DOUBLE-STRANDED NUCLEIC ACID SIGNAL PROBE AND METHOD FOR DETECTING TARGET MOLECULE USING SAME
20200308631 ยท 2020-10-01
Assignee
Inventors
Cpc classification
C12Q2565/601
CHEMISTRY; METALLURGY
G01N21/6486
PHYSICS
C12Q2565/601
CHEMISTRY; METALLURGY
C12Q2565/1025
CHEMISTRY; METALLURGY
C12Q2565/1025
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed is a stable double-stranded nucleic acid signal probe in which single-stranded nucleic acids constituting a double-stranded nucleic acid are complementarily crosslinked (or covalently bonded) with each other, and thus are not affected by temperature, pH, salinity, ionic strength, etc. Also disclosed is a method capable of detecting a target molecule by forming a complex of the stable double-stranded nucleic acid signal probe and the target molecule using the signal probe in the detection of the target molecule, separating only the signal probe from the complex by heating or the like, and detecting the signal probe.
Claims
1.-41. (canceled)
42. A double-stranded nucleic acid signal probe, which is capable of generating a unique signal to a target molecule, comprising: (i) a region that binds specifically to the target molecule; and (ii) a signal-generating region that is linked to the target-molecule-specific binding region, wherein the signal-generating region is a double-stranded nucleic acid formed via complementary cross-linking, and the double-stranded nucleic acid contains two or more regions, each of which is labelled with a same or different signal-generating substance.
43. The signal probe of claim 42, wherein one or more of the two or more regions generate a signal different from those of other remaining regions.
44. The signal probe of claim 42, wherein the signal-generating region is a double-stranded nucleic acid in which two strands are fully or partially double-stranded.
45. The signal probe of claim 42, wherein the target-molecule-specific binding region is a single-stranded nucleic acid, an antibody, an antigen, or an aptamer.
46. The signal probe of claim 42, wherein the signal-generating substance is two or more fluorescent materials each having a different color.
47. The signal probe of claim 42, wherein an immobilization region, which is a previously known sequence, is connected adjacent to the signal-generating region.
48. The signal probe of claim 42, wherein a spacer is linked between the target-molecule-specific binding region and the signal-generating region.
49. The signal probe of claim 42, wherein a binding tag is attached to an opposite side of the target-molecule-specific binding region.
50. The signal probe of claim 42, wherein a binding tag is attached to an opposite side of the target-molecule-specific binding region and the binding tag is biotin or an analog thereof.
51. A method of detecting a target molecule in a sample intended to be analyzed, comprising the steps of: (a) treating the sample intended to be analyzed with a signal probe having a target-molecule-specific binding region to form a complex of the signal probe and the target molecule in the sample; and (b) detecting the signal probe of the complex, wherein the signal probe comprises: (i) the region that binds specifically to the target molecule; and (ii) a signal-generating region that is linked to the target-molecule-specific binding region, wherein the signal-generating region is a double-stranded nucleic acid formed via complementary cross-linking, and the double-stranded nucleic acid contains two or more regions, each of which is labelled with a same or different signal-generating substance, and the step of detecting the signal probe is performed by detecting a signal of the signal-generating region.
52. The detection method of claim 51, wherein the step of detecting the signal probe comprises the steps of (b-1) separating the signal probe from the complex; and (b-2) detecting the signal of the separated signal probe.
53. The detection method of claim 52, wherein the step (b-1) of separating the signal probe from the complex is a step of separating only the signal probe from the complex by heating.
54. The detection method of claim 51, the signal-generating region is a double-stranded nucleic acid in which two strands are fully or partially double-stranded.
55. The detection method of claim 51, the target-molecule-specific binding region is a single-stranded nucleic acid, an antibody, an antigen, or an aptamer.
56. The detection method of claim 51, the signal-generating substance is two or more fluorescent materials each having a different color.
57. The detection method of claim 51, wherein a spacer is linked between the target-molecule-specific binding region and the signal-generating region.
58. The detection method of claim 52, wherein a binding tag is attached to an opposite side of the target-molecule-specific binding region, and wherein the step (b-2) of the signal of the separated signal probe comprises the steps of: (b-2-i) applying the separated signal probe to an analytical support, which is coated with a binding partner to the binding tag, to thus immobilize the signal probe via the binding tag onto the analytical support through specific interaction between the binding tag and the binding partner; and (b-2-ii) detecting a signal of the signal probe immobilized onto the support.
59. The detection method of claim 58, wherein the binding tag is biotin or an analog thereof and the binding partner is streptavidin or an analog thereof.
60. The detection method of claim 58, wherein an immobilization region, which is a previously known sequence, is further connected adjacent to the signal-generating region, and the step (b-2-ii) of detecting the signal of the signal probe comprises the steps of: applying, to the support, an immobilization nucleic acid molecule having a single-stranded nucleic acid sequence complementary to the immobilization region and a binding tag that is linked to the sequence and is able to specifically bind to the binding partner; and detecting the signal of the signal probe.
61. The detection method of claim 60, wherein the binding tag of the immobilization nucleic acid molecule is biotin or an analog thereof and the binding partner is streptavidin or an analog thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
DETAILED DESCRIPTION
[0095] Hereinafter, a better understanding of the present invention may be obtained through the following examples, which are set forth to illustrate but are not to be construed as limiting the present invention.
Terms Used in Examples
[0096] The terms used in the following examples have the meanings described below with regard to the terms used in other parts of this specification including the claims.
[0097] First, in the following examples, the term signal probe, as used herein, is used interchangeably with the first probe, the term signal-generating region is used interchangeably with the color-coded barcode, and the term target-molecule-specific binding region of the signal probe is used interchangeably with the first binding region or the first ligand.
[0098] In the following examples, the term capture probe is used interchangeably with the second probe or the capture probe, and the term target-molecule-specific binding region of the capture probe is used interchangeably with the second binding region or the second ligand.
