ENGINEERED NUCLEASES IN PLANT GENERATION
20200308595 ยท 2020-10-01
Assignee
Inventors
Cpc classification
A01H1/104
HUMAN NECESSITIES
C12N15/8261
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/8213
CHEMISTRY; METALLURGY
International classification
Abstract
Methods are provided to mutate, in a targeted manner, the genome of a plant cell using a double stranded DNA break inducing enzyme. Also provided are plants, in particular Brassica plants that yield seeds producing oils having a reduced total saturated fatty acid content, and method for making such plants.
Claims
1. A method to mutate the genome of a Brassica plant cell at a target site comprising: a) inducing a double stranded DNA break at said target site, said double stranded break being induced by the introduction to said cell of a double stranded DNA break inducing (DSBI) enzyme which recognizes a recognition sequence in the vicinity of or at said target site in a Kas2 gene; and b) selecting a plant cell wherein said double stranded DNA break has been repaired resulting in a modification in the genome at said target site, wherein said modification is a substitution of at least one nucleotide, a deletion of at least one nucleotide, an insertion of at least one nucleotide or any combination thereof.
2. The method of claim 1, wherein said plant cell is regenerated into a plant.
3. A plant cell comprising a mutation at a target site of the genome obtained by the method of claim 1.
4. A plant, plant part, seed or propagating material thereof comprising a mutation at a target site of the genome comprising the plant cell of claim 3.
5. A method to produce a Brassica plant with reduced saturated fatty acids comprising: a) inducing a double stranded DNA break at a target site, said double stranded break being induced by the introduction to a plant cell of a double stranded DNA break inducing (DSBI) enzyme which recognizes a recognition sequence in the vicinity of or at said target site in a Kas2 gene; and b) selecting a plant cell wherein said double stranded DNA break has been repaired resulting in a mutation in the genome at said target site, wherein said mutation is a substitution of at least one nucleotide, a deletion of at least one nucleotide, an insertion of at least one nucleotide or any combination thereof; and c) regenerating said plant cell(s) of b) into a plant; wherein said mutation results in reduced production of saturated fatty acids by said plant as compared to a control plant of identical genetic background that has not been mutated by said DSBI and repair.
6. The method of claim 1, wherein the DSBI enzyme is a single chain meganuclease or a pair of meganucleases which recognizes or recognize in concert a site and induces or induce said double strand break.
7. The method of claim 2, wherein said plant is crossed with another plant.
8. A plant, plant part, seed or propagating material thereof comprising a mutation at a target site of the genome obtained by the method of claim 2.
9. The method of claim 1, wherein the plant is Brassica napus, Brassica juncea, or Brassica rapa.
10. The method of claim 1, wherein one or both Kas2 alleles on N2 and/or N12 are mutated.
11. The method of claim 10, wherein one or both Kas2 alleles on N2 and/or N12 are mutated.
12. The method of claim 11, wherein one or both Kas2 alleles on N2 are mutated.
13. The method of claim 11, wherein one or both Kas2 alleles on N12 are mutated.
14. The method of claim 10, wherein the mutation is a deletion of one or more nucleotides.
15. The method of claim 14, further comprising at least one substitution mutation.
16. The method of claim 2, wherein the plant yields a reduction of stearic acid (18:0) of about 8% to about 17% as compared to a non-mutated plant of identical genetic background.
17. The method of claim 2, wherein the plant yields a reduction of palmitic acid (16:0) of about 2% to about 10% as compared to a non-mutated plant of identical genetic background.
18. The method of claim 2, wherein the plant yields an overall reduction in total saturated fatty acids of about 1% to about 7%.
19. A mutated Brassica plant comprising a deletion in at least one allele of Kas2.
20. The mutated plant of claim 19, wherein the deletion is from about 1 to about 350 base pairs in length.
21. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
DETAILED DESCRIPTION OF THE INVENTION
[0028] Methods are provided to mutate, in a targeted manner, the genome of a plant using a double stranded DNA break inducing enzyme. Also provided are plants, in particular Brassica plants, which yield seeds producing oils having a reduced saturated fatty acid content, and method for making such plants.
[0029] The invention provides methods to introduce a targeted mutation, including insertion, deletion, or substitution of one or more nucleotides, at a precisely localized nucleotide sequence in the genome of a plant using engineered double stranded DNA break inducing enzymes. The invention further provides a plant cell, plant part, plant or seed comprising such a mutated sequence, wherein said mutation results in a reduction of saturated fatty acid production by the plant, and methods for making such plant.
[0030] The invention is based on the observation that functional meganucleases can be engineered to specifically recognize and cleave a nucleotide sequence, such as Kas2 (SEQ ID NO: 1), in a plant cell, from which a plant can be produced. Provided herein are plants made by the methods provided herein, such as Brassica plants including B. napus, B. juncea, and B. rapa species of Brassica, that yield seeds producing oils having a reduced saturated fatty acid content.
Definitions:
[0031] In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. Specific and preferred values listed below for radicals, substituents, and ranges are for illustration only; they do not exclude other defined values or other values within defined ranges for the radicals and substituents.
[0032] As used herein, the articles a and an refer to one or to more than one, i.e., to at least one, of the grammatical object of the article. By way of example, an element means one element or more than one element.
[0033] The term about, as used herein, means approximately, in the region of, roughly, or around. When the term about is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term about is used herein to modify a numerical value above and below the stated value by a variance of 20%.
[0034] As used herein, a double stranded DNA break endonuclease is an enzyme capable of inducing a double stranded DNA break at a particular nucleotide sequence, called the recognition site. Homing endonucleases constitute a family of endonucleases and are sometimes also referred to as meganucleases. They may be encoded by introns, independent genes or intervening sequences, and present structural and functional properties that distinguish them from the more classical restriction enzymes, usually from bacterial restriction-modification Type II systems.
[0035] A person skilled in the art would be able to either choose a double stranded DNA break inducing (DSBI) enzyme recognizing the selected target nucleotide sequence to engineer such a DSBI endonuclease.
[0036] As used herein located in the vicinity refers to the site of double DNA stranded break induction, i.e. the recognition site of the DSBI enzyme, being located at a distance of 0 bp, 2 bp, 4 bp, 6 bp, 8 bp,10 bp, 20 bp, 30 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200, 250 bp, 500 bp, 1 kbp, 2 kbp, 3 kbp, 4 kbp, 5 kbp to 10 kbp from the target, i.e. the site in the genomic DNA which is to be mutated (the target site).
[0037] The term heterologous refers to the relationship between two or more nucleic acid or protein sequences that are derived from different sources. For example, a promoter is heterologous with respect to an operably linked nucleic acid sequence, such as a coding sequence, if such a combination is not normally found in nature. In addition, a particular sequence may be heterologous with respect to a cell or organism into which it is inserted (i.e. does not naturally occur in that particular cell or organism).
[0038] The expression operably linked means that said elements of the chimeric gene are linked to one another in such a way that their function is coordinated and allows expression of the coding sequence, i.e. they are functionally linked. By way of example, a promoter is functionally linked to another nucleotide sequence when it is capable of ensuring transcription and ultimately expression of said other nucleotide sequence.
[0039] A nullizygous organism carries two mutant or missing alleles for the same gene. The mutant/missing alleles are both complete loss-of-function or null alleles, so homozygous null and nullizygous are synonymous.
