RNA-Guided Human Genome Engineering
20200308599 ยท 2020-10-01
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/01
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/1024
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N15/8201
CHEMISTRY; METALLURGY
International classification
C12N15/01
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
Claims
1. A method of altering a eukaryotic cell comprising transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
2. The method of claim 1 wherein the enzyme is Cas9.
3. The method of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
4. The method of claim 1 wherein the RNA includes between about 10 to about 250 nucleotides.
5. The method of claim 1 wherein the RNA includes between about 20 to about 100 nucleotides.
6. A method of altering a human cell comprising transfecting the human cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the human cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the human cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
7. The method of claim 6 wherein the enzyme is Cas9.
8. The method of claim 6 wherein the RNA includes between about 10 to about 250 nucleotides.
9. The method of claim 6 wherein the RNA includes between about 20 to about 100 nucleotides.
10. A method of altering a eukaryotic cell at a plurality of genomic DNA sites comprising transfecting the eukaryotic cell with a plurality of nucleic acids encoding RNAs complementary to different sites on genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNAs and the enzyme, the RNAs bind to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
11. The method of claim 10 wherein the enzyme is Cas9.
12. The method of claim 10 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
13. The method of claim 10 wherein the RNA includes between about 10 to about 250 nucleotides.
14. The method of claim 10 wherein the RNA includes between about 20 to about 100 nucleotides.
15. A method of modulating transcription from a target DNA molecule, the method comprising: contacting a target DNA molecule inside of a cell with a complex comprising (a) a chimeric Cas9 protein comprising a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or a HNH domain; and (b) a DNA-targeting RNA comprising (i) a targeter-RNA that hybridizes with a target sequence of the target DNA molecule, and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 11 base pairs, thereby resulting in modulation of transcription from the target DNA molecule.
16. The method of claim 15, wherein said contacting comprises introducing into the cell one or more of: (1) the chimeric Cas9 protein, or a nucleic acid encoding the chimeric Cas9 protein; (2) the targeter-RNA, or a DNA molecule encoding the targeter-RNA; and (3) the activator-RNA, or a DNA molecule encoding the activator-RNA.
17. The method of claim 16, wherein one or more of: the nucleic acid encoding the chimeric Cas9 protein; the DNA molecule encoding the targeter-RNA; and the DNA molecule encoding the activator-RNA, is a recombinant expression vector selected from the group consisting of a plasmid and a viral vector.
18. The method of claim 16, wherein said contacting comprises introducing (1), (2), and (3) into the cell.
19. The method of claim 16, wherein said contacting comprises introducing the targeter-RNA and the activator-RNA into the cell.
20. The method of claim 16, wherein said contacting comprises introducing the chimeric Cas9 protein, the targeter-RNA, and the activator-RNA into the cell.
21. The method of claim 16, wherein the DNA molecule encoding the targeter-RNA and the DNA molecule encoding the activator-RNA are the same DNA molecule.
22. The method of claim 16, wherein one or more of: the targeter-RNA, and the DNA molecule encoding the targeter-RNA, is conjugated to a heterologous moiety.
23. The method of claim 15, wherein said contacting comprises inducing the expression of (a).
24. The method of claim 15, wherein the method comprises introducing two or more DNA-targeting RNAs into the cell, wherein the two or more DNA-targeting RNAs hybridize with different target sequences within the same or different target DNA molecules.
25. The method of claim 15, wherein the target sequence is 15 nucleotides (nt) to 18 nt long.
26. The method of claim 15, wherein the target sequence is 18 nucleotides (nt) to 25 nt long.
27. The method of claim 15, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.
28. The method of claim 15, wherein the activator-RNA comprises the 64 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU.
29. The method of claim 15, wherein the targeter-RNA and the activator-RNA are not covalently linked by intervening nucleotides.
30. The method of claim 15, wherein the targeter-RNA and the activator-RNA are conjugated to a heterologous moiety.
31. The method of claim 15, wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide.
32. The method of claim 15, wherein the heterologous polypeptide exhibits DNA-modifying activity.
33. A method of targeting and binding a target DNA, modifying a target DNA, or modulating transcription from a target DNA, the method comprising: contacting a target DNA inside of a cell with a complex that comprises (a) a Cas9 protein; and (b) a nonnaturally occurring DNA-targeting RNA comprising (i) a targeter-RNA comprising a first nucleotide sequence that hybridizes with a target sequence of the target DNA, and a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and (ii) the activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 11 base pairs, wherein the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, and/or transcription from the target DNA is modulated.
34. The method of claim 33, wherein the target sequence of the target DNA is 15 nucleotides (nt) to 18 long.
35. The method of claim 33, wherein the target sequence of the target DNA is 18 nucleotides (nt) to 25 long.
36. The method of claim 33, wherein said contacting comprises inducing expression of (a).
37. The method of claim 33, wherein said contacting comprises introducing into the cell one or more of: (1) the Cas9 protein, or a nucleic acid encoding the Cas9 protein; (2) the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and (3) the activator-RNA, or a nucleic acid encoding the activator-RNA.
38. The method of claim 37, wherein one or more of: (A) the nucleic acid encoding the Cas9 protein; (B) the nucleic acid encoding the targeter-RNA; and(C) the nucleic acid encoding the activator-RNA, is a plasmid or a viral vector.
39. The method of claim 37, comprising introducing into the cell (1), (2), and (3).
40. The method of claim 37, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.
41. The method of claim 37, wherein said introducing comprises: introducing the Cas9 protein into the cell as protein, and introducing the targeter-RNA and the activator-RNA into the cell as RNA.
42. The method of claim 41, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
43. The method of claim 37, wherein said introducing comprises: introducing into the cell the nucleic acid encoding the Cas9 protein.
44. The method of claim 37, wherein said introducing comprises: introducing into the cell, the nucleic acid encoding the Cas9 protein, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the activator-RNA.
45. The method of claim 44, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
46. The method of claim 33, wherein the method comprises introducing a donor polynucleotide into the cell.
47. The method of claim 33, wherein the method comprises introducing into the cell a DNA molecule that encodes both the non-naturally occurring DNA-targeting RNA and the Cas9 protein.
48. The method of claim 33, wherein the targeter-RNA and the activator-RNA are covalently linked via the 3 end of the targeter-RNA and the 5 end of the activator-RNA.
49. The method of claim 33, wherein the method comprises introducing two or more of the non-naturally occurring DNA-targeting RNAs into the cell, wherein the two or more non-naturally occurring DNA-targeting RNAs are complementary to different target sequences within the same or different target DNAs.
50. The method of claim 33, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
51. The method of claim 33, wherein the Cas9 protein is fused to a heterologous polypeptide.
52. The method of claim 33, wherein the targeter-RNA and the activator-RNA are not covalently linked by intervening nucleotides.
53. The method of claim 33, wherein the target DNA is chromosomal DNA.
54. The method of claim 33, wherein the activator-RNA comprises the 64 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUG CUUUU.
55. The method of claim 33, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.
56. The method of claim 33, wherein said contacting results in cleavage of the target DNA.
57. The method of claim 33, wherein the Cas9 protein is capable of cleaving only one strand of DNA and comprises one or more mutations in a RuvC domain or an HNH domain.
58. A method of targeting and binding a target DNA in a cell, the method comprising: contacting the target DNA inside of the cell with (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein the Cas9 protein and the single molecule DNA-targeting RNA form a complex that binds to the target DNA.
59. The method of claim 58, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.
60. The method of claim 58, wherein the Cas9 protein is fused to a heterologous polypeptide.
61. The method of claim 58, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises a fluorescent protein.
62. The method of claim 58, wherein the single molecule DNA-targeting RNA comprises a heterologous moiety.
63. The method of claim 58, wherein the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.
64. The method of claim 58, wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
65. The method of claim 58, wherein the method comprises introducing the Cas9 protein, an RNA molecule that encodes the Cas9 protein, or a DNA molecule that encodes the Cas9 protein into the cell.
66. The method of claim 58, wherein the method comprises introducing a nucleic acid encoding the single molecule DNA-targeting RNA into the cell.
67. The method of claim 58, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
68. A method of cleaving a target DNA in a cell, the method comprising: contacting the target DNA inside of the cell with (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said contacting results in cleavage of the target DNA.
