METHODS FOR THE TREATMENT OF EPILEPSY
20230039652 · 2023-02-09
Inventors
- Valérie CREPEL (Marseille, FR)
- Christophe Mulle (Pessac, FR)
- Céline Boileau (Marseille, FR)
- Julie Masante (Saint Jean D'illac, FR)
- Séverine Deforges (Bruges, FR)
- Angélique Peret (Marseille, FR)
- Olivier Danos (Princeton, NJ, US)
- Andrew Mercer (Poolesville, MD)
Cpc classification
C12N2320/32
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/1024
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12N15/66
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to gene therapy targeting GluK2 subunit that can be used to inhibit epileptiform discharges. Short interfering RNA sequences against the human Grik2 gene sequence are described which are efficient in decreasing the expression of GluK2-containing KARs in neurons engineered to express the equivalent shRNA or miRNA. Using a tissue culture model of TLE, the examples remarkably demonstrate that viral expression of shRNA or miRNA inhibits the frequency of epileptiform discharges. Therefore, RNA therapeutics aimed at decreasing the expression of GluK2-containing KARs in neurons can remarkably prevent spontaneous epileptiform discharges in TLE. In particular, the present disclosure relates to a recombinant antisense oligonucleotide that targets a Grik2 mRNA. The present disclosure also relates to a method for treating epilepsy in a subject in need thereof, wherein the method comprises: administering an effective amount of a vector comprising an oligonucleotide encoding an inhibitory RNA that binds (e.g., hybridizes) specifically to Grik2 mRNA and inhibits expression of Grik2 in the subject.
Claims
1. A recombinant antisense oligonucleotide comprising a guide sequence that targets a Grik2 mRNA, wherein the guide sequence comprises a polynucleotide with at least 85% sequence identity to the nucleic acid sequence of SEQ ID NOs: 14, 15, 18, or 19.
2. The antisense oligonucleotide of claim 1, wherein the polynucleotide has at least 90%, 95%, or 100% sequence identity to the nucleic acid sequence of SEQ ID NOs: 14, 15, 18, or 19.
3.-4. (canceled)
5. The antisense oligonucleotide of claim 1, further comprising a passenger sequence, wherein the passenger sequence has at least 85% sequence identity to the nucleic acid sequence of SEQ ID NOs: 2, 3, 16, or 17.
6.-7. (canceled)
8. An expression vector comprising a polynucleotide with at least 85% sequence identity to the nucleic acid sequence of SEQ ID NOs: 2, 3, 16, or 17.
9. The expression vector of claim 8, wherein the expression vector further comprises a guide sequence with at least 85% sequence identity to the nucleic acid sequence of SEQ ID NOs: 14, 15, 18, or 19.
10. The expression vector of claim 8, wherein the vector is a mammalian, bacterial, or viral vector.
11. The expression vector according to claim 10, wherein the viral vector is an adeno-associated viral (AAV) vector, lentiviral vector, or retroviral vector.
12. (canceled)
13. The expression vector of claim 11, wherein the AAV vector is an AAV9 or AAVrh10 vector.
14. The expression vector of claim 11, wherein the AAV vector comprises (i) an expression cassette comprising a transgene operably linked to one or more regulatory elements and flanked by ITRs, and (ii) an AAV capsid.
15. The expression vector of claim 14, wherein the one or more regulatory elements comprise a promoter sequence, enhancer sequence, transcription termination sequence, and/or polyadenylation signal.
