TUMOR ORGANOID MODEL

Abstract

A method of generating an artificial 3D tissue culture of a cancer grown in non-cancerous tissue, includes the steps of providing an aggregate of pluripotent stem cells or progenitor cells, culturing and expanding the cells in a 3D biocompatible matrix, wherein the cells are allowed to differentiate to develop the aggregate into a tissue culture of a desired size; wherein at least a portion of the cells are subjected to cancerogenesis by expressing a oncogene and/or by suppressing a tumor suppressor gene during any of the steps or in the tissue culture, and further including the step of allowing the cells with an expressed oncogene or suppressed tumor suppressor to develop into cancerous cells; drug screening methods; oncolytic virus screening methods; a 3D tissue culture; and a kit for performing the inventive methods.

Claims

1.-15. (canceled)

16. A method of generating an artificial 3D tissue culture of a cancer grown in non-cancerous tissue, comprising the steps of providing an aggregate of pluripotent stem or progenitor cells, culturing and expanding said stem or progenitor cells in a 3D biocompatible matrix, wherein the cells are allowed to differentiate to develop the aggregate into a tissue culture of a desired size; wherein at least a portion of the cells are subjected to carcinogenesis by expressing an oncogene and/or by suppressing a tumor suppressor gene during any of said steps or in the tissue culture, and further comprising the step of allowing said cells with an expressed oncogene or suppressed tumor suppressor gene to develop into cancerous cells.

17. A method of screening a candidate gene or agent for its effects on carcinogenesis, comprising generating an artificial 3D tissue culture, comprising the steps of providing an aggregate of pluripotent stem cells or progenitor, culturing and expanding said stem or progenitor cells in a 3D biocompatible matrix, wherein the cells are allowed to differentiate to develop the aggregate into a tissue culture of a desired size; wherein at least a portion of said cells are subjected to carcinogenesis by expressing or suppressing the candidate gene or by treating the cells with the candidate agent during any of said steps or in the tissue culture, and further comprising the step of culturing said cells in conditions that allow them to develop into cancerous cells.

18. The method of claim 16, wherein the pluripotent stem cells are differentiated into neural cells and/or the tissue is developed into an organoid.

19. The method of claim 16, wherein the 3D biocompatible matrix is a gel, preferably a collagenous gel and/or a hydrogel.

20. The method of claim 16, wherein said aggregate of cells and/or the 3D matrix are cultured in a suspension culture.

21. The method of claim 16, wherein the oncogene, tumor suppressor or candidate gene are selected from CDKN2A, CDKN2B, CDKN2C, NF1, PTEN, p53, ATRX, RB1, CDK4, CDK6, MDM2-B, EGFR, EGFRvIII, PDGFRA, H3F3A, MYC, SMARB1, PTCH1, CTNNB1, MET, RTK, FGFR1, FGFR2, FGFR3, PI3-kinase, PIK3CA, PIK3R1, PIK3C2G, PIK3CB, PIK3C2B, PIK3C2A, PIK3R2, PTEN, BRAF, MDM2, MDM4, MDM1, IDH1, IDH2; preferably from MYC, CDKN2A, CDKN2B, EGFR, EGFRvIII, NF1, PTEN, p53; or combinations thereof such as (i) CDKN2A, CDKN2B, EGFR, and EGFRvIII, (ii) NF1, PTEN and p53, or (iii) EGFRvIII, CDKN2A and PTEN.

22. The method of claim 16, wherein carcinogenesis is after the pluripotent stem cells have been stimulated for tissue-specific differentiation, such as neural differentiation, preferably before expanding said stem cells in a 3D biocompatible matrix, and/or wherein carcinogenesis is a recombinant modification of said genes, preferably by introduction of a transgene for expression of the oncogene or a gene inhibition construct for suppression of the tumor suppressor, especially preferred, wherein said transgene or construct are introduced into cells by nucleofection such as electroporation.

23. The method of claim 16 further comprising the step of identifying cancerous cells in said tissue culture.

24. An artificial 3D tissue culture comprising non-cancerous tissue and cancerous tissue, wherein the cancerous tissue overexpresses an oncogene and/or has a suppressed tumor suppressor, wherein said tissue (i) is obtainable by a method according to claim 16; and/or (ii) comprises a transgene or a construct for suppression of a tumor suppressor at least in cells of the cancerous tissue; and/or (iii) comprises a 3D biocompatible matrix that is a hydrogel.

25. The tissue culture of claim 24, wherein said tissue culture comprises neural tissue and wherein the cancerous tissue is a neural tissue tumor.

26. The tissue culture of claim 24, wherein non-cancerous tissue is at least at the core of the tissue and the cancerous tissue at least at the surface of the tissue.

27. A method of testing or screening a candidate compound or agent or condition for carcinogenesis or for its effect on cancer tissue, comprising contacting cells or a tissue in a method comprising: providing an aggregate of pluripotent stem or progenitor cells, culturing and expanding said stem or progenitor cells in a 3D biocompatible matrix, wherein the cells are allowed to differentiate to develop the aggregate into a tissue culture of a desired size; wherein at least a portion of the cells are subjected to carcinogenesis by expressing an oncogene and/or by suppressing a tumor suppressor gene during any of said steps or in the tissue culture, and further comprising the step of allowing said cells with an expressed oncogene or suppressed tumor suppressor gene to develop into cancerous cells, with the candidate compound or agent or exposing it to the condition, or contacting a tissue of claim 24, with the candidate compound or agent or exposing it to the condition; and maintaining said contacted tissue in culture, and observing any changes in the tissue as compared to said tissue without contacting by said candidate compound or agent or exposure to said condition.

28. The method of claim 27, wherein the candidate agent comprises a virus, preferably a Flavivirus, or wherein the candidate compound comprises a biomolecule, such as a protein or a nucleic acid.

29. The method of claim 27, wherein the condition comprises a difference in culturing environment, preferably lowered or increased nutrients, such as glucose, fat or fatty acids, or altered redox potential or altered temperature.

Description

FIGURES

[0101] FIG. 1. Nucleofection of genome-editing constructs into neural stem/precursor cells (NS/PCs) of cerebral organoids. a, Schematic of the culture system of cerebral organoid system and nucleofection strategy. Example images of each stage are presented. EBs were electroporated at the end of neural induction stage, right before the matrigel embedding to initiate tumorigenesis. EB, embryoid body; bFGF, basic fibroblast growth factor; hESCs, human embryonic stem cells; hiPSCs, human induced pluripotent stem cells; RA, retinoic acid. b, Immunofluorescence photographs revealed that nucleofected cells (GFP, green) in EBs at the end of neural induction stage are NS/PCs (SOX1, red; N-CAD, red; NES, red; arrowheads), but neither mesodermal cells (BRA, red; FOXF1, red; arrows) nor endodermal cells (SOX17, red; CD31, red; arrows). N-CAD: N-CADHERIN; NES: NESTIN; BRA: BRACHYURY. Scale bar: b, upper panel: 200 m; lower panel: 100 m.

[0102] FIG. 2. Clonal mutagenesis in organoids induces tumorous overgrowth. Immunofluorescence photographs (a) and quantification of the GFP fluorescence intensity of organoids 1 day (b) and 1 month (c) after nucleofection. Result showed that EBs from all groups contains similar amount of nucleofected cells 1 day after nucleofection, while organoids from four groups, including MYC, CDKN2A.sup./CDKN2B.sup./EGFR.sup.OE/EGFRvIII.sup.OE, NF1.sup./PTEN.sup./p53.sup., EGFRvIII/PTEN.sup./CDK2A.sup., exhibit dramatic overgrowth of GFP.sup.+cells in cerebral organoids 1 month after nucleofection. Scale bar: a: 1 day: 200 m; 1 month: 500 m.

[0103] FIG. 3. MYC.sup.OE and GBM-like neoplastic cerebral organoids have distinct transcriptional profiles and cellular identities. a, Principle component analysis (PCA) of the top 500 variable genes between normal cells from CTRL organoids and tumor cells from different neoplastic cerebral organoid groups. b, Venn diagrams showed overlap of genes differentially expressed (DESeq, adjusted p value<0.05) between the Cluster 2 (MYC.sup.OE, n=3) and the Cluster 3 (GBM-1, GBM-2, GBM-3, n=7) relative to the CTRL organoids (Cluster 1; n=3). The p value for overlaps were calculated by hypergeometric test. c, KEGG pathway enrichment analysis revealed the differences in signalling pathways between neoplastic cerebral organoids from the Cluster 2 and the Cluster 3. d, The heatmap shows normalised expression levels for differentially expressed genes (adjusted absolute log2fc value>1 or <1 and adjusted p value<0.05) between Cluster 2 and Cluster 3 (n=3 for Cluster 2 and n=7 for Cluster 3 from one experiment) selected from differentially expressed genes between human primary CNS-PNET and GBM tumors. The heatmap was created from log2 (Transcripts Per Kilobase Million, TPM) transformed data that was row (gene) normalised using the Median Center Genes/Rows and Normalise Genes/Rows functions to report data as relative expression between samples. e, Low-magnification images of DAPI (blue) and GFP (green) staining of control and neo-plasm groups 4 months after nucleofection. f-k, Representative immunofluorescence images and quantification of four-month-old organoids from CTRL, MYC.sup.OE, and GBM-1. The staining was performed from six independent experiments with similar results. Quantification was performed on organoids from three independent experiments. Statistical analysis was performed using one-way ANOVA with Dunnett's test. Data are presented as meanSD, with details of sample sizes and values, as well as adjusted p value in Source Data. *, p<0.05; **, p<0.01; ***, p<0.001. Scale bar: c: 100 m.