69. The method of claim 68, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.
70. The method of claim 68, wherein the Cas9 protein is fused to a heterologous polypeptide.
71. The method of claim 68, wherein the Cas9 protein comprises a fluorescent protein.
72. The method of claim 68, wherein the single molecule DNA-targeting RNA comprises a heterologous moiety.
73. The method of claim 68, wherein the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG.
74. The method of claim 68, wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
75. The method of claim 68, wherein the method comprises introducing the Cas9 protein, an RNA molecule that encodes the Cas9 protein, or a DNA molecule that encodes the Cas9 protein into the cell.
76. The method of claim 68, wherein the method comprises introducing a nucleic acid encoding the single molecule DNA-targeting RNA into the cell.
77. The method of claim 68, wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
78. The method of claim 68, comprising introducing a donor polynucleotide into the cell.
79. A method of targeting and binding a nucleic acid comprising: contacting a target DNA molecule having a target sequence with an engineered and/or non naturally occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising a) a Cas9 protein; and b) a DNA-targeting RNA comprising i) a targeter-RNA that hybridizes with the target sequence, and ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein (I) the DNA-targeting RNA comprises a nucleotide sequence that is modified relative to naturally occurring DNA-targeting RNAs, and/or (II) the Cas9 protein comprises an amino acid sequence that is modified relative to naturally occurring Cas9 proteins wherein the DNA-targeting RNA forms a complex with the Cas9 protein, whereby the DNA-targeting RNA targets the target sequence, and the Cas9 protein binds the target DNA molecule; and wherein said contacting occurs in a eukaryotic cell.
80. The method of claim 79, wherein, prior to the contacting step, the method comprises: introducing into a eukaryotic cell containing the target DNA molecule 1) the DNA-targeting RNA, or one or more DNA molecules comprising one or more nucleotide sequences that (i) encode the DNA-targeting RNA and (ii) are expressed in said eukaryotic cell; and 2) the Cas9 protein, an RNA molecule comprising a nucleotide sequence encoding the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that (i) encodes the Cas9 protein and (ii) is expressed in said eukaryotic cell.
81. The method of claim 80, wherein the genome of said eukaryotic cell comprises the target DNA molecule.
82. The method of claim 79, wherein the method comprises introducing the Cas9 protein or an RNA that encodes the Cas9 protein into the eukaryotic cell.
83. The method of claim 79, wherein the method comprises introducing the DNA-targeting RNA into the eukaryotic cell as RNA.
84. The method of claim 79, wherein the method comprises introducing into the eukaryotic cell: the DNA-targeting RNA as RNA; and the Cas9 protein or an RNA that encodes the Cas9 protein.
85. The method of claim 84, wherein the eukaryotic cell is in vivo.
86. The method of claim 84, wherein the eukaryotic cell is a mammalian cell and said introducing comprises lipofection.
87. The method of claim 79, wherein the method comprises introducing a plasmid that encodes the DNA-targeting RNA into the eukaryotic cell.
88. The method of claim 79, wherein the method comprises introducing a plasmid that encodes the Cas9 protein into the eukaryotic cell.
89. The method of claim 79, wherein the method comprises introducing into the eukaryotic cell: a plasmid that encodes the DNA-targeting RNA, and a plasmid that encodes the Cas9 protein.
90. The method of claim 89, wherein the eukaryotic cell is a mammalian cell and said introducing comprises lipofection.
91. The method of claim 89, wherein the eukaryotic cell is a yeast cell.
92. The method of claim 90, wherein the Cas9 protein comprises the amino acid sequence encoded by the human codon optimized Cas9 nucleic acid sequence set forth in
93. The method of claim 79, wherein the method comprises introducing a viral vector that encodes the DNA-targeting RNA into the eukaryotic cell.
94. The method of claim 80, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.
95. A method of cleaving or editing a target DNA molecule or modulating transcription of at least one gene encoded thereon, the method comprising contacting a target DNA molecule having a target sequence with an engineered and/or non-naturally-occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising: (a) a Cas9 protein; and (b) a DNA-targeting RNA comprising (i) a targeter-RNA that hybridizes with the target sequence, and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein (I) the DNA-targeting RNA comprises a nucleotide sequence that is modified relative to naturally occurring DNA-targeting RNAs, and/or (II) the Cas9 protein comprises an amino acid sequence that is modified relative to naturally occurring Cas9, wherein the DNA-targeting RNA forms a complex with the Cas9 protein, whereby said target DNA molecule is cleaved or edited or transcription of at least one gene encoded by the target DNA molecule is modulated, wherein said contacting occurs in a eukaryotic cell, wherein, prior to the contacting step, the method comprises introducing into the eukaryotic cell containing the target DNA molecule 1) the DNA-targeting RNA, or one or more DNA molecules comprising one or more nucleotide sequences that (i) encode the DNA-targeting RNA and (ii) are expressed in said eukaryotic cell; and 2) the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that (i) encodes the Cas9 protein and (ii) is expressed in said eukaryotic cell.
96. The method of claim 95, wherein said Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or a HNH domain.
97. The method of claim 95, wherein the method comprises creation of a double strand break in the target DNA molecule which is repaired by a homology-directed repair mechanism which incorporates a sequence of a donor polynucleotide into the target DNA molecule, thereby editing the target DNA molecule.
98. The method of claim 95, wherein the eukaryotic cell is an in vivo plant cell or in vivo animal cell, and wherein the method comprises introducing into the in vivo plant cell or in vivo animal: (1) the DNA-targeting RNA, or one or more DNA molecules comprising nucleotide sequences that (i) encode the DNA-targeting RNA and (ii) are expressed in said eukaryotic cell; and (2) the Cas9 protein, or a DNA molecule comprising a nucleotide sequence that (i) encodes the Cas9 protein and (ii) is expressed in said eukaryotic cell, wherein the method results in editing of the target DNA, wherein the method is performed to produce a gene knock-out, to produce a gene knock-in, or to produce a genetically modified organism.
99. A method of cleaving or editing a target DNA molecule, the method comprising contacting a target DNA molecule having a target sequence with an engineered and/or non-naturally-occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising: (a) a Cas9 protein; and (b) a DNA-targeting RNA comprising (i) a targeter-RNA that hybridizes with the target sequence, and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein (I) the DNA-targeting RNA comprises a nucleotide sequence that is modified relative to naturally occurring DNA-targeting RNAs, and/or (II) the Cas9 protein comprises an amino acid sequence that is modified relative to naturally occurring Cas9, wherein the DNA-targeting RNA forms a complex with the Cas9 protein, whereby said target DNA molecule is cleaved or edited, wherein said contacting occurs in a eukaryotic cell.
100. A eukaryotic cell comprising a target DNA molecule and an engineered and/or non-naturally occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising a nucleic acid comprising a nucleotide sequence encoding a Cas9 protein, and a DNA-targeting RNA or one or more nucleic acids comprising one or more nucleotide sequences encoding the DNA-targeting RNA; wherein the DNA-targeting RNA comprises i) a targeter-RNA that is capable of hybridizing with a target sequence in a target DNA molecule, and ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment, wherein (I) the DNA-targeting RNA comprises a nucleotide sequence that is modified relative to naturally occurring DNA-targeting RNAs, and/or (II) the Cas9 protein comprises an amino acid sequence that is modified relative to naturally occurring Cas9 proteins, whereby hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA molecule.
101. The eukaryotic cell of claim 100, wherein the genome of said eukaryotic cell comprises the target DNA molecule.
102. The eukaryotic cell of claim 100, wherein the eukaryotic cell is a mammalian cell or a human cell.
103. The eukaryotic cell of claim 100, wherein the nucleic acid comprising the nucleotide sequence encoding the Cas9 protein is an RNA molecule.
104. The eukaryotic cell of claim 100, comprising the DNA-targeting RNA as RNA.
105. The eukaryotic cell of claim 100, wherein the nucleic acid comprising the nucleotide sequence encoding the Cas9 protein is an RNA molecule, and the eukaryotic cell comprises the DNA-targeting RNA as RNA.
106. The eukaryotic cell of claim 105, wherein the eukaryotic cell is in vivo.
107. The eukaryotic cell of claim 105, wherein the eukaryotic cell is a mammalian cell.
108. The eukaryotic cell of claim 100, wherein the nucleic acid comprising the nucleotide sequence encoding the DNA-targeting RNA is a plasmid, and the eukaryotic cell comprises said plasmid.