[0099] Each region labeled with a signal-generating substance, constituting the signal-generating region of the signal probe, is designated as a signal tag.
[0100] The term immobilization nucleic acid molecule is used interchangeably with the immobilization molecule in the following examples.
Example 1: Preparation of Reagents
[0101] 1-1. Preparation of the First Probe (the Signal Probe)
[0102] The first probe functions to bind to a target molecule and generate a signal unique to a target molecule. The first probe basically consists of a signal-generating region, assigning a unique signal to a target molecule, and the first binding region linked thereto, specifically binding to the target molecule. The first probe may further include an immobilization region and a binding tag.
[0103] 1) Preparation of Signal Tag
[0104] The signal tag indicates the basic unit constituting the signal-generating region and is composed of a double-stranded nucleic acid fragment labeled with a signal-generating substance.
[0105] The double-stranded nucleic acid was prepared by performing a polymerase chain reaction (PCR) using M13 DNA as a template and labeling the PCR product of about 900 bp with a signal-generating substance (a detectable label).
[0106] The nucleotide sequence of M13 DNA, which is the backbone of the signal tag, was obtained from the GenBank Database system (http://www.ncbi.nlm.nih.gov; Accession No. NC_003287).
[0107] PCR was carried out using 100 ng of M13 DNA (NEB, USA) as a template with 0.1 M of each of a primer pair below (Bioneer, South Korea) and 1.25 units of Taq Polymerase (Promega, USA) according to a standard PCR method, thereby giving a DNA fragment (903 bp).
[0108] Forward primer (SEQ ID NO: 1): atcaggcgaatccgttattg
[0109] Reverse primer (SEQ ID NO: 2): tcggccttgctggtaatatc
[0110] According to the standard method provided by the manufacturer, using as a template the DNA fragment, which is the PCR product thus obtained, another PCR was performed with the above primer pair, aminoallyl-dCTP (TriLink, USA) and three other types of dNTP according to the standard PCR method, thereby obtaining an aminoallyl-dCTP-incorporated DNA fragment.
TABLE-US-00001 TABLE1 Thenucleotidesequenceofadaptorscontaining sequencesrecognizedbyrestrictionenzymes Adaptors NucleotideSequence SEQIDNO EcoRI/ 5-AATTCCCCGGG-3 SEQIDNO:3 SmaIAdaptor 3-GGGGCCCp-5 SEQIDNO:4 HindIII/ 5-AGCTTGCGGCCGC-3 SEQIDNO:5 NotIAdaptor 3-ACGCCGGCGp-5 SEQIDNO:6 XhoI/ 5-TCGAGCTGCAGG-3 SEQIDNO:7 PstlAdaptor 3-CGACGTCCp-5 SEQIDNO:8 SaII/ 5-TCGACGGATCC--3 SEQIDNO:9 BamHIAdaptor 3-GCCTAGGp-5 SEQIDNO:10
[0111] A restriction enzyme map was prepared for the above PCR product to select restriction enzymes not capable of digesting the PCR product, and the adaptors containing recognition sites for the selected restriction enzymes, as listed in Table 1, were purchased (Gene Link, USA).
[0112] The adaptors were linked to the aminoallyl-dCTP-incorporated PCR product according to the standard method recommended by the manufacturer to give the combinations described below.
[0113] The first domain: 5-Blunt end-DNA fragment-Eco R1/Sma I adaptor-3
[0114] The second domain: 5-Eco RI/Sma I adaptor-DNA fragment-Sal I/Bam HIadaptor-3
[0115] The third domain: 5-Sal I/Bam HI adaptor-DNA fragment-Hind III/Not Iadaptor-3
[0116] The fourth domain: 5-Hind III/Not I adaptor-DNA fragment-Xho I/Pst1adaptor-3
[0117] The fifth domain: 5-Xho I/PstI adaptor-DNA fragment-Sal I/Bam HIadaptor-3
[0118] The sixth domain: 5-Sal I/Bam HI adaptor-DNA fragment-3
[0119] In detail, a ligation reaction was conducted by mixing 3 nmol of the adaptor with 0.3 nmol of the PCR product DNA fragment and adding 1 l of T4 ligase (5 units/l; NEB, USA) to 19 l of the resulting mixture. The products thus ligated were purified to obtain adaptor-attached, aminoallyl-dCTP-incorporated DNA fragments. These DNA fragments were then treated with the above restriction enzymes and purified.
[0120] Four different signal-generating substances were prepared, which were N-hydroxysuccinimide (NHS)-ester fluorescent dyes, Alexa 488, Alexa 594, Alexa 647 (Invitrogen, USA) and Cy3 (GE Healthcare, USA).
[0121] According to the standard method recommended by the manufacturer, 16-20 g of the adaptor-attached, aminoallyl-dCTP-incorporated DNA fragment for each domain was dissolved in 20 l of sterile distilled water (DW) and mixed with 12 l of a labeling solution (25 mg of NaHCO.sub.3 in 1 ml of sterile DW) to give a reaction solution. Separately, each of the signal-generating substances was dissolved in DMSO at a final concentration of 30 g/L to give a signal-generating substance solution. Then, the reaction solution was aliquoted into four tubes with 5 l per tube, and to each tube was added 2 l of any one of the signal-generating substance solutions, followed by incubation for 1 hr at room temperature in the dark.
[0122] After the DNA fragments were labeled with the signal-generating substances in this way, they were purified using the QIAquick PCR Purification Kit (Qiagen, USA), thus giving adaptor-attached DNA fragments, each of which was labeled with the signal-generating substance.
[0123] As a result, four types of signal tags were prepared for each domain, which are double-stranded DNA fragments each labeled with any one of the four different signal-generating substances. These signal tags were designated as H signal tags for convenience.