[0104] FIG. 4. Neoplastic organoids expanded upon renal subscapular xenografts. a, Schematic of renal capsule xenograft procedure. Two-month-old neoplastic organoids were implanted into kidney capsule of nude mice, and tissues were collected 1.5 months after. b, Brightfield and immunofluorescence photographs showed that neoplastic organoids were expanded, while control organoids were largely absorbed. c, Photograph of H&E staining of neoplastic organoids in renal capsule. Glial cells are pointed by arrows, and neurons are pointed by arrowhead. d, Immunohistochemical photographs of glial marker GFAP, precursor marker SOX1, and cell cycle marker Ki67 on implanted organoids. e, Photographs of H&E staining of implanted MYC.sup.OE organoids showed that MYC.sup.OE neoplasm exhibit CNS-PNET-like histopathological features. f, Immunohistochemical photographs of neuronal marker MAP2 revealed that MYC.sup.OE neoplasm barely differentiated into neurons. Scale bar: b: 500 mm; c, d, f: 200 m and 50 m (inset); e: 1000 m; e, e, e: 50 m.

[0105] FIG. 5. GBM neoplastic cerebral organoids exhibit features of GBM invasion. a-c, Representative images of the tumor-normal interface in GBM-1 neoplastic cerebral organoids. Images are representative of at least three independent experiments. d, Immunohistochemical staining of GFAP in GBM-like neoplastic cerebral organoids. Images are representative of two independent renal implantations. Dotted black lines indicate the boundary between implanted neoplastic cerebral organoids and murine kidney. Dotted red line indicates the renal tubule. Arrowheads indicate invaded tumor cells. e, Hierarchical clustering analysis of GBM invasiveness-relevant genes from four-month-old organoids (n=3 for CTRL organoids; n=4 for MYC.sup.OE, n=4 for GBM-1, n=4 for GBM-2, and n=3 for GBM-3 neoplastic cerebral organoids, from three independent cultures for each group). The heatmap was created from log2 (TPM) transformed data that was row (gene) normalised using the Median Center Genes/Rows and Normalise Genes/Rows functions to report data as relative expression between samples. f, Representative immunofluorescence staining of neoplastic cerebral organoids from GBM-1 group for the indicated mesenchymal marker and invasiveness markers; GFP is also shown. Images are representative of two independent experiments. Scale bar: a, 1000 mm; b and c, 200 mm; d, 25 m; f: 100 m.

[0106] FIG. 6. Using brain neoplastic organoid model to investigate potential brain tumor therapies. a, b, Images (a) and quantification of FACS sorting (b) assay revealed that EGFR inhibitors Afatinib was able to diminish most of GFP.sup.+tumor cells in GBM-1 (n=6) and GBM-3 (n=3) neoplastic cerebral organoids, but exhibited no effect on tumor cells in MYC.sup.OE and GBM-2 neoplastic cerebral organoids compared to DMSO treatment. The percentage of GFP.sup.+cells in total cells from the drug-treated groups were normalized to the percentage of GFP.sup.+cells from DMSO-treated neoplastic cerebral organoids. Statistical analysis of quantification was performed using unpaired two-tailed Student's t-test. c, Schematic of ZIKV infection and experimental setups. d, Immunofluorescence images of GFP and ZIKV of CTRL organoids treated with either MOCK or ZIKV, as well as ZIKV-treated MYC.sup.OE and GBM-1 neoplastic cerebral organoids. e, Quantification of ZIKV infection ratio showed significantly higher infection ratio of GFP.sup.+tumor cells from all neoplastic cerebral organoid groups compared to non-tumor cells from CTRL organoids or neoplastic cerebral organoids. Statistical analysis of quantification was performed using one-way ANOVA with Dunnett's test. f, Immunofluorescence images of neural precursor marker MUSASHI1 (MSI1) of CTRL organoids treated with either MOCK or ZIKV, as well as ZIKV-treated MYC.sup.OE and GBM-1 neoplastic cerebral organoids. g, Immunofluorescence images of apoptosis marker activated Caspase3 (CASP3) of CTRL organoids treated with either MOCK or ZIKV, as well as ZIKV-treated MYC.sup.OE and GBM-1 neoplastic cerebral organoids. h, Quantification of percentage of CASP3.sup.+apoptosis cells showed that ZIKV-infection induced significantly more cells apoptosis in tumor regions compared to MOCK-treated tumor regions, and MOCK- or ZIKV-treated non-tumor regions. CTRL-ZIKV Statistical analysis of quantification was performed using one-way ANOVA with Dunnett's test. i, Quantification of the yields of progeny ZIKV by analysing the percentage of ZIKV-infected Vero cells exposed to the supernatant from CTRL and neoplastic cerebral organoids at 4 dpi. Compared to supernatant from CTRL organoids, significantly more Vero cells were infected exposed to the supernatant from neoplastic cerebral organoid groups. Statistical analysis of quantifications was performed using one-way ANOVA with Dunnett's test. j, Epifluorescence iamges of neoplastic cerebral organoids from MYC.sup.OE groups upon MOCK or ZIKV exposure at 0, 6, and 14 dpi. k, FACS sorting analysis of GFP.sup.+tumor cell proportion in different neoplastic cerebral organoid groups upon MOCK treatment at 14 dpi. The percentage of GFP.sup.+cells in total cells from the ZIKV-treated groups were normalized to the percentage of GFP.sup.+cells from MOCK-treated neoplastic cerebral organoids. Statistical analysis of quantification was performed using unpaired two-tailed Student's t-test. *, p<0.05; **, p<0.01; ***, p<0.001. Scale bar: a, d, f, g, j, 1000 m.

[0107] FIG. 7. The strategy to introduce gene aberrations into neural stem/precursor cells in cerebral organoids. a, Schematic of the strategy of genome-editing techniques to introduce oncogene amplification and/or tumor suppressor mutation/deletion. Sleeping Beauty transposon system was used to integrate oncogene-expression and GFP-expression elements into genome. CRISPR-Cassystem was applied to introduce mutation/deletion of tumor suppressors. b, Quantification of cellular identities of nucleofected cells in EBs 1 day after nucleofection by immunofluorescence staining on serial cryo-sections. Results showed that 100% of GFP.sup.+cells are SOX1.sup.+(n=402), N-CADHERIN.sup.+(N-CAD) (n=451), and NESTIN.sup.+(NES) (n=433) neural stem/precursor cells. None of GFP.sup.+cells is BRACHYURY.sup.+(BRA) (n=398) or FOXF1.sup.+(n=356) mesodermal cells, or SOX17.sup.+(n=328) or CD31.sup.+(n=267) endodermal cells. c, d, Immunofluorescence images (c) and quantification (d) of adherent cell culture of dissociated EBs 1 day after nucleofection. Results showed that 100% of GFP.sup.+cells are SOX1.sup.+(n=549), N-CADHERIN.sup.+(N-CAD) (n=403), and NESTIN.sup.+(NES) (n=461) neural stem/precursor cells. None of GFP.sup.+cells is BRACHYURY.sup.+(BRA) (n=474) or FOXF1.sup.+(n=402) mesodermal cells, or SOX17.sup.+(n=334) or CD31.sup.+(n=415) endodermal cells. Scale bar: c, 50 m.

[0108] FIG. 8. Verification of gene aberrations introduced by genome-editing techniques. a, RNA-seq and RT-PCR analysis showed that tumor cells from MYC.sup.OE neoplastic cerebral organoids exhibit high MYC expression levels. b, Three example sequences of CRISPR-Cas9 targeting CDKN2A and CDKN2B locus in tumor cells from GBM-1 neoplastic cerebral organoids. RNA-seq and RT-PCR analysis showed that tumor cells from GBM-1 neoplastic cerebral organoids exhibit high expression levels of both EGFR and EG-FRvIII. c, Three example sequences of CRISPR-Cas9 targeting NF1, PTEN, and TP53 locus in tumor cells from GBM-2 neoplastic cerebral organoids. d, Three example sequences of CRISPR-Cas9 targeting CDKN2A and PTEN locus in tumor cells from GBM-3 neoplastic cerebral organoids. RNA-seq and RT-PCR analysis showed that tumor cells from GBM-3 neoplastic cerebral organoids exhibit high expression level of EGFRvIII, but not EGFR.