109. The eukaryotic cell of claim 100, wherein the nucleic acid comprising the nucleotide sequence encoding the Cas9 protein is a plasmid, and the eukaryotic cell comprises said plasmid.
110. The eukaryotic cell of claim 100, comprising: the nucleic acid comprising the nucleotide sequence encoding the DNA-targeting RNA, and the nucleic acid comprising the nucleotide sequence encoding the Cas9 protein, wherein both of said nucleic acids are plasmids.
111. The eukaryotic cell of claim 110, wherein the eukaryotic cell is a mammalian cell.
112. The eukaryotic cell of claim 111, wherein the Cas9 protein comprises the amino acid sequence encoded by the human codon optimized Cas9 nucleic acid sequence set forth in
113. The eukaryotic cell of claim 110, wherein the eukaryotic cell is a yeast cell.
114. The eukaryotic cell of claim 100, wherein the nucleic acid comprising the nucleotide sequence encoding the DNA-targeting RNA is a viral vector, and the eukaryotic cell comprises said viral vector.
115. The eukaryotic cell of claim 100, wherein one or more of a) the nucleic acid comprising the nucleotide sequence encoding said Cas9 protein and b) the one or more nucleic acids comprising one or more nucleotide sequences encoding said DNA-targeting RNA, are one or more vectors, wherein the one or more vectors are selected from the group consisting of plasmids, viral, and adeno-associated virus vectors; and wherein the nucleotide sequence encoding said Cas9 protein and/or the one or more nucleotide sequences encoding said DNA-targeting RNA is expressed in said eukaryotic cell.
116. The eukaryotic cell of claim 100, wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain.
117. The eukaryotic cell of claim 100, wherein the system comprises a donor polynucleotide and the system is capable of editing the target DNA molecule by inserting a sequence of the donor polynucleotide into a cleaved strand of the target DNA molecule.
118. The eukaryotic cell of claim 100, wherein the nucleotide sequence encoding said Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more human codons encoding the same amino acid.
119. The eukaryotic cell of claim 100, wherein said Cas9 protein comprises one or more mutations in a RuvC domain and/or a HNH domain and is capable of cleaving only one strand of DNA.
120. A eukaryotic cell comprising a target DNA and an engineered and/or non-naturally occurring Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system comprising a) a nucleic acid comprising a nucleotide sequence encoding a Cas9 protein; and b) a DNA-targeting RNA, or one or more nucleic acids comprising one or more nucleotide sequences encoding said DNA-targeting RNA; wherein the DNA-targeting RNA comprises: i) a targeter-RNA that is capable of hybridizing with a target sequence in the target DNA molecule, and ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex of a protein-binding segment; wherein (I) the DNA-targeting RNA comprises a nucleotide sequence that is modified relative to naturally occurring DNA-targeting RNAs, and/or (II) the Cas9 protein comprises an amino acid sequence that is modified relative to naturally occurring Cas9 proteins, wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein, thereby targeting the Cas9 protein to the target DNA molecule, whereby said system is capable of cleaving or editing the target DNA molecule or modulating transcription of at least one gene encoded by the target DNA molecule.
121. A non-human plant or animal comprising the eukaryotic cell of claim 100.
122. A method of targeting and binding a target DNA, the method comprising: introducing a composition comprising a protein-RNA complex into a cell, wherein the cell comprises the target DNA and the protein-RNA complex comprises (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said protein-RNA complex binds to the target DNA.
123. The method of claim 122, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 20 nucleotides (nt) long.
124. The method of claim 122, wherein the Cas9 protein is fused to a heterologous polypeptide.
125. The method of claim 122, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises a fluorescent protein.
126. The method of claim 122, wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
127. The method of claim 122, wherein: (a) the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGG UGCUUUU; or (b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG; or (c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA, the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGG UGCUUUU.
128. The method of claim 122, wherein said composition comprises two or more single molecule DNA-targeting RNAs, and thereby two or more protein-RNA complexes, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
129. The method of claim 122, wherein the method comprises introducing two or more of said compositions into the cell, wherein the single molecule DNA-targeting RNAs of each of said two or more compositions hybridize to different target sequences within the same or different target DNA molecules.
130. The method of claim 122, wherein the method further comprises introducing a donor polynucleotide into the cell.
131. A method of modifying a target DNA, the method comprising: introducing a composition comprising a protein-RNA complex into a cell, wherein the cell comprises the target DNA and the protein-RNA complex comprises (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said introducing results in modification of the target DNA.
132. The method of claim 131, wherein said modification is cleavage of the target DNA.
133. The method of claim 131, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 20 nucleotides (nt) long.
134. The method of claim 131, wherein the Cas9 protein is fused to a heterologous polypeptide.
135. The method of claim 131, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises a fluorescent protein.
136. The method of claim 131, wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
137. The method of claim 131, wherein: (a) the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGG UGCUUUU; or (b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG; or (c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA, the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGG UGCUUUU.
138. The method of claim 131, wherein said composition comprises two or more single molecule DNA-targeting RNAs, and thereby two or more protein-RNA complexes, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
139. The method of claim 131, wherein the method comprises introducing two or more of said compositions into the cell, wherein the single molecule DNA-targeting RNAs of each of said two or more compositions hybridize to different target sequences within the same or different target DNA molecules.
140. The method of claim 135, wherein the method further comprises introducing a donor polynucleotide into the cell.
141. The method of claim 140, wherein a nucleotide sequence of the donor polynucleotide inserts into the target DNA, producing a genetically modified cell.
142. A method of cleaving a target DNA, the method comprising: introducing a composition comprising a protein-RNA complex into a cell, wherein the cell comprises the target DNA and the protein-RNA complex comprises (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA, wherein the nucleotide sequence that is complementary to the target sequence is 20 nucleotides (nt) long; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said introducing results in cleavage of the target DNA.
143. The method of claim 142, wherein the method further comprises introducing a donor polynucleotide into the cell, and wherein a nucleotide sequence of the donor polynucleotide inserts into the target DNA, producing a genetically modified cell.
144. The method of claim 122 wherein the single molecule DNA-targeting RNA comprises between 100 to 250 nucleotides.
145. The method of claim 122 wherein the single molecule DNA-targeting RNA comprises the following nucleic acid sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC.
146. A method of altering a cell comprising providing to the cell a guide RNA complementary to a target nucleic acid sequence, providing to the cell a Cas9 enzyme that interacts with the guide RNA and cleaves the target nucleic acid sequence in a site specific manner, wherein the guide RNA binds to the complementary target nucleic acid sequence and the Cas9 enzyme cleaves the target nucleic acid sequence in a site specific manner; wherein the guide RNA includes a guide sequence complementary to the target nucleic acid sequence and a gRNA scaffold sequence connected to the guide sequence and the gRNA scaffold sequence having the following nucleic acid sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC.
147. A method of altering a cell comprising providing to the cell a guide RNA complementary to a target nucleic acid sequence, providing to the cell a Cas9 enzyme that interacts with the guide RNA and cleaves the target nucleic acid sequence in a site specific manner, wherein the guide RNA binds to the complementary target nucleic acid sequence and the Cas9 enzyme cleaves the target nucleic acid sequence in a site specific manner; wherein the guide RNA includes a guide sequence complementary to the target nucleic acid sequence and a gRNA scaffold sequence connected to the guide sequence and the gRNA comprises between 100 and 250 nucleotides.
148. A method of producing a genetically modified cell comprising: (1) introducing into a target cell comprising a target DNA (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and (b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said introducing results in modification of the target DNA thereby producing the genetically modified cell; and then (2) culturing said genetically modified cell to produce a population of cells.
149. The method of claim 148, wherein said modification is cleavage.
150. The method of claim 149, wherein the method further comprises introducing a donor polynucleotide into the target cell.
151. The method of claim 150, wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain.
152. The method of claim 148, wherein the Cas9 protein is fused to a heterologous polypeptide that has DNA modifying activity.
153. The method of claim 148, wherein: (a) the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGG UGCUUUU; or (b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG; or (c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA, the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGG UGCUUUU.