[0124] 2) Induction and Confirmation of Covalent Bonding
[0125] 1 mg of the H signal tag as prepared above was dissolved in 1 ml of reaction buffer (10 mM Tris (pH 7.0), 200 mM NaCl) and mixed with an equal volume of 0.3 umol of 8-methoxypsoralen (8-MOP; Sigma, USA) dissolved in 95% ethanol, followed by incubation for 1 hr in the dark. Then, this reaction mixture was illuminated with UV light (365 nm, 4 W) for three hours so as to induce covalent bonding between base pairs of the H signal tag chains (A. Arabzadeh et al., International Journal of Pharmaceutics 237 (2002) 47-55).
[0126] A four-fold volume of chloroform was added to the resulting reaction mixture to obtain a non-reactive psoralen-removed supernatant through an extraction process. To the supernatant was added 5 M NaCl at a final concentration of 0.2 M and a three-fold volume of ethanol so as to recover the covalent-bond-induced H signal tag. The covalent-bond-induced H signal tag thus obtained was designated a C signal tag for convenience.
[0127] While the H signal tag and its corresponding C signal tag were heated to 95 C. at a constant rate of 0.5 C., the absorbance was measured at 260 nm using a UV-1800 spectrophotometer (Shimadzu, Japan). The results are given in
[0128] As the temperature was raised, the double strands of the H signal tag began to dissociate and the duplex was converted to single strands, wherein it was found that the melting temperature (Tm) was about 85 C. and the duplex was completely denatured at 95 C. to the single-stranded state. In contrast, the C signal tag was found to maintain its double-stranded structure even at 95 C.
[0129] Preparation of the Signal-Generating Region (the Color-Coded Barcode)
[0130] The C signal tags thus prepared were used for preparing color-coded barcodes as the signal-generating regions.
[0131] First, one signal tag was selected from among the four signal tags for the first domain and placed into each of four tubes at a final concentration of 10 g/ml. To each tube, each of the four signal tags for the second domain was added at a final concentration of 10 g/ml. Then, to this mixture was added a reaction solution of T4 ligase (50 mM Tris-HCl, 10 mM MgCl.sub.2, 1 mM ATP, 10 mM DTT, pH 7.5) at a final volume of 100 L. Also, the other three types of signal tags for the first domain were reacted with each signal tag for the second domain according to the same method as described above. Each of the four signal tags for the first domain was mixed with each of the four signal tags for the second domain, and the resulting 16 reaction mixtures were designated as the first-second domain mixture solutions.
[0132] Similarly, one signal tag was selected from among the four signal tags for the third domain and placed into each of four tubes at a final concentration of 10 g/ml. To each tube, each of the four signal tags for the fourth domain was added at a final concentration of 10 g/ml. Then, to this mixture was added a reaction solution of T4 ligase (50 mM Tris-HCl, 10 mM MgCl.sub.2, 1 mM ATP, 10 mM DTT, pH 7.5) at a final volume of 100 L. Also, the other three types of signal tags for the third domain were reacted with each signal tag for the fourth domain according to the same method as described above. Each of the four signal tags for the third domain was mixed with each of the four signal tags for the fourth domain, and the resulting 16 reaction mixtures were designated as the third-fourth domain mixture solutions.
[0133] Similarly, one signal tag was selected from among the four signal tags for the fifth domain and placed into each of four tubes at a final concentration of 10 g/ml. To each tube, each of the four signal tags for the sixth domain was added at a final concentration of 10 g/ml. Then, to this mixture was added a reaction solution of T4 ligase (50 mM Tris-HCl, 10 mM MgCl.sub.2, 1 mM ATP, 10 mM DTT, pH 7.5) at a final volume of 100 L. Also, the other three types of signal tags for the fifth domain were reacted with each signal tag for the sixth domain according to the same method as described above. Each of the four signal tags for the fifth domain was mixed with each of the four signal tags for the sixth domain, and the resulting 16 reaction mixtures were designated as the fifth-sixth domain mixture solutions.
[0134] Taken together, the above procedures resulted in 16 tubes of the first-second domain mixture solutions, 16 tubes of the third-fourth domain mixture solutions, and 16 tubes of the fifth-sixth domain mixture solutions.
[0135] Thereafter, one tube selected from among the 16 tubes of the first-second domain mixture solutions, one tube selected from among the 16 tubes of the third-fourth domain mixture solutions and one tube selected from among the 16 tubes of the fifth-sixth domain mixture solutions were mixed at an equal concentration. To the resulting reaction solution of 95 l was added 5 l of T4 ligase (5 units/l; NEB, USA). A ligation reaction for 12 hrs resulted in arrangement of the six domain signal tags in a linear, continuous combination, thereby generating a total of 4,096 (161616=4.sup.6) signal-generating regions as the final constructs, which were designated as color-coded barcodes for convenience.
[0136] The reaction products at each reaction step were electrophoresed and the result is shown in
[0137] The color-coded barcodes thus obtained have a structure in which the six signal tags (double-stranded nucleic acid fragments labeled with signal-generating substances) are arranged in a linear order and each signal tag is labeled with any one of four different fluorescent dyes (three Alexa dyes and Cy3), whereby the color-coded barcodes generate a unique detectable signal according to the linear combination of signals, and, as will be described below, when linked to the first binding region, that is, the target-molecule-specific binding region, make it possible to distinguish a total of 4,096 (161616=4.sup.6) target molecules. These color-coded barcodes form a spot of 300 nm in size and are imaged using an epi-fluorescent microscope (U.S. Pat. No. 8,519,115 B2; Nat. Biotechnol. 2008 Mar. 26(3):293-4).
[0138] 4) Preparation of Probes
[0139] The first probe is a construct that recognizes and binds to a target molecule and generates a unique signal to detect the target molecule, wherein the target-molecule-specific binding region, that is, the first binding region, is connected with the signal-generating region.