[0040] A gene knockout (abbreviation: KO) is a genetic technique in which both of an organism's alleles are made inoperative (knocked out of the organism). The term knockout, inactivated, and disrupted are used interchangeably herein to mean that the targeted site is changed so that the gene expression product is eliminated or greatly reduced or the product expressed has reduced activity as compared to a control (e.g., wild type protein). Also known as knockout organisms or simply knockouts. The term also refers to the process of creating such an organism, as in knocking out a gene.
[0041] When an amount, concentration, or other value or parameter is given as either a range, preferred range, or a list of upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. Where a range of numerical values is recited herein, unless otherwise stated, the range is intended to include the endpoints thereof, and all integers and fractions within the range. It is not intended that the scope of the invention be limited to the specific values recited when defining a range.
[0042] As used herein, plant part includes any plant organ or plant tissue, including but not limited to fruits, seeds, embryos, meristematic regions, callus tissue, leaves, roots, shoots, flowers, gametophytes, sporophytes, pollen, and microspores.
[0043] For the purpose of this invention, the sequence identity of two related nucleotide or amino acid sequences, expressed as a percentage, refers to the number of positions in the two optimally aligned sequences which have identical residues (100) divided by the number of positions compared. A gap, i.e. a position in an alignment where a residue is present in one sequence but not in the other, is regarded as a position with non-identical residues. The optimal alignment of the two sequences is performed by the Needleman and Wunsch algorithm (Needleman and Wunsch 1970). The computer-assisted sequence alignment above, can be conveniently performed using standard software program such as GAP which is part of the Wisconsin Package Version 10.1 (Genetics Computer Group, Madison, Wis., USA) using the default scoring matrix with a gap creation penalty of 50 and a gap extension penalty of 3.
[0044] Nucleic acids can be DNA or RNA, single- or double-stranded. Nucleic acids can be synthesized chemically or produced by biological expression in vitro or in vivo. Nucleic acids can be chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. DNA includes cDNA and genomic DNA.
[0045] Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring
[0046] Harbor, N.Y. (1989); by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience, Hoboken, N.J. (1987).
[0047] The terms comprises, comprising, and the like can have the meaning ascribed to them in U.S. Patent Law and can mean includes, including and the like. As used herein, including or includes or the like means including, without limitation.
Brassica Plants
[0048] Brassica plants described herein have reduced levels of total saturated fatty acids in the seed oil as a result of reduced activity of FatA1, FatA2, Kas2, Kas3 and/or FatB. It is understood that throughout the disclosure, reference to plant or plants includes progeny, i.e., descendants of a particular plant or plant line, as well as cells or tissues from the plant. Progeny of an instant plant include seeds formed on F) F.sub.2, F.sub.3, F.sub.4 and subsequent generation plants, or seeds formed on BC.sub.i, BC.sub.2, BC.sub.3, and subsequent generation plants. Seeds produced by a plant can be grown and then selfed (or outcrossed and selfed, or doubled through dihaploid) to obtain seeds homozygous for a mutant allele. The term allele or alleles refers to one or more alternative forms of a gene at a particular locus.
[0049] Reduced activity, including absence of detectable activity, of FatA1, FatA2, Kas2, Kas3 and/or FatB, can be achieved by mutating one or more endogenous FatA1, FatA2, Kas2, Kas3 and/or FatB allele(s) (each of these genes has one or more isoforms, for example, Kas2 has six isoforms, including one on each of chromosome N2 and N12, as well as two on N7 and two on N16; however, modification of isoforms on N7 and N16 has not demonstrated a reduction in saturates). An endogenous isoform/allele of FatA1, FatA2, Kas2, Kas3 and/or FatB allele can be mutated (deletion, addition and/or substitution mutation) by the use of engineered nucleases.
[0050] Genetic mutations can be introduced within, for example, regenerable plant tissue using one or more engineered nucleases. The treated population, or a subsequent generation of that population, can be screened for reduced protein activity that results from the mutation, e.g., by determining the fatty acid profile of the population and comparing it to a corresponding non-mutagenized population. Mutations can be in any portion of a gene, including coding sequence, intron sequence and regulatory elements, that render the resulting gene product non-functional or with reduced activity.
[0051] The plants on which the genetic mutations can be carried out are any plants, including those in the Brassica family, including any wild-type and mutant plant backgrounds. Such Brassica plants include, but are not limited to, IMC201 (U.S. Pat. No. 9,334,483), IMCO2 (represented by American Type Culture Collection (ATCC) Accession No. PTA-6221), Westar (U.S. Pat No. 6,342,658), 1904 (represented by American Type Culture Collection (ATCC) Accession No. PTA-11273, as well as progeny of the seed designated 1904 and represented by ATCC Accession No. PTA-11273), 2558 (represented by American Type Culture Collection (ATCC) Accession No. PTA-11274, as well as progeny of the seed designated 2558 and represented by ATCC Accession No. PTA-11274), US Pub Appln No. 2013/0081156, 95CB504 (U.S. Pat. No. 9,334,483), Cargill background (represented by American Type Culture Collection (ATCC) Accession No. PTA-12314, PTA-12315 and PTA-12316), 03LC LL and hybrid backgrounds deposited as Accession No. PTA-12314, PTA-12315 and PTA-12316, and Topas (represented by American Type Culture Collection (ATCC) Accession No. PTA-120738).
Engineered Nucleases
[0052] The use of engineered nucleases (GEEN) is a type of genetic engineering in which DNA is inserted, deleted or substituted in the genome of an organism using engineered nucleases, or molecular scissors. These nucleases create site-specific double-strand breaks (DSBs) at desired locations in the genome. The induced double-strand breaks are repaired resulting in targeted mutations, such as deletions.
[0053] There are currently four families of engineered nucleases being used: meganucleases, zinc finger nucleases (ZFNs), Transcription Activator-Like Effector-based Nucleases (TALEN), and the CRISPR-Cas system (Esvelt, K M. and Wang, H H. (2013). Genome-scale engineering for systems and synthetic biology. Mol Syst Biol 9 (1): 641; Tan, W S. et al. (2012). Precision editing of large animal genomes. Adv Genet 80: 37-97; Puchta, H. and Fauser, F. (2013). Gene targeting in plants: 25 years later. Int. J. Dev. Biol 57: 629-637; Boglioli, E. and Richard, M. Rewriting the book of life: a new era in precision genome editing (PDF). Boston Consulting Group; Method of the Year 2011. Nat Meth 9 (1), 1-1; www.sciencemag.org/topic/2015-breakthrough-year).
[0054] Meganucleases, found commonly in microbial species, have the unique property of having long recognition sequences (>14bp) thus making them naturally specific (de Souza, N., Primer: genome editing with engineered nucleases. Nat Meth 9 (1), 27-27 (2011); Smith, J. et al., A combinatorial approach to create artificial homing endonucleases cleaving chosen sequences. Nucleic Acids Research 34 (22), e149 (2006)). This can be exploited to make site-specific DSB in genome editing. Meganuclease variants that recognize unique sequences have been created (Id). Also of use is the fusion of various meganucleases to create hybrid enzymes that recognize a new sequence (Chevalier, B. S. et al., Design, Activity, and Structure of a Highly Specific Artificial Endonuclease Molecular Cell 10 (4), 895-905 (2002)). Yet others have altered the DNA interacting amino acids of the meganuclease to design sequence specific meganucelases in a method named rationally designed meganuclease (U.S. Pat. No. 8,021,867; WO2007/047859; WO2011/064736).