[0109] FIG. 9. Low-magnification images revealed that 4-month-old neoplastic organoids showed brain tumor subtype-specific cellular identities. a, Immunofluorescence photographs of control and neoplastic groups 1 day and 4 months after nucleofection confirmed the tumor-initiation capability of genetic disruptions. b, Immunofluorescence photographs of DAPI (blue) and GFP (green) staining of control and neoplastic groups 4 months after nucleofection. c-h, Immunofluorescence photographs and quantification of neuronal marker HuC/D (c), precursor marker SOX2 (d, red), cell cycle marker Ki67 (e, red), CNS-PNET marker CD99 (f, red), as well as glial marker S100 (h, red) and GFAP (g, red). Scale bar: a: upper panel: 200 m, lower panel: 1000 m; b-g: 1000 m.

[0110] FIG. 10. High-magnification images revealed that 1-monthold neoplastic organoids showed brain tumor subtype-specific cellular identities. a, Immunofluorescence photographs of control and neoplastic groups 1 day and 1 months after nucleofection confirmed the tumor-initiation capability of genetic disruptions. b, Immunofluorescence photographs of DAPI (blue) and GFP (green) of control and tumor groups 1 month after nucleofection. c-e, Immunofluorescence photographs and quantification of neuronal marker HuC/D (c, red), precursor marker SOX2 (c, cyan), cell cycle marker Ki67 (d, red), as well as glial marker S100 (e, red). Scale bar: a: upper panel: 200 m, lower panel: 1000 m; b, 1000 m; c-h: 100 m.

[0111] FIG. 11. Low-magnification images revealed that one-month-old Neoplastic organoids showed brain tumor subtype-specific cellular identities. a, Immunofluorescence photographs of control and neoplastic groups 1 day and 1 month after nucleofection confirmed the tumor-initiation capability of genetic disruptions. b, Immunofluorescence photographs of DAPI (blue) and GFP (green) staining of control and neoplastic groups 1 month after nucleofection. c-e, Immunofluorescence photographs and quantification of neuronal marker HuC/D (c, red), precursor marker SOX2 (c, cyan), cell cycle marker Ki67 (d), as well as glial marker S100 (e). Scale bar: a: upper panel: 200 m, lower panel: 1000 m; b-h: 1000 m.

[0112] FIG. 12. In vivo expansion of neoplastic cerebral organoids. Neoplastic cerebral organoids from MYC.sup.OE group and GBM-1 group were implanted into kidney capsule. Engrafted kidneys were analysed at 1 week and 1.5 months after xenograft to evaluate the in vivo expansion of neoplastic cerebral organoids.

[0113] FIG. 13. Drug testing assay showed the drug screening potential of neoplastic organoids. a, Schematic of luciferase assay-based drug testing strategy on neoplastic organoids. b, Quantification of relative luciferase activity revealed that EGFR inhibitors Afatinib and Erlotinib significantly reduced luciferase activity in GBM1 (CDKN2A.sup./CDKN2B.sup./EGFR.sup.OE/EGFRvIII.sup.OE) neoplastic organoids (CTRL group: n=3; DMSO: n=9; Canertinib: n=9; Pelitinib: n=8; Afatinib: n=9; Gefitinib: n=10; Erlotinib: n=9). Normalized luciferase activity was presented. Statistical analysis of quantifications was performed using one-way ANOVA with Dunnett's test. **, p<0.01.

[0114] FIG. 14. ZIKV exhibits various tropism toward different subtypes of neural cells. a,b, Immunofluorescence images and quantifications of triple-staining of GFP (green), ZIKV (magenta), and different neural cell subtype markers, including neural precursor marker SOX2 (cyan) and MSI1 (cyan), glial marker S100 (cyan), and neuronal marker HuC/D (cyan), as well as a double staining for ZIKV (magenta) and GFP (green) that represent tumor cells. Results showed significantly more GFP+ tumor cells co-localized with ZIKV staining compared to other non-tumor neural cell types. In addition, ZIKV infection ratios of SOX2.sup.+and MSI1.sup.+non-tumor precursor cells are significantly higher than HuC/D.sup.+non-tumor neurons, which match the previous observations. c,d, Immunofluorescence images and quantifications of ZIKV infection ratio of different cell types within tumors from different neoplastic cerebral organoid groups. Results demonstrated that cell type tropism within tumor regions. Statistical analysis of quantifications was performed using one-way ANOVA with Dunnett's test. *, p<0.05; ***, p<0.001. Scale bar: a, c, 100 m.

[0115] FIG. 15. Neoplastic cerebral organoids produce more ZIKV progeny. a, Immunofluorescence images of ZIKV-infected Vero cells exposed to the supernatant from CTRL and neoplastic cerebral organoids at 4 dpi. Cells were stained by DAPI (blue), and ZIKV was stained as green. b, qPCR analysis revealed the significantly higher ZIKV gene expression in neoplastic cerebral organoids compared to CTRL organoids upon ZIKV infection. The ZIKV vRNA level of neoplastic cerebral organoids were normalized to the ZIKV vRNA level of CTRL organoids. Statistical analysis of quantifications was performed using one-way ANOVA with Dunnett's test. ***, p<0.001. Scale bar: 100 m.

[0116] FIG. 16. ZIKV infection in tumor regions of neoplastic cerebral organoids resulted in a remarkable more cell apoptosis. a, Immunofluorescence images of cell apoptosis marker CASP3 (red) of ZIKV-infected non-tumor and tumor regions, as well as MOCK-treated non-tumor and tumor regions. DAPI (blue) was stained for nuclei, and GFP (green) was staining to represent tumor cells. b, Immunofluorescence images of ZIKV staining and cell apoptosis marker CASP3 of MYC.sup.OE neoplastic cerebral organoids upon MOCK-treatment, and ZIKV-infection at 6 dpi and 14 dpi. Scale bar: a, 100 m; b, 1000 m.

EXAMPLES

Example 1. Materials and Methods

1.1 Plasmid Constructs and Materials

[0117] For overexpression constructs, based on the Sleeping Beauty Transposase System, the CMV promoter from pCMV(CAT)T7-SB100 (Addgene cat. No.: 34879; Mts et al., 2009, Nat Genet, 41, 753-61) was replaced with CAG promotor from pCAGEN (Addgene cat. No.: 11160; Matsuda and Cepko, 2004, Proc. Natl. Acad. Sci. U.S.A., 101, 16-22). IRDR-R and IRDR-L sequences from pT2/LTR7-GFP (Addgene cat. No.: 62541; Wang et al., 2014, Nature 516, 405-9) were cloned into pCAGEN to produce pCAG-GS/IR. cDNAs used for overexpression were amplified from human cDNA and cloned into the MCS of pCAG-GS/IR. With the help of sleeping beauty transposase SB100X (pCAG-SB100X), CAG-GFP and CAG-oncogenes were integrated into the genome of cells in organoids. To introduce gene mutations, short guide RNAs of tumor suppressors were cloned into CRISPR/Cas9 vector pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene cat. No.: 42230; Ran et al., 2013, Nat Protoc, 8, 2281-308). All cloning primers are listed in the Tables 1.

TABLE-US-00001 TABLE1 Primersforcloningoncogenesintosleeping beautyconstruct Gene symbols Primers MYC up- GACGGCGCGCCCGCCACCATGCTGGATTTTTTTC stream GGGTAG(SEQIDNO:1) down- GACACCGGTTTACGCACAAGAGTTCCGTAG stream (SEQIDNO:2) EGFR/EG up- GACGGCGCGCCCGCCACCATGCGACCCTCCGGGA FRvIII stream CG(SEQIDNO:3) down- GACACCGGTTCATGCTCCAATAAATTCACTG stream (SEQIDNO:4) PDGFRA up- GACGGCGCGCCCGCCACCATGGGGACTTCCCATC stream CGGCGTTC(SEQIDNO:5) down- GACACCGGTTTACAGGAAGCTGTCTTCCACCAG stream (SEQIDNO:6) CDK4 up- GACGGCGCGCCCGCCACCATGGCTACCTCTCGA stream TATGAGC(SEQIDNO:7) down- GACACCGGTTCACTCCGGATTACCTTCATCC stream (SEQIDNO:8) MDM2-B up- GACGGCGCGCCCGCCACCATGTGCAATACCAACA stream TGTCTG(SEQIDNO:9) down- GACACCGGTCTAGGGGAAATAAGTTAGCAC stream (SEQIDNO:10) H3F3A- up- CATTTTGGCAAAGAATTCCCTCGATACCGGGGG K27M/ stream CGCGCCCGCCACCATGGCTCGTACAAAGCAGAC H3F3A- TGC(SEQIDNO:11) G34R down- CGGGAATGCTAGCAATCATTGGTTGATCAGCTT stream TGTTACCGGTTTAAGCACGTTCTCCACGTATG (SEQIDNO:12)
1.2 Human Embryonic Stem Cell (hESC) And Human Induced Pluripotent Stem Cell (iPSC) Culture