154. A method of making a genetically modified cell, the method comprising: contacting a population of target cells with (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and (b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of a target DNA inside of one or more target cells of said population of target cells; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said contacting results in modification of the target DNA inside of one or more target cells of said population of target cells, thereby producing one or more genetically modified cells.
155. The method of claim 154, wherein the method further comprises, after said contacting, separating said one or more genetically modified cells from the population of target cells.
156. The method of claim 154, wherein the Cas9 protein is fused to a heterologous polypeptide.
157. The method of claim 154, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises a fluorescent protein.
158. The method of claim 154, wherein the Cas9 protein is fused to a heterologous polypeptide that has DNA modifying activity.
159. The method of claim 154, wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
160. The method of claim 154, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 20 nucleotides (nt) long.
161. The method of claim 154, wherein: (a) the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGG UGCUUUU; or (b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG; or (c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA, the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGG UGCUUUU.
162. The method of claim 154, wherein the method comprises contacting the population of target cells with two or more single molecule DNA-targeting RNAs, or one or more nucleic acids encoding the two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences.
163. The method of claim 154, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.
164. The method of claim 154, wherein the method comprises inducing expression of the Cas9 protein.
165. The method of claim 154, wherein said modification is cleavage.
166. The method of claim 165, wherein the method further comprises, after said contacting, separating said one or more genetically modified cells from the population of target cells.
167. The method of claim 165, wherein the method further comprises contacting the population of target cells with a donor polynucleotide.
168. The method of claim 165, wherein the Cas9 protein is fused to a heterologous polypeptide.
169. The method of claim 165, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain.
170. The method of claim 169, wherein the method further comprises contacting the population of target cells with a donor polynucleotide.
171. The method of claim 165, wherein the method comprises contacting the population of target cells with two or more single molecule DNA-targeting RNAs, or one or more nucleic acids encoding the two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences.
172. The method of claim 148 wherein the single molecule DNA-targeting RNA comprises between 100 to 250 nucleotides.
173. The method of claim 148 wherein the single molecule DNA-targeting RNA comprises the following nucleic acid sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC.
174. A method of producing a genetically modified cell comprising providing to the cell a guide RNA complementary to a target nucleic acid sequence, providing to the cell a Cas9 enzyme that interacts with the guide RNA; wherein the guide RNA includes a guide sequence complementary to the target nucleic acid sequence and a gRNA scaffold sequence connected to the guide sequence and the gRNA scaffold sequence having the following nucleic acid sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC.
175. A method of producing a genetically modified cell comprising providing to the cell a guide RNA complementary to a target nucleic acid sequence, providing to the cell a Cas9 enzyme that interacts with the guide RNA; wherein the guide RNA includes a guide sequence complementary to the target nucleic acid sequence and a gRNA scaffold sequence connected to the guide sequence and the gRNA comprises between 100 and 250 nucleotides.
176. A method of targeting and binding a target DNA, the method comprising: contacting the target DNA with (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein the Cas9 protein and the single molecule DNA-targeting RNA form a complex that binds to the target DNA.
177. The method of claim 176, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 20 nucleotides (nt) long.
178. The method of claim 176, wherein the Cas9 protein is fused to a heterologous polypeptide.
179. The method of claim 176, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises a fluorescent protein.
180. The method of claim 176, wherein: (a) the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUU; or (b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG; or (c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA, the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUU.
181. The method of claim 176, wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
182. The method of claim 176, wherein the target DNA is inside of a cell and the method comprises introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA.
183. The method of claim 182, wherein the method comprises introducing into the cell the single-molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.
184. The method of claim 183, wherein the nucleic acid that encodes the Cas9 protein is a DNA molecule.
185. The method of claim 182, wherein the method comprises introducing into the cell the nucleic acid that encodes the single-molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.
186. The method of claim 176, wherein the target DNA is inside of a cell and the method comprises introducing a nucleic acid encoding the Cas9 protein into the cell, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.
187. A method of modifying a target DNA, the method comprising: contacting the target DNA with (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said contacting results in modification of the target DNA.
188. The method of claim 187, wherein said modification is cleavage of the target DNA.
189. The method of claim 188, wherein the target DNA is inside of a cell and the method further comprises introducing a donor polynucleotide into the cell.
190. The method of claim 189, wherein a nucleotide sequence of the donor polynucleotide inserts into the target DNA, producing a genetically modified cell.
191. The method of claim 187, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 20 nucleotides (nt) long.
192. The method of claim 187, wherein the Cas9 protein is fused to a heterologous polypeptide.
193. The method of claim 187, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises a fluorescent protein.
194. The method of claim 187, wherein: (a) the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUU; or (b) the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG; or (c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA, the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the
195. The method of claim 187, wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
196. The method of claim 187, wherein the target DNA is inside of a cell and the method comprises introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA.
197. The method of claim 196, wherein the method comprises introducing into the cell the single molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.
198. A method of cleaving a target DNA in a cell, the method comprising: contacting the target DNA in the cell with (a) a Cas9 protein; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA, wherein the nucleotide sequence that is complementary to the target sequence is 20 nucleotides (nt) long; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said contacting comprises introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA, and introducing into the cell the Cas9 protein or a nucleic acid that encodes the Cas9 protein, wherein said contacting results in cleavage of the target DNA.
199. The method of claim 176 wherein the single molecule DNA-targeting RNA comprises between 100 to 250 nucleotides.
200. The method of claim 176 wherein the single molecule DNA-targeting RNA comprises the following nucleic acid sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC.
201. A method of targeting and binding a target DNA, the method comprising: contacting the target DNA with (a) a Cas9 protein that comprises a mutation in a RuvC and/or an HNH domain; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein the Cas9 protein and the single molecule DNA-targeting RNA form a complex that binds to the target DNA.
202. The method of claim 201, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 20 nucleotides (nt) long.
203. The method of claim 201, wherein the Cas9 protein is fused to a heterologous polypeptide.
204. The method of claim 201, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises a fluorescent protein.
205. The method of claim 201, wherein: (a) the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU; or (b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG; or (c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA, the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU.
206. The method of claim 201, wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
207. The method of claim 201, wherein the target DNA is inside of a cell and the method comprises introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA.
208. The method of claim 207, wherein the method comprises introducing into the cell the single-molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.
209. The method of claim 208, wherein the nucleic acid that encodes the Cas9 protein is a DNA molecule.
210. The method of claim 207, wherein the method comprises introducing into the cell the nucleic acid that encodes the single-molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.
211. The method of claim 201, wherein the target DNA is inside of a cell and the method comprises introducing a nucleic acid encoding the Cas9 protein into the cell, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9 encoding nucleotide sequence with one or more different codons encoding the same amino acid.
212. A method of modifying a target DNA, the method comprising: contacting the target DNA with (a) a Cas9 protein that comprises a mutation in a RuvC and/or an HNH domain; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said contacting results in modification of the target DNA.
213. The method of claim 212, wherein said modification is cleavage of the target DNA.
214. The method of claim 213, wherein the target DNA is inside of a cell and the method further comprises introducing a donor polynucleotide into the cell, wherein a nucleotide sequence of the donor polynucleotide inserts into the target DNA, producing a genetically modified cell.
215. The method of claim 212, wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 20 nucleotides (nt) long.
216. The method of claim 212, wherein the Cas9 protein is fused to a heterologous polypeptide.
217. The method of claim 212, wherein the Cas9 protein is fused to a heterologous polypeptide that comprises a fluorescent protein.
218. The method of claim 212 wherein the single molecule DNA targeting RNA comprises a heterologous moiety.
219. The method of claim 212, wherein: (a) the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU; or (b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG; or (c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA, the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 64 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU.
220. The method of claim 212, wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
221. The method of claim 212, wherein the target DNA is inside of a cell and the method comprises introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA.
222. The method of claim 221, the method comprising introducing into the cell the single-molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.
223. A method of cleaving a target DNA in a cell, the method comprising: contacting the target DNA in the cell with (a) a Cas9 protein that comprises a mutation in a RuvC and/or an HNH domain; and (b) a single molecule DNA-targeting RNA comprising, in 5 to 3 order (i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA, wherein the nucleotide sequence that is complementary to the target sequence is 20 nucleotides (nt) long; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein said contacting comprises introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA, and introducing into the cell the Cas9 protein or a nucleic acid that encodes the Cas9 protein, wherein said contacting results in cleavage of the target DNA.
