Hybrid plant products from <i>Theobroma </i>species and methods of making the same
10791689 ยท 2020-10-06
Assignee
Inventors
- Jean-Philippe Marelli (Mogi Mirim, BR)
- Chigozie V. Nwosu (Hackettstown, NJ, US)
- Juan Carlos Motamayor Arias (Miami, FL, US)
- Carolina Schaper Bizzotto (Mogi Mirim, BR)
- Rodrigo Campos (Elizabethtown, PA, US)
- Stefan Emiel Royaert (Mogi Mirim, BR)
Cpc classification
A23G1/30
HUMAN NECESSITIES
A01H1/04
HUMAN NECESSITIES
A23G1/0006
HUMAN NECESSITIES
International classification
A01H1/02
HUMAN NECESSITIES
A01H1/04
HUMAN NECESSITIES
Abstract
Methods for hybridizing members of the Theobroma genus, and particularly to methods for hybridizing Theobroma cacao and Theobroma grandiflorum are provided. Hybrid seeds, plants and plant parts thereof, obtained from these methods are also provided. Methods for confirming that the resulting progeny are hybrids are described. Theobroma hybrid plant products, such as seeds obtained by crossing Theobroma cacao and Theobroma grandiflorum, having modified chemical compositions, such as modified fatty acid content, and/or modified alkaloid content, are provided. Products obtainable from the hybrid plants and seeds, particularly foodstuffs such as cocoa products, are also provided.
Claims
1. A method for producing a hybrid plant or seed of Theobroma cacao and Theobroma grandiflorum, comprising: (a) crossing a variety of Theobroma cacao and a variety of Theobroma grandiflorum to obtain progeny seeds therefrom; (b) analyzing at least a portion of the progeny seeds for the presence of a single nucleotide polymorphism (SNP) marker indicative of a Theobroma cacao and Theobroma grandiflorum hybrid, wherein said SNP marker is w17s189(T/C), e0050s274(CAT), CIR211s1036(T/A), c3s595(C/A), w3 s41(G/T), w8s131(T/C), w3s558(A/G), or any combination thereof; and (c) selecting one or more hybrid seeds from the progeny seeds analyzed in step (b) to produce the hybrid plant or seed.
2. The method of claim 1, further comprising growing seed that is selected in step (c).
3. The method of claim 1, wherein at least one of the following applies: (i) step (a) comprises applying pollen of Theobroma grandiflorum to female parts of Theobroma cacao; (ii) step (a) further comprises harvesting mature pods between 140 and 160 days after pollination, and seeds are removed therefrom; and/or (iii) step (c) comprises removing a sample of cotyledon from said seeds and analyzing the chemical and/or genetic composition of said seeds.
4. The method of claim 3, where step (b) further comprises removing of said cotyledon.
5. The method of claim 3, further comprising sowing said hybrid seeds in a growth medium and incubating said hybrid seeds in a growth room until hybrid plantlets have been formed and optionally thereafter.
6. The method of claim 5, wherein the growth medium is a woody plant medium.
7. The method of claim 5, further comprising incubating said hybrid seeds at a temperature of from 27-30 C. and at 70% relative humidity.
8. The method of claim 5, wherein said hybrid seeds are incubated for 10-15 days.
9. The method of claim 5, further comprising holding said hybrid plantlets in a humid chamber with at least 90% humidity.
10. The method of claim 5, further comprising transferring said hybrid plantlets to a suitable substrate comprising peat moss, coconut powder, perlite or mixtures thereof.
11. The method of claim 5, further comprising grafting said hybrid plantlets onto a Theobroma cacao or Theobroma grandiflorum plant.
12. The method of claim 1, wherein step (b) further comprises analyzing at least a portion of the progeny seeds for the presence of tetramethyluric acid, and wherein the one or more hybrid seeds are one or more progeny seeds that comprise tetramethyluric acid.
13. The method of claim 1, wherein the one or more hybrid seeds are one or more progeny seeds that exhibit a single nucleotide polymorphism (SNP) marker indicative of a Theobroma cacao and Theobroma grandiflorum hybrid, wherein the SNP marker is w17s189(T/C), e0050s274(C/T), CIR211s1036(T/A), c3s595(C/A), w3s41(G/T), w8s131(T/C), or w3s558(A/G).
14. The method of claim 1, wherein step (b) further comprises one or more of the following characteristics for which at least a portion of the progeny seeds are analyzed: (i) decreased palmitic acid as compared to Theobroma cacao; (ii) decreased theobromine compared to Theobroma cacao; and (iii) the presence of tetramethyluric acid.
15. The method of claim 14, wherein the one or more hybrid seeds are one or more progeny seeds that further exhibit one or more of the following characteristics: (i) decreased palmitic acid as compared to Theobroma cacao; (ii) decreased theobromine compared to Theobroma cacao; and the presence of tetramethyluric acid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
DETAILED DESCRIPTION OF THE INVENTION
(28) Methods for hybridizing members of the Theobroma genus in order to obtain hybrid seeds, plants and plant parts thereof, and particularly to methods for hybridizing Theobroma cacao and Theobroma grandiflorum are provided. Hybrid seeds and plants, as well as, flower, fruit and seed-bearing hybrids of Theobroma are provided. Methods for confirming that the resulting progeny are hybrids, and methods for identifying and/or selecting Theobroma cacao and Theobroma grandiflorum hybrids are described. Hybrid Theobroma plant products, such as seeds obtained from crossing Theobroma cacao and Theobroma grandiflorum, having modified chemical compositions, such as modified fatty acid content and/or modified alkaloid content are also described. Products derived from the hybrid seeds or plants, particularly foodstuffs, such as cocoa products, are also provided.
(29) The inventors have surprisingly found that Theobroma cacao and Theobroma grandiflorum hybrid products, such as seeds obtained from crossing Theobroma cacao and Theobroma grandiflorum, comprise advantageous properties. For example, the inventors obtained Theobroma cacao and Theobroma grandiflorum hybrid products having decreased palmitic acid compared to Theobroma cacao, and/or decreased theobromine compared to Theobroma cacao. Moreover, the inventors unexpectedly found Theobroma cacao and Theobroma grandiflorum hybrid products are suitable for making cocoa products and, for example, have higher melting and crystallization temperatures than Theobroma cacao. The inventors have also determined that certain chemical and/or genetic markers can be used to identify and/or select for Theobroma cacao and Theobroma grandiflorum hybrids.
(30) As used herein, the term hybrid encompasses fully hybridized offspring that are heterozygous with respect to the parents, as well as partially hybridized offspring that may result, for example, from genetic translocations.