[0140] This first probe was prepared in two types, namely a form not immobilized to a support and a form immobilized thereto, depending on the presence or absence of a binding material (e.g., biotin). As the first binding region, used were a single-stranded nucleic acid for nucleic acid detection and an antibody and an aptamer for protein detection.
[0141] (1) The Non-Immobilizable First Probe
[0142] A non-immobilizable first probe was designed to have a structure of 5-color-coded barcode-spacer-the first binding region-3. The 5 and 3 ends, used here and below, are intended to indicate the direction or order of the arrangement of the nucleic acid when a nucleic acid such as the color-coded barcode or the spacer is used as a constituent factor of the probe.
[0143] As the spacer, a single-stranded nucleic acid was synthesized to have the following sequence by a commercial supplier.
TABLE-US-00002 Spacersequence: 5-AGAAGCGCAGAGCTTGGGCGCAGAACAC-3
[0144] {circle around (1)} Preparation of the Non-Immobilizable First Probe Containing a Single-Stranded Nucleic Acid as the First Binding Region
[0145] A non-immobilizable first probe was prepared using a single-stranded nucleic acid as the first binding region as follows. First, a single-stranded nucleic acid was synthesized to have a construct of 5-spacer-first binding region-3 (Integrated DNA Technologies, USA). Then, 10 l of the 5-spacer-first binding region-3 construct (1 mg/ml) was mixed with 10 l of a color-coded barcode (1 mg/ml) in a reaction solution (50 mM Tris-HCl, 10 mM MgCl.sub.2, 1 mM ATP, 10 mM DTT, pH 7.5). To the resulting solution of 48 l was added 2 l of T4 ligase (5 units/l; NEB, USA) to allow a ligation reaction, thereby obtaining the non-immobilizable first probe for nucleic acid detection.
[0146] {circle around (2)} Preparation of the Non-Immobilizable First Probe Containing an Antibody as the First Binding Region
[0147] A non-immobilizable first probe was prepared using an antibody as the first binding region as follows. First, to an antibody was added a reactive group (SH group obtained by reducing disulfide bonds of the antibody using DTT) using the Thunder-Link oligo conjugation system (Innova Biosciences, England) according to the manufacturer's protocol, thereby giving an antibody having a reactive group. In detail, according to the manufacturer's standard method, 100 l of an antibody (1 mg/ml) was added to the Antibody Activation Reagent vial and incubated for 1 hr at room temperature, thereby generating an activated antibody having a reactive group. Separately, a spacer having a reactive group (NH.sub.2), 5-spacer-NH.sub.2, was synthesized in the form of a single-stranded nucleic acid (Integrated DNA Technologies, USA). Thereafter, the activated antibody was reacted with the spacer having the reactive group in a solution of N-succinimidyl-S-acetyl-thioacetate to obtain a 5-spacer-antibody-3 construct. Finally, 10 l of the 5-spacer-antibody-3 construct (1 mg/ml) was mixed with 10 l of a color-coded barcode (1 mg/ml) in a reaction solution (50 mM Tris-HCl, 10 mM MgCl.sub.2, 1 mM ATP, 10 mM DTT, pH 7.5). To the resulting solution of 48 l was added 2 l of T4 ligase (5 units/l; NEB, USA) to induce a ligation reaction, thereby yielding the non-immobilizable first probe for protein detection.
[0148] {circle around (3)} Preparation of the Non-Immobilizable First Probe Containing an Aptamer as the First Binding Region
[0149] A non-immobilizable first probe was prepared using an aptamer as the first binding region as follows. First, a construct of 5-spacer-aptamer-3 was synthesized (Integrated DNA Technologies, USA). Then, 10 l of the 5-spacer-aptamer-3 construct (1 mg/ml) was mixed with 10 l of a color-coded barcode (1 mg/ml) in a reaction solution (50 mM Tris-HCl, 10 mM MgCl.sub.2, 1 mM ATP, 10 mM DTT, pH 7.5). To the resulting solution of 48 l was added 2 l of T4 ligase (5 units/l; NEB, USA) to induce a ligation reaction, thereby yielding the non-immobilizable first probe for nucleic acid detection.
[0150] (2) The Immobilizable First Probe
[0151] An immobilizable first probe was designed to have a construct of 5-first binding region-spacer-immobilization region-color-coded barcode-biotin-3. The immobilization region, which consists of repetitions of a previously known sequence, was used to immobilize the first probe onto a support through complementary binding between the immobilization region and an immobilization molecule (that is, an immobilization nucleic acid molecule) containing a sequence complementary to the immobilization region.
[0152] The immobilization region was a single-stranded nucleic acid having the following sequence.
[0153] The immobilization region: 5-(GCCACAGCACCTTGGTGCGTAGGATCTG).sub.10-3
[0154] The number 10, which is an integer, refers to the repeated number of the above sequence.