224. The method of claim 201 wherein the single molecule DNA-targeting RNA comprises between 100 to 250 nucleotides.
225. The method of claim 201 wherein the single molecule DNA-targeting RNA comprises the following nucleic acid sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. The foregoing and other features and advantages of the present embodiments will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings in which:
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION
[0026] According to one aspect, a human codon-optimized version of the Cas9 protein bearing a C-terminus SV40 nuclear localization signal is synthetized and cloned into a mammalian expression system (
[0027] According to one aspect, to direct Cas9 to cleave sequences of interest, crRNA-tracrRNA fusion transcripts are expressed, hereafter referred to as guide RNAs (gRNAs), from the human U6 polymerase III promoter. According to one aspect, gRNAs are directly transcribed by the cell. This aspect advantageously avoids reconstituting the RNA processing machinery employed by bacterial CRISPR systems (
[0028] According to one aspect, a GFP reporter assay (
[0029] According to one aspect, a method is provided of homologous recombination (HR). Two gRNAs are constructed, T1 and T2, that target the intervening AAVS1 fragment (
[0030] According to certain aspects, a native locus was modified. gRNAs were used to target the AAVS1 locus located in the PPP1R12C gene on chromosome 19, which is ubiquitously expressed across most tissues (
[0031] Consistent with results for the GFP reporter assay, high numbers of NHEJ events were observed at the endogenous locus for all three cell types. The two gRNAs T1 and T2 achieved NHEJ rates of 10 and 25% in 293Ts, 13 and 38% in K562s, and 2 and 4% in PGP1-iPS cells, respectively (
[0032] According to one aspect, HR is used to integrate either a dsDNA donor construct (see reference (13)) or an oligo donor into the native AAVS1 locus (
[0033] According to one aspect, an RNA-guided genome editing system is provided which can readily be adapted to modify other genomic sites by simply modifying the sequence of the gRNA expression vector to match a compatible sequence in the locus of interest. According to this aspect, 190,000 specifically gRNA-targetable sequences targeting about 40.5% exons of genes in the human genome were generated. These target sequences were incorporated into a 200 bp format compatible with multiplex synthesis on DNA arrays (see reference (14)) (FIGS. 13A-1 and 13A-2). According to this aspect, a ready genome-wide reference of potential target sites in the human genome and a methodology for multiplex gRNA synthesis is provided.
[0034] According to one aspect, methods are provided for multiplexing genomic alterations in a cell by using one or more or a plurality of RNA/enzyme systems described herein to alter the genome of a cell at a plurality of locations. According to one aspect, target sites perfectly match the PAM sequence NGG and the 8-12 base seed sequence at the 3 end of the gRNA. According to certain aspects, perfect match is not required of the remaining 8-12 bases. According to certain aspects, Cas9 will function with single mismatches at the 5 end. According to certain aspects, the target locus's underlying chromatin structure and epigenetic state may affect efficiency of Cas9 function. According to certain aspects, Cas9 homologs having higher specificity are included as useful enzymes. One of skill in the art will be able to identify or engineer suitable Cas9 homologs. According to one aspect, CRISPR-targetable sequences include those having different PAM requirements (see reference (9)), or directed evolution. According to one aspect, inactivating one of the Cas9 nuclease domains increases the ratio of HR to NHEJ and may reduce toxicity (
[0035] According to certain aspects, a re-engineerable organism is provided as a model system for biological discovery and in vivo screening. According to one aspect, a re-engineerable mouse bearing an inducible Cas9 transgene is provided, and localized delivery (using adeno-associated viruses, for example) of libraries of gRNAs targeting multiple genes or regulatory elements allow one to screen for mutations that result in the onset of tumors in the target tissue type. Use of Cas9 homologs or nuclease-null variants bearing effector domains (such as activators) allow one to multiplex activate or repress genes in vivo. According to this aspect, one could screen for factors that enable phenotypes such as: tissue-regeneration, trans-differentiation etc. According to certain aspects, (a) use of DNA-arrays enables multiplex synthesis of defined gRNA libraries (refer
[0036] According to one aspect, the lower toxicities observed with nickases for genome engineering applications is achieved by inactivating one of the Cas9 nuclease domains, either the nicking of the DNA strand base-paired with the RNA or nicking its complement. Inactivating both domains allows Cas9 to function as a retargetable DNA binding protein. According to one aspect, the Cas9 retargetable DNA binding protein is attached [0037] (a) to transcriptional activation or repression domains for modulating target gene expression, including but not limited to chromatin remodeling, histone modification, silencing, insulation, direct interactions with the transcriptional machinery; [0038] (b) to nuclease domains such as Fold to enable highly specific genome editing contingent upon dimerization of adjacent gRNA-Cas9 complexes; [0039] (c) to fluorescent proteins for visualizing genomic loci and chromosome dynamics; or [0040] (d) to other fluorescent molecules such as protein or nucleic acid bound organic fluorophores, quantum dots, molecular beacons and echo probes or molecular beacon replacements; [0041] (e) to multivalent ligand-binding protein domains that enable programmable manipulation of genome-wide 3D architecture.
[0042] According to one aspect, the transcriptional activation and repression components can employ CRISPR systems naturally or synthetically orthogonal, such that the gRNAs only bind to the activator or repressor class of Cas. This allows a large set of gRNAs to tune multiple targets.
[0043] According to certain aspects, the use of gRNAs provide the ability to multiplex than mRNAs in part due to the smaller size100 vs. 2000 nucleotide lengths respectively. This is particularly valuable when nucleic acid delivery is size limited, as in viral packaging. This enables multiple instances of cleavage, nicking, activation, or repressionor combinations thereof. The ability to easily target multiple regulatory targets allows the coarse-or-fine-tuning or regulatory networks without being constrained to the natural regulatory circuits downstream of specific regulatory factors (e.g. the 4 mRNAs used in reprogramming fibroblasts into IPSCs). Examples of multiplexing applications include: [0044] 1. Establishing (major and minor) histocompatibility alleles, haplotypes, and genotypes for human (or animal) tissue/organ transplantation. This aspect results e.g. in HLA homozygous cell lines or humanized animal breedsora set of gRNAs capable of superimposing such HLA alleles onto an otherwise desirable cell lines or breeds. [0045] 2. Multiplex cis-regulatory element (CRE=signals for transcription, splicing, translation, RNA and protein folding, degradation, etc.) mutations in a single cell (or a collection of cells) can be used for efficiently studying the complex sets of regulatory interaction that can occur in normal development or pathological, synthetic or pharmaceutical scenarios. According to one aspect, the CREs are (or can be made) somewhat orthogonal (i.e. low cross talk) so that many can be tested in one settinge.g. in an expensive animal embryo time series. One exemplary application is with RNA fluorescent in situ sequencing (FISSeq). [0046] 3. Multiplex combinations of CRE mutations and/or epigenetic activation or repression of CREs can be used to alter or reprogram iPSCs or ESCs or other stem cells or non-stem cells to any cell type or combination of cell types for use in organs-on-chips or other cell and organ cultures for purposes of testing pharmaceuticals (small molecules, proteins, RNAs, cells, animal, plant or microbial cells, aerosols and other delivery methods), transplantation strategies, personalization strategies, etc. [0047] 4. Making multiplex mutant human cells for use in diagnostic testing (and/or DNA sequencing) for medical genetics. To the extent that the chromosomal location and context of a human genome allele (or epigenetic mark) can influence the accuracy of a clinical genetic diagnosis, it is important to have alleles present in the correct location in a reference genomerather than in an ectopic (aka transgenic) location or in a separate piece of synthetic DNA. One embodiment is a series of independent cell lines one per each diagnostic human SNP, or structural variant. Alternatively, one embodiment includes multiplex sets of alleles in the same cell. In some cases multiplex changes in one gene (or multiple genes) will be desirable under the assumption of independent testing. In other cases, particular haplotype combinations of alleles allows testing of sequencing (genotyping) methods which accurately establish haplotype phase (i.e. whether one or both copies of a gene are affected in an individual person or somatic cell type. [0048] 5. Repetitive elements or endogenous viral elements can be targeted with engineered Cas+gRNA systems in microbes, plants, animals, or human cells to reduce deleterious transposition or to aid in sequencing or other analytic genomic/transcriptomic/proteomic/diagnostic tools (in which nearly identical copies can be problematic).