[0055] A well characterized megaendonuclease is I-Scel. I-Scel is a site-specific endonuclease, responsible for intron mobility in mitochondria in Saccharomyces cerevisea. The enzyme is encoded by the optional intron Sc LSU.1 of the 21 S rRNA gene and initiates a double stranded DNA break at the intron insertion site generating a 4 bp staggered cut with 30H overhangs. The recognition site of I-Scel endonuclease extends over an 18 bp non-symmetrical sequence (Colleaux et al. 1988 Proc. Natl. Acad. Sci. USA 85: 6022-6026). The amino acid sequence for I-Scel and a universal code equivalent of the mitochondrial I-Scel gene have been provided by e.g. WO 96/14408. WO 96/14408 further discloses a number of variants of I-Scel protein which are still functional. PCT application PCT/EP04/013122 (incorporated herein by reference) provides synthetic nucleotide sequence variants of I-Scel which have been optimized for expression in plants.
[0056] Another well characterized designed meganuclease is based on the naturally occurring meganuclease I-CreI for use as a scaffold. I-CreI is an endonuclease found in the chloroplasts of Chlamydomonas rheinhardti (Thompson et al. 1992, Gene 119, 247-251). This endonuclease is a homodimer that recognizes a pseudo-palindromic 22 bp DNA site in the 23SrRNA gene and creates a double stranded DNA break that can be used for the introduction of an intron. I-CreI is a member of a group of endonucleases carrying a single LAGLIDADG (SEQ ID NO: 22) motif. LAGLIDADG (SEQ ID NO: 29) enzymes contain one or two copies of the consensus motif. Single-motif enzymes, such as I-CreI function as homodimers, whereas double-motif enzymes are monomers with two separate domains. Accordingly, when designing meganucleases derived from an I-CreI scaffold to recognize a 22 bp nucleotide sequence of interest, two monomeric units are designed, each recognizing a part of the 22 bp recognition site, which are needed in concert to induce a double stranded break at the 22 bp recognition site (W02007/047859). Concerted action may be achieved by linking the two monomeric units into one single chain meganuclease, or may also be achieved by promoting the formation of heterodimers, as described e.g. in W02007/047859.
[0057] A list of other DSB inducing enzymes and their respective recognition sites is provided in Table I of WO 03/004659 (pages 17 to 20) (incorporated herein by reference). These include I-See I, I-Chu I, I-Dmo I, I-Cre I, I-Csm I, PI-Fli I, Pt-Mtu I, I-Ceu I, I-See II, I-See III, HO, PI-Civ I, PI-Ctr I, PI-Aae I, PI-BSU I, PI-Dhal, PI-Dra I, PI-May I, PI-Mch I, PI-Mfu I, PI-Mfl I, PI-Mga I, PI-Mgo I, PI-Min I, PI-Mka I, PI-Mle I, PI-Mma I, PI-Msh I, PI-Msm I, PI-Mth I, PI-Mtu I, PI-Mxe I, PI-Npu I, PI-Pfu I, PI-Rma I, PI-Spb I, PI-Ssp I, PI-Fae I, PI-Mja I, PI-Pho I, PI-Tag I, PI-Thy I, PI-Tko I or PI-Tsp I.
[0058] As opposed to meganucleases, the concept behind ZFNs and TALEN technology is based on a non-specific DNA cutting enzyme, which can then be linked to specific DNA sequence recognizing peptides, such as zinc fingers (such methods have been described e.g. in WO 03/080809, W094/18313 or W095/09233 and in Isalan et al., 2001, Nature Biotechnology 19, 656-660; Liu et al. 1997, Proc. Natl. Acad. Sci. USA 94, 5525-5530)) and transcription activator-like effectors (TALEs; Baker, M., Gene-editing nucleases. Nat Meth 9 (1), 23-26 (2012); Christian et al., 2010, Genetics 186: 757-761, WO10/079430 and WO10/146121). In these technologies, the endonuclease has a DNA recognition site and cleaving site separate from each other. Although the nuclease portions of both ZFNs and TALEN constructs have similar properties (e.g., FokI), the difference between these engineered nucleases is in their DNA recognition peptide. ZFNs rely on Cys2-His2 zinc fingers and TALEN constructs on TALEs. Both of these DNA recognizing peptide domains have the characteristic that they are naturally found in combinations in their proteins. Cys2-His2 Zinc fingers typically happen in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid interacting proteins such as transcription factors. TALEs on the other hand are found in repeats with a one-to-one recognition ratio between the amino acids and the recognized nucleotide pairs. Because both zinc fingers and TALEs happen in repeated patterns, different combinations can be tried to create a wide variety of sequence specificities (de Souza, N., Primer: genome editing with engineered nucleases. Nat Meth 9 (1), 27-27 (2011)). Zinc fingers have been more established in these terms and approaches such as modular assembly (where Zinc fingers correlated with a triplet sequence are attached in a row to cover the required sequence), OPEN (low-stringency selection of peptide domains vs. triplet nucleotides followed by high-stringency selections of peptide combination vs. the final target in bacterial systems), and bacterial one-hybrid screening of zinc finger libraries among other methods have been used to make site specific nucleases.
[0059] Another way of producing custom-made meganucleases, by selection from a library of variants, is described in W02004/067736. Custom made meganucleases with altered sequence specificity and DNA-binding affinity may also be obtained through rational design as described in W02007/047859. Such custom designed endonucleases are also referred to as a non-naturally occurring endonucleases.
[0060] The designed double stranded break inducing enzyme may comprise, but need not comprise, a nuclear localization signal (NLS), such as the NLS of SV40 large T-antigen (Raikhel, Plant Physiol. 100: 1627-1632 (1992) and references therein) (Kalderon et al. Cell 39: 499-509 (1984)). The nuclear localization signal may be located anywhere in the protein, but is conveniently located at the N-terminal end of the protein. The nuclear localization signal may replace one or more of the amino acids of the double stranded break inducing enzyme.
[0061] Conveniently, the DSBI enzyme can be provided by expression of a plant expressible recombinant gene(s) encoding such enzyme(s). To this end, a DNA region comprising a nucleotide sequence encoding, for example, a designed meganuclease or meganuclease monomeric unit can be operably linked to a plant-expressible promoter and optionally a DNA region involved in transcription termination and polyadenylation and introduced into a plant, plant part or plant cell(s). The recombinant gene(s) encoding DSBI enzyme may be introduced transiently or stably. The DSBI enzyme may also be introduced into the plant, plant part or plant cell(s) by introducing into the cell an RNA molecule which is translated into the DSBI enzyme. Alternatively, the DSBI enzyme may be introduced into the plant, plant part or plant cell(s) directly as a protein. Methods for the introduction of DNA or RNA molecules or proteins into a plant, plant part, tissue or plant cell(s) are available to an art worker and briefly described below.
[0062] Described herein, the term plant operative promoter and plant-expressible promoter mean a promoter which is capable of driving transcription in a plant, plant tissue, plant organ, plant part, or plant cell. This includes any promoter of plant origin, but also any promoter of non-plant origin which is capable of directing transcription in a plant cell.
[0063] Promoters that may be used in this respect are constitutive promoters, such as the promoter of the cauliflower mosaic virus (CaMV) 35S transcript (Hapster et al., 1988, Md. Gen. Genet. 212: 182-190), the CaMV 19S promoter (U.S. Pat. No. 5,352,605; WO 84/02913; Benfey et al., 1989, EMBO J. 8:2195-2202), the subterranean clover virus promoter No 4 or No 7 (WO 96/06932), the Rubisco small subunit promoter (U.S. Pat. No. 4,962,028), the ubiquitin promoter (Holtorf et al., 1995, Plant Mal. Biol. 29:637-649), T-DNA gene promoters such as the octopine synthase (OCS) and nopaline synthase (NOS) promoters from Agrobacterium, and further promoters of genes whose constitutive expression in plants is available to the person skilled in the art.