(31) As used herein, the term seed is used interchangeably with the term bean.
(32) As used herein, the term pod is used interchangeably with the term fruit.
(33) As used herein, the term heat-resistant cocoa product means a cocoa product that has a higher melting temperature than a cocoa product made from Theobroma cacao alone.
(34) Theobroma hybrid products, such as seeds obtained by crossing Theobroma cacao and Theobroma grandiflorum, and plants grown from such hybrid seeds are provided. Hybrid products are obtained from crossing two different species of Theobroma.
(35) The species of Theobroma that may be used include Theobroma angustifolium, Theobroma bicolor, Theobroma cacao, Theobroma canumanense, Theobroma grandiflorum, Theobroma mammosum, Theobroma microcarpum, Theobroma obovatum, Theobroma simiarum, Theobroma speciosum, Theobroma stipulatum, Theobroma subincanum, and Theobroma sylvestre. Preferred species for use include Theobroma cacao and Theobroma grandiflorum.
(36) Particular varieties of Theobroma cacao that may be used include ALMC 5, P7-B, ICS39, NA168, ALMC 3, IP268, ICS40, NO34, UF 677, NA-45, EET400, P10B, PH85, COCA 3370/5, GU114, AMAZ 12/4, FADA100, LCT 37F, RB37, AMAZ 1515, CA-1.4, CAB-0022, CAB-0266, CCN 10, CCN 51, COMUM, GU-296H, HUALLAGA-7, HUALLAGA-9, IAC-1, IP 38, LCTEEN-1621010, LCTEEN-37A, LCTEEN-37G, MOQ 4.25, PAIN 9 316, PAQUETA 01, PH 123, PH 9, RB 39, ROSA MARIA, S THIAGO, SC-1, SJ-02, UF-667, VB-1151, VB-1156, VB-276, VB-515, and AMAZ 6.3. Of these, preferred varieties include NA-45, ICS-39, ICS-40, NA-168, NO-34, P-10B, P-7B, PH-85, and ALMC-5. Each of the above varieties of Theobroma cacao are known in the art, and material (e.g., germplasm) for these varieties can be accessed through various depositories, such as the International Cocoa Germplasm Database (http://www.icgd.rdg.ac.uk/index.php), the International Cocoa Collection (IC3) (http://catie.ac.cden/products-and-services/collections-and-germplasm-banks/international-cocoa-collection), or through the International Cocoa Genebank, Trinidad (ICG,T) (http://sta.uwi.edu/cru/GeneticResources.asp)
(37) Particular varieties of Theobroma grandiflorum that may be used in the invention are SUBCANUM, MCSG-17, MCSG-122, MCSG-174, MCSG-134, MCSG-74, MCSG-148, MCSG-36, MCSG-42, MCSG-101, MCSG-30, MCSG-46, MCSG-69, MCSG-89, MCSG-95, MCSG-11, MCSG-139, MCSG-150, MCSG-173, MCSG-2, MCSG-28, MCSG-3, MCSG-37, MCSG-41, MCSG-47, MCSG-98, and MCSG-35. Of these, preferred varieties include MCSG-36, MCSG-69, MCSG-89, MCSG-122, MCSG-148, and MCSG-46. All varieties of Theobroma grandiflorum designated as MCSG are available through the Mars Center for Cocoa Science, Itajuipe, Brazil. Additional cultivars of Theobroma grandiflorum that may be used in the invention are the Mamorano and Mamau cultivars.
(38) Combinations of varieties that may yield hybrid plants according to the invention include the 81 crosses described in
(39) In other embodiments, the following hybrid seeds and plants grown from such seeds are provided: MCGH-015-001-13, MCGH-022-002-01, MCGH-022-003-03, MCGH-022-006-04, MCGH-022-020-11, MCGH-023-008-14, MCGH-023-009-01, MCGH-023-009-11, MCGH-023-009-14, MCGH-023-013-02, MCGH-023-014-03, MCGH-023-014-06, MCGH-023-024-14, MCGH-023-037-05, MCGH-023-037-07, MCGH-030-012-04, MCGH-031-006-19, MCGH-031-006-22, MCGH-031-020-16, MCGH-031-028-34, MCGH-031-051-11, MCGH-031-052-34, MCGH-031-057-07, MCGH-031-061-05, MCGH-031-066-01, MCGH-031-066-05, MCGH-031-066-24, MCGH-031-070-10, MCGH-031-072-07, MCGH-031-073-04, MCGH-031-074-14, MCGH-031-079-06, MCGH-031-079-16, MCGH-031-081-02, MCGH-031-092-09, MCGH-031-095-08, MCGH-031-096-04, MCGH-031-103-09, MCGH-031-104-32, MCGH-031-110-15, MCGH-031-111-16, MCGH-031-113-11, MCGH-031-113-19, MCGH-031-116-03, MCGH-031-119-04, MCGH-031-123-18, MCGH-031-124-02, MCGH-031-69-06, MCGH-033-014-01, MCGH-034-002-12, MCGH-034-006-01, MCGH-059-029-03, MCGH-059-041-13, MCGH-065-010-09, MCGH-067-001-41, MCGH-067-002-31, or MCGH-067-003-06. The first three digit number refers to the cross (shown in the first column of
(40) In certain aspects, the mother plant used in crossing is Theobroma cacao. For example, as shown in
(41) The flowers of the pollinated mother plant (see, e.g.,
(42) Seeds are recovered from the pods. The seeds are cleaned, and the testa removed, for example, under sterile conditions. A comparison in the appearance of the seeds from T. cacao (
(43) Seeds may be chemically and/or genetically analyzed. In one aspect, a sample of cotyledon is removed from seeds and the chemical composition and/or genetic makeup of each seed is analyzed, as illustrated in
(44) Analysis of the chemical composition of the seeds may be carried out to determine the amounts of various fatty acids, flavanols, and/or alkaloids contained therein. Conveniently, the sample may be freeze-dried prior to conducting the chemical analysis, as this facilitates handling and gives accurate analytical results. The amounts of the various chemical components of the seeds may be determined using techniques known to those skilled in the art.
(45) For example, fatty acid content may be analyzed by solvent-based lipid extraction and subsequent quantification using chromatographic techniques (gas chromatography (e.g., GC-FID, GS-MS), gas-liquid chromatography (e.g., GLC-FID, GLC-MS), and high-performance liquid chromatography (HPLC)). See, e.g., Christie, W. W., (1989) Gas Chromatography and Lipids: A Practical Guide, The Oily Press, Dundee; Christie, W. W. (1982) J. Lipid Res., 23, 1072-1075; Ciucanu, I. and Kerek, F., (1984) J. Chromatography, 279, 493-506, each of which is hereby incorporated by reference.