[0049] The following references identified by number in the foregoing section are hereby incorporated by reference in their entireties. [0050] 1. B. Wiedenheft, S. H. Sternberg, J. A. Doudna, Nature 482, 331 (Feb. 16, 2012). [0051] 2. D. Bhaya, M. Davison, R. Barrangou, Annual review of genetics 45, 273 (2011). [0052] 3. M. P. Terns, R. M. Terns, Current opinion in microbiology 14, 321 (June, 2011). [0053] 4. M. Jinek et al., Science 337, 816 (Aug. 17, 2012). [0054] 5. G. Gasiunas, R. Barrangou, P. Horvath, V. Siksnys, Proceedings of the National Academy of Sciences of the United States of America 109, E2579 (Sep. 25, 2012). [0055] 6. R. Sapranauskas et al., Nucleic acids research 39, 9275 (November, 2011). [0056] 7. T. R. Brummelkamp, R. Bernards, R. Agami, Science 296, 550 (Apr. 19, 2002). [0057] 8. M. Miyagishi, K. Taira, Nature biotechnology 20, 497 (May, 2002). [0058] 9. E. Deltcheva et al., Nature 471, 602 (Mar. 31, 2011). [0059] 10. J. Zou, P. Mali, X. Huang, S. N. Dowey, L. Cheng, Blood 118, 4599 (Oct. 27, 2011). [0060] 11. N. E. Sanjana et al., Nature protocols 7, 171 (January, 2012). [0061] 12. J. H. Lee et al., PLoS Genet 5, e1000718 (November, 2009). [0062] 13. D. Hockemeyer et al., Nature biotechnology 27, 851 (September, 2009). [0063] 14. S. Kosuri et al., Nature biotechnology 28, 1295 (December, 2010). [0064] 15. V. Pattanayak, C. L Ramirez, J. K. Joung, D. R. Liu, Nature methods 8, 765 (September, 2011). [0065] 16. N. M. King, O. Cohen-Haguenauer, Molecular therapy: the journal of the American Society of Gene Therapy 16, 432 (March, 2008). [0066] 17. Y. G. Kim, J Cha, S. Chandrasegaran, Proceedings of the National Academy of Sciences of the United States of America 93, 1156 (Feb. 6, 1996). [0067] 18. E. J. Rebar, C. O. Pabo, Science 263, 671 (Feb. 4, 1994). [0068] 19. J. Boch et al., Science 326, 1509 (Dec. 11, 2009). [0069] 20. M. J. Moscou, A. J. Bogdanove, Science 326, 1501 (Dec. 11, 2009). [0070] 21. A. S. Khalil, J. J. Collins, Nature reviews. Genetics 11, 367 (May, 2010). [0071] 22. P. E. Purnick, R. Weiss, Nature reviews. Molecular cell biology 10, 410 (June, 2009). [0072] 23. J. Zou et al., Cell stem cell 5, 97 (Jul. 2, 2009). [0073] 24. N. Holt et al., Nature biotechnology 28, 839 (August, 2010). [0074] 25. F. D. Urnov et al., Nature 435, 646 (Jun. 2, 2005). [0075] 26. A. Lombardo et al., Nature biotechnology 25, 1298 (November, 2007). [0076] 27. H. Li et al., Nature 475, 217 (Jul. 14, 2011).
[0077] The following examples are set forth as being representative of the present disclosure. These examples are not to be construed as limiting the scope of the present disclosure as these and other equivalent embodiments will be apparent in view of the present disclosure, figures and accompanying claims.
EXAMPLE I
The Type II CRISPR-Cas System
[0078] According to one aspect, embodiments of the present disclosure utilize short RNA to identify foreign nucleic acids for activity by a nuclease in a eukaryotic cell. According to a certain aspect of the present disclosure, a eukaryotic cell is altered to include within its genome nucleic acids encoding one or more short RNA and one or more nucleases which are activated by the binding of a short RNA to a target DNA sequence. According to certain aspects, exemplary short RNA/enzyme systems may be identified within bacteria or archaea, such as (CRISPR)/CRISPR-associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. CRISPR (clustered regularly interspaced short palindromic repeats) defense involves acquisition and integration of new targeting spacers from invading virus or plasmid DNA into the CRISPR locus, expression and processing of short guiding CRISPR RNAs (crRNAs) consisting of spacer-repeat units, and cleavage of nucleic acids (most commonly DNA) complementary to the spacer.
[0079] Three classes of CRISPR systems are generally known and are referred to as Type I, Type II or Type III). According to one aspect, a particular useful enzyme according to the present disclosure to cleave dsDNA is the single effector enzyme, Cas9, common to Type II. (See reference (1)). Within bacteria, the Type II effector system consists of a long pre-crRNA transcribed from the spacer-containing CRISPR locus, the multifunctional Cas9 protein, and a tracrRNA important for gRNA processing. The tracrRNAs hybridize to the repeat regions separating the spacers of the pre-crRNA, initiating dsRNA cleavage by endogenous RNase III, which is followed by a second cleavage event within each spacer by Cas9, producing mature crRNAs that remain associated with the tracrRNA and Cas9. According to one aspect, eukaryotic cells of the present disclosure are engineered to avoid use of RNase III and the crRNA processing in general. See reference (2).
[0080] According to one aspect, the enzyme of the present disclosure, such as Cas9 unwinds the DNA duplex and searches for sequences matching the crRNA to cleave. Target recognition occurs upon detection of complementarity between a protospacer sequence in the target DNA and the remaining spacer sequence in the crRNA. Importantly, Cas9 cuts the DNA only if a correct protospacer-adjacent motif (PAM) is also present at the 3 end. According to certain aspects, different protospacer-adjacent motif can be utilized. For example, the S. pyogenes system requires an NGG sequence, where N can be any nucleotide. S. thermophilus Type II systems require NGGNG (see reference (3)) and NNAGAAW (see reference (4)), respectively, while different S. mutans systems tolerate NGG or NAAR (see reference (5)). Bioinformatic analyses have generated extensive databases of CRISPR loci in a variety of bacteria that may serve to identify additional useful PAMs and expand the set of CRISPR-targetable sequences (see references (6, 7)). In S. thermophilus, Cas9 generates a blunt-ended double-stranded break 3 bp prior to the 3 end of the protospacer (see reference (8)), a process mediated by two catalytic domains in the Cas9 protein: an HNH domain that cleaves the complementary strand of the DNA and a RuvC-like domain that cleaves the non-complementary strand (See
[0081] According to one aspect, the specificity of gRNA-directed Cas9 cleavage is used as a mechanism for genome engineering in a eukaryotic cell. According to one aspect, hybridization of the gRNA need not be 100 percent in order for the enzyme to recognize the gRNA/DNA hybrid and affect cleavage. Some off-target activity could occur. For example, the S. pyogenes system tolerates mismatches in the first 6 bases out of the 20 bp mature spacer sequence in vitro. According to one aspect, greater stringency may be beneficial in vivo when potential off-target sites matching (last 14 bp) NGG exist within the human reference genome for the gRNAs. The effect of mismatches and enzyme activity in general are described in references (9), (2), (10), and (4).
[0082] According to certain aspects, specificity may be improved. When interference is sensitive to the melting temperature of the gRNA-DNA hybrid, AT-rich target sequences may have fewer off-target sites. Carefully choosing target sites to avoid pseudo-sites with at least 14 bp matching sequences elsewhere in the genome may improve specificity. The use of a Cas9 variant requiring a longer PAM sequence may reduce the frequency of off-target sites. Directed evolution may improve Cas9 specificity to a level sufficient to completely preclude off-target activity, ideally requiring a perfect 20 bp gRNA match with a minimal PAM. Accordingly, modification to the Cas9 protein is a representative embodiment of the present disclosure. As such, novel methods permitting many rounds of evolution in a short timeframe (see reference (11) and envisioned. CRISPR systems useful in the present disclosure are described in references (12, 13).
EXAMPLE II
Plasmid Construction
[0083] The Cas9 gene sequence was human codon optimized and assembled by hierarchical fusion PCR assembly of 9 500 bp gBlocks ordered from IDT.