16. An expression cassette comprising a polynucleotide comprising: (I) (a) a stem-loop sequence comprising, from 5′ to 3′: (i) a 5′ stem-loop arm comprising a guide sequence having a nucleic acid sequence of SEQ ID NOs: 14, 15, 18, or 19; (ii) a loop region, wherein the loop region comprises a miR-30 loop sequence; (iii) a 3′ stem-loop arm comprising a passenger sequence having a nucleic acid sequence of SEQ ID NOs: 2, 3, 16, or 17 (b) a first flanking region located 5′ to the guide sequence; and a second flanking region located 3′ to the passenger sequence; or (II) (a) a stem-loop sequence comprising, from 5′ to 3′: (i) a 5′ stem-loop arm comprising a passenger sequence having a nucleic acid sequence of SEQ ID NOs: 2, 3, 16, or 17; (ii) a loop region, wherein the loop region comprises a miR-30 loop sequence; (iii) a 3′ stem-loop arm comprising guide sequence having a nucleic acid sequence of SEQ ID NOs: 14, 15, 18, or 19; (b) a first flanking region located 5′ to the guide sequence; and (c) a second flanking region located 3′ to the passenger sequence.
17. The expression cassette of claim 16, wherein: (a) the stem-loop sequence of the expression cassette of (I) comprises a polynucleotide having at least 85% sequence identity to the nucleic acid sequence of SEQ ID NO: 20; or (b) the stem-loop sequence of the expression cassette of (II) comprises a polynucleotide having at least 85% sequence identity to the nucleic acid sequence of SEQ ID NO: 22.
18. The expression cassette of claim 17, wherein: (a) the expression cassette of (I) comprises a polynucleotide having at least 85% sequence identity to the nucleic acid sequence of SEQ ID NO: 21; or (b) the expression cassette of (II) comprises a polynucleotide having at least 85% sequence identity to the nucleic acid sequence of SEQ ID NO: 23.
19.-21. (canceled)
22. The expression cassette of claim 16, wherein: a) the first flanking region and the second flanking regions are miR-30 flanking regions; b) the first flanking region comprises a polynucleotide having at least 85% sequence identity to the nucleic acid sequence of SEQ ID NO: 24; c) the miR-30 loop sequence comprises a polynucleotide having at least 70% sequence identity to the nucleic acid sequence of SEQ ID NO: 25; d) the passenger sequence is fully or partially complementary to the guide sequence; or e) the expression cassette comprises a promoter.
23.-27. (canceled)
28. The expression cassette of claim 22 wherein the promoter is a Pol II, Pol III promoter, a neuron-specific promoter, an hSyn promoter, a CaMKII promoter, a U6 promoter, or a CAG promoter.
29. (canceled)
30. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1, or an expression vector or expression cassette comprising the antisense oligonucleotide, and a pharmaceutically acceptable carrier, excipient, or diluent.
31.-34. (canceled)
35. A method for treating a disorder in a subject in need thereof comprising administering the pharmaceutical composition of claim 30 to the subject.
36. The method of claim 35, wherein the disorder is an epilepsy.
37. The method of claim 36, wherein the epilepsy is temporal lobe epilepsy, a chronic epilepsy, and/or a drug-resistant epilepsy.
38. The method of claim 35, wherein the subject is a human.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0374]
[0375]
[0376]
EXAMPLES
Example 1
Material & Methods
[0377] Ethics
[0378] All the procedures were conducted in accordance with the guidelines of the University of Bordeaux/CNRS Animal Care or approved by the Institut National de la Sante et de la Recherche Médicale (INSERM) animal care and use agreement (B-13-055-19) and the European community council directive (2010/63/UE).
[0379] Primary Hippocampal Cultures
[0380] Primary hippocampal cultures were prepared from 18-day embryonic Sprague-Dawley rats. Briefly, hippocampi were dissected and collected in HBSS containing Penicillin-Streptomycin (PS) and HEPES. Tissues were dissociated with Trypsin-EDTA/PS/HEPES and neurons were plated in minimum essential medium supplemented with 10% horse serum on coverslips coated with 1 mg/mL poly-Llysine (PLL) in 6-well plates at a density of 550.000 cells, for transfection, per dish. Following neuronal attachment to the surface, Ara was added to prevent the growth of glial cells. Cells were maintained at 36.5° C. with 5% CO2.
