 ACA(SEQIDNO:13) R:CGAATTGACGATAAATACAAA ATA(SEQIDNO:14) ER870656 CF634 F:GAAATTCAAATTTTAAAGAAG (AG).sub.14 TCC(SEQIDNO:15) R:TTGTATAGTACTTCAAGGCCA CT(SEQIDNO:16) ER870735 CF713 F:GATACTTATGCAATTAGGACA (TC).sub.18 CAA(SEQIDNO:17) R:GTAACAATGGTGGAAGGAAG (SEQIDNO:18)

    [0014] The cultivar Erica's Appalachian Sunrise has some phenotypic similarities to the cultivar Cherokee Brave, but also distinct differences. The following Table 3 provides a comparison of those characteristics for each cultivar that have been observed. Measurements are provided as averages (with ranges also provided as indicated):

    TABLE-US-00003 TABLE 3 Comparison of Characteristics for Three Dogwood Tree Cultivars Erica's Karen Appalachian Cherokee Appalachian Character Sunrise Brave Blush 1 Tree Height 2 meters 2-3 meters 2-3 meters (observation) (at 8 years) (10 -15 years) (10 -15 years) 2 Tree Form Branching/Spreading Branching/Spreading Narrow few branches 3 Growth Rate Slow 16 cm/year Moderate 24 cm/year Slow 12 cm/year 4 Spread of Tree 1.5 meters 2.0 meters 0.8 meters 5 Trunk Diam. at 6.5 cm 8 cm 5 cm 1 meter 6 Trunk Texture Smooth Smooth Smooth 7 Primary Trunk 144A New Growth 144A New Growth 144C New Growth Color/New Older Mature Older Mature Older Mature Branches/ 201B/196B 201B/196B 202A/196B Texture Smooth Smooth Smooth 8 Presence of Red with Green Red with Green Green 143B anthocyanin Mainly 61B with Mainly 61B with (observation) some 143C some 143C Coloration by anthocyanin on the immature leaf upper side 9 Color of mature Green Green Group 136C, 144C to 144B leaf upper 143C and some 61B with very little red Both surfaces surface/lower More red than (mostly Green 136C surface Cherokee Brave for the growing and red is persistent season) through growing season/ Green 143C 10 Color of leaves in Red-Purple 71A Red-Purple 71A 71C to 71D autumn (observation) 11 Leaf shape Ovate Ovate Ovate 12 Leaf Margin Entire Entire Entire 13 Leaf Tip Cuspidate Cuspidate Cuspidate 14 Leaf Base Cuneate Cuneate Cuneate 15 Leaf Venation/ Palmate/Smooth Palmate/Smooth Palmate/Smooth Texture with hairs with hairs with hairs 16 Leaf Length 4.1-6.25 cm 5.0-7.2 cm 5.0-8.0 cm 17 Leaf Width 0.8-1.2 cm 1.0-2.0 cm 2.0-2.5 cm 18 Petiole Length <1 cm <1 cm 1.0-1.3 cm 19 Petiole Color 134C 134C 149A 20 Petiole Texture Smooth Smooth Smooth 21 Flower diameter 6.5 mm open 6.5 mm open 6.5 mm open (measurement) 22 Floret color when Yellow Green 150A- Yellow Green 150A- Yellow Green open 150B with some 150B with some 150A-150B with (observation) purple 76A to 76B purple 76A to 76B some purple 76A on top on top to 76B on top 23 Uniformity of See 24-29 See 24-29 See 24-29 bract size (observation) 24 Bract overlapping Overlapping tips Slightly overlap Very little overlap (observation for and edges both types) 25 Whole shape of Spade-shaped with Tear-drop with Linear bracts point at the base blunt tip (observation) 26 Inner Bract length 23.1 mm 38.8 mm 29.3 mm (measurement) (both types) 27 Inner Bract width 16.8 mm 35.9 mm 20.4 mm (measurement)- (both types) modified cleft 28 Outer Bract 18.9 mm 38.5 mm 23.8 mm width (measure) (both types) 29 Outer Bract 15.3 mm 30.3 mm 31.8 mm length (both types) (measurement) 30 Number of bracts 4 4 4 31 Bract color 63C-striated red- 63C-striated red- White 155B (light red) veined, on white veined, on white, (95%) pure white base of bract 32 Bract color 182A to 181B 63C striated red- Some pink 49D (dark red) (mostly solid color veined, on white, around margins with some white pure white base of bleeding towards striation near the bract center base (<5%)) 33 Cleft in Bract Yellow Green 145C Some are almost Reduced and (<5%) pure white, others Violet purple 93B have same color to Blush purple as the bracts group N74C or creamy white with purple/red 84D 34 Bract duration Most bracts gone by Most bracts gone by Most bract gone by (both types) mid-late April mid-late April mid-late April 35 Pedicel Length 23.8 mm 25.2 mm 19.5 mm 36 Bract variegation None None None (observation) 37 Pistil color Yellow Green Yellow Green Yellow Green (observation) 150A-150B 150A-150B 150A-150B 38 Fruit shape Broadly oval Broadly oval Broadly oval (observation) 39 Fruit length About 1.5 cm About 1.5 cm About 1.5 cm (measurement) 40 Fruit color Red when mature in Red when mature in Red when mature (observation) fall 45A to 45B fall 45A to 45B in fall 45A to 45B 41 Fragrance None None None (observation) 42 Flowering season Spring Spring Spring (observation) 43 Flowering time April April April (observation) 44 Deciduous or Deciduous Deciduous Deciduous evergreen (observation) 45 Disease resistance Highly resistant to Moderately Highly resistant to (observation) powdery mildew resistance to powdery mildew caused by Erisphe powdery mildew caused by Erisphe pulchra but some caused by Erisphe pulchra but some Spot Anthracnose pulchra but some Spot Anthracnose spotting by Elsinoe Spot Anthracnose by Elsinoe cornii cornii Elsinoe cornii 46 Bark color 144A (mottled) 144A (mottled) 144C (mature) 47 Flower/ 19.7 25.0 16.4 inflorescence number 48 Anther color Purple 86A Purple 86A Purple 86A 49 Flower petal 3-5 mm 3-5 mm 3-5 mm length 50 Flower petal Purple 76A to 76B Yellow Green group Purple 76A to 76B color (closed) on top and Yellow 149B (no purple) on top and Yellow Green 150A-150B Green 150A-150B near bottom near bottom 51 Flower petal 150A to 150B 150A to 150B 150C color (open)

    [0015] Botanical classification: Cornus florida Erica's Appalachian Sunrise.

    [0016] Unique Features: A mixture of two types of bracts, a first one being less than about 5% of the bracts produced that is fully dark red and a second type being more than about 95% of the bracts produced that is similar in color to the bracts produced by the parent Cherokee Brave. Both types of bracts on Erica's Appalachian Sunset are similar in size and significantly smaller than the bracts produced by the parent Cherokee Brave. Fewer flowers per inflorescence of Erica's Appalachian Sunset than on Cherokee Brave.

    [0017] Disease susceptibility: Erica's Appalachian Sunrise has a strong resistance to Powdery mildew caused by Erisphe pulchra and only some spotting caused by Elsinoe corni, a cosmetic disease with little damage.

    [0018] Insect damage: None noted.