[0118] Feeder-free (FF) H9 hESCs were obtained from WiCell with verified normal karyotype and contamination free. FF H9 hESCs were cultured in a feeder-free manner on Matrigel (Corning, hESC-qualified Matrix)-coated plate with mTeSR medium (Stemcell Technologies). Feeder-dependent (FD) H9 hESCs were obtained from WiCell with verified contamination-free. FD H9 hESCs were cultured on CF-1-gamma-irradiated mouse embryonic stem cells (MEFs) (GSC-6001G, Global Stem) according to WiCell protocols. All cell lines were routinely checked for mycoplasma-negative. All stem cells were maintained in a 5% CO.sub.2 incubator at 37 C. Standard procedures were used for culturing and splitting hESCs as explained previously (Lancaster et al., 2013, Nature, 501, 373-9). All hESCs were authenticated using Infinium PsychArray-24 Kit (Illumina).

1.3 Generation of Cerebral Organoids

[0119] Cerebral organoids were cultured as previous described (Lancaster et al., 2013 Nature 501, 373-379; WO 2014/090993 A1; both incorporated herein by reference). Briefly, to make EBs (embryoid bodies), hESCs/hiPSCs were trypsinized into single cells, and 9,000 cells were plated into each well of an ultraplow-binding 96-well plate (Corning) in human ES medium containing low concentration basic fibroblast growth factor (bFGF, 4 ng/ml) and 50 M Rho-associated protein kinase (ROCK) inhibitor (Calbiochem). EBs were fed every three days for 6 days then transferred to neural induction media to form neuroepithelial tissues. After 5-7 days in neural induction media, EBs were embedded into droplets of Matrigel (Corning) and cultured in differentiation medium without vitamin A (Diff-A). Finally, the EB droplets were transferred to 10 cm-dish containing differentiation medium with vitamin A (Diff+A) and cultured on an orbital shaker. Media were changed weekly.

1.4 Nucleofection of Organoids to Induce Gene Mutation/Amplification

[0120] In order to initiate the brain tumors, we introduced the tumor suppressor mutations and/or oncogene amplifications on neuroepithelial cells at the end of neural induction culture, right before the Matrigel embedding. Briefly, 10-15 EBs were collected, resuspended in nucleofetion reagent (Nucleofector kits for human stem cells, Lonza) containing plasmids and transferred into nucleofection vials. Nucleofection was performed according to the manufacturer's protocol. After electroporation, EBs were carefully transferred to 6 cm-dish containing neural induction medium, and cultured at 37 C. incubator for 4 hours. Then nucleofected EBs were embedded into Matrigel and cultured for organoids as described. The neoplastic cerebral organoids with significant overgrowth of GFP.sup.+cels were selected for further investigations, in which the samples were randomly allocated.

1.5 Adherent Cell Culture of Dissociated EBs.

[0121] One day after nucleofection, the EBs were trypsinised at 37 C. for 20 min to make single cell suspension. Then cells were plated on the poly-D-lysine- and laminin-coated coverglasses in neural induction medium with ROCK inhibitor, and cultured in a 5% CO.sub.2 incubator at 37 C. The further immunofluorescence staining and analysis were performed the day after.

1.6 RNA-Seq Analysis

[0122] Organoids from control and neoplastic groups were collected 40 days and four months after nucleofection, and trypsinised with shaking at 37 C. for half an hour. GFP.sup.+cells were sorted according to the example gating strategy, and total RNA was isolated using RNeasy Micro kit (Qiagen) according to the manufacturer's instruction. RNA concentration and quality were analysed using RNA 6000 Nano Chip (Agilent Technologies). Messenger RNA (mRNA) was enriched using SMART-Seq v4 Ultra Low Input RNA Kit (TaKaRa) according to manufacturer's protocol. Libraries were prepared using NEB Next Ultra Directional RNA library Prep kit for Illumina (NEB). Barcoded samples were multiplexed and sequenced 50 bp SE on a HighSeq 2500 (Illumina). mRNA sample isolation, library preparation, and sequencing were performed at the VBCF NGS Unit (www.vbcf.ac.at).

[0123] The unstranded reads were screened for ribosomal RNA by aligning with BWA (v0.7.12) against known rRNA sequences (RefSeq). The rRNA subtracted reads were aligned with TopHat (v2.1.1) against the Homo sapiens genome (hg38). Microexonsearch was enabled. Additionally, a gene model was provided as GTF (UCSC, 2015_01, hg38). rRNA loci are masked on the genome for downstream analysis. Aligned reads are subjected to Transcripts Per Kilobase Million (TPM) estimation with Kallisto (v0.43.0). Furthermore, the aligned reads were counted with HTSeq (v0.6.1; intersection-nonempty) and the genes were subjected to differential expression analysis with DESeq2 (v1.12.4).

[0124] Before the bioinformatics analysis, the expression of oncogenes according to the genome editing manipulation was checked, and one four-month-old sample from GBM-3 neoplastic cerebral organoid group was excluded from the further analysis because of the failure of introducing the overexpression of EGFRvIII.

[0125] PCA was performed using the top 500 variable genes between normal cells from CTRL organoids and tumor cells from different neoplastic cerebral organoid groups. Venn diagram hypergeometric test was performed on differentially expressed genes between Cluster 2 or Cluster 3 versus CTRL, and KEGG pathway enrichment analysis were performed on differentially expressed genes between Cluster 2 and Cluster 3 with an adjusted absolute log2fc value>0.5 and adjusted p value<0.05. Venn diagram hypergeometric test was performed via R language. KEGG pathway enrichment was analysed using DAVID Bioinformatics (david.ncifcrf.gov) (Huang et al, 2009, Nature Protocol, 4, 44-57). The heatmap of RNA-seq was generated using MeV (Saeed et al., 2003, BioTechniques 34, 374-8). For the heatmap of tumor-subtype gene profiling (FIG. 3c), the differentially expressed genes between Cluster 2 and Cluster 3 (adjusted absolute log2fc value>1 or <1 and adjusted p value<0.05) were selected from the differentially expressed gene list (adjusted absolute log2fc value>1 or <1 and adjusted p value<0.05) from human primary tumor transcriptome analysis (Sturm et al., 2016, Cell, 164, 1060-1072). For the heatmap of hierarchical clustering analysis of GBM invasiveness-relevant genes (FIG. 5e), differential expressed genes from any individual GBM groups versus CTRL organoids with an adjusted absolute log2fc value>0.5 and adjusted p value<0.05 were selected. The heatmap was created from log2 (TPM) transformed data that was row (gene) normalised using the Median Center Genes/Rows and Normalise Genes/Rows functions to report data as relative expression between samples.

1.7 Verification of Genome Alteration Introduced by SB and CRISPR/Cas9

[0126] To test whether the genome editing techniques actually altered the genome in tumor cells, GFP.sup.+tumor cells were FACS sorted for genomic DNAs isolation for genotyping and for RNAs to verify the expression of oncogenes. RNAs were isolated using RNeasy Micro kit (Qiagen), and cDNA was synthesised according to previous description (Bagley et al., 2017, Nature Methods, 14, 743-751). RT-PCRs for. MYC, EGFR, EGFRvIII, and TBP were performed using the primers listed in Table 2. Genomic DNAs were isolated using DNeasy Blood & Tissue Kits (Qiagen) according to the manufacturer's instruction. The CRISPR/Cas9 targeted genome locus of tumor suppressor genes were amplified using primers listed in the Table 3. The PCR products were inserted into T vector (Promega) according to the manufacturer's instruction. Nighty-six colonies per gene were cultured for sequencing.