[0064] Further promoters that may be used in this respect are tissue-specific or organ-specific promoters, such as seed-specific promoters, such as the 2S albumin promoter (Joseffson et al., 1987, J. Biol. Chem. 262:12196-12201), the phaseolin promoter (U.S. Pat. No. 5,504,200; Bustos et al., 1989, Plant Cell 1. (9):839-53), the legumine promoter (Shirsat et al., 1989, Mal. Gen. Genet. 215(2):326-331), the unknown seed protein (USP) promoter (Baumlein et al., 1991, Mal. Gen. Genet. 225(3):459-67), the napin promoter (U.S. Pat. No. 5,608,152; Stalberg et al., 1996, Planta 199: 515-519), the Arabidopsis oleosin promoter (WO 98/45461), the Brassica Bce4 promoter (WO 91/13980), and further promoters of genes whose seed-specific expression in plants is available to the person skilled in the art.
Plant Gene Editing
[0065] The use of meganucleases, ZFNs, CRISPR and TALEN, provides a novel strategy for genetic manipulation in plants and can assist in the engineering of desired plant traits by mutating endogenous genes.
[0066] Using engineered nucleases, or any method available to an art worker, various genes can be mutated (so as to create a deletion mutation/truncation, addition of one more nucleotides and/or mutating one or more nucleotides (changing its sequence/substitution) and not a mutation by insertion of foreign/non-endogenous DNA), including FatA1 (fatty acyl thioesterase A 1; Moreno-Perez et al. 2012. Reduced expression of FatA thioesterases in Arabidopsis affects the oil content and fatty acid composition of the seeds. Planta 235: 629-39; Hawkins & Kridl. 1998. Characterization of acyl-ACP thioesterases of mangosteen (Garcinia mangostana) seed and high levels of stearate production in transgenic canola. Plant J 13: 743-52); FatA2 (fatty acyl thioesterase A 2; U.S. Pat. No. 9,334,483); Kas3 (Dehesh et al. 2001. Overexpression of 3-ketoacyl-acyl-carrier protein synthase IIIs in plants reduces the rate of lipid synthesis. Plant Phys 125:1103-1114; Abbadi et al. 2000. Knockout of the regulatory site of 3-ketoacyl-ACP synthase III enhances short- and medium-chain acyl-ACP synthesis. Plant J 24: 1-9); Kas2 (Pidkowich et al. 2007. Modulating seed -ketoacyl-acyl carrier protein synthase II level converts the composition of a temperate seed oil to that of a palm-like tropical oil. PNAS 104:4742-4747; Wu et al. 1994. A mutant of Arabidopsis deficient in the elongation of palmitic acid. Plant Phys 106: 143-150; Gupta et al. 2012. Transcriptional activation of Brassica napus -ketoacyl-ACP synthase II with an engineered zinc finger protein transcription factor. Plant Biotech J 10:783-791); and/or FATB (acyl-acyl carrier protein thioesterases; Bonaventure, G. (2003) Plant Cell. April 15 (4) 1020-33; PCT/EP2008/005551; PCT/US2010/061226) of a plant, such as a Cruciferae plant, for example a Brassica plant, including a plant of the Brassica napus, Brassica juncea, or Brassica rapa species. In one aspect, the plant is an oilseed crop, such as flax (Linum sp.), rapeseed (Brassica sp.), soybean (Glycine sp.), sunflower (Helianthus sp.), cotton (Gossypium sp.), corn (Zea mays), olive (Olea sp.), safflower (Carthamus sp.), cocoa (Theobroma cacoa), peanut (Arachis sp.), hemp, oil palm, coconuts, groundnuts, sesame seed, castor bean, lesquerella, tallow tree, shea nuts, poppy seed, and/or jojoba seeds. Thus, provided herein are genes and plants, such as Brassica plants, that include modified alleles of, for example FatA1, FatA2, Kas2, Kas3and/or FatB, that result in the production of the protein encoded by the gene to have reduced activity or no activity (as compared to wild type FatA1, FatA2, Kas2, Kas2 and/or FatB) or results in little to no protein product being produced.
[0067] For example, through use of a targeted/designed meganuclease and endogenous repair mechanisms, an insertion, substitution or deletion mutation can be created in any one of the genes described herein. A deletion mutation can be from 1 nucleotide to 400 plus nucleotides in length, including for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 342, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400 and so on (and any range encompassing such numbers or the entire gene). Such deletions can result in little to no expression of the gene (RNA and/or protein) and if protein is expressed from the gene, it will have no or reduced activity as compared to a wild type gene.
[0068] The engineered nuclease is provided to plants or plant tissues via conventional methods (e.g., DNA coding for engineered nuclease is inserted into a plasmid (generally operably linked components comprising a promoter sequence, engineered nuclease, terminator (stop) sequence and optionally an antibiotic resistance gene)) which is then introduced into the plant cells by any method available to the art, including for example into bacteria, such as Agrobacterium tumefaciens, but also by direct DNA transfer methods. Various methods for DNA delivery into cells/tissues (intact plant cells or partially degraded tissues or plant cells) are known in the art, and include electroporation as illustrated in U.S. Pat. No. 5,384,253; microprojectile bombardment (biolistics) as illustrated in U.S. Pat. Nos. 5,015,580; 5,550,318; 5,538,880; 6,160,208; 6,399,861; and 6,403,865; Agrobacterium-mediated transformation as illustrated in U.S. Pat. Nos. 5,635,055; 5,824,877; 5,591,616; 5,981,840; and 6,384,301; protoplast transformation as illustrated in U.S. Pat. No. 5,508,184, electroporation, chemically-assisted transformation, liposome-mediated transformation (see, e.g., A. Deshayes, et al. (1985) EMBO J. 4:2731-7.), carbon fiber, silicon carbide fiber or aluminum borate fiber (generally termed whiskers) (see, e.g., J. Brisibe, Exp. Bot. 51 (343): 187-196 (2000); Dunwell (1999) Methods Mol. Biol. 111:375-82; and U.S. Pat. No. 5,464,765), micro-injection (see, e.g., T J. Reich, of al. (1986) Biotechnology 4: 1001-1004) and viral-mediated transformation (see, e.g., S. B. Gelvin, (2005) Nat Biotechnol. 23: 684-5, WO 90/12107, WO 03/052108 and WO 2005/098004), bombardment of plant cells with heterologous foreign DNA adhered to particles, ballistic particle acceleration, aerosol beam transformation (U.S. Patent Application No. 20010026941; U.S. Pat. No. 4,945,050; International Publication No. WO 91/00915; U.S. Patent Application No. 2002015066, WO 01/038514; all incorporated herein by reference), Led transformation, PEG transformation, and various other non-particle direct-mediated methods to transfer DNA. As used herein direct DNA transfer is any method of DNA introduction into plant cells which does not involve the use of natural Agrobacterium spp. and which is capable of introducing DNA into plant cells.
[0069] It will also be clear that the terms used to describe the method such as introduction of a DNA as well as regeneration of a plant from the cell do not imply that such DNA necessarily needs to be introduced by transformation techniques. Indeed, it will be immediately clear to the person skilled in the art that the DNA molecule of interest may also be introduced by breeding or crossing techniques from one plant to another. Thus, introducing in connection with the present application relate to the placing of genetic information in a plant cell or plant by any known means. This can be effected by any method known in the art for transforming RNA or DNA into plant cells, tissues, protoplasts or whole plants or by introgressing said RNA or DNA into plants as described below.