[0155] {circle around (1)} Preparation of the Immobilizable First Probe Containing a Single-Stranded Nucleic Acid as the First Binding Region
[0156] An immobilizable first probe was prepared using a single-stranded nucleic acid as the first binding region as follows. First, a single-stranded nucleic acid was synthesized to have a construct of 5-spacer-immobilization region-3 (Integrated DNA Technologies, USA). Separately, a color-coded barcode was biotinylated using the Thermo Scientific Biotin 3 End DNA Labeling Kit (Thermo Scientific, USA), thereby generating a 5-color-coded barcode-biotin-3 construct. In detail, 100 l of a color-coded barcode (1 mg/ml) was mixed with 5 l of 5 M Biotin-11-UTP (Biotin-11-Uridine-5-triphosphate) in a reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9). To the resulting solution of 45 l was added 5 l of 1.5 U/l terminal deoxynucleotidyl transferase (TdT), followed by incubation for 1 hr at 37 C. Then, 10 l of the 5-spacer-immobilization region-3 construct (1 mg/ml) was mixed with 10 l of the 5-color-coded barcode-biotin-3 construct (1 mg/ml) in a reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9). To the resulting solution of 45 l was added 2 l of T4 ligase (5 units/l; NEB, USA) to allow a ligation reaction to generate a 5-spacer-immobilization region-color-coded barcode-biotin-3 construct, followed by a purification procedure. Finally, 10 l of the resulting purified construct (1 mg/ml) was mixed with 10 l of the first binding region (1 mg/ml) in a reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9). To the resulting solution of 45 l was added 2 l of T4 ligase (5 units/l; NEB, USA) to allow a ligation reaction, thereby obtaining an immobilizable first probe containing a single-stranded nucleic acid as the first binding region in the construct of 5-first binding region-spacer-immobilization region-color-coded barcode-biotin-3.
[0157] {circle around (2)} Preparation of the Immobilizable First Probe Containing an Antibody as the First Binding Region
[0158] An immobilizable first probe was prepared using an antibody as the first binding region as follows. First, a 5-color-coded barcode-biotin-3 construct and an antibody having a reactive group (SH group) were prepared according to the same method as described above, while a single-stranded nucleic acid having a reactive group (NH.sub.2), 5-NH.sub.2-spacer-immobilization region-3, was synthesized by a commercial supplier (Integrated DNA Technologies, USA). Then, 100 l of the NH.sub.2-spacer-immobilization region construct (1 mg/ml) was mixed with 100 l of the 5-color-coded barcode-biotin-3 construct (1 mg/ml) in a reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9). To the resulting solution of 45 l was added 2 l of T4 ligase (5 units/l; NEB, USA) to allow a ligation reaction, thereby obtaining an NH.sub.2-spacer-immobilization region-color-coded-barcode-biotin-3 construct. Thereafter, the antibody having the reactive group was reacted with the above construct for 12 to 24 hrs at room temperature. To the reaction mixture was added the Conjugate Clean Up Reagent (Innova Biosciences, England), and the resulting mixture was allowed to react for 10 min and then centrifuged at 15,000g for 5 min. This step, the reaction in the Conjugate Clean Up Reagent, followed by centrifugation, was repeated twice to obtain a purified immobilizable first probe containing an antibody as the first binding region in the construct of 5-first binding region-spacer-immobilization region-color-coded barcode-biotin-3.
[0159] {circle around (3)} Preparation of the Immobilizable First Probe Containing an Aptamer as the First Binding Region
[0160] An immobilizable first probe was prepared using an aptamer as the first binding region as follows. First, a 5-color-coded barcode-biotin-3 construct was prepared according to the same method as described above, while a single-stranded nucleic acid, 5-aptamer-spacer-immobilization region-3, was synthesized by a commercial supplier (Integrated DNA Technologies, USA). Then, 100 l of the 5-color-coded barcode-biotin-3 construct (1 mg/ml) was mixed with 100 l of the 5-aptamer-spacer-immobilization region-3 construct (1 mg/ml) in a reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9). To the resulting solution of 45 l was added 2 l of T4 ligase (5 units/l; NEB, USA) to allow a ligation reaction, thereby obtaining an immobilizable first probe containing an aptamer as the first binding region in the construct of 5-first binding region-spacer-immobilization region-color-coded-barcode-biotin-3.
[0161] 1-2. Preparation of the Second Probe and the Capture Competitive Molecule
[0162] The second probe, which is a capture probe, was prepared by binding the second binding region, serving as a target-molecule-specific binding region, to magnetic beads serving as a harvesting material. The competitive molecule was prepared by binding a target molecule (or a target molecule analog capable of competing with the target molecule) to magnetic beads.
[0163] 1) Preparation of the Second Probe Containing a Single-Stranded Nucleic Acid or an Aptamer as the Second Binding Region
[0164] A second probe, containing a single-stranded nucleic acid or an aptamer as the second binding region, was prepared by attaching the second binding region to magnetic beads through biotin-streptavidin interaction. First, a single-stranded nucleic acid or an aptamer, prepared in advance, was biotinylated using the Thermo Scientific Biotin 3 End DNA Labeling Kit (Thermo Scientific, USA) according to the same method as described above in order to obtain 5-second binding region-biotin-3. In detail, according to the manufacturer's standard method, 100 l of the construct (1 mg/ml) was mixed with 5 l of 5 M Biotin-11-UTP in a reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9). To the resulting solution of 45 l was added 5 l of 1.5 U/l terminal deoxynucleotidyl transferase (TdT), followed by incubation for 1 hr at 37 C. Then, the above-prepared 5-second binding region-biotin-3 (50 ng/L) was added to an equal volume of the Streptavidin-coupled Dynabeads (5 g/L) (Dynal Biotech ASA, Norway) and allowed to react by continuous rocking according to the manufacturer's protocol, thereby obtaining a second probe containing a single-stranded nucleic acid as the second binding region.
[0165] 2) Preparation of the Second Probe Containing an Antibody as the Second Binding Region
[0166] The second probe containing an antibody as the second binding region was prepared by directly binding an antibody to magnetic beads, serving as a harvesting material. First, 100 g of an antibody was mixed with 5 mg of magnetic beads having a tosyl group (M-280 Tosyl activated magnetic beads, Dynal Biotech ASA, Norway) in a buffer (0.1 M borate buffer, pH 9.5) and incubated for 48 hrs at room temperature. The antibody-bound magnetic beads were separated using a magnet via the tosyl group and washed with the same buffer to remove unbound antibodies. After washing, the antibody-bound magnetic beads (hereinafter, referred to as capture probe) were reacted with 0.1% bovine serum albumin (BSA) (Sigma, USA) for 4 hrs at 37 C. in order to inactivate tosyl groups unbound to molecules. After several washings, the magnetic beads were stored at 4 C. in a buffer (0.1 M PBS, pH 7.4).