TABLE-US-00002 TABLE2 PrimersforRT-PCR Gene symbols Primers MYC Top TCGGATTCTCTGCTCTCCTC(SEQID NO:33) Bottom CCTGCCTCTTTTCCACAGAA(SEQID NO:34) EGFR/ Top CGGGCTCTGGAGGAAAAG(SEQID EGFRvIII NO:35) Bottom GCCCTTCGCACTTCTTACAC(SEQID NO:36) TBP Top GGGCACCACTCCACTGTATC(SEQID NO:37) Bottom CGAAGTGCAATGGTCTTTAGG(SEQID NO:38) ZIKV Top TTGGTCATGATACTGCTGATTGC(SEQID NO:39) Bottom CCTTCCACAAAGTCCCTATTGC(SEQID NO:40)

TABLE-US-00003 TABLE3 Primersforcloningtumorsuppressorguide RNAsintoCRISPR-Cas9construct Gene symbols Primers CDKN2A Top CACCGTCCCGGGCAGCGTCGTGCAC(SEQID NO:13) Bottom AAACGTGCACGACGCTGCCCGGGAC(SEQID NO:14) CDKN2B Top CACCGACGGAGTCAACCGTTTCGGG(SEQID NO:15) Bottom AAACCCCGAAACGGTTGACTCCGTC(SEQID NO:16) NF1 Top CACCGCTCGTCGAAGCGGCTGACCA(SEQID NO:17) Bottom AAACTGGTCAGCCGCTTCGACGAGC(SEQID NO:18) PTEN Top CACCGAACTTGTCTTCCCGTCGTGT(SEQID NO:19) Bottom AAACACACGACGGGAAGACAAGTTC(SEQID NO:20) p53 Top CACCGTCGACGCTAGGATCTGACTG(SEQID NO:21) Bottom AAACCAGTCAGATCCTAGCGTCGAC(SEQID NO:22) RB1 Top CACCGCGGTGGCGGCCGTTTTTCGG(SEQID NO:23) Bottom AAACCCGAAAAACGGCCGCCACCGC(SEQID NO:24) ATRX Top CACCGAAATTCCGAGTTTCGAGCGA(SEQID NO:25) Bottom AAACTCGCTCGAAACTCGGAATTTC(SEQID NO:26) SMARCB1 Top CACCGAGAACCTCGGAACATACGG(SEQID NO:27) Bottom AAACCCGTATGTTCCGAGGTTCTC(SEQID NO:28) PTCH1 Top CACCGCAGATAGTCCCGGTCCGGCG(SEQID NO:29) Bottom AAACCGCCGGACCGGGACTATCTGC(SEQID NO:30) CTNNB1 Top CACCGAAACAGCTCGTTGTACCGCT(SEQID NO:31) Bottom AAACAGCGGTACAACGAGCTGTTTC(SEQID NO:32)

1.8 Renal Subcapsular Engrafting

[0127] All procedures were performed in accordance with institutional animal care guidelines. Briefly, adult MF1 nu/nu male mice (8 to 12 weeks) were anesthetized with ketamine solution. After disinfecting the surgical site with 70% alcohol, a 1.5-2 cm incision was made and the kidney was carefully exteriorized. The renal capsule was incised for 2-4 mm using a pipette tip, and a capsule pocket for the grafts was made using a blunted glass Pasteur pipette. Two-month-old organoids from each group were carefully implanted under the renal capsule, respectively. Then kidney was gently replaced back into the retroperitoneal cavity. During the exteriorization, the kidney was kept hydration by applying PBS with penicillin/streptomycin. The kidneys were collected one and half months after xenograft for further analysis.

1.9 Immunofluorescence and Immunohistochemistry

[0128] For immunofluorescence staining, tissues were fixed in 4% paraformaldehyde (PFA) at 4 C. for overnight. The tissues were dehydrated in 30% sucrose overnight, embedded in Tissue-Tek (VWR), and then cryosectioned at 16 m. For immunofluorescence staining, sections were blocked and permeabilized in 0.25% Triton X-100 and 4% normal donkey serum (NDS) in PBS at room temperature (RT). Sections were incubated at 4 C. with primary antibody in 0.1% Triton-X-100 and 4% NDS in PBS. After washing three times for 10 min with PBS, sections were incubated with secondary antibodies in 0.1% Triton-X-100 and 4% NDS in PBS and DAPI consecutively for visualizing the immunostains. The primary and secondary antibodies were used for immunofluorescence were listed in Tables 4, 5. Images were captured using a confocal microscope (Zeiss LSM 780). Quantification of images from three independent preparations of neoplastic organoids was performed using Fiji.

TABLE-US-00004 TABLE 4 Primary Antibodies Catalog Appli- Antigen Species Company No. Dilution cation BRACHYURY Goat R&D Systems AF2085 1:200 IF CD31 Mouse Dako M0832 1:200 IF CD99 Rabbit Abcam ab108297 1:500 IF Cleaved Rabbit Cell Signaling 9661S 1:200 IF Caspase-3 Technology Flavivirus Mouse Merck Millipore MAB10216 1:600 IF antigen FOXF1 Goat R&D Systems AF4798 1:200 IF GFAP Rabbit DAKO Z0334 1:500 IF&IHC GFP Chicken Abcam ab13970 1:500 IF&IHC HuC/D Mouse Abcam ab21271 1:100 IF Ki67 Mouse BD Pharmingen 550609 1:100 IF&IHC MAP2 Rabbit Merck Millipore MAB3418 1:500 IHC MSI1 Rabbit Abcam ab21628 1:200 IF N-CADHERIN Mouse BD Biosciences 610920 1:500 IF NESTIN Mouse BD Transduction 611658 1:200 IF Laboratories S100 Rabbit Abcam ab52642 1:200 IF SOX1 Goat R&D Systems AF3389 1:200 IF&IHC SOX2 Rabbit Abcam ab97959 1:1000 IF SOX17 Goat R&D Systems AF1924 1:100 IF Zika Rabbit GeneTex GTX133314 1:600 IF

TABLE-US-00005 TABLE 5 Secondary Antibodies Recog- Fluoro- Catalog Dilu- Appli- Host nizes phore Company No. tion cation Donkey Chicken Alexa Jackson 703- 1: 500 IF Fluor Immuno 605-155 488 Donkey Rabbit Alexa Invitrogen A10042 1: 500 IF Fluor 568 Donkey Rabbit Alexa Invitrogen A31573 1: 500 IF Fluor 647 Donkey Mouse Alexa Invitrogen A31571 1: 500 IF Fluor 647 Donkey Mouse Alexa Invitrogen A10036 1: 500 IF Fluor 568 Donkey Goat Alexa Invitrogen A11057 1: 500 IF Fluor 568 Goat Mouse Alexa Invitrogen A21144 1: 500 IF IgG2b Fluor 568 Goat Rabbit n/a Dako E0432 1: 500 IHC Goat Chicken n/a Abcam Ab97135 1: 500 IHC Rabbit Goat n/a Dako F0250 1: 500 IHC

[0129] For histologic and immunohistochemical staining, tissues were fixed in 4% paraformaldehyde overnight. Fixed tissues were rinsed in PBS, dehydrated by immersion in an ascending ethanol gradient (70%, 90%, and 100% ethanol), embedded in paraffin, and sectioned at a thickness of 2 to 5 m. Sections were stained by a routine Hematoxylin and Eosin (H&E) protocol in a Microm HMS 740 automated stainer. Immunohistochemistry was performed using the Leica Bond III automated immunostainer. The primary and secondary antibodies used in this study were listed in Table 4, 5. Slides were reviewed with a Zeiss Axioskop 2 MOT microscope and images were acquired with a SPOT Insight digital camera. Slides were also scanned with a Pannoramic 250 Flash II Scanner (3D Histech). Digital slides were reviewed and images acquired with the Pannoramic Viewer software (3D Histech). Slides were reviewed by a board certified Veterinary Comparative Pathologist (A.K.).

1.10 Drug Testing on Neoplastic Organoids

[0130] For drug testing, neoplastic organoids were first grown for 2 months, followed by drug treatment for 40 days. EGFR inhibitors Afatinib (www.selleckchem.com, cat. No.: S1011), Erlotinib (www.selleckchem.com, cat. No.: S7786), Gefitinib (www.selleckchem.com, cat. No.: S1025), Canertinib (www.selleckchem.com, cat. No.: S1019), and Pelitinib (Sigma-Aldrich, cat. #: 257933-82-7) (final concentration 1 M) were applied, and DMSO was used as control. After drug treatment, neoplastic organoids were trypsinized for single cell preparation, followed by FACS sorting analysis. Total cell numbers were counted to evaluate the cytotoxicity of the drugs.