[0381] In Vitro Models of Temporal Lobe Epilepsy
[0382] Swiss mice were used. They had access to food and water ad libitum and were housed under a 12 h light/dark cycle at 22-24° C. Hippocampal organotypic slices (350 μm) were prepared from mice (P8-9) using a McIlwain tissue chopper. Slices were placed on mesh inserts (Millipore) inside culture dishes containing 1 ml of the following medium: MEM 50%, HS 25%, HBSS 25%, HEPES 15 mM, glucose 6.5 mg/ml and insulin 0.1 mg/ml. Culture medium was changed every 2-3 days and slices maintained in an incubator at 37° C./5% CO2. Pilocarpine (0.5 μM) was added to the medium at 5 D.I.V and removed at 7 D.I.V; slices were recorded for experiments from 13 D.I.V. to 15 D.I.V. When slices were treated with lentivirus or adeno-associated virus (AAV), the infection were performed at 0 D.I.V.
[0383] Electrophysiological Recordings and Analysis
[0384] Organotypic slices were individually transferred to a recording chamber maintained at 30-32° C. and continuously perfused (2 ml/min) with oxygenated ACSF containing the following (in mM): 126 NaCl, 3.5 KCl, 1.2 NaH2PO4, 26 NaHCO.sub.3, 1.3 MgCl2, 2.0 CaCl2), and 10 D-glucose, pH 7.4. Experiments were performed in the presence of 5 μM SR-95531 (gabazine, Sigma). Local field potentials were recorded in the granule cell layer of the dentate gyrus with an insulated tungsten electrode (diameter 50 μm) using a DAM-80 amplifier (low filter, 1 Hz; highpass filter, 3 KHz; World Precision Instruments, Sarasota, Fla.). Signals were analyzed off-line using Clampfit 10.7 (PClamp) and MiniAnalysis 6.0.1 (Synaptosoft, Decatur, Ga.).
[0385] RNAi and Viral Vectors
[0386] We designed RNAi sequences using Smart selection design (Birmingham et al., A protocol for designing siRNAs with high functionality and specificity, Nature Methods., August 2007; 9: 2068-2078.) We compared the efficiency of RNAi sequences (RNAi #h, RNAi #r, RNAi #m) either as shRNAs, or folded as a short hairpin micro RNA adapted (shmiRNA), and finally as a microRNA using the miR30 structure. To express RNAi sequences (RNAi #h, RNAi #r, RNAi #m), we used viral vectors, in order to promote more efficient transfection than with plasmids for DNA expression. In a first series of experiments, RNAi were delivered by lentiviral vectors (Table 3). We selected RNAi #h sequence as an efficient sequence to downregulate the levels of GluK2 in infected primary cultures of rat neurons by Western blotting. We next changed to AAVs which are commonly used viral vectors for gene therapy (Table 3). These AAV were produced by REGENXBIO, Inc. (Rockville, Md.; see exemplary AAV vector map of
[0387] The selected human RNAi (RNAi #h) sequence was compared with rat and mouse sequences (Table 1):
TABLE-US-00014 TABLE 1 Oligonucleotides encoding RNAi sequences targeting human, mouse, and rat Grik2 mRNA SEQ cDNA encoding a SEQ cDNA encoding a ID passenger strand ID guide strand Name Species NO sequence NO sequence RNAi#h H. sapiens 2 taaaacaggcattagctatggg 14 cccatagctaatgcctgtttta RNAi#r R. norvegicus 2 taaaacaggcattagctatggg 14 cccatagctaatgcctgtttta RNAi#m M. musculus 3 taaagcaggcattagctatggg 15 cccatagctaatgcctgcttta
[0388] Table 2 below describes RNA sequences encoded by vectors of the disclosure.
TABLE-US-00015 TABLE 2 RNA sequences encoded by vectors of the disclosure SEQ RNA sequence SEQ RNA sequence ID corresponding to ID corresponding to guide Name Species NO passenger strand NO strand RNAi#h H. sapiens 16 uaaaacaggcauuagcuauggg 18 cccauagcuaaugccuguuuua RNAi#r R. norvegicus 16 uaaaacaggcauuagcuauggg 18 cccauagcuaaugccuguuuua RNAi#m M. musculus 17 uaaagcaggcauuagcuauggg 19 cccauagcuaaugccugcuuua
[0389] Lentivirus or AAV9 coding for miRNAih were used; miRNAih was expressed under CAG or human synapsin (hSyn) promoters. The promoter sequence for the hSyn promoter used in conjunction with lentiviral vectors is provided in SEQ ID NO: 27, as is shown below.