[0167] 3) Preparation of the Capture Competitive Molecule Using a Single-Stranded Nucleic Acid as the Competitive Molecule
[0168] The capture competitive molecule using a single-stranded nucleic acid as the competitive molecule was intended to be used for detecting a nucleic acid as a target molecule. This capture competitive molecule was prepared according to the same method as in the preparation of the second probe containing a single-stranded nucleic acid or an aptamer as the second binding region.
[0169] 4) Preparation of the Capture Competitive Molecule Using a Protein as the Competitive Molecule
[0170] The capture competitive molecule using a protein as the competitive molecule was intended to be used for detecting a protein as a target molecule. This capture competitive molecule was prepared according to the same method as in the preparation of the second probe containing a single-stranded nucleic acid or an aptamer as the second binding region. The same protein as a target protein was used as the competitive molecule.
[0171] 1-3. Preparation of the Immobilization Molecule
[0172] An immobilization molecule was designed to have a nucleotide sequence complementary to the repeated sequence constituting the immobilization region of the first probe, and was prepared by synthesizing a single-stranded nucleic acid biotinylated at its 5 end (Integrated DNA Technologies, USA).
Example 2: Detection of Bacteria
[0173] Typical food-poisoning bacteria, such as E. coli, Salmonella, Listeria and Staphylococcus, were detected using the immobilizable first probe, prepared using the antibodies of Table 2 and the aptamers of Table 3 as the first binding region (ligand).
TABLE-US-00003 TABLE 2 Antibodies binding to surface molecule of food-poisoning bacteria Antibodies Catalog No. Supplier E. coli/Anti-E. coli antibody ab25823 Abcam Listeria/Anti-Listeria Antibody 01-90-95 KPL Salmonella CSA-1/Anti- 01-91-99 KPL Salmonella CSA-1 Antibody
TABLE-US-00004 TABLE3 Nucleotidesequencesofaptamersbindingtosurface moleculeoffood-poisoningbacteria FoodPoisoning Nucleotidesequence Bacteria (5.fwdarw.3) SEQIDNO Note E.coli CGCAGUUUGCGCGCGUUCCA SEQIDNO:13 Korean AGUUCUCUCAUCACGGAAUA PatatentNo. ACACUGCGUGCUUACGACUU SEQIDNO:14 10-0730359 CUGGUCCCAUCAUUCGGCUA AGUUCGAUGAGGGUGACACC SEQIDNO:15 GCCAGGAGUGUUUGCUAGAC Salmonella AGGTCTGTAGGTCTGCGGGGCGTGG SEQIDNO:16 KoreanPatent typhimurium CAGCCAGGATGGGAGGTCTGTAGGT SEQIDNO:17 No. CTGCGGGGCGTGG 10-1459547 Staphylococcus GCAATGGTACGGTACTTCCGGGCTG SEQIDNO:18 Aptagen aureus GCCAGATCAGACCCCGGATGATCAT CCTTGTGAGAACCACAAAAGTGCAC GCTACTTTGCTAA
[0174] As a reaction solution was used 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, pH 7.4) for the antibody ligand and SELEX buffer (20 mM Tris-CI, pH 7.6, containing 100 mM NaCl, 2 mM MgCl.sub.2, 5 mM KCl, 1 mM CaCl.sub.2) and 0.02% Tween) for the aptamer ligand. The reaction solution was supplemented with 0.05% to 0.2% (w/v) of sodium azide for suppressing bacterial proliferation and 0.1% to 0.3% (w/v) of bovine serum albumin for inhibiting non-specific binding. The reaction was carried out at 20 C. to 30 C.
[0175] 70 l of a sample containing bacteria was mixed with 15 l of the biotinylated first probe and allowed to react for 30 min with rocking. 20 l of the reaction mixture was applied to a streptavidin-coated glass slide (Nanocs, USA). The glass slide was washed three times with a washing solution containing 0.1SSPE and 0.1% Tween 20 in order to remove the first probe, which was not bound to bacteria or had non-specific binding. The glass slide was then covered with a coverslip, and spots, generating the signal for the presence of bacteria in a complex formed through the binding of the first probe to bacteria, were imaged using the nCounter digital analyzer (Nanostring technology, USA), and the result is given in
Example 3: Detection of Nucleic Acid and Protein
[0176] 3-1. Nucleic Acid Detection
[0177] The nucleic acid detection was conducted with an immobilizable first probe, containing a single-stranded nucleic acid of Table 4 below as the first binding region, and a second probe, containing a single-stranded nucleic acid of Table 4 below as the second binding region, using -actin, IL17 and IL17RA mRNA molecules as a target molecule. The single-stranded nucleic acids, listed in Table 4 below, for -actin, IL17 and IL17RA mRNA molecules were synthesized (Bioneer, South Korea) and used in the preparation of the first probe and the second probe. The nucleotide sequences of the target molecules, -actin, IL17 and IL17RA mRNA, were obtained from the GenBank database system (http://www.ncbi.nlm.nih.gov) (IL17: Accession number NM_002190; and IL17RA: Accession number NM_014339).