1.11 ZIKV Stock Production and Infections

[0131] The ZIKV strain (H/PF/2013) was passaged in Vero cells to establish a viral stock. Briefly, Vero cells (maintained in DMEM medium supplemented with 10% Fetal Bovine Serum, and 2 mM L-Glutamine) were infected with ZIKV at MOI 0.1 and incubated at 37 C., in 5% CO.sub.2 humidified atmosphere. At 3 days post infection, cell supernatants from infected cells were harvested and purified by centrifugation at 1500 rpm for 10 min to remove cellular debris. Supernatant of non-infected cells was used as MOCK. Supernatants were aliquoted and stored at 80 C. To determine viral titer, confluent Vero cells in 96-well plates were infected with serially diluted ZIKV stock. The assay was carried out in eight parallels wells for each dilution with the last column of 96-well plate as cell control without virus. The cells were incubated at 37 C. in 5% CO.sub.2 humidified atmosphere. At 5 days post infection, the appearance of cytopathic effects (CPE) were examined by microscope. The TCID.sub.50 was calculated from the CPE induced in the cell culture. All ZIKV experiments were conducted under Biosafety Level 2 Plus (BSL2+) containment. For infections of organoids, 130 to 160-day-old CTRL or neoplastic organoids cultured in Diff+A medium were transferred into 6 or 10 cm dishes. ZIKV stock and equivalent volume of MOCK were diluted in Diff+A medium to 0.510{circumflex over ()}6 TCID.sub.50 particles/ml and 2 ml/organoid of diluted stocks (for a total of 10{circumflex over ()}6 TCID.sub.50 particles/organoid) were added to the dish and incubated at 37 C., in 5% CO.sub.2 humidified atmosphere on an orbital shaker. Media were changed every 4 days. All the experiments performed in ZIKV studies were done for at least three times independently.

1.12 Statistical Analysis

[0132] Statistical analyses were performed with GraphPad Prism 7. Statistical analysis of quantifications performed was done using unpaired Student's two-tailed t-test for significance between two experimental groups in all experiments, except for those involving NGS-based approaches. Statistically significant threshold was accepted as p<0.05.

Example 2. Clonal Mutagenesis in Organoids Induces Tumorous Overgrowth

[0133] Brain tumors are characterized by a wide variety of DNA aberrations that either cause oncogene overexpression or loss of tumor suppressor gene function (McLendon et al., 2008, Nature, 455, 1061-8). Importantly, a recent re-classification of brain cancer subtypes includes DNA aberrations as a defining feature (Louis et al., 2016, Acta Neuropathol, 131, 803-20), highlighting the need for genetically defined human brain cancer models. To recapitulate a wide variety of tumorigenic events, we combined Sleeping Beauty (SB) transposon-mediated gene insertion with CRISPR/Cas9-based mutagenesis. Combinations of plasmids encoding (1) the SB transposase, (2) GFP flanked by SB inverted repeats (IRs), (3) any oncogene flanked by IRs and (4) multiple plasmids expressing the Cas9 nuclease together with one or many guide RNAs (gRNAs) were introduced into cerebral organoids by electroporation before matrigel embedding (FIG. 7). At this stage of the protocol (FIG. 1a), neural induction is complete and neural stem and progenitor cells (NS/PCs) are expanding on the surface of embryoid bodies (EBs). Immunostaining of EBs 24 h after nucleofection of pCAG-GFP showed that 100% of GFP.sup.+cells are SOX2.sup.+, N-CADHERIN.sup.+(N-CAD.sup.+), and NESTIN.sup.+(NES.sup.+) NS/PCs (FIG. 1b and FIG. 7b-d). None of GFP.sup.+cells are BRACHYURY.sup.+(BRA+) or FOXF1.sup.+mesodermal cells, or SOX17.sup.+or CD31.sup.+endodermal cells (FIG. 1b and FIG. 7b-d). Thus, the electroporated plasmids are exclusively delivered into NS/PCs, which are often presumed to be cells of origin for brain cancers (Chen et al., 2012, Cell, 149, 36-47).

[0134] To ask whether tumor-like overgrowth can be induced in cerebral organoids, we tested 18 single gene mutations or amplifications as well as 15 of the most common clinically-relevant combinations observed in GBM (McLendon et al., 2008, Nature, 455, 1061-8) (Table 6). As most electroporated cells carry the CAG-GFP insertion, GFP intensity was used to quantify proliferation of cells carrying gene aberrations. One day after electroporation, EBs from all groups contained similar amounts of GFP.sup.+cells (FIG. 2a, b). One month later, however, striking overgrowth of GFP.sup.+cells was observed in organoids carrying the MYC-amplification (MYC.sup.OE), and in organoids carrying CDKN2A.sup./CDKN2B.sup./EGFR.sup.OE/EGFRvIII.sup.OE, NF1.sup./PTEN.sup./p53, and EGFRvIII.sup.OE/CDKN2A.sup./PTEN.sup.(FIG. 2a, c). As these combinations of gene aberrations are commonly found in GBM, we refer to them as GBM-1, GBM-2, and GBM-3, respectively. Thus, cerebral organoids can be used to test the tumorigenic capacity of different gene aberrations induced within the same cell of origin.

TABLE-US-00006 TABLE 6 Genetic aberrations Groups with gene aberrations Tumor subtypes CDKN2A GBM CDKN2B GBM NF1 GBM PTEN GBM p53 GBM, Pediatric GBM ATRX Pediatric GBM RB1 GBM CDK4 GBM, Pediatric GBM MDM2-B GBM, Pediatric GBM EGFR GBM EGFRvIII GBM PDGFRA GBM, Pediatric GBM H3F3A-K27M Pediatric GBM H3F3A-G34R Pediatric GBM MYC GBM, CNS-PNET, MB SMARB1 AT/RT PTCH1 MB CTNNB1 MB CDKN2A/CDKN2B GBM CDKN2A/CDKN2B/EGFR GBM CDKN2A/CDKN2B/EGFRvIII GBM CDKN2A/CDKN2B/EGFR/EGFRvIII GBM CDKN2A/CDKN2B/PTEN GBM CDKN2A/CDKN2B/p53 GBM CDKN2A/CDKN2B/PDGFRA GBM EGFR/CDK4 GBM EGFRvIII/CDK4 GBM EGFR/EGFRvIII/CDK4 GBM MDM2-B/CDK4 GBM NF1/PTEN/p53 GBM EGFRvIII/CDKN2A/PTEN GBM H3F3A-K27M/ARTX/p53 Pediatric GBM H3F3A-G34R/ARTX/p53 Pediatric GBM Abbreviation GBM: glioblastoma; CNS-PNET: center nervous system primitive neuroectodermal tumor; MB: medulloblastoma AT/RT: atypical teratoid/rhabdoid tumor

[0135] To confirm that the genome editing techniques actually altered the genome in tumor cells, the expression of oncogenes and/or sequences of CRISPR-targeting regions were analysed, and the results confirmed that tumor cells from different groups carried the expected gene mutations/amplifications (FIG. 8a-d). Thus, cerebral organoids can be used as a platform to test the tumorigenic capacity of different gene aberrations induced within the same cell of origin.

Example 3. MYC.SUP.OE .and GBM-Like Tumors have Distinct Transcriptional Profiles

[0136] To test whether brain tumor-like organoids resemble distinct brain tumor-subtypes, we performed transcriptome analysis on GFP.sup.+cells isolated by FACS. Principal component analysis (PCA) of genes expressed differently between groups identified three distinct clusters. Cluster one included all control (CTRL) organoids which harbour only CAG-GFP and a control gRNA targeting tdTomato (FIG. 3a). Cluster two included the organoids carrying the MYC.sup.OE construct, while cluster three contained the organoids carrying genetic aberrations found in GBM (GBM-1, GBM-2, GBM-3). Importantly, the majority of genes deregulated in the MYC.sup.OE group are distinct from those deregulated in the GBM-groups (FIG. 3b), confirming the PCA analysis. KEGG pathway analysis via the DAVID Bioinformatics tools (Huang et al., 2009, Nature Protocol, 4, 44-57) confirmed a glioma signature in organoids in Cluster 3 and showed upregulation of the PI3K-Akt, Rap1, ErbB, HIF1, NF-kappa B, and Estrogen signaling pathways that are also relevant for GBM (Gutmann et al., 1997, Oncogene, 15, 1611-6; Clark et al., 2012, NEO, 14, 420-IN13; Mayer et al., 2012, Int. J. Oncol., 41, 1260-70; Puliyappadamba et al., 2014, Mol Cell Oncol, 1, e963478) (FIG. 3c). In the organoids from the Cluster 2, we detected upregulation of metabolic pathways and cell cycle genes, but also the Hippo, WNT, TGF, and p53 signalling pathways that are known to be connected to MYC (Rogers et al., 2012, British Journal of Cancer, 107, 1144-52; Hutter et al., 2017, Genes, 8, 107-19; Atkins et al., 2016, Curr. Biol., 26, 2101-13) (FIG. 3c). In addition, the MYC.sup.OE group showed upregulation of an epithelial development signature, suggesting a CNS-PNET-like neoplasm, which originates from neuroepithelial cells.

[0137] To confirm the similarity of the organoid tumors with primary tumor tissues, we tested the genes differentially expressed between CNS-PNET and GBM (Sturm et al., 2016, Cell 164, 1060-72) for their expression in neoplastic organoids. Hierarchical clustering revealed that neoplastic organoids from the MYC.sup.OE group showed a strong CNS-PNET signature. Organoids from Cluster 3 exhibited upregulation of GBM genes (FIG. 3d) and we refer to this cluster as the GBM-group below. Taken together, our observations suggest that we succeeded in creating neoplastic organoids that recapitulate two subtypes of brain tumors by inducing distinct genetic modifications in the same cell of origin.