(46) Alkaloid and flavanol content may be analyzed by liquid extraction and subsequent quantification using spectrophotometry (e.g., UV/Visible, IR, NIR, and Raman), chromatography (e.g., HPLC, GS-MS), or capillary electrophoresis. See, e.g., Blauch, J. L. and Stanley, M. T., Determination of Caffeine and Theobromine in Coffee, Tea and Instant Hot Cocoa Mixes, Journal of Food Science, 48, (1983), pp. 745-747; G. E. Adamson et al., HPLC method for the Quantification of Procyanidins in Cocoa and Chocolate Samples and Correlation to Total Anti-oxidant Capacity, J. Agric. Food Chem. 47, 1999, 4184-4188; M. A. Kelm et al., HPLC separation and purification of cacao (Theobroma cacao L.) procyanidins according to degree of polymerization using a diol stationary phase, J Agric. Food Chem. 54, 2006, 1571, each of which is hereby incorporated by reference.
(47) Once the chemical composition of the seeds has been analyzed, for example, as shown in
(48) For example, according to some aspects, a hybrid of T. cacao and T. grandiflorum is developed that exhibits a modified fatty acid profile as compared to T. cacao. Particular fatty acid modifications include, but are limited to, increased polyunsaturated fatty acid levels (e.g., linoleic acid), and decreased saturated fatty acid levels (e.g., palmitic acid). Also included are increased levels of the saturated fatty acid stearic acid, which is associated with lower LDL-levels than other saturated fatty acids.
(49) According to some aspects, the level of linoleic acid is increased by about 25%-500%, 50%-250%, or 75%-100% compared to T. cacao and/or T. grandiflorum.
(50) According to other aspects, the level of palmitic acid of any of the hybrids described herein is decreased by about 10%-95%, 25%-75%, or 50%-67% compared to T. cacao. In other aspects, the level of palmitic acid is measured as the percentage of the total amount of fatty acids in a sample and is in the range of 7% to 20%, 7% to 19%, 7% to 18%, 7% to 17%, 7% to 16%, or 7% to 15%. In other aspects, the level of palmitic acid is measured as the percentage of the total amount of fatty acids in a sample and is in the range of 10% to 20%, 10% to 19%, 10% to 18%, 10% to 17%, 10% to 16%, or 10% to 15%. In other aspects, the level of palmitic acid is measured as the percentage of the total amount of fatty acids in a sample and is in the range of 5% to 15%, 5% to 12%, or 5% to 10%. In other aspects, the level of palmitic acid is measured as the percentage of the total amount of fatty acids in a sample and is less than 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, or 8%.
(51) According to still other aspects, the level of stearic acid is increased by about 10%-100%, preferably 20%-70%, more preferably 30%-40% compared to T. cacao.
(52) According to further aspects, hybrid seed of T. cacao and T. grandiflorum is developed that exhibits a modified alkaloid profile as compared to T. cacao. Particular alkaloid modifications within the scope of the invention include methyl xanthines (e.g., theobromine, caffeine, and tetramethyluric acid (TMUA, also known as theacrine or ATMU)). According to some aspects, the level of caffeine may be either increased or decreased by about 10%-100%, about 25%-75%, or about 40%-60% compared to T. cacao. In some aspects, the level of caffeine in any of the hybrids described herein is between 1-10 mg/g, 2-8 mg/g, or 4-6 mg/g. In T. cacao, the level of caffeine is typically between 2-5 mg/g in Theobroma cacao.
(53) According to other aspects, the level of theobromine in any of the hybrids described herein is decreased by 10%-100%, 25%-75%, or 40%-60% compared to T. cacao. In other aspects, the level of theobromine is less than 5 mg/g, less than 4.5 mg/g, less than 4 mg/g, less than 3.5 mg/g, less than 3 mg/g, less than 2.5 mg/g, less than 2 mg/g, less than 1.5 mg/g, less than 1 mg/g, less than 0.5 mg/g, less than 0.25 mg/g, or less than 0.1 mg/g. In other aspects, the level of theobromine is in the range of 0 mg/g to 5 mg/g, 0.05 mg/g to 5 mg/g, 0.10 mg/g to 5 mg/g, 0.5 mg/g to 5 mg/g, 1 mg/g to 5 mg/g, 1.5 mg/g to 5 mg/g, 2 mg/g to 5 mg/g, 2.5 mg/g to 5 mg/g, 3 mg/g to 5 mg/g. In other aspects, the level of theobromine is in the range of 0 mg/g to 4.5 mg/g, 0.05 mg/g to 4.5 mg/g, 0.10 mg/g to 4.5 mg/g, 0.5 mg/g to 4.5 mg/g, 1 mg/g to 4.5 mg/g, 1.5 mg/g to 4.5 mg/g, 2 mg/g to 4.5 mg/g, 2.5 mg/g to 4.5 mg/g, 3 mg/g to 4.5 mg/g. In other aspects, the level of theobromine is in the range of 0 mg/g to 4 mg/g, 0.05 mg/g to 4 mg/g, 0.10 mg/g to 4 mg/g, 0.5 mg/g to 4 mg/g, 1 mg/g to 4 mg/g, 1.5 mg/g to 4 mg/g, 2 mg/g to 4 mg/g, 2.5 mg/g to 4 mg/g, 3 mg/g to 4 mg/g. In other aspects, the level of theobromine is in the range of 0 mg/g to 3.5 mg/g, 0.05 mg/g to 3.5 mg/g, 0.10 mg/g to 3.5 mg/g, 0.5 mg/g to 3.5 mg/g, 1 mg/g to 3.5 mg/g, 1.5 mg/g to 3.5 mg/g, 2 mg/g to 3.5 mg/g, 2.5 mg/g to 3.5 mg/g, 3 mg/g to 3.5 mg/g. In T. cacao, the level of Theobromine is in the range of 15-40 mg/g.
(54) According to still other aspects, the presence TMUA is determined in any of the hybrids or seeds described herein. In some aspects, the level of TMUA is in the range of 0.5 mg/g to 3 mg/g, 0.5 mg/g to 2.5 mg/g, 0.5 mg/g to 2 mg/g, or 0.5 mg/g to 1.5 mg/g. In other aspects, the level of TMUA is 1.0 mg/g to 3 mg/g, 1.0 mg/g to 2.5 mg/g, 1.0 mg/g to 2.0 mg/g, or 1.0 mg/g to 1.5 mg/g. In T. cacao, TMUA is not present.