[0070] In the case of introducing DNA into a plant, plant tissue or pant cell(s) in which the mutation is desired (e.g., canola plant or plant tissue; including, for example, several varieties of the Brassicaceae plants, including for example, Brassica napus, Brassica rapa, B. campestris or Brassica juncea and mutated Brassica plants) via Agrobacterium tumefaciens, the plant, plant tissues, or plant cell(s) is exposed to the bacteria carrying the engineered nuclease. For example, the plant can be dipped in a solution comprising the bacterium or disks can be punched out from a plant leaf (or other plant tissue, such as the stems, can be used) and incubated with a culture of plasmid-containing A. tumefaciens. The disks/plant tissue are then placed under conditions to generate callus in the presence of antibiotic. Only those plant cells/tissue that have DNA from the plasmid (the resistance gene) will have antibiotic resistance. The conditions therefore select for the plant cells/tissue by killing those that do not contain plasmid DNA. After resistant callus is selected, they are transferred to medium that induces growth of shoots, where they grow roots, and then to soil to grow into mature plants.
[0071] Plants (offspring) are then selected for those which have a mutation in the desired gene (e.g., such as those listed above). The selection process can look for altered size in the gene of interest and/or protein activity (protein normally produced by the gene of interest), as well as antibiotic resistance (an extra piece of DNA that was included in the plasmid inserted into the bacteria that provides for resistance to a specific antibiotic) or by sequence. Those plants with reduced to no activity in the desired gene (expression of RNA and/or protein), as compared to plants that were not exposed to the engineered nuclease (with identical starting backgrounds), are of particular interest. If the bacteria inserted any foreign DNA into the plant, these plants can be further bred until such DNA is no longer part of the mutated plant. The plants can also be bred so that they are homozygous for the mutation (e.g., deletion).
[0072] Also provided is a method crossing one or more first parent plants that contain a mutant allele at one or more loci of FatA1, FatA2, FatB, Kas2, and/or Kas3 and one or more second parent plants that contain a mutant allele at a different locus of FatA1, FatA2, FatB, Kas2, and/or Kas3, wherein each mutant allele results in the production of a polypeptide having reduced activity (or no activity) relative to a corresponding wild-type (or a gene that was not mutated as described herein) FatA1, FatA2, FatB, Kas2, and/or Kas3 polypeptide (or no polypeptide is produced at all); and selecting progeny plants having mutants alleles at two or more different loci thereby obtaining a desired plant.
Plant Products
[0073] Oils obtained from such plants, such as Brassica plants (canola oil), can have low or no saturated fatty acids and an altered stearic or palmitic acid fatty acid content as compared to a plant that was not mutated as described herein (identical genetic background to plant prior to exposure to an engineered nuclease). Oil content in the seeds can be determined by methods known to those of skill in the art.
[0074] In another aspect, a method of producing an oil is provided. The method includes crushing seeds produced from at least one Brassica plant described herein; and extracting oil from the crushed seeds. Such oils can be used in food compositions, spray coatings for food, and/or for frying applications (such as frying food, so as to produce fried foods such as snack chips (e.g., corn or potato chips), French fries, or other quick serve foods).
[0075] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
EXAMPLES 1
[0076] Mutation of Kas2 with use of a Meganuclease
[0077] Using a meganuclease specific for Kas2 (SEQ ID NO:1)(the expression of the desired meganuclease in a canola plant cell causes specific breaks in Kas2 DNA in the plant genome; repair of which leads to deletions, insertions and/or base pair changes), several canola plants with deletions in Kas2 were generated (ranging from 1 to 350 base pair deletions). This resulted in phenotypes with a decrease in C18:0 saturated fat production from about 8% to about 17%, a reduction in 16:0 of about 0% to about 10% (including about 6%) and with a reduction in combined C18:0/C20:0/C22:0/C24:0 from about 12% to about 19%, as compared to plants with an identical genetic background to the plant prior to exposure to an engineered nuclease.
[0078] Thus targeted mutation of Kas2 resulted in a significant and unexpected decrease in saturated fat production.
[0079] A meganuclease specific for Kas2 was used to prepare a mutant in the N2 allele. SEQ ID NO:2 is the region of the wild type N2 allele that was selected for mutation. A Kas2-N2 mutant (SEQ ID NO:3) with a 6 bp deletion in the N2 allele was generated.
[0080] A meganuclease specific for Kas2 was used to prepare a mutant in the N2 allele. SEQ ID NO:2 is the region of the wild type N2 allele that was selected for mutation. A Kas2-N2 mutant (SEQ ID NO:8) with a 16 bp deletion in the N2 allele was generated.
[0081] A meganuclease specific for Kas2 was used to prepare a mutant in the N12 allele. SEQ ID NO:13 is the region of the wild type N12 allele that was selected for mutation. A Kas2-N12 mutant (SEQ ID NO:14) with a 51 bp deletion in the N12 allele was generated.
[0082] A meganuclease specific for Kas2 was used to prepare a mutant in the N12 allele of a Kas2-N2 mutant. A Kas2-N2/N12 double mutant (SEQ ID NO:19) with a deletion in the N2 allele and a 6 bp deletion in the N12 allele was generated.
[0083] A meganuclease specific for Kas2 was used to prepare a mutant in the N12 allele of a Kas2-N2 mutant. A Kas2-N2/N12 double mutant (SEQ ID NO:24) with a deletion in the N2 allele and a 15 bp deletion in the N12 allele was generated.
[0084] A meganuclease specific for Kas2 was used to prepare a mutant in the N12 allele of a Kas2-N2 mutant in a IMC201 background. SEQ ID NO:29 is the region of the wild type N12 allele that was selected for mutation. A Kas2-N2/N12 double mutant (SEQ ID NO:30) with a deletion in the N2 allele and a 13 bp deletion in the N12 allele was generated.
EXAMPLE 2
Kas2 Mutation and Analysis
[0085] The Kas2 mutants described above were grown and tested for saturated fatty acid production.
[0086] In the Tables provided below, the fatty acids are referred to by the length of the carbon chain and number of double bonds within the chain. For example, C14:0 refers to myristic acid; C16:0 refers to palmitic acid; C18:0 refers to stearic acid; C18:1 refers to oleic acid; C18:2 refers to linoleic acid; C18:3 refers to ALA; C20:0 refers to archidic acid; C20:1 refers to eicosenoic acid; C22:0 refers to behenic acid; C22:1 refers to erucic acid; C24:0 refers to lignoceric acid; and C24:1 refers to nervonic acid. Total Sats refers to the total of C14:0, C16:0, C18:0, C20:0, C22:0, and C24:0. Representative fatty acid profiles are provided for each of the specified samples.
[0087] Unless otherwise indicated, all percentages refer to fatty acid % based on total fatty acids (i.e., fatty acid moieties) in the oil.
[0088] Brassica plants with lower saturated fatty acid were obtained by subjecting cells of Brassica plants to engineered meganucleases, followed by analysis of sequence (
[0089] The average results of saturated fatty acid production in said mutant plant lines is presented in Table 1 (Cargill background), Table 2 (Cargill background) and Table 3 (Cargill background), Table 4 (Cargill background), Table 5 (IMC201 background), showing mutated plant lines, prepared by the methods described herein having a reduction of saturated fatty acid 18:0 (stearic acid) of about 8% to about 17%, a reduction in 18/20/22/24 saturated fatty acids combined of about 8% to about 19%, a reduction in 16:0 of about 0% to about 10% (including about 6%), and a reduction in total saturated fatty acids of about 1% to about 7%. WT indicates average results for non-mutated (e.g., wild-type allele(s)) plants of the identical genetic background.