Example 4. MYC.SUP.OE .and GBM Organoid Tumors have Different Cellular Identities

[0138] To characterize the cellular identities of MYC.sup.OE and GBM neoplastic organoids, we tested specific CNS-PNET and GBM markers 4 months after nucleofection. CNS-PNETs are characterized by undifferentiated SOX2.sup.+cells and high CD99 expression (Rocchi et al., 2010, J. Clin. Invest., 120, 668-80), while the glial markers S100 and GFAP and the proliferation marker Ki67 are diagnostic for GBM.

[0139] In CTRL organoids, the majority of GFP.sup.+cells were HuC/D.sup.+neurons (FIG. 3f and FIG. 9c), while only a small portion of GFP.sup.+cells maintained SOX2 (FIG. 3g and FIG. 9d) and Ki67.sup.+(FIG. 3h and FIG. 9e) and the glial markers S100 (FIG. 3j and FIG. 9h) and GFAP (FIG. 3k and FIG. 9g) were essentially absent in GFP.sup.+cells. In the MYC.sup.OE group, very few GFP.sup.+cells are HuC/D.sup.+(FIG. 3f and FIG. 9c), or express the glial markers S100 (FIG. 3j and FIG. 9h) or GFAP (FIG. 3k and FIG. 9g). Instead, the most GFP.sup.+cells were SOX2.sup.+(FIG. 3g and FIG. 9d), and almost half of them expressed Ki67 (FIG. 3h and FIG. 9e). In addition, most MYC.sup.OE/GFP.sup.+cells expressed high levels of CD99 antigen (FIG. 4i and FIG. 9f), further confirming their CNS-PNET-like cellular identities. In the GBM-relevant groups, GFP.sup.+regions were positive for S100.sup.+(FIG. 3j and FIG. 9h) and GFAP.sup.+(FIG. 3k and FIG. 9g) glial cells and contained only few HuC/D.sup.+neurons (FIG. 3f and FIG. 9c). Compared with CTRL organoids, we also detected more SOX2.sup.+(FIG. 3g and FIG. 9d) and Ki67.sup.+(FIG. 3h and FIG. 9e) cells, which are also found in the central core of GBM tumors (Schmitz et al., 2007, British Journal of Cancer, 96, 1293-301). In addition, GFP.sup.+regions in GBM-relevant groups showed elevated CD99 levels (FIG. 4i and FIG. 9f), a feature also reported for GBM tissues (Seol et al., 2012, Genes & Cancer, 3, 535-49).

[0140] We also examined tissue organization in the various groups of organoid neoplasms. In CTRL organoids, GFP.sup.+cells located in the ventricular zone (labelled with dashed line) of rosette-like cortical regions, expressed SOX2 and Ki67, while GFP.sup.+/HuC/D.sup.+neurons were located in the basal cortical regions (FIG. 3e-k and FIG. 9b-g). In the MYC.sup.OE group, GFP.sup.+cells formed both large sheets of cells and small rosette-like structures (FIG. 3e-k and FIG. 9b-g), which are also often observed in CNS-PNET tissues. GBM-groups, in contrast, showed a disorganized architecture with disruption of orderly cortical architecture (FIG. 3e-k and FIG. 9b-g). Noteworthy, staining of 1-month-old control organoids and neoplastic organoids showed similar trends of cellular identities and same histological features as 4-month-old organoids (FIG. 10a-e and FIG. 11a-e).

[0141] Thus, neoplastic organoids induced through generating distinct genetic aberrations recapitulate the establishment of cellular identities and histo-morphological structures of either CNS-PNET or GBM, starting from the same cell of origin.

Example 5. Renal Subscapular Engrafting of Neoplastic Organoids

[0142] To confirm that organoid neoplasms can grow in vivo, we implanted them into renal subcapsular space of immunodeficient mice, an environment that can provide abundant blood supply to implanted cells (FIG. 4a). In controls, four out of five organoids were resorbed within six weeks and the remaining organoid was reduced to only a tiny cluster of cells (FIG. 4b) that had lost cellularity and architectural detail (FIG. 4c). Thirteen out of fifteen neoplastic organoids, in contrast, were retained and often expanded even beyond the renal capsule (FIG. 4b and FIG. 12). Transplanted organoids from the MYC.sup.OE group proliferated massively often invading the adjacent renal cortex. They formed cell sheets and rosettes remarkably similar to CNS-PNET (FIG. 4c, e, e). Immunohistochemical analysis revealed many neuro-epithelial areas positive for the NS/PC marker SOX1 (FIG. 4d), but very few cells positive for the glial marker GFAP (FIG. 4d) or the neuronal marker MAP2 (FIG. 4f), indicating their primitive, poorly differentiated state. GBM groups instead displayed high expression of glial marker GFAP, NS/PC marker SOX1, and cell cycle marker Ki67 (FIG. 4d). GBM-1 and GBM-3 organoids displayed a glial (arrowhead) neoplasia like expansion (FIG. 4c), while GBM-2 showed glial (arrowhead) neoplasia like proliferation with additional cells of mature neuronal appearance (arrow) reminiscent of glioneuronal tumors (FIG. 4c). Thus, neoplastic organoids can engraft and expand in vivo and maintain their subtype identity upon renal transplantation into nude mice.

Example 6: GBM-Like Neoplastic Cerebral Organoids are Suitable to Study Interaction Between Tumorous and Normal Tissues

[0143] Compared to other in vitro brain tumor models such as 2D cell cultures or 3D tumor spheres, a distinct feature of the inventive neoplastic cerebral organoids is that tumors were initiated by introducing gene aberrations in a very small portion of cells during cerebral organoid culture. This not only mimics human tumor initiation in vivo, but also results in a mixed structure which contains both tumor and normal tissues adjacent to each other. This advantage allowed this approach an ideal platform to study some essential tumor biological questions such as invasiveness, which is one of the main causes of high mortality in GBM patients.

[0144] GBMs are known to extensively infiltrate into adjacent brain parenchyma. During GBM progression, epithelial-mesenchymal transition (EMT) confers essential migratory and invasive capabilities to tumor cells. Therefore, high expression of transcription factors inducing EMT are observed in GBMs, which may also activate mesenchymal features in them. With respect to invasiveness, many proteases, including matrix metalloproteases, are also involved in the interaction between GBM tumor cells and the extracellular matrix (ECM).

[0145] To assess whether neoplastic cerebral organoids can be used to study the invasiveness of GBM, we evaluated the neoplastic and normo-cellular interface in GBM-like neoplastic cerebral organoids. We observed the invasive presence of GFP.sup.+tumor cells within normal regions (FIG. 5a-c). Small invasive foci of tumor cells that breached the renal capsule were also observed in the renal xenografts of GBM-group neoplastic cerebral organoids (FIG. 5d). To analyze the invasiveness of GBM-group tumor cells, RNA-seq analysis was further performed to compare the expression of invasion-related genes in tumor cells and normal cells from 4-month-old organoids. Hierarchical clustering analysis showed that, compared to CTRL organoids, the tumor cells from different GBM groups have higher expression level of GBM invasiveness genes, including EMT-related transcriptional factors (TGF, TGF1I1, STAT3, SNAI2, ZEB1, ZEB2), migration-related receptor (CXCR4), extracellular matrix molecules (ITGA5), proteases (PLAU, CTSB, ADAM10, ADAM17, MMP2, MMP14), respectively (FIG. 5e). In addition, tumor cells from GBM groups exhibit downregulation of many genes inhibiting tumor invasion compared to normal cells in CTRL organoids, such as tissue inhibitors of matrix metalloproteinases (TIMP2, TIMP3), and tight junction components (CLDN1, CLDN2, CLDN3, OCLN) (FIG. 5e). To confirm the RNA-seq results, immunostaining was performed using antibodies against the mesenchymal marker vimentin (VIM), invasion-associated proteases urokinase (PLAU) and matrix metalloproteinase 2 (MMP2). Results revealed that tumor cells in neoplastic cerebral organoids expressed higher level of all those GBM invasiveness genes compared to the surrounding normal tissues (FIG. 5f). Interestingly, most invasion-related genes were downregulated in MYC.sup.OE neoplastic cerebral organoids compared to GBM groups (FIG. 5e), which correlated with the lower regional infiltration tendency of embryonal neoplasms when compared to astrocytic neoplasms. These observations confirmed the invasiveness of tumor cells from the GBM group of neoplastic cerebral organoids, and suggested the immense potential for using neoplastic cerebral organoids to study the properties of carcinogenic mutations and the behavior of invasive cells at the interface between neoplastic and normal cells.