(55) According to still further aspects, hybrid seed of T. cacao and T. grandiflorum is developed that exhibits a modified flavanol content as compared to T. cacao. Particular flavanol content modifications include total flavanols, catechins, and epicatechins. According to some aspects, the level of total flavanols may be either increased or decreased by about 10%-100%, 25%-75%, or about 40%-60% compared to T. cacao. According to other aspects, the level of catechins may be either increased or decreased by about 10%-100%, about 25%-75%, or about 40%-60% compared to T. cacao. According to still other aspects, the level of epicatechins may be either increased or decreased by about 10%-100%, about 25%-75%, or about 40%-60% compared to T. cacao.
(56) In some aspects, hybrid seeds having any of the properties described above are used to make cocoa products. For example, hybrid seeds having decreased palmitic acid compared to Theobroma cacao and/or decreased theobromine compared to Theobroma cacao are used to prepare cocoa products.
(57) In other aspects, the presence of tetramethyluric acid is used to confirm whether the seeds are a result of hybridization of T. cacaoT. grandiflorum. In other aspects, hybrid seeds having presence of tetramethyluric acid are used to make cocoa products.
(58) Analysis of the genetic material of the seeds may also be carried out to confirm whether the seeds are a result of hybridization of the two parental plants. For example, DNA analysis of samples of cotyledons obtained from the seeds may be conducted to identify the presence or absence of specific markers. Specific SNPs may be selected, for example, based on their distribution across the chromosomes of the parents being crossed, in order to permit confirmation that hybridization has occurred throughout the genome. In some aspects, the presence or absence of one or more of the 22 SNP markers shown in
(59) In other aspects, the presence or absence of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, or 9) of the following 9 markers are determined: w17s189(T/C), e0050s274(C/T), CIR211s1036(T/A), w11s867(T/C), w8s204(T/C), c3s595(C/A), w3s41(G/T), w8s131(T/C), w3s558(A/G). These SNPs are discussed in one or more of the following, each of which is hereby incorporated by reference: Borrone et al., Theor. Appl. Genet. 109 (3), 495-507 (2004); Pugh et al., Theor. Appl. Genet. 108 (6), 1151-1161 (2004); Kuhn et al., Tree Genetics & Genomes 6, 783-792 (2010); Livingstone et al., Mol Breeding (2011) 27:93-106; Kuhn et al., Tree Genetics & Genomes 8, 97-111 (2012). Information regarding these SNPs (e.g., NCBI accession numbers, primer/probe combination and sequences used for detecting the SNPs) is provided in Table 1 below. In particular, the SNPs can be identified, selected, screened, and/or detected using the primer and/or probe combinations described in Table 1.
(60) TABLE-US-00001 TABLE1 SNPMarkers Primer/ Probe NCBI Marker Linkage Combi- Fluorescent LociName ref. Name Group nation Allele label Sequence Tm %GC WRKY17 EF173893 w17s189 1 Wrky17_189_F TGATTACACTGTTACACCAACTTTAGACG 59.8 38 (SEQIDNO:1) Wrky17_189_R ACGTGTAAAGAAAGGAGGAAAACTTT 58.1 35 (SEQIDNO:2) Wrky17_189_t T VIC TCTTGCtGAGATATC(SEQIDNO:3) 67 40 Wrky17_189_c C FAM TCTCTTGCcGAGATAT(SEQIDNO:4) 67 44 CA797820 e0050s274 3 Est_0050_229_F CTCAGGTTCCAACCATTGATTTAA 58.1 38 (SEQIDNO:5) Est_0050_229_R CCGAGATCCCATGGTTAACAA 58.4 48 (SEQIDNO:6) Est_0050_229_c C FAM AAGCTGCCAcGGAGT(SEQIDNO:7) 67 60 Est_0050_229_t T VIC AAGCTGCCAtGGAGT(SEQIDNO:8) 67 53 WRKY11 AY331171 w11s867 5 Wrky17_867_F AACTTGTCAGCTGTCTCTCTTTCTTG 58.5 42 (SEQIDNO:9) Wrky17_867_R CAGAACTGTGCATGCTTGAAGC 59.7 50 (SEQIDNO:10) Wrky17_867_t T VIC CTAAATGAATCAtCCAAAGA 65 30 (SEQIDNO:11) Wrky17_867_c C FAM AAATGAATCAcCCAAAGA(SEQIDNO:12) 58.9 33 WRKY3 AY331158 w3s41 2 w3s41_FW AAAGGCAATCCTTACCCAAGGT 58.9 45 (SEQIDNO:13) w3s41_RV AAGAATGAACCACTTTGCAGTAGATAGT 58.1 36 (SEQIDNO:14) w3s41_pG G FAM ATgCcCcTggtTgt(SEQIDNO:15) 65 57 w3s41_pT T VIC atGcCcCtGTTtgt(SEQIDNO:16) 65 50 WRKY3 AY331158 w3s558 2 w3s558_FW GTTGTTGTTCTGTTCAATTCGTATGA 58.2 35 (SEQIDNO:17) w3s558_RV ATCAGGAATGCTCCAAAATAATCAA 58.9 32 (SEQIDNO:18) w3s558_pG A FAM tgacTACcttttatgTgAtCt 66 33 (SEQIDNO:19) w3s558_pT G VIC TGACTgCCTTTTATGTGAT 66 37 (SEQIDNO:20) WRKY8 AY331165 w8s131 9 w3s131_FW GCCCTGTCAAAAAGAAGGTACTG 64.7 48 (probe (SEQIDNO:21) 119) w3s131_RV TTACTGTTGCTTTCCATTTTCTAAGTG 64.1 33 (SEQIDNO:22) w3s131_pG T VIC TTCTGAGGTATCATTCCCA 69 42 (SEQIDNO:23) w3s131_pT C FAM TTCTGAGGCATCATTCC 71 47 (SEQIDNO:24) WRKY8 AY331165 w8s204 9 w3s204_FW cacttagaaaatggaaagcaacagt 63.2 36 (SEQIDNO:25) w3s204_RV acctagagccagatgatgaattgtatt 64.6 37 (SEQIDNO:26) w3s204_pG T VIC ttccTgagacttgtacttga 68 40 (SEQIDNO:27) w3s204_pT C FAM ttccCgagacttgtactt 68 44 (SEQIDNO:28) COS3 XM007019015 c3s595 8 c3s595_FW TGCTGGTGGCAAGAAGTATTATATTAG 58.1 37 (Tc_ (SEQIDNO:29) At1g44446) c3s595_RV CAGATCCTCATTCAATACCTGTATCAA 58.6 37 (SEQIDNO:30) c3s595_pA A 6FAM CTCTGCaTCATTGGT(SEQIDNO:31) 66 47 c3s595_pC C VIC CTCTGCcTCATTGGT(SEQIDNO:32) 67 53 mTcCir211 AJ566534 CIR211s1036 8 CIR211s1036_FW ACCTTAATTTTATGGGAAACGAGGT 58.4 36 (SEQIDNO:33) CIR211s1036_RV CCAAACAAAATCTTAATGCACTGTG 58.7 36 (SEQIDNO:34) CIR211s1036_pT T VIC AATCtGTGCTGACTGAT(SEQIDNO:35) 67 41 CIR211s1036_pA A 6FAM CAATCaGTGCTGACTG 65 50 (SEQIDNO:36)
(61) In order to conduct the SNP analysis, the genetic profile of the parent plants with respect to the SNPs of interest must first be evaluated. Preferred varieties of T. cacao and T. grandiflorum that may be used as parental plants are shown in
(62) The seeds, and in particular the seeds selected after the chemical and/or genetic analysis, are planted into a suitable plant growth medium (e.g., as shown in
(63) The seeds are incubated in the growth medium at a suitable temperature, such as from 20-35 C., preferably from 25-32 C., more preferably from 27-30 C. According to some aspects, they may be maintained in a humid atmosphere, for example in an environment having at least about 50% relative humidity, at least about 70% relative humidity, or at least about 85% relative humidity. However, any conditions capable of supporting growth of the hybrid plants may be used in accordance with the invention.