TABLE-US-00005 TABLE4 SequencesofbindingregionsfortargetmRNAs Thefirstbinding Thesecondbinding Types region(5-3) region(5-3) -actinmRNA Gggcgacgaggcccag Ggcatcctcaccctgaa agcaagaga gtacccca (SEQIDNO:19) (SEQIDNO:20) IL17mRNA Ccctcaggaaccctca gacagcctcatttcgga tccttcaaa ctaaactc (SEQIDNO:21) (SEQIDNO:22) IL17RAmRNA Ggagcagaagcctccc Ccttttgggctcagtct agccactag ctccaata (SEQIDNO:23) (SEQIDNO:24)
[0178] Human cartilage tissue (Promocell, Germany) was used as a sample to be analyzed. First, mRNA, as the target molecule, was isolated from the sample using the AllPrep DNA/RNA/Protein Mini kit (Qiagen, USA). In detail, according to the manufacturer's protocol, the cartilage tissue was dissolved in a buffer provided by the manufacturer, loaded onto a column and centrifuged to bind RNA to the column membrane. The RNA bound to the column membrane was recovered by washing the column, eluting RNA from the column membrane and centrifuging the column.
[0179] The isolated RNA (100 ng/l) was mixed with the first probe (200 ng/l) and the second probe (200 ng/l) with rocking to form a complex of the first probe, the target mRNA and the second probe through hybridization. Hybridization was carried out at 65 C. in a reaction solution containing 0.5 M NaHPO.sub.4, 7% sodium dodecyl sulfate (SDS) and 1 mM EDTA. Then, the reaction mixture was applied to a magnet to immobilize the complex onto the magnet through the magnetic beads of the second probe, followed by washing with a washing solution in order to remove the unbound first probe and non-target RNA. The washing was performed three times: once with 6SSC (standard saline citrate)/0.1% SDS at 8 C., once with 0.1SSC/0.1% SDS at 68 C., and once 0.2SSC/0.1% SDS at 42 C.
[0180] The magnet, to which the complex of the first probe, the target mRNA and the second probe was bound, was incubated in a solution containing 0.1SSPE and 0.1% Tween 20 for 5 min at 95 C. in order to separate the first probe from the complex, thereby obtaining a supernatant containing the first probe.
[0181] After the supernatant was obtained, the first probe was immobilized onto a streptavidin-coated coverslip using the nCounter digital analyzer (Nanostring technology, USA), which enables molecular counting, according to the manufacturer's protocol, and the immobilized spots were imaged to thus be detected and quantified.
[0182] In detail, 3 l of the above-obtained supernatant was mixed with 1 l of a 1:5,000 dilution of 0.1% TetraSpeck Fluorescent Microspheres, loaded into a fluid device in the above analyzer equipped with a streptavidin-coated coverslip (Optichem, Accelr8 Technology Corporation) in order to induce attachment of the first probe onto the coverslip as a support, through the interaction between biotin in the first probe and streptavidin in the coverslip. Thereafter, the surface was washed once with 90 l of 1TAE and then treated with 40 l of 1TAE to stretch the first probe, followed by applying 160 V/cm for 1 min. To the stretched first probe was added 60 l of a 500 nM immobilization molecule solution in order to induce complementary binding to an immobilization region, consisting of a repeated sequence, of the first probe, and to thus further immobilize the first probe onto the surface. During the immobilization process, the voltage was maintained for 5 min. After the immobilization process, the TAE solution was removed, and an anti-photobleaching agent for photography, SlowFade reagent (Invitrogen), was added for imaging. Thereafter, four images were obtained at four different excitation wavelengths (480, 545, 580 and 622) corresponding to the four different fluorescent dyes through a camera of the above analyzer. The obtained four images were integrated (spatial clustering), and an image for the first probe was obtained as shown in the schematic diagram of
[0183] Quantitative results were obtained as described above using the above analyzer through molecular counting for the target molecule mRNA. The results thus obtained were found to be similar to the RT-PCR result for the target mRNA.
[0184] 3-2. Protein Detection
[0185] 3-2-1. Protein Detection Using Only the First Probe
[0186] The target molecules of Table 5 below were detected using only an immobilizable first probe containing a polyclonal antibody as listed in Table 5 below as the first binding region for a target molecule. The overall process of protein detection can be seen in
TABLE-US-00006 TABLE 5 Target molecules and antibodies thereto Target molecule/antibody Catalog No. Supplier NGF/NGF Anti-NGF/NGF antibody OKBB00229 Aviva Systems Biology Amyloid beta (A4) Precursor Protein ab12266 Abcam (APP) Anti-Amyloid beta (A4) Precursor Protein (APP) antibody (Tau)/Anti- (Tau) antibody T6402 SIGMA phospho-Tau (pSer400)/Anti-phospho- T1700 SIGMA Tau (pSer400) antibody C Reactive Protein (CRP)/Anti-C ab99995 abcam Reactive Protein (CRP)antibody TGF alpha/Anti-TGF alpha antibody ab9585 abcam IL1 beta/Anti-IL1 beta antibody ab2105 abcam Serum Amyloid A/Anti-Serum ab200584 abcam Amyloid A antibody p53/p53 Antibody (DO-7) MA5-12557 abcam CEACAM5/CEACAM5 Polyclonal MBS170144 BioSource Antibody alpha Fetoprotein/alpha Fetoprotein ABIN356914 Biocompare antibody (alpha-Fetoprotein) (N-Term) E. coli Enoyl-ACP Reductase/Anti- Sino Biological E. coli Enoyl-ACP Inc., China Reductase antibody Phototropin 1/Anti-Phototropin 1 Cosmo Bio Co. antibody Ltd., Japan
[0187] First, each target molecule of Table 5 was added at a concentration of 100 g/ml to 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl pH 7.4) and serially diluted to give final concentrations of 1,000 g/ml, 100 g/ml, 10 g/ml, 0.1 g/ml and 0 g/ml. The resulting serial dilutions for the thirteen biological molecules were mixed at various concentrations to give mixture samples to be analyzed.
[0188] In addition, the first probe was added at a concentration of 200 ng/ml to 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl pH 7.4) to give an immobilizable first probe solution.