TABLE-US-00001 TABLE 1 % % reduction Total Sats reduction Total % reduction Sample C18:0 C18:0 C20:0 C22:0 C24:0 18/20/22 18/20/22/24 Sats total sats Kas2-N2 1.25 14% 0.35 0.15 0.11 1.85 16% 5.12 4% Mutant Wild-Type 1.45 0.41 0.18 0.15 2.19 5.36
TABLE-US-00002 TABLE 2 % reduction Total Sats %reduction Total %reduction Sample C18:0 C18:0 C20:0 C22:0 C24:0 18/20/22 18/20/22/24 Sats total sats Kas2-N12 1.31 10% 0.36 0.15 0.11 1.93 12% 5.31 1% Mutant Wild-Type 1.45 0.41 0.18 0.15 2.19 5.36
TABLE-US-00003 TABLE 3 % reduction % reduction Total Sats % reduction Total % reduction Sample C16:0 C16:0 C18:0 C18:0 C20:0 C22:0 C24:0 18/20/22/24 18/20/22/24 Sats total sats Kas2-N2/N12 2.99 6% 1.33 8% 0.33 0.13 0.1 1.89 14% 4.96 7% Mutant Wild-Type 3.17 1.45 0.41 0.18 0.15 2.19 5.36
TABLE-US-00004 TABLE 4 % reduction Total Sats % reduction Total % reduction Sample C18:0 C18:0 C20:0 C22:0 C24:0 18/20/22/24 18/20/22/24 Sats total sats Kas2-N2/N12(x) 1.30 17% 0.33 0.12 0.12 1.87 19% 4.72 7% Mutant (6 bp deletion in N12) Kas2-N2/N12(y) 1.37 13% 0.34 0.12 0.14 1.96 15% 4.90 4% Mutant (15 bp deletion in N12) Wild-Type 1.57 0.43 0.17 0.15 2.32 5.10
TABLE-US-00005 TABLE 5 % reduction Total Sats % reduction Total % reduction Sample C18:0 C18:0 C20:0 C22:0 C24:0 18/20/ 18/20/22 Sats total sats Kas2-N12 2.25 9% 0.67 0.29 0.15 3.36 8% 7.76 5% Mutant Wild-Type 2.46 0.71 0.31 0.17 3.65 8.16 IMC201
Bibliography
[0090] D'Halluin et al. 2013. Targeted molecular trait stacking in cotton through targeted double-strand break induction. Plant Biotech J 11:933-41.
[0091] Djukanovic et al. 2013. Male-sterile maize plants produced by targeted mutagenesis of the cytochrome P450-like gene (MS26) using a re-designed I-CreI homing endonuclease. The Plant Journal 76:888-99.
[0092] Gao et al. 2010. Heritable targeted mutagenesis in maize using a designed endonuclease. The Plant Journal 61:176-187.
[0093] Honig et al. 2015. Transient expression of virally delivered meganuclease in planta generates inherited genomic deletions. Mol Plant 8:1292-4.
[0094] Puchta & Fauser. 2014. Synthetic nucleases for genome engineering in plants: prospects for a bright future. The Plant Journal 78:727-741.
[0095] Sprink et al. 2015. Plant genome editing by novel tools: TALEN and other sequence specific nucleases. Current Opinion in Biotech 32:47-53.
[0096] Tzfira et al. 2012. Genome modifications in plant cells by custom-made restriction enzymes. Plant Biotech Journal 10:373-389.
[0097] All patents, patent applications, accession numbers and publications cited herein are incorporated herein by reference in their entirety.
TABLE-US-00006 SEQUENCES SEQIDNO:1(Brassicanapus)Kas2,wildtype atggtggctg cctcttcctgttacgcctat ttggacttta ggccttgcaa tcactacaac 60 aacaacaaca acgccttgtcttctctcttc ggatcaaata gtatttcttt gaatcaaaac 120 cagagtagat tgaaccgagcaactaactcc ggtagagcat tcttcttttg ccgcgtcttc 180 ctgttaaagt tttttttttttaatgtttgc tcacacaagt ctttgtttca tgttgttatg 240 gtttttatgt tattgggcaaatgatgaaac ttgtaggtaa tttttattgt gagtttcaga 300 ctagatataa ggactatgtggatacatagt ttggagacct gcataaatgg cagtcaaact 360 atatatataa actatgaagttgcatggaac ttaattgata taatgccatt gagatgaggt 420 ttatgaatag tagctaattaattttaagta actccatcgt caacttataa tgtgttatgt 480 tgtttttagg tagagccatggctattgcta tgaatatgga aaatgaagcc atggttagca 540 agaataatcc ccctatggagaagcgtcggg ttgtggtgac aggcatggga gttgaaacat 600 cattaggtca tgacccacataccttttacg agaacttgct acaaggaaac agtggtatta 660 gccacattga ggattttgattgttctgact ttcctacggt aaataagcaa atattattat 720 catattatat caagactttcttggtatctt tgtgggtttc tttatttact atctttcctt 780 tgtttttaaa ttttgttcaagagaatcgcg ggtgagatca aatctttctc cactgaagga 840 tgggttgctc ctaaactgtctaggaggatg gacaagttca tgctctatct cctcactgct 900 ggcaagaaag ctttggctgatggtggtgta accgaacaag tcatggctga gtttgacaaa 960 gccaaatgtg gcgttttgattggctctgca ctgggtggca tgaaggtctt tcatgaggct 1020 attcaagctt tgaagatctcttacaagaag atgaatcctt tttgtgttcc tcttgctaca 1080 actaacatgg gttctgctatgcttgctgtt gatctggtgt ctgattaaat ctgaatgtta 1140 atataaacaa aatatgaatgaacaacactg acgtttcttt tcaaatgata aataggggtg 1200 gatggggcca aactactctatttcaagtgc ttgtgctaca agcaacttct gcattctgaa 1260 ttcagctaac cacattattaagggtgaagc tgtaagtatc ctacatccac ttggaaactc 1320 aaaagtttgg tagaactactttattagact gtctcctaaa cctttcagga tgtaatgcta 1380 tgtggtggct cagatgcagctattattcca ataggtgcaa actctctctc tctcctgcac 1440 tgctctttga agtttaagatacatgtatct tattgtatgt gtaccagtgc agggttggca 1500 ggtttcgtgg cagtccgggctctttcacaa aggaataatg atcccgcaaa agcttcacgt 1560 ccttgggatt gtgtaattttcttacactgc atcgaagttc tgtcaatagg accttccctt 1620 acatgtctgt aatgttgaaggaagtttaat gtgttgaaat gtgtgtatta tgtttttgta 1680 acagaatcga gatggtttcgtgattgggga gggagctgga gttctgcttt tggaagaact 1740 tgagcatgct aaggtatataacttattaca aatgaaactt atctcgttct tgccatggaa 1800 aaagttgtaa gaacttatgtattttgattt tatgttttca gaaaagagga gcaactatct 1860 acgcagagtt tcttggtgggagcttcacat gtgatgccta ccacatgacc gagcctcacc 1920 ctgatggtag tttcattttcccctatttca tattagtttg ccattaaccc atgtctaaat 1980 