(64) Seeds are allowed to mature to plantlets under these conditions. Typically, this takes from 5-25 days, or, for example, from 10-15 days.
(65) According to other aspects of the invention, after the hybrid plantlets have matured, they may be held in a humid chamber with a high humidity, for example of at least 80% relative humidity and suitably at least 90% humidity to allow them to acclimatize (e.g., as shown in
(66) The plantlets are transferred to and grown in a suitable medium. According to some aspects of the invention, the medium comprises peat moss, coconut powder, perlite, and mixtures thereof. In other aspects, the medium comprises coconut powder and Carolina Soil (commercially sold; Substrate Carolina Standard CE=0.7 ms/cm+/0.3; Composition: expanded vermiculite, sphagnum peat, agricultural lime, gypsum and fertilizer dashes (NPK), pH=5.5+/0.5)).
(67) The plantlets may be grafted to other plants. For example, suitable plants to which the hybrid plantlets may be grafted include Theobroma grandiflorum (e.g., as shown in
(68) The hybrid plants described herein may be grown to maturity and allowed to produce flowers (e.g., as shown in
(69) Analysis of the genetic material of the hybrid plants may be carried out at a mature stage by analyzing samples of the plant, such as leaf, stem, root, or flower tissue, to confirm whether the hybrid plants are a result of hybridization of the two parental plants. For example, DNA analysis of samples such as leaf samples obtained from the plants may be conducted to identify the presence or absence of specific markers discussed above with respect to the seeds.
(70) Methods of producing T. cacao and T. grandiflorum hybrid plants and parts thereof, as well as, hybrid products, such as seed obtained by crossing T. cacao and T. grandiflorum, are provided. In several aspects, the methods comprise crossing a variety of T. cacao and T. grandiflorum and obtaining seeds therefrom, and selecting seeds and/or plants resulting from the cross. The seeds and/or plants may be selected based on the characteristics described herein, such as whether they possess decreased palmitic acid as compared to T. cacao; decreased theobromine compared to T. cacao; the presence of tetramethyluric acid; and/or one or more of the following SNP markers: w17s189(T/C), e0050s274(C/T), CIR211s1036(T/A), w11s867(T/C), w8s204(T/C), c3s595(C/A), w3s41(G/T), w8s131(T/C), w3s558(A/G), and any combination thereof. In other aspects, methods for identifying, selecting, screening and/or confirming T. cacao and/or T. grandiflorum hybrid plants or plant products, such as seeds obtained from crossing T. cacao and T. grandiflorum, based on one or more of the above-mentioned characteristics are also provided.
(71) In other embodiments, methods for producing a hybrid plant of T. cacao and T. grandiflorum are provided, which comprises (a) crossing a variety of Theobroma cacao and a variety of Theobroma grandiflorum and obtaining hybrid seed therefrom; (b) sowing hybrid seeds obtained in a growth medium and incubating them in a growth room until plantlets have been formed; (c) transferring plantlets to a suitable substrate; and (d) optionally grafting hybrid plantlets obtained onto a plant. In other embodiments, after step (a), and before step (b), a sample of seed is removed and the chemical composition and/or genetic makeup is analyzed. In other embodiments, only seeds that possess certain characteristics, such as the above-mentioned characteristics and/or SNP markers, progress on to step (b). Hybrid plants produced by these processes are also provided.
(72) In other aspects, hybrid plants obtained from any of the crosses described herein are crossed with another plant. In some aspects, the hybrid plants are backcrossed with one of its parents (T. cacao or T. grandiflorum), and seeds are obtained. In other aspects, hybrid plantlets are grafted onto rootstock, as discussed above, and the resulting plant is crossed with another plant or backcrossed with one of its parents (T. cacao or T. grandiflorum).
(73) Methods for removing the fruit from a Theobroma cacao and Theobroma grandiflorum cross and processing it into a cocoa product are also provided. In accordance with such further aspects, there is provided a hybrid plant-derived product, preferably seeds obtained from crossing T. cacao and T. grandiflorum, which comprise fatty acids. The seeds have a fatty acid profile that is altered as compared to the fatty acid profile of seeds produced by the parents from which the hybrids were obtained. These fatty acid profiles described herein are advantageous because saturated fatty acids, such as palmitic acid, may be associated with increased risk of cardiovascular disease, and unsaturated fatty acids, such as linoleic acid, may be useful in reducing LDL cholesterol and the risk of cardiovascular disease. Thus, the hybrid plants, or seeds obtained from crossing T. cacao and T. grandiflorum, described herein provide a particularly suitable starting material for the production of foodstuffs possessing the fatty acid, flavanol, and alkaloid profiles of the plant products from which they are made, such as confectionaries, including, but not limited to chocolate and cocoa-containing products.