TABLE-US-00016 (SEQ ID NO: 27) CTGCAGAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGA GGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAG CACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAG GGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGC GGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTCAGC GACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTC CCGGCCACCTTGGTCGCGTCCGCGCCCCGCCGGCCCAGCCGGACCGCACC ACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGC GCCGGCGACTCAGCGCTGCCTCAGTCTGC
[0390] The promoter sequence for the hSyn promoter used in conjunction with the AAV9 vectors is provided in SEQ ID NO: 28, as is shown below.
TABLE-US-00017 (SEQ ID NO: 28) CTGCAGAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGA GGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAG CACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAG GGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGC GGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTCAGC ACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTCC CGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGGCCCAGCCGGACCGCACC ACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGC GCCGGCGACTCAGCGCTGCCTCAGTCTGCCAATTGCAGCGGAGGAGTCGT GTCGTGCCTGAGAGCGCAG
[0391] Some constructs were hybrid constructs also expressing fluorescent reporter genes.
TABLE-US-00018 TABLE 3 List of viral constructs used to knockdown the expression of Grik2 by RNAi Construct Sequence Construct Viral titer/mL LV180 Scramble LV.hSyn.TdTomato. 4.6E+08 U6.shRNAscramble Infectious particles LV173 Human LV.hSyn.TdTomato. 7.9E+08 U6.shRNAi#h Infectious particles LV137 Human LV.CAG.tGFP.IRES. 2.7E+08 shmiRNAi#h Infectious particles LV104 — LV.hSyn.GFP 8E+08 Infectious particles LV178 Human LV.hSyn.TdTomato. 3.0E+09 miRNAi#h Infectious particles AAV9-control — AAV9.CAG.GFP 2.0E+13 Gene copies AAV9-scramble Scramble AAV9.hSyn.GFP.Scr2 9E+12 Gene copies AAV9-hu1010 Human AAV9.hSyn.miR30.miRNAi#h 9E+12 (SEQ ID NO: 25) Gene copies
[0392] Statistics Analyses
[0393] All values are given as means+SEM. Statistical analyses were performed using Graphpad Prism Graphpad Prism 7 (GraphPad Software, La Jolla, Calif.). For between-group comparisons, raw data were analyzed by a Mann-Whitney test. The level of significance was set at P<0.05.
[0394] Results
[0395] Firstly, cell culture experiments were performed in primary embryonic rat neurons to evaluate the effect of RNA interference strategy on the levels of the endogenous GluK2 protein level. By Western blotting, we observed a significant reduction of the GluK2 level with the RNAi #1 h (SEQ ID NO: 14) (
TABLE-US-00019 TABLE 4 GluK2 levels in cultured cortical neurons infected with LV constructs encoding RNAi sequences GluK2 levels LV173 LV137 LV178 Mean 40.6 61.2 35.8 S.E.M. 10.9 12.8 1.5 P-value* 0.005 0.038 <0.0001 *Statistically significant differences in GluK2 levels were measured between GluK2 levels in cells treated with RNAi sequences and a control condition in which cortical neurons were not infected.