atccacagga gctggtgtgattatatgtat tgagagagcg ttagctcatg ctgggattcc 2040 caaggaacag ataaattacgtcaatgcaca tgcaacctca acaccagctg gagaccttaa 2100 ggagtacaaa gccctggttcactgttttgg tcaaaatcct gaggtagttt cattttttca 2160 gtcctcaagt ttagtatcttagaaaatgtt acaagattcc aaggtagttt tatgtgcttt 2220 tcttatttgc tcctctcactatgttggcag ctaaaggtaa actccacgaa atcgatgatc 2280 ggacacttgc tgggagctgctggtgctgta gaggctgttg caaccgtgca ggtaagacaa 2340 taaatattag agactgggtgcagttttctc agttttcatg ctaattttct tttggtttct 2400 aaaggcaata agaaccggttgggttcatcc aaatatcaac ctagacaatc cagagaatgg 2460 agtggtatgt tgttgttttttgccttattg ttattcaaag atgatcatat tttgatacta 2520 gtattctaca caaagaccatttaatgtcca taataaaagt tttaataata ctacctaatg 2580 ttatgaaact ggagcaggatacaaaattgc tggtgggttc taagaaggag agattgaaca 2640 ttaaagcagc cttgtcaaattcttttgggt ttggtggtca taactccagc atcatttttg 2700 ctccttacaa gtga 2714 SEQIDNO:2(Brassicanapus)Kas2,wildtype tgatggtggt gtaaccgaacaagtcatggc tgagtttgac aaagccaaat gtggcgtttt 60 gattggctct gcactgggtggcatgaaggt ctttcatgag gctattcaag ctttgaagat 120 ctcttacaag aagatgaatcctttttgtgt tcctcttgct acaactaaca tgggttctgc 180 tatgcttgct gttgatctggtgtctgatta aatctgaatg ttaatataaa caaaatatga 240 atgaacaaca ctgacgtttcttttcaaatg ataaataggg gtggatgggg ccaaactact 300 ctatttcaag tgcttgtgctacaagcaact tctgcattct gaattcagct aaccacatta 360 ttaagggtga agctgtaagtatcctacatc cacttggaaa ctcaaaagtt tggtagaact 420 actttattag actgtctcctaaacctttca ggatg 455 SEQIDNO:3ArtificialSequence(fromBrassicanapus)Kas2,N2mutant(6 bpdeletioninN2),inaCargillbackground tgatggtggt gtaaccgaacaagtcatggc tgagtttgac aaagccaaat gtggcgtttt 60 gattggctct gcactgggtggcatgaaggt ctttcatgag gctattcaag ctttgaagat 120 ctcttacaag aagatgaatcctttttgtgt tcctcttgct acaactaaca tgggttctgc 180 tatgcttgct gttgatctggtgtctgatta aatctgaatg ttaatataaa caaaatatga 240 atgaacaaca ctgacgtttcttttcaaatg ataaataggg gtggatgggg ccaaactact 300 ctatttcaag tgctacaagcaacttctgca ttctgaattc agctaaccac attattaagg 360 gtgaagctgt aagtatcctacatccacttg gaaactcaaa agtttggtag aactacttta 420 ttagactgtc tcctaaacctttcaggatg 449 SEQIDNO:4ArtificialSequence(fromBrassicanapus)meganuclease recognitionsiteofKas2N2mutant(6bpdeletioninN2) ggggtggatg gggccaaactactctatttc aagtgctaca agcaacttct gcattctgaa 60 ttcagctaac 70 SEQIDNO:5ArtificialSequence(fromBrassicanapus)aminoacid translationofmeganucleaserecognitionsiteofKas2N2mutant(6bp deletioninN2) GlyTrpMetGlyProAsnTyrSerIleSerSerAlaThrSerAsnPhe 151015 CysIleLeuAsnSerAlaAsn 20 SEQIDNO:6(Brassicanapus)meganucleaserecognitionsiteofwildtype Kas2 ggggtggatg gggccaaactactctatttc aagtgcttgt gctacaagca acttctgcat 60 tctgaattca gctaac 76 SEQIDNO:7(Brassicanapus)aminoacidtranslationofmeganuclease recognitionsiteofwildtypeKas2 GlyTrpMetGlyProAsnTyrSerIleSerSerAlaCysAlaThrSer 151015 AsnPheCysIleLeuAsnSerAlaAsn 2025 SEQIDNO:8ArtificialSequence(fromBrassicanapus)Kas2N2mutantIna Cargillbackground(16bpdeletionInN2) tgatggtggt gtaaccgaacaagtcatggc tgagtttgac aaagccaaat gtggcgtttt 60 gattggctct gcactgggtggcatgaaggt ctttcatgag gctattcaag ctttgaagat 120 ctcttacaag aagatgaatcctttttgtgt tcctcttgct acaactaaca tgggttctgc 180 tatgcttgct gttgatctggtgtctgatta aatctgaatg ttaatataaa caaaatatga 240 atgaacaaca ctgacgtttcttttcaaatg ataaataggg gtggatgggg ccaaactact 300 ctatttcaag tgcttgtgcattctgaattc agctaaccac attattaagg gtgaagctgt 360 aagtatccta catccacttggaaactcaaa agtttggtag aactacttta ttagactgtc 420 tcctaaacct ttcaggatg 439 SEQIDNO:9ArtificialSequence(fromBrassicanapus)meganuclease recognitionsiteofKas2mutant ggggtggatggggccaaact actctatttc aagtgcttgt gcattctgaa ttcagctaac 60 cac 63 SEQIDNO:10ArtificialSequence(fromBrassicanapus)aminoacid translationofmeganucleaserecognitionsiteofKas2mutant GlyTrpMetGlyProAsnTyrSerIleSerSerAlaCysAlaPhe 151015 SEQIDNO:11(Brassicanapus)meganucleaserecognitionsiteofwildtype Kas2 ggggtggatg gggccaaactactctatttc aagtgcttgt gctacaagca acttctgcat 60 tctgaattca gctaaccac 79 SEQIDNO:12(Brassicanapus)aminoacidtranslationofmeganuclease recognitionsiteofwildtypeKas2 GlyTrpMetGlyProAsnTyrSerIleSerSerAlaCysAlaThrSer 151015 AsnPheCysIleLeuAsnSerAlaAsnHis 2025 SEQIDNO:13(Brassicanapus)wildtypepartialsequenceofKas2(N12) cgggtgagat caaatctttctcaactgaag gatgggttgc tcctaaactg tctaggagga 60 tggacaagtt catgctctatcttctcactg ctggcaagaa agctttggct gatggtggtg 120 taaccgaaca agtcatggctgagtttgaca aagccaaatg tggcattttg attggctctg 180 cactgggtgg catgaaggtctttcatgagg ctattcaagc tttgaagatc tcttacaaga 240 agatgaatcc tttttgtgttcctcttgcta caactaacat gggttctgct atgctcgcta 300 ttgatctggt ctggtctggtctaaatgtga atgttatata aacaaaatat gaatgaacaa 360 ccactgacgt ttcttttcaaatgataaatt aggggtggat ggggccaaac tactctatat 420 caagtgcttg cgctacaagcaacttttgca ttctgaattc agctaaccac attattaagg 480 gtgaagctgt aagtatctcctaaactctgt ttggtagact tctcttctgg ttttacttta 540 ttagactgtc ttgtctttcccctaaacctt tca 573 SEQIDNO:14ArtificialSequence(fromBrassicanapus)partialsequence ofKas2N12mutant cgggtgagat caaatctttctcaactgaag gatgggttgc tcctaaactg tctaggagga 60 tggacaagtt catgctctatcttctcactg ctggcaagaa agctttggct