(74) The processing techniques used to prepare cocoa products include partially or fully depulping the fruit of the plant (e.g., from the cross of T. cacao and T. grandiflorum), fermenting the beans using microbiological processes or chemical processes, drying the beans and exposing them to the sun or an artificial dryer, including, but not limited to, a Samoan dryer, Buttner dryer, and a platform dryer.
(75) According to some aspects, the dried beans may be further roasted and winnowed to generate nibs that are converted to cocoa liquor or cocoa butter. Cocoa liquor may be converted to cocoa powder. The liquor, which still contains the cocoa butter, may be mixed with sugar or other natural or synthetic sweetening substances. In some aspects, the resulting mixture may be in the form of a paste.
(76) The paste may be refined, optionally by means of a roller system, in order to generate smaller particle sizes within the paste. According to further aspects, milk solids may be added, and the mixture then further processed to a milk crumb. This mixture may be mixed in a conche, optionally with cocoa butter and emulsifier. The paste and crumb may also be mixed with cocoa butter and emulsifier in a conche. The conche used for the mixing includes, but is not limited to, a Frissee conch, a Tourell conche, Macintyre refiner/conche, and a wiener process.
(77) The end product of this process of preparing, and optionally refining and further processing the paste is an edible cocoa containing product, including, but not limited to, chocolate, compound chocolate, or a chocolate-like substance.
(78) Presently-preferred cocoa products that may be produced using the fruit from the plants propagated in accordance with methods herein (e.g., fruit from cross of T. cacao and T. grandiflorum) include cocoa liquor, chocolate, compound chocolate, chocolate-like substance, cocoa powder, and cocoa butter. Cocoa-containing products obtained by the processes described above are also provided.
(79) In some aspects, cocoa products having a higher melting temperature and/or higher crystallization temperature than T. cacao products are provided. In other aspects, heat-resistant cocoa products are provided.
EXAMPLES
(80) Various embodiments of the invention will now be particularly described by way of examples. However, it will be apparent to one skilled in the art that the specific details are not required in order to practice the invention. The following descriptions of specific embodiments are presented for purposes of illustration and description. They are not intended to be exhaustive of or to limit the invention to the precise forms disclosed. Many modifications and variations are possible in view of the above teachings. The embodiments are shown and described in order to best explain the principles of the invention and its practical applications, to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated.
Example 1
(81) This example provides T. cacao and T. grandiflorum hybrids and hybrid products, such as seed obtained from crossing T. cacao and T. grandiflorum, as well as, chemical and genetic characteristics of such hybrids and hybrid products.
(82) 1. Choice of Progenitors
(83) The pollen donors were selected among plants from the T. grandiflorum collection held at MCCS. The female plants were selected from the MCCS T. cacao germplasm collection based on the diversity panel of cacao genetic diversity.
(84)
(85) 2. Pollinations
(86) The pollinations were performed manually, by covering the mother flower with a polyethylene transparent tube for 24 hours, prior to bud opening (
(87) After 24 hours, the success of pollination was checked and this was repeated subsequently after 5, 15, and 30 days. An example of a flower following successful pollination is shown in
(88) 3. Collection of Hybrid Seeds
(89) The pollinated flowers were allowed to develop and mature pods were harvested between 140 and 160 days after pollination, as shown in
(90) The resultant hybrid seeds were then sown in Woody Plant Medium (Lloyd and McCown's, 1981) media the composition of which is set out in Table 1, and placed in a growth room at about 27-30 C., and 70% RH, as shown in
(91) TABLE-US-00002 TABLE 1 WPM medium composition WPM Solution I NH.sub.4NO.sub.3 20 g/L Ca(NO.sub.3).sub.2 4H.sub.2O 27.8 g/L WPM Solution II K.sub.2SO.sub.4 49.5 g/L WMP Solution III CaCl.sub.2 2H.sub.2O 19.2 g/L WPM Solution IV H.sub.3BO.sub.3 0.62 g/L KH.sub.2PO.sub.4 17 g/L Na.sub.2MoO.sub.4 2H.sub.2O 0.025 g/L MS Solution II MgSO.sub.4 7H.sub.2O 37 g/L MnSO.sub.4 H.sub.2O 2.23 g/L ZnSO.sub.4 7H.sub.2O 0.86 g/L CuSO.sub.4 5H.sub.2O 0.0025 g/L MS solution IV Na.sub.2 EDTA 3.73 g/L FeSO.sub.4 7H.sub.2O 2.78 g/L Final Concentration (mg/L) NH.sub.4NO.sub.3 400 Ca(NO.sub.3).sub.2 4H.sub.2O 556 K.sub.2SO.sub.4 990 CaCl.sub.2 2H.sub.2O 96 H.sub.3BO.sub.3 6.2 KH.sub.2PO.sub.4 170 Na.sub.2MoO.sub.4 2H.sub.2O 0.25 MgSO.sub.4 7H.sub.2O 370 MnSO.sub.4 H.sub.2O 22.3 ZnSO.sub.4 7H.sub.2O 8.6 CuSO.sub.4 5H.sub.2O 0.25 FeNaEDTA 3H.sub.2O 42.1
4. Chemical Analysis
(92) In some instances, after collection of the hybrid seeds and before sowing, a sample comprising approximately of a cotyledon was cut from the seed as illustrated in
(93) The fatty acid composition (e.g., palmitic acid) was determined using capillary GC. The fats were transesterified to their respective fatty acid methyl esters (FAMEs) with methanolic tetramethylammonium hydroxide. The FAMEs were then separated on a HP Innowax capillary column with FAME composition determined by area normalization. Quantitative determination was accomplished using external standard calibration. External standard typically used is Nu-Chek GLC Reference Standard 68C. One point calibration curves were constructed for all components, thus accounting for differences in relative response factors of fatty acids.
(94) Cocoa flavanol content was determined using normal phase HPLC. Lyophilized cocoa bean powder was extracted with hexane to remove the lipid components prior to extraction of the flavanols/procyanidins. Next, flavanols/procyanidins (DP1-10) were extracted from defatted samples with an acidified acetone/water solvent system. The extracts were then passed through a solid phase extraction (SPE), filtered and transferred to chromatographic vials for normal phase HPLC analysis. Quantification was accomplished with the external standard approach, and a calibration curve was constructed for each flavanol/procyanidin fraction. The values reported for total flavanol and procyanidin content of the sample is the sum of the quantities determined for each oligomeric fraction (DP1-10).