[0396] Secondly, reliable stereotyped spontaneous epileptiform discharges were recorded in organotypic slices in the presence of 5 μM gabazine as previously described (Peret et al., 2014). In this condition, we observed a striking reduction of the frequency of epileptiform discharges in treated slices with LV137 (LV.CAG.tGFP.IRES.shmiRNAi #h), LV178 (LV.hSyn.TdTomato.miRNAi #h) and AAV9-hu1010 (AAV9.hSyn.miR30.miRNAi #h), compared with control conditions (LV.hSyn.GFP, LV.hSyn.TdTomato.U6.shRNAscramble (TTTGTGAGGGTCTGGTC; SEQ ID NO: 36) and AAV9.CAG.GFP, respective; Tables 5 and 6 and
TABLE-US-00020 TABLE 5 Effect of LV137 and LV178 on the frequency of epileptiform discharges WT.sup.(a) GluK2.sup.−/−(a) LV104 LV137 LV180 LV178 Mean 0.057 0.029 0.065 0.032 0.067 0.043 S.E.M. 0.0068 0.0046 0.0149 0.0098 0.0099 0.0060 n 28 25 6 11 12 23 P-value* ***0.0001 *0.0449 *0.0348 *Statistically significant differences in epileptiform discharges were measured between LV137 or LV178 and control treatments (LV104 and LV180-scramble, respectively). .sup.(a)From Peret et al. Cell Rep. 8(2):347-54, 2014.
TABLE-US-00021 TABLE 6 Effect of AAV9-hu1010 compared with control conditions (AAV9-scramble) on the frequency of epileptiform discharges. AAV9- AAV9- AAV9- WT.sup.(a) GluK2.sup.−/−(a) control scramble hu1010 Mean 0.057 0.029 0.077 0.080 0.029 S.E.M. 0.0068 0.0046 0.0127 0.0146 0.0085 n 28 25 11 7 17 P-value* ***0.0001 **0.0031 *Statistically significant differences in epileptiform discharges were measured between AAV9-hu1010 and control vector (AAV9-scramble; UAAUGUUAGUCAUGUCCACCG; SEQ ID NO: 37) treatment groups. .sup.(a)From Peret et al. Cell Rep. 8(2):347-54, 2014.
CONCLUSION
[0397] In conclusion, our data demonstrated that GluK2 gene (Grik2) silencing, using lentivirus or AAV vectors carrying a RNAi sequence targeting Grik2 (e.g., miRNAi1h), is an efficient strategy to prevent spontaneous epileptiform discharges in TLE.
REFERENCES
[0398] Throughout this application, various references describe the state of the art to which this disclosure pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. [0399] Bahn S., Volk B., Wisden W. (1994). Kainate receptor gene expression in the developing rat brain. J. Neurosci. 14 5525-5547. 10.1523/JNEUROSCI.14-09-05525.1994. [0400] Boudreau Ryan L., Rodriguez-Lehr& Edgardo, Davidson Beverly L., RNAi medicine for the brain: progresses and challenges, Human Molecular Genetics, Volume 20, Issue R1, 15 Apr. 2011, Pages R21-R27. [0401] Bouvier G., Larsen R. S., Rodriguez-Moreno A., Paulsen O., Sjostrom P. J. (2018). Towards resolving the presynaptic NMDA receptor debate. Curr. Opin. Neurobiol. 51 1-7. 10.1016/j.conb.2017.12.020. [0402] Crépel V, Mulle C (2015) Physiopathology of kainate receptors in epilepsy. Curr Opin Pharmacol 20:83-88; doi: 10.1016/j.coph.2014.11.012. Epub 2014 Dec. 13. [0403] Englot, D J., et al (2013) Seizure outcomes after resective surgery for extra—temporal lobe epilepsy in pediatric patients: A systematic review. J. Neurosurgery. 12(2):97-201 [0404] Fritsch B., Reis J., Gasior M., Kaminski R. M., Michael A., Rogawski M. A. (2014). Role of GluK1 kainate receptors in seizures, epileptic discharges, and epileptogenesis. J. Neurosci. 34 5765-5775. 