[0084] The vectors for the HR reporter assay involving a broken GFP were constructed by fusion PCR assembly of the GFP sequence bearing the stop codon and 68 bp AAVS1 fragment (or mutants thereof; see
EXAMPLE III
Cell Culture
[0085] PGP1 iPS cells were maintained on Matrigel (BD Biosciences)-coated plates in mTeSR1 (Stemcell Technologies). Cultures were passaged every 5-7 d with TrypLE Express (Invitrogen). K562 cells were grown and maintained in RPMI (Invitrogen) containing 15% FBS. HEK 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) high glucose supplemented with 10% fetal bovine serum (FBS, Invitrogen), penicillin/streptomycin (pen/strep, Invitrogen), and non-essential amino acids (NEAA, Invitrogen). All cells were maintained at 37 C. and 5% CO.sub.2 in a humidified incubator.
EXAMPLE IV
Gene Targeting of PGP1 iPS, K562 and 293Ts
[0086] PGP1 iPS cells were cultured in Rho kinase (ROCK) inhibitor (Calbiochem) 2 h before nucleofection. Cells were harvest using TrypLE Express (Invitrogen) and 210.sup.6 cells were resuspended in P3 reagent (Lonza) with 1 g Cas9 plasmid, 1 g gRNA and/or 1 g DNA donor plasmid, and nucleofected according to manufacturer's instruction (Lonza). Cells were subsequently plated on an mTeSR1-coated plate in mTeSR1 medium supplemented with ROCK inhibitor for the first 24 h. For K562s, 210.sup.6 cells were resuspended in SF reagent (Lonza) with 1 g Cas9 plasmid, 1 g gRNA and/or 1 g DNA donor plasmid, and nucleofected according to manufacturer's instruction (Lonza). For 293Ts, 0.110.sup.6 cells were transfected with 1 g Cas9 plasmid, 1 g gRNA and/or 1 g DNA donor plasmid using Lipofectamine 2000 as per the manufacturer's protocols. The DNA donors used for endogenous AAVS1 targeting were either a dsDNA donor (
[0087] The targeting efficiency was assessed as follows. Cells were harvested 3 days after nucleofection and the genomic DNA of 110.sup.6 cells was extracted using prepGEM (ZyGEM). PCR was conducted to amplify the targeting region with genomic DNA derived from the cells and amplicons were deep sequenced by MiSeq Personal Sequencer (Illumina) with coverage >200,000 reads. The sequencing data was analyzed to estimate NHEJ efficiencies. The reference AAVS1 sequence analyzed is:
TABLE-US-00001 (SEQIDNO:1) CACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGAGC TGGGACCACCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTCTGGG TACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCCACTAGGGACAGGAT TGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGA TATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGAC ACACCCCCATTTCCTGGA ThePCRprimersforamplifyingthetargeting regionsinthehumangenomeare: AAVS1-R (SEQIDNO:2) CTCGGCATTCCTGCTGAACCGCTCTTCCGATCTacaggaggtgggggtta gac AAVS1-F.1 (SEQIDNO:3) ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTGATtatattcccag ggccggtta AAVS1-F.2 (SEQIDNO:4) ACACTCTTTCCCTACACGACGCTCTTCCGATCTACATCGtatattcccag ggccggtta AAVS1-F.3 (SEQIDNO:5) ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCTAAtatattcccag ggccggtta AAVS1-F.4 (SEQIDNO:6) ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGTCAtatattcccag ggccggtta AAVS1-F.5 (SEQIDNO:7) ACACTCTTTCCCTACACGACGCTCTTCCGATCTCACTGTtatattcccag ggccggtta AAVS1-F.6 (SEQIDNO:8) ACACTCTTTCCCTACACGACGCTCTTCCGATCTATTGGCtatattcccag ggccggtta AAVS1-F.7 (SEQIDNO:9) ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATCTGtatattcccag ggccggtta AAVS1-F.8 (SEQIDNO:10) ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCAAGTtatattcccag ggccggtta AAVS1-F.9 (SEQIDNO:11) ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGATCtatattcccag ggccggtta AAVS1-F.10 (SEQIDNO:12) ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGCTAtatattcccag ggccggtta AAVS1-F.11 (SEQIDNO:13) ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAGCCtatattcccag ggccggtta AAVS1-F.12 (SEQIDNO:14) ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACAAGtatattcccag ggccggtta ToanalyzetheHReventsusingtheDNAdonorin FIG.2C,theprimersusedwere: HR_AAVS1-F (SEQIDNO:15) CTGCCGTCTCTCTCCTGAGT HR_Puro-R (SEQIDNO:16) GTGGGCTTGTACTCGGTCAT
EXAMPLE V
Bioinformatics Approach for Computing Human Exon CRISPR Targets and Methodology for Their Multiplexed Synthesis
[0088] A set of gRNA gene sequences that maximally target specific locations in human exons but minimally target other locations in the genome were determined as follows. According to one aspect, maximally efficient targeting by a gRNA is achieved by 23 nt sequences, the 5-most 20 nt of which exactly complement a desired location, while the three 3-most bases must be of the form NGG. Additionally, the 5-most nt must be a G to establish a pol-III transcription start site. However, according to (2), mispairing of the six 5-most nt of a 20 bp gRNA against its genomic target does not abrogate Cas9-mediated cleavage so long as the last 14 nt pairs properly, but mispairing of the eight 5-most nt along with pairing of the last 12 nt does, while the case of the seven 5-most nt mispairs and 13 3 pairs was not tested. To be conservative regarding off-target effects, one condition was that the case of the seven 5-most mispairs is, like the case of six, permissive of cleavage, so that pairing of the 3-most 13 nt is sufficient for cleavage. To identify CRISPR target sites within human exons that should be cleavable without off-target cuts, all 23 bp sequences of the form 5-GBBBB BBBBB BBBBB BBBBB NGG-3 (form 1) were examined, where the Bs represent the bases at the exon location, for which no sequence of the form 5-NNNNN NNBBB BBBBB BBBBB NGG-3 (form 2) existed at any other location in the human genome. Specifically, (i) a BED file of locations of coding regions of all RefSeq genes the GRCh37/hg19 human genome from the UCSC Genome Browser (15-17) was downloaded. Coding exon locations in this BED file comprised a set of 346089 mappings of RefSeq mRNA accessions to the hg19 genome. However, some RefSeq mRNA accessions mapped to multiple genomic locations (probable gene duplications), and many accessions mapped to subsets of the same set of exon locations (multiple isoforms of the same genes). To distinguish apparently duplicated gene instances and consolidate multiple references to the same genomic exon instance by multiple RefSeq isoform accessions, (ii) unique numerical suffixes to 705 RefSeq accession numbers that had multiple genomic locations were added, and (iii) the mergeBed function of BEDTools (18) (v2.16.2-zip-87e3926) was used to consolidate overlapping exon locations into merged exon regions. These steps reduced the initial set of 346089 RefSeq exon locations to 192783 distinct genomic regions. The hg19 sequence for all merged exon regions were downloaded using the UCSC Table Browser, adding 20 bp of padding on each end. (iv) Using custom perl code, 1657793 instances of form 1 were identified within this exonic sequence. (v) These sequences were then filtered for the existence of off-target occurrences of form 2: For each merged exon form 1 target, the 3-most 13 bp specific (B) core sequences were extracted and, for each core generated the four 16 bp sequences 5-BBB BBBBB BBBBB NGG-3 (N=A, C, G, and T), and searched the entire hg19 genome for exact matches to these 6631172 sequences using Bowtie version 0.12.8 (19) using the parameters 116v 0k 2. Any exon target site for which there was more than a single match was rejected. Note that because any specific 13 bp core sequence followed by the sequence NGG confers only 15 bp of specificity, there should be on average 5.6 matches to an extended core sequence in a random 3 Gb sequence (both strands). Therefore, most of the 1657793 initially identified targets were rejected; however 189864 sequences passed this filter. These comprise the set of CRISPR-targetable exonic locations in the human genome. The 189864 sequences target locations in 78028 merged exonic regions (40.5% of the total of 192783 merged human exon regions) at a multiplicity of 2.4 sites per targeted exonic region. To assess targeting at a gene level, RefSeq mRNA mappings were clustered so that any two RefSeq accessions (including the gene duplicates distinguished in (ii)) that overlap a merged exon region are counted as a single gene cluster, the 189864 exonic specific CRISPR sites target 17104 out of 18872 gene clusters (90.6% of all gene clusters) at a multiplicity of 11.1 per targeted gene cluster. (Note that while these gene clusters collapse RefSeq mRNA accessions that represent multiple isoforms of a single transcribed gene into a single entity, they will also collapse overlapping distinct genes as well as genes with antisense transcripts.) At the level of original RefSeq accessions, the 189864 sequences targeted exonic regions in 30563 out of a total of 43726 (69.9%) mapped RefSeq accessions (including distinguished gene duplicates) at a multiplicity of 6.2 sites per targeted mapped RefSeq accession.