(95) Alkaloid levels (theobromine, caffeine and TMUA) were determined using reverse phase HPLC with UV detection at 274 nm. Lyophilized bean powder samples were prepared by dissolution in hot (>95 C.) water, filtered and analyzed by HPLC. External standard calibration was employed for quantitative determination of the alkaloids, and NIST baking chocolate as used as a secondary standard to evaluate and ensure method/system performance.
(96) The distribution of palmitic acid in seeds obtained from 2009 to 2013 from 37 different crosses as shown in
(97) Histograms showing the distribution of palmitic acid in hybrid seeds of the crosses, both normal and non-normal, are found in
(98) In 2012 and 2013, the methyxantines from the seeds were analyzed, in order to help to confirm the interspecific crosses. 957 samples were analyzed in 2012, and 678 samples in 2013 (only the samples with presence of tetramethyluric acid were analyzed for palmitic acid content).
(99) The palmitic acid, tetramethyluric acid, theobromine, and caffeine contents of the seeds obtained in 2012-2013 for NA-45MCGS-122, are reported in
(100)
(101)
(102)
(103) In addition, separate plants were analyzed for total cocoa flavanol content, as well as catechins and epicatechins, and the results are reported in
(104) 5. Growth of Hybrid Seeds
(105) After 10-15 days in the growth room, hybrid plantlets were weaned in a humid chamber developed to keep high RH rates (100%) until they were acclimated (
(106) The height of the young seedlings as well as the number of leaves was monitored every month. Their appearance was also recorded at this time. Many of the plants had a stunted growth and high mortality rate. However, depending on the specific T. cacaoT. grandiflorum combination some plants survived and reached various heights. For example, some of the smallest hybrids with T. grandiflorum appearance have a height between 16 cm (MCGH-023-037-07) and 22 cm (MCGH-031-020-16), whereas some of the tallest hybrids with T. grandiflorum appearance are between 64 cm (MCGH-023-013-02) and 85 cm (MCGH-023-014-03). All hybrids with T. cacao appearance develop as regular cacao and are already between 180 cm (MCGH-023-017-03) and 260 cm (MCGH-059-014-12) tall. The hybrids with T. cacao appearance also produced pods. All of these hybrids are about five years old.
(107) Some plants produced flowers as shown in
(108) 6. DNA Analysis
(109) Leaf discs of the hybrid plants were collected and DNA extraction carried out with a DNeasy Plant Mini Kit (Qiagen).
(110) Genotyping was carried out using Single Nucleotide polymorphism markers (SNPs) developed for T. cacao (Kuhn et al. 2010).
(111) 51 clones of T. cacao and 25 clones of T. grandiflorum were analyzed in order to characterize the 81 crosses between T. cacao and T. grandiflorum, and 22 SNPs (Single Nucleotide Polymorphism) were used for the initial analysis (see
(112) In one example, illustrated in
(113) 7. Grafting of Hybrids
(114) Some of the plantlets were grafted onto a T. grandiflorum rootstock, others onto a T. cacao rootstock. The plants developed well and were planted in the field, as shown, for example, in
Example 2
(115) In 2010, the palmitic acid, tetramethyluric acid, and theobromine content of seeds from cross 31 (NA-45MCGS-122) were analyzed using the methods described above. Ten pods and 211 seeds where collected. The results are shown in
Example 3
(116) This example compares cocoa liquor obtained from seeds of T. cacaoT. grandiflorum hybrids and non-hybrids, a standard T. cacao plant (Low Roast West African-ELZ), and a T. grandiflorum plant.
(117) Micro-Fermentation
(118) Micro-fermentation of mature pods from NA-45MCSG-122, EET400MCSG46, and NA45MCSG-46 were carried as follows. Pods were broken 1 day after harvest outside the laboratory and the bean content carefully removed and placed in individual nylon nets that are then sealed inside zip lock bags. Simultaneously, freshly prepared pulp were prepared and transferred to a covered jar at ambient temperature for about 1-3 hours in order to initiate its fermentation. Each bag containing the beans was then transferred to the laboratory where 5 mL of the freshly fermented pulp was added to the zip lock bag. The bags were incubated at controlled temperatures. On the second and fourth day, the sweatings of the each zip lock bag were removed and discarded. After fermentation, the beans were sun dried to a moisture content of 7 to 8%. After drying the beans from each individual bag, they were stored in jute bags. The beans for T. cacao plant (Low Roast West African-ELZ) and the T. grandiflorum plant were purchased commercially and thus already fermented.
(119) Following drying, of the seed was removed, lyophilized (freeze dried) and analyzed for palmitic acid (C 16:0) using capillary GC, and theobromine and TMUA content using reverse phase HPLC, as discussed above.
(120) Based on palmitic acid content, the beans were divided into the following 8 groups (or bands):
(121) TABLE-US-00003 Band 1 8.38-9.99% C16:0 Band 2 10.00-10.99% C16:0 Band 3 11.01-11.99% C16:0 Band 4 12.00-12.98% C16:0 Band 5 13.03-13.99% C16:0 Band 6 14.26-15.37% C16:0 Band 7 17.65-19.43% C16:0 Band 8 19.62-22.07% C16:0
(122) These groups are also shown in
(123) Liquor Making Procedure
(124) To prepare cocoa liquor, the beans were placed in stainless steel trays and roasted in a Binder oven at 121 C. for 21 min. The beans were the cooled at room temperature and broken so that the nibs were easily separated from the shell in a portable winnower. Then, they were hand-picked to remove all of the shell. A total of 35 g of nibs was then milled in a Restch RM200 mill for 30 min. Finally, the liquor was transferred to a tube and stored at 20 C. for analyses.
(125) Palmitic acid (C 16:0) and theobromine levels of liquors from seeds of hybrids (bands B1-B6), non-hybrids (bands B7-B8), T. cacao, and T. grandiflorum were analyzed. Palmitic acid was measured as a percentage of the total concentration of fatty acids, and theobromine was measured in mg/g. The results are shown below:
(126) TABLE-US-00004 B1 B2 B3 B4 B5 B6 B7 B8 Tc Tg C16:0 14.03 14.6 15.52 16.52 17.8 18.35 24.51 26.21 25.8 6.49 Theo 0.07 0.06 0.08 0.05 0.04 0.04 0.99 0.99 1.13 0
(127) The results show that liquor from seeds of T. cacaoT. grandiflorum crosses have lower palmitic acid levels compared to T. cacao, and lower theobromine levels compared to T. cacao.
(128) The melting temperature, crystallization temperature, and melt profiles were also analyzed according to Campos R. (2005) Experimental Methodology, in Fat Crystal Networks, Editor Alejandro G. Marangoni, Marcel Dekker, USA. pp. 267-348.