10.1523/JNEUROSC1.5307-13.2014. [0405] Gabriel S, Njunting M, Pomper J K, Merschhemke M, Sanabria E R G, Eilers A, Kivi A, Zeller M, Meencke H-J, Cavalheiro E a, Heinemann U, Lehmann T-N (2004) Stimulus and potassium-induced epileptiform activity in the human dentate gyrus from patients with and without hippocampal sclerosis. J Neurosci 24:10416-10430. [0406] Hardy J. (2010). Genetic analysis of pathways to Parkinson disease. Neuron, 68(2), 201-206. doi:10.1016/j.neuron.2010.10.014. [0407] Melyan Z., Lancaster B., Wheal H. V. (2004). Metabotropic regulation of intrinsic excitability by synaptic activation of kainate receptors. J. Neurosci. 24 4530-4534. 10.1523/JNEUROSCI.5356-03.2004 [0408] Melyan Z., Wheal H. V., Lancaster B. (2002). Metabotropic-mediated kainate receptor regulation of isAHP and excitability in pyramidal cells. Neuron 34 107-114. 10.1016/S0896-6273(02)00624-4. [0409] Mulle C., Sailer A., Pérez-Otaño I., Dickinson-Anson H., Castillo P. E., Bureau I., et al. (1998). Altered synaptic physiology and reduced susceptibility to kainate-induced seizures in GluR6-deficient mice. Nature 392 601-605. [0410] Peret A, Christie L a., Ouedraogo D W, Gorlewicz A, Epsztein J, Mulle C, Crépel V (2014) Contribution of Aberrant GluK2-Containing Kainate Receptors to Chronic Seizures in Temporal Lobe Epilepsy. Cell Rep 8:347-354. [0411] Reiner A, Arant R J, and Isacoff E Y (2012) Assembly Stoichiometry of the GluK2/GluK5 Kainate Receptor Complex. Cell Rep 1:234-240. [0412] Represa A, Le Gall La Salle G, Ben-Ari Y (1989a) Hippocampal plasticity in the kindling model of epilepsy in rats. Neurosci Lett 99:345-350. [0413] Represa A, Robain O, Tremblay E, Ben-Ari Y (1989b) Hippocampal plasticity in childhood epilepsy. Neurosci Lett 99:351-355. [0414] Rodríguez-Moreno A., Herreras O., Lerma J. (1997). Kainate receptors presynaptically downregulate GABAergic inhibition in the rat hippocampus. Neuron 19 893-901. 10.1016/S0896-6273(00)80970-8. [0415] Rodriguez-Moreno A., Sihra T. S. (2007a). Kainate receptors with a metabotropic modus operandi. Trends Neurosci. 30 630-637. [0416] Rodriguez-Moreno A., Sihra T. S. (2007b). Metabotropic actions of kainate receptors in the CNS. J. Neurochem. 103 2121-2135. [0417] Sapru Mohan K., Yates Jonathan W., Hogan Shea, Jiang Lixin, Halter Jeremy, Bohn Martha C. (2006). Silencing of human α-synuclein in vitro and in rat brain using lentiviral-mediated RNAi. Neurology. 198:382-390. [0418] Smolders I., Bortolotto Z. A., Clarke V. R., Warre R., Khan G. M., O'Neill M. J., et al. (2002). Antagonists of GLU(K5)-containing kainate receptors prevent pilocarpine-induced limbic seizures. Nat. Neurosci. 5 796-804. 10.1038/nn88. [0419] Sutula T, Cascino G, Cavazos J, Parada I, Ramirez L (1989) Mossy fiber synaptic reorganization in the epileptic human temporal lobe. Ann Neurol 26:321-330. [0420] Tauck D L, Nadler J V (1985) Evidence of functional mossy fiber sprouting in hippocampal formation of kainic acid-treated rats. J Neurosci 5:1016-1022 [0421] Valbuena S., Lerma J. (2016). Non-canonical signaling, the hidden life of ligand-gated ion channels. Neuron 92 316-329. 10.1016/j.neuron.2016.10.016. [0422] Zinn, E., Pacouret, S., Khaychuk, V., Turunen, H. T., Carvalho, L. S., Andres-Mateos, E., . . . Vandenberghe, L. H. (2015). In Silico Reconstruction of the Viral Evolutionary Lineage Yields a Potent Gene Therapy Vector. Cell reports, 12(6), 1056-1068. doi:10.1016/j.celrep.2015.07.019.