Example 7. Screening of EGFR Inhibitors to Reduce Tumor Growth

[0146] To evaluate the potential use of neoplastic cerebral organoids in preclinical investigation of human brain tumors, we tested the suitability of using the model for targeted drug testing. Since our approach initiated tumorigenesis by introducing defined gene aberrations, the neoplastic cerebral organoids could be potentially used for targeted drug testing. To exam this, we applied one EGFR inhibitor Afatinib, which is currently in a clinical trial for GBM (ClinicalTrials.gov NCT No.: NCT02423525), as a proof of principle. Forty days after treatment, Afatinib significantly reduced the number of tumor cells in GBM-1 and GBM-3 (FIG. 6a,b), but showed no effect on the MYC.sup.OE and GBM-2 groups (FIG. 6a,b). This is consistent with the fact that only GBM-1 and GBM-3 organoids are mainly driven by EGFR over-activation. Thus, neoplastic cerebral organoids can be used to test the effect of chemical compounds on tumors originating from specific driver mutations.

[0147] In an effort toward adapting this method for large scale screening, we modified the neoplastic cerebral organoid system to include firefly luciferase for measurement of tumor size (FIG. 13a). Five different EGFR inhibitors, including Afatinib, Erlotinib, and Gefitinib, which are approved for different types of cancers, and the experimental drugs Canertibib and Pelitinib, were applied to organoids from GBM-1 groups, which are mainly driven by EGFR signalling. Forty days after drug treatment, Afatinib and Erlotinib significantly reduced firefly luciferase activity, while the other inhibitors had only non-significant effects (FIG. 13b). Thus, these results suggested that our model could identify the efficacy of different compounds and is suitable for drug screening.

Example 8. Tumor Tropism and Oncolytic Effect of Zika Virus

[0148] Neoplastic cerebral organoids contain both normal and tumor tissues, which make them an ideal model to evaluate tumor tropism and efficacy of oncolytic viral therapy. In this study, we tested the neurotropic ZIKV as the proof of principle. In embryos, ZIKV infects neural precursors resulting in massive apoptosis and severe foetal microcephaly (Qian et al., 2016, Cell, 165, 1238-54; Tang et al., 2016, Cell Stem Cell, 18, 587-90). In adults, the virus causes only mild symptoms and a connection with severe diseases like Guillain-Barre syndrome is controversial (Silva and Souza, 2016, Rev. Soc. Bras. Med. Trop., 49, 267-73). A recent study showed that ZIKV can specifically infect GBM stem cells (Zhu et al., 2017, J. Exp. Med., 214, 2843-57), which shares similarities to NS/PCs (Ward et al., 2007, Annu. Rev. Pathol. Mech. Dis., 2, 175-89).

[0149] In this study, we used organoids older than 4 months that consist mostly of differentiated neurons and glial cells (Pasca et al., 2015, Nature Methods, 12, 671-8; Renner et al., 2017, EMBO J, 36, 1316-29) (FIG. 6c). Six days post infection (dpi), immunofluorescent analysis from photographs and quantification showed widespread infection of ZIKV in the GFP.sup.+tumor regions, with little infection in GFP.sup.non-tumor regions (FIG. 6d,e). Interestingly, ZIKV.sup.+cells in the tumor regions expressed the neural precursor markers MUSASHI1 (MSI1) (FIG. 6f), which is also highly expressed in gliomas (Kaneko et al., 2000, Dev. Neurosci., 22, 139-53; Fox et al., 2015, Annu. Rev. Cell Dev. Biol., 31, 249-67). Comparison of ZIKV infection ratio in different subtypes of neural cells in non-tumor regions and GFP.sup.+tumor cells revealed that ZIKV exhibited higher tropism towards tumor cells than other neural cells, even including NS/PCs in the non-tumor regions (FIG. 14a,b). Further quantification of the cell subtypes infected by ZIKV in tumor regions showed that most ZIKV-infected cells from GBM organoid tissue are SOX2.sup.+, MSI1.sup.+NS/PCs, or S100.sup.+glial cells, but not HuC/D.sup.+neurons, which is consistent with previous work (Zhu et al., 2017, J.Exp. Med., 214, 2843-57) (FIG. 14c,d). In MYC.sup.OE neoplastic cerebral organoids, ZIKV-infected cells are mainly SOX2.sup.+and MSI1.sup.+NS/PCs (FIG. 14c,d). In addition, since it has been shown that MSI1 promotes ZIKV replication (Chavali et al., 2017, Science, 357, 83-8), we compared the production of ZIKV particles from CTRL and neoplastic cerebral organoids. This experiment demonstrated that the yield of progeny ZIKV from neoplastic cerebral organoids were significantly higher than CTRL organoids at 4 dpi (FIG. 6i and FIG. 15a,b).

[0150] Next, we tested if ZIKV infection could cause tumor cell apoptosis in neoplastic cerebral organoids. We stained for the apoptosis marker activated Caspase3 (CASP3) and found that ZIKV-infected tumor regions in organoids are largely CASP3.sup.+, while non-tumor regions and CTRL organoids, as well as the MOCK-exposed neoplastic cerebral organoids contained significantly less CASP3.sup.+cells (FIG. 6g, h and FIG. 16). In the MYC.sup.OE group, the oncolytic effect of ZIKV was particularly striking and could even be observed by epifluorescence analysis (FIG. 6j). To further confirm a preferential cytotoxicity of tumor cells over non-tumor cells induced by ZIKV infection, we measured the fraction of GFP.sup.+cells in neoplastic cerebral organoids at 14 dpi. The proportions of GFP.sup.+cells in ZIKV-exposed neoplastic cerebral organoids were significantly reduced compared to the proportion in MOCK-exposed neoplastic cerebral organoids (FIG. 6k), indicating that ZIKV exhibits tropism towards tumor cells and significantly reduces the number of tumor cells in both PNET and GBM neoplastic cerebral organoids, with minor damage to normal cells.

Example 9. Recapitulation and Comparison

[0151] By recapitulating genetic aberrations found in human brain cancer patients, we were able to induce tumor-like over proliferation in brain organoids. Neoplastic organoids showed many cancer features, such as cellular identities, cancer pathway specific transcriptome profiles, and capability of in vivo expansion and invasion. We tested three mutant combinations that induce glial-orientated differentiation and abnormal overgrowth, indicating their glial neoplasm-like identities. Furthermore, by overexpressing MYC, we could generate neoplastic organoids that showed histopathological features, cellular identities and transcriptome signatures very similar to those in human CNS-PNET (Sturm et al., 2016, Cell, 164, 1060-70; Ellison et al., 2012, Neuropathology), a tumor for which no successful animal or in vitro model existed so far. It is interesting to note that amplification of MYC alone could initiate CNS-PNET-like neoplasia in cerebral organoids within a very short period, while it requires much longer time in animal models with low incidence (Momota et al., 2008, Oncogene, 27, 4392-401).

[0152] Unlike previous GBM culture models (Hubert et al., 2016, Cancer Res, 76: 2465-77), neoplastic cerebral organoids allow the functional analysis of genome aberrations identified in cancer sequencing projects all within the same genetic background. By introducing genome aberrations in organoids started from patient iPS cells, neoplastic organoids can also be used to test the susceptibility of individual patients to different combinations of driver mutations. Unlike glioblastoma cell lines, neoplastic organoids mimic, to a certain degree, the in vivo structural organization. They contain both tumor cells and normal cells within the same culture, so that interactions between transformed and non-transformed cells can be analysed. For drug screening, this particular situation allows for an analysis of anti-tumor effects accompanied by a safety test in the same system. Like all organoid systems, neoplastic organoids are limited by the lack of vasculature so that certain features of GBM such as glomeruloid vascular proliferation and perivascular palisading necrosis are not be observable. Co-culture organoid systems like the one that has been generated for microglia (Muffat et al., 2016, Nat Med, 22, 1358-67) can overcome those limitations.

[0153] Our results add ZIKV to the list of oncolytic viruses that might be used to selectively target tumor cells with minimal disruption of non-neoplastic tissues. Viruses from different viral genera and families have been tested in human glioblastoma multiforme and considered for clinical applications against GBM (Russell et al., 2012, Nat Biotechnol., 30, 658-70). ZIKV is a fetal neurotropic virus able to target neural progenitor cells, astrocytes, oligodendrocyte precursors and to a minor extent neurons in the developing fetus (Qian et al., 2016, Cell, 165, 1238-54). Interestingly, our data indicate that the tumor tropism of ZIKV cannot simply be explained by the abundance of immature progenitor cells as a portion of MSI1.sup.+cells in non-tumor areas or in CTRL organoids were not infected. In adults, the effects of ZIKV infection are mild with only very rare suspected complications (Li et al., 2016, Neuron, 92, 949-58). Thus, a clinical use of ZIKV should be feasible. In any case, our results showcase the power of brain neoplastic organoid models for testing unconventional therapeutic approaches.