(129) The results are shown in
(130) In order to make a 70% chocolate product, for example, 30% sugar is added to the liquor. Methods of making the chocolate or caramel etc. (without cellodextrins) are well known to skilled artisans and can also be found in textbooks such as Chocolate, Cocoa and Confectionery, Bernard W. Minifie Third Edition, which is hereby incorporated by reference.
Example 4
(131) This example shows that a T. cacao and T grandiflorum hybrid plant can be backcrossed with one of its parents.
(132) Choice of Progenitors
(133) The male parent was selected from one of the hybrid plants described herein based on its low palmitic acid profile, morphological traits and DNA analysis confirming the hybridization between T. cacao and T. grandiflorum. The female parent used in the backcross was the T. cacao parent.
(134) Pollinations
(135) The pollinations were performed manually by covering flowers of the female parent with polyethylene tubes for 24 hours, prior to anthesis. On the day of pollination, the tubes were removed and stigma of the flowers of the female parent were exposed by removing the staminodes. After that, pollen from Herrania sp was dipped onto the stigma in order to overcome pollen incompatibility. Next, the pollen from fresh flowers of the hybrid was rubbed onto the stigma of the T. cacao parent. Additionally, pollination without pollen from Herrania sp. was also performed. In the next step, the pollinated flowers were protected with the same polyethylene tube in order to prevent any unexpected pollination during 24 hours. After this time period, the tube was removed and the success of pollination was checked for 30 days.
(136) Collection of Hybrid Seeds
(137) Around 140 to 160 days after pollination the mature pods were collected and taken to the laboratory, where they were cleaned with bleached water, flamed and then opened under the laminar flow hood. The seeds were then taken out from the pods with sterile forceps and put in sterile Petri dishes. Then, the seed testa was peeled off and one third of the seed, corresponding to the region containing the endosperm, was cut and sent for chemical analysis of fatty acids content. The rest of the seed was then sown in Wood Plant Medium (Lloyd and McCown's, 1981), and placed in a growth room at about 27 C., 70% RH and LED artificial illumination ranging from 90 a 120 mol.Math.m.sup.2.Math.s.sup.1.
(138) It will, of course, be appreciated that the above description has been given by way of example only and that modifications in detail may be made within the scope of the present invention.
(139) Throughout this application, various patents and publications have been cited. The disclosures of these patents and publications in their entireties are hereby incorporated by reference into this application.
(140) The embodiments described herein are capable of modification, alteration, and equivalents in form and function, as will occur to those ordinarily skilled in the pertinent arts having the benefit of this disclosure.
REFERENCES
(141) Adamson et al., HPLC method for the Quantification of Procyanidins in Cocoa and Chocolate Samples and Correlation to Total Anti-oxidant Capacity, J. Agric. Food Chem. 47, 1999, 4184-4188 Addison G. O., Tavares R. M. 1951. Observaes sobre as espcies do gnero Theobroma que ocorrem na Amaznia. Boletim Tcnico do Instituto Agronmico do Norte 25:3-20. Addison G. O., Tavares R. M. 1952. Hybridization and grafting in species of Theobroma which occur in Amazonia. Evolution 6: 380-386. Bartley B. G. D. 2005. The Genetic diversity of cacao and its utilization. CABI Publishing. 341 pp. Blauch, J. L. and Stanley, M. T., Determination of Caffeine and Theobromine in Coffee, Tea and Instant Hot Cocoa Mixes, Journal of Food Science, 48, (1983), pp. 745-747. Borrone et al., Theor. Appl. Genet. 109 (3), 495-507 (2004). Campos R. (2005) Experimental Methodology, in Fat Crystal Networks, Editor Alejandro G. Marangoni, Marcel Dekker, USA. pp. 267-348 Carpenter D. R., Hammerstone J. F., Romanczyk L. J. and Aitken W. M. 1994. Lipid Composition of Herrania and Theobroma Seeds. J. Am. Oil Chem. Soc. 71: 845-851. Christie, W. W., J. Lipid Res., 23, 1072-1075 (1982). Christie, W. W., (1989) Gas Chromatogrpahy and Lipids: A Practical Guide, The Oily Press, Dundee. Ciucanu, I. and Kerek, F., J. Chromatography, 279, 493-506 (1984). Cuatrecasas, J. 1964. Cacao and its allies: a taxonomic revision of the genus Theobroma. Contributions from The United States National Herbarium 35: 379-614. Figueira A., Pires J. L., Cascardo J. C. M., Cardoso R. D., Nascimento C. S., Lambert S. V. 2000. Cocoa butter quality can be improved by genetic breeding for fatty acid and triacylglycerol composition and hardness. In. Proceedings 12th International Cocoa Research Conference, Salvador, Bahia, Brazil, 17-23 de novembro de 1996. Cocoa Producers' Alliance, Lagos, Nigeria. pp. 399-407. Gilabert-Escriv M. V., Gonalves L. A. G., Figueira A. Silva C. R. S. 2002. Fatty acid and triacylglycerol composition and thermal behavior of fats from seeds of Brazilian Amazonian Theobroma species. Journal of the Science of Food and Agriculture 82:1425-1431. Gunstone F. D., Harwood J. L., Padley F. B. 1994. The lipid handbook. Chapman and Hall. London. Kelm et al., HPLC separation and purification of cacao (Theobroma cacao L.) procyanidins according to degree of polymerization using a diol stationary phase, J Agric. Food Chem. 54, 2006, 1571 Kuhn D. N., Figueira A. Lopes, U. Motamayor J. C., Meerow A. W. Cariaga K. & Freeman B. & Livingstone D. S Schnell R. J. 2010. Evaluating Theobroma grandiflorum for comparative genomic studies with Theobroma cacao. Tree Genetics & Genomes. 6:783-792 Kuhn et al., Tree Genetics & Genomes 8, 97-111 (2012). Livingstone et al., Mol Breeding 27:93-106 (2011). Martinson V. A. 1966. Hybridisation of cacao and Theobroma grandiflora. Journal of Heredity 57: 134-136. Posnette A. F. 1945. Interspecific pollination in Theobroma. Tropical Agriculture 22: 188-190. Pugh et al., Theor. Appl. Genet. 108 (6), 1151-1161 (2004). Silva C. R. S., Venturieri G. A., Figueira A. 2004. Description of Amazonian Theobroma L. collections, species identification, and characterization of interspecific hybrids. Acta Botanica Brasilis 18: 333-341.