[0089] According to one aspect, the database can be refined by correlating performance with factors, such as base composition and secondary structure of both gRNAs and genomic targets (20, 21), and the epigenetic state of these targets in human cell lines for which this information is available (22).
EXAMPLE VI
Multiplex Synthesis
[0090] The target sequences were incorporated into a 200 bp format that is compatible for multiplex synthesis on DNA arrays (23, 24). According to one aspect the method allows for targeted retrieval of a specific or pools of gRNA sequences from the DNA array based oligonucleotide pool and its rapid cloning into a common expression vector (
EXAMPLE VII
RNA-Guided Genome Editing Requires Both Cas9 and Guide RNA for Successful Targeting
[0091] Using the GFP reporter assay described in
EXAMPLE VIII
Analysis of gRNA and Cas9 Mediated Genome Editing
[0092] The CRISPR mediated genome editing process was examined using either (A) a GFP reporter assay as described earlier results of which are shown in
EXAMPLE IX
RNA-Guided Genome Editing is Target Sequence Specific
[0093] Similar to the GFP reporter assay described in
EXAMPLE X
Guide RNAs Targeted to the GFP Sequence Enable Robust Genome Editing
[0094] In addition to the 2 gRNAs targeting the AAVS1 insert, two additional gRNAs targeting the flanking GFP sequences of the reporter described in
EXAMPLE XI
RNA-Guided Genome Editing is Target Sequence Specific, and Demonstrates Similar Targeting Efficiencies as ZFNs or TALENs
[0095] Similar to the GFP reporter assay described in
EXAMPLE XII
RNA-Guided NHEJ in Human iPS Cells
[0096] Human iPS cells (PGP1) were nucleofected with constructs indicated in the left panel of
EXAMPLE XIII
RNA-Guided NHEJ in K562 Cells
[0097] K562 cells were nucleated with constructs indicated in the left panel of
EXAMPLE XIV
RNA-Guided NHEJ in 293T Cells
[0098] 293T cells were transfected with constructs indicated in the left panel of
EXAMPLE XV
HR at the Endogenous AAVS1 Locus Using Either a dsDNA Donor or a Short Oligonucleotide Donor
[0099] As shown in
EXAMPLE XVI
Methodology for Multiplex Synthesis, Retrieval and U6 Expression Vector Cloning of Guide RNAs Targeting Genes in the Human Genome
[0100] A resource of about 190 k bioinformatically computed unique gRNA sites targeting 40.5% of all exons of genes in the human genome was generated. As shown in
EXAMPLE XVII
CRISPR Mediated RNA-Guided Transcriptional Activation
[0101] The CRISPR-Cas system has an adaptive immune defense system in bacteria and functions to cleave invading nucleic acids. According to one aspect, the CRISPR-CAS system is engineered to function in human cells, and to cleave genomic DNA. This is achieved by a short guide RNA directing a Cas9 protein (which has nuclease function) to a target sequence complementary to the spacer in the guide RNA. The ability to cleave DNA enables a host of applications related to genome editing, and also targeted genome regulation. Towards this, the Cas9 protein was mutated to make it nuclease-null by introducing mutations that are predicted to abrogate coupling to Mg2+ (known to be important for the nuclease functions of the RuvC-like and HNH-like domains): specifically, combinations of D10A, D839A, H840A and N863A mutations were introduced. The thus generated Cas9 nuclease-null protein (as confirmed by its ability to not cut DNA by sequencing analysis) and hereafter referred to as Cas9R-H-, was then coupled to a transcriptional activation domain, here VP64, enabling the CRISPR-cas system to function as a RNA guided transcription factor (see
EXAMPLE XVIII
gRNA Sequence Flexibility and Applications Thereof
[0102] Flexibility of the gRNA scaffold sequence to designer sequence insertions was determined by systematically assaying for a range of the random sequence insertions on the 5, middle and 3 portions of the gRNA: specifically, 1 bp, 5 bp, 10 bp, 20 bp, and 40 bp inserts were made in the gRNA sequence at the 5, middle, and 3 ends of the gRNA (the exact positions of the insertion are highlighted in red in
[0103] The following references identified in the Examples section by number are hereby incorporated by reference in their entireties for all purposes.
REFERENCES
[0104] 1. K. S. Makarova et al., Evolution and classification of the CRISPR-Cas systems. Nature reviews. Microbiology 9, 467 (June, 2011). [0105] 2. M. Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816 (Aug. 17, 2012). [0106] 3. P. Horvath, R. Barrangou, CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 167 (Jan. 8, 2010). [0107] 4. H. Deveau et al., Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. Journal of bacteriology 190, 1390 (February, 2008). [0108] 5. J. R. van der Ploeg, Analysis of CRISPR in Streptococcus mutans suggests frequent occurrence of acquired immunity against infection by M102-like bacteriophages. Microbiology 155, 1966 (June, 2009). [0109] 6. M. Rho, Y. W. Wu, H. Tang, T. G. Doak, Y. Ye, Diverse CRISPRs evolving in human microbiomes. PLoS genetics 8, e1002441 (2012). [0110] 7. D. T. Pride et al., Analysis of streptococcal CRISPRs from human saliva reveals substantial sequence diversity within and between subjects over time. Genome research 21, 126 (January, 2011). [0111] 8. G. Gasiunas, R. Barrangou, P. Horvath, V. Siksnys, Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America 109, E2579 (Sep. 25, 2012). [0112] 9. R. Sapranauskas et al., The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coli. Nucleic acids research 39, 9275 (November, 2011). [0113] 10. J. E. Garneau et al., The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67 (Nov. 4, 2010). [0114] 11. K. M. Esvelt, J. C. Carlson, D. R. Liu, A system for the continuous directed evolution of biomolecules. Nature 472, 499 (Apr. 28, 2011). [0115] 12. R. Barrangou, P. Horvath, CRISPR: new horizons in phage resistance and strain identification. Annual review of food science and technology 3, 143 (2012). [0116] 13. B. Wiedenheft, S. H. Sternberg, J. A. Doudna, RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331 (Feb. 16, 2012). [0117] 14. N. E. Sanjana et al., A transcription activator-like effector toolbox for genome engineering. Nature protocols 7, 171 (January, 2012). [0118] 15. W. J. Kent et al., The human genome browser at UCSC. Genome Res 12, 996 (June, 2002). [0119] 16. T. R. Dreszer et al., The UCSC Genome Browser database: extensions and updates 2011. Nucleic Acids Res 40, D918 (January, 2012). [0120] 17. D. Karolchik et al., The UCSC Table Browser data retrieval tool. Nucleic Acids Res 32, D493 (Jan. 1, 2004). [0121] 18. A. R. Quinlan, I. M. Hall, BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841 (Mar. 15, 2010). [0122] 19. B. Langmead, C. Trapnell, M. Pop, S. L. Salzberg, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25 (2009). [0123] 20. R. Lorenz et al., ViennaRNA Package 2.0. Algorithms for molecular biology: AMB 6, 26 (2011). [0124] 21. D. H. Mathews, J. Sabina, M. Zuker, D. H. Turner, Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of molecular biology 288, 911 (May 21, 1999). [0125] 22. R. E. Thurman et al., The accessible chromatin landscape of the human genome. Nature 489, 75 (Sep. 6, 2012). [0126] 23. S. Kosuri et al., Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature biotechnology 28, 1295 (December, 2010). [0127] 24. Q. Xu, M. R. Schlabach, G. J. Hannon, S. J. Elledge, Design of 240,000 orthogonal 25mer DNA barcode probes. Proceedings of the National Academy of Sciences of the United States of America 106, 2289 (Feb. 17, 2009).