[0189] A nitrocellulose membrane disc was added to the reaction solution containing the sample to be analyzed and allowed to react for 30 min with rocking to attach proteins in the sample onto the membrane. Then, the disc was washed with 150 l of 0.1SSPE/0.1% Tween 20 and allowed to react in a blocking solution (2% (w/v) bovine serum albumin (BSA)). 70 l of the immobilizable first probe solution for each target molecule was added and the solution was rocked for 1 hr to induce the formation of a complex between the target molecule and the first probe. The disc was then washed with 150 l of 0.1SSPE/0.1% Tween 20 three times so as to eliminate excess first probes, not forming the complex, and the first probe forming a non-specific complex.
[0190] In order to separate and harvest the first probe from the washed disc, the washed disc was heated in 0.1SSPE/0.1% Tween 20 for 5 min at 95 C. to thus induce separation of the first probe from the complex, thereby obtaining a supernatant containing the first probe.
[0191] After the supernatant was obtained, according to the same method as in Example 3-1, the first probe was immobilized onto a streptavidin-coated coverslip using the nCounter digital analyzer (Nanostring technology, USA), which enables molecular counting, according to the manufacturer's protocol, and the immobilized spots were imaged to thus be detected and quantified.
[0192] 3-2-2. Protein Detection Using the First Probe and the Second Probe (Capture Detection Reaction)
[0193] In the same way as in the immobilizable first probe containing the polyclonal antibody of Table 5 as the first binding region for a target molecule, the target molecules of Table 5 were detected using a second probe containing a polyclonal antibody as listed in Table 5 as the second binding region for a target molecule. The overall process of protein detection can be seen in
[0194] A sample to be analyzed was prepared according to the same method as in the above Example 3-1. 25 l of the sample to be analyzed was mixed with 70 l of an immobilizable first probe solution for each target molecule and 70 l of a second probe and rocked for 1 hr to induce the formation of a complex of the first probe, the target molecule and the second probe. Then, the reaction mixture was applied to a magnet to attach the complex onto the magnet through the magnetic beads of the second probe. The beads bound to the magnet were then washed with a washing solution so as to eliminate unbound first probes and non-target molecules. The washing was carried out three times using 150 l of 0.1SSPE/0.1% Tween 20.
[0195] Then, the complex-adhered magnet was heated in 0.1SSPE/0.1% Tween 20 for 5 min at 95 C. in order to separate the first probe from the complex, thereby obtaining a supernatant containing the first probe.
[0196] After the supernatant was obtained, according to the same method as in Example 3-1, the first probe was immobilized onto a streptavidin-coated coverslip using the nCounter digital analyzer (Nanostring technology, USA), which enables molecular counting, according to the manufacturer's protocol, and the immobilized spots were imaged to thus be detected and quantified.
[0197] The quantified results are given in Table 6 below.
TABLE-US-00007 TABLE 6 The actual and analyzed concentrations of target molecules in the prepared mixture samples Actually Measured Serial used amount amount Target molecules No. (pg/mL) (pg/mL) NGF/NGF 1 12.0 12.5 Amyloid beta (A4) Precursor 2 1.0 0.8 Protein (APP) Tau 3 1.0 0.8 phospho-Tau (pSer400) 4 0.2 0.2 C Reactive Protein (CRP) 5 130 125.5 TGF alpha 6 6.0 6.2 IL1 beta/Anti-IL1 beta antibody 7 40.0 38.1 Serum Amyloid A 8 5.0 5.0 p53 9 2.5 2.5 CEACAM5 10 2.0 1.9 alpha Fetoprotein 11 0.5 0.6 E. coli Enoyl-ACP Reductase 12 80.0 81.9 Phototropin 1 13 10.0 9.5
[0198] Analysis was performed three time for a mock comparative group, consisting of two standard materials (E. coli Enoyl-ACP Reductase and Phototropin 1), and a control group containing a standard material and other target molecules. The mock comparative group consisting of the standard materials was used to generate a standard concentration curve and normalizing data having a difference in reaction, purification and collection efficiencies. The linearity, dynamic range and reproducibility of the standard materials were examined and are shown in
[0199] The thirteen biological molecules of Table 6 were detected in two independent reactions, and the normalized results are shown in a log-log scale in
[0200] 3-2-3. Protein Detection Using the First Probe and the Capture Competitive Molecule (Competitive Detection Reaction)
[0201] The target molecules of Table 5 were detected using a first probe containing an antibody listed in Table 6 as the second binding region and a capture competitive molecule using each protein of Table 5. The overall process of protein detection can be seen in
[0202] A sample to be analyzed was prepared according to the same method as in the above Example 3-1. 25 l of the sample to be analyzed was mixed with 70 l of an immobilizable first probe solution for each target molecule and 70 l of a capture competitive molecule (30 g/l) and rocked for 1 hr to induce the formation of a complex of the first probe, the target molecule and the capture competitive molecule. Then, the reaction mixture was applied to a magnet to attach the complex onto the magnet through the magnetic beads of the capture competitive molecule. The bead bound to the magnet was then washed with a washing solution so as to eliminate unbound first probes, non-target molecules and the first probe-target molecule complex, thereby harvesting only the complex between the first probe and the capture competitive molecule. The washing was carried out three times using 150 l of 0.1SSPE/0.1% Tween 20.
[0203] Then, the magnet, to which the complex of the first probe and the capture competitive molecule was adhered, was heated in 0.1SSPE/0.1% Tween 20 for 5 min at 95 C. in order to separate the first probe from the complex, thereby obtaining a supernatant containing the first probe.
[0204] After the supernatant was obtained, according to the same method as in Example 3-1, the first probe was immobilized onto a streptavidin-coated coverslip using the nCounter digital analyzer (Nanostring technology, USA), which enables molecular counting, according to the manufacturer's protocol, and the immobilized spots were imaged to thus detect and quantify the same. A standard curve was generated from the quantitative results of the capture competitive molecule, and quantitative results of target molecules were obtained from the standard curve.