gatggtggtg 120 taaccgaaca agtcatggctgagtttgaca aagccaaatg tggcattttg attggctctg 180 cactgggtgg catgaaggtctttcatgagg ctattcaagc tttgaagatc tcttacaaga 240 agatgaatcc tttttgtgttcctcttgcta caactaacat gggttctgct atgctcgcta 300 ttgatctggt ctggtctggtctaaatgtga atgttatata aacaaaatat gaatgaacaa 360 ccactgacgt ttcttttcaaatgataaatt aggggtggat ggggccaaac tactctatat 420 caagtgcttg tgaagctgtaagtatctcct aaactctgtt tggtagactt ctcttctggt 480 tttactttat tagactgtcttgtctttccc ctaaaccttt ca 522 SEQIDNO:15ArtificialSequence(fromBrassicanapus)meganuclease recognitionsiteofKas2mutant tggatggggt ggatggggccaaactactct atttcaagtg cttgtgaagc t 51 SEQIDNO:16ArtificialSequence(fromBrassicanapus)aminoacid translationofmeganucleaserecognitionsiteofKas2mutant TrpMetGlyThrAsnTyrSerIleSerSerAlaCysGluAla 1510 SEQIDNO:17(Brassicanapus)meganucleaserecognitionsiteofwildtype Kas2 tggatggggt ggatggggccaaactactct atttcaagtg cttgtgctac aagcaacttc 60 tgcattctga attcagctaaccacattatt aagggtgaag ct 102 SEQIDNO:18(Brassicanapus)aminoacidtranslationofmeganuclease recognitionsiteofwildtypeKas2 TrpMetGlyThrAsnTyrSerIleSerSerAlaCysAlaThrSerAsn 151015 PheCysIleLeuAsnSerAlaAsnHisIleIleLysGlyGluAla 202530 SEQIDNO:19ArtificialSequence(fromBrassicanapus)partialsequence foraKas2N12mutantInaCargillbackground(6bpdeletionInN12) cgggtgagat caaatctttctcaactgaag gatgggttgc tcctaaactg tctaggagga 60 tggacaagtt catgctctatcttctcactg ctggcaagaa agctttggct gatggtggtg 120 taaccgaaca agtcatggctgagtttgaca aagccaaatg tggcattttg attggctctg 180 cactgggtgg catgaaggtctttcatgagg ctattcaagc tttgaagatc tcttacaaga 240 agatgaatcc tttttgtgttcctcttgcta caactaacat gggttctgct atgctcgcta 300 ttgatctggt ctggtctggtctaaatgtga atgttatata aacaaaatat gaatgaacaa 360 ccactgacgt ttcttttcaaatgataaatt aggggtggat ggggccaaac tactctatat 420 caagtgctac aagcaacttttgcattctga attcagctaa ccacattatt aagggtgaag 480 ctgtaagtat ctcctaaactctgtttggta gacttctctt ctggttttac tttattagac 540 tgtcttgtct ttcccctaaacctttca 567 SEQIDNO:20ArtificialSequence(fromBrassicanapus)meganuclease recognitionsiteofKas2mutant gggtggatgg ggccaaactactctatatca agtgctacaa gcaacttttg cattctgaat 60 tcagctaac 69 SEQIDNO:21ArtificialSequence(fromBrassicanapus)aminoacid translationofmeganucleaserecognitionsiteofKas2mutant GlyTrpMetGlyProAsnTyrSerIleSerSerAlaThrSerAsnPhe 151015 CysIleLeuAsnSerAlaAsn 20 SEQIDNO:22(Brassicanapus)meganucleaserecognitionsiteofwildtype Kas2 ggtggatggg gacaaactactctatatcaa gtgcttgtgc tacaagcaac ttttgcattc 60 tgaattcagc taac 74 SEQIDNO:23(Brassicanapus)aminoacidtranslationofmeganuclease recognitionsiteofwildtypeKas2 GlyTrpMetGlyThrAsnTyrSerIleSerSerAlaCysAlaThrSer 151015 AsnPheCysIleLeuAsnSerAlaAsn 2025 SEQIDNO:24ArtificialSequence(fromBrassicanapus)partialsequence foraKas2N12mutantinaCargillbackground(15bpdeletioninN12) cgggtgagat caaatctttctcaactgaag gatgggttgc tcctaaactg tctaggagga 60 tggacaagtt catgctctatcttctcactg ctggcaagaa agctttggct gatggtggtg 120 taaccgaaca agtcatggctgagtttgaca aagccaaatg tggcattttg attggctctg 180 cactgggtgg catgaaggtctttcatgagg ctattcaagc tttgaagatc tcttacaaga 240 agatgaatcc tttttgtgttcctcttgcta caactaacat gggttctgct atgctcgcta 300 ttgatctggt ctggtctggtctaaatgtga atgttatata aacaaaatat gaatgaacaa 360 ccactgacgt ttcttttcaaatgataaatt aggggtggat ggggccaaac tactctatat 420 caagcaactt ttgcattctgaattcagcta accacattat taagggtgaa gctgtaagta 480 tctcctaaac tctgtttggtagacttctct tctggtttta ctttattaga ctgtcttgtc 540 tttcccctaa acctttca 558 SEQIDNO:25ArtificialSequence(fromBrassicanapus)meganuclease recognitionsiteofKas2mutant ggggtggatg gggccaaactactctatatc aagcaacttt tgcattctga attcagctaa 60 c 61 SEQIDNO:26ArtificialSequence(fromBrassicanapus)aminoacid translationofmeganucleaserecognitionsiteofKas2mutant GlyTrpMetGlyProAsnTyrSerIleSerSerAsnPheCysIleLeu 151015 AsnSerAlaAsn 20 SEQIDNO:27(Brassicanapus)meganucleaserecognitionsiteofwildtype Kas2 ggggtggatg gggacaaactactctatatc aagtgcttgc gctacaagca acttttgcat 60 tctgaattca gctaac 76 SEQIDNO:28(Brassicanapus)aminoacidtranslationofmeganuclease recognitionsiteofwildtypeKas2 GlyTrpMetGlyThrAsnTyrSerIleSerSerAlaCysAlaThrSer 151015 AsnPheCysIleLeuAsnSerAlaAsn 2025 SEQIDNO:29(Brassicanapus)partialwild-typesequenceforKas2Ina IMC201background(N12) cattttgatt ggctctgcactgggtggcat gaaggtcttt catgaggcta ttcaagcttt 60 gaagatctct tacaagaagatgaatccttt ttgtgttcct cttgctacaa ctaacatggg 120 ttctgctatg ctcgctattgatctggtctg gtctggtcta aatgtgaatg ttatataaac 180 aaaatatgaa tgaacaaccactgacgtttc ttttcaaatg ataaattagg ggtggatggg 240 gccaaactac tctatatcaagtgcttgtgc tacaagcaac ttttgcattc tgaattcagc 300 taaccacatt attaagggtgaagctgtaag tatctcctaa actctgtttg gtagacttct 360 cttctggttc tactttattagactgtcttg tctttcccct aaacctttca 410 SEQIDNO:30ArtificialSequence(fromBrassicanapus)partialsequence foraKas2N12mutantInaIMC201background(13bpdeletionInN12) cattttgatt ggctctgcactgggtggcat gaaggtcttt catgaggcta ttcaagcttt 60 gaagatctct tacaagaagatgaatccttt ttgtgttcct cttgctacaa ctaacatggg 120 ttctgctatg ctcgctattgatctggtctg gtctggtcta aatgtgaatg ttatataaac 180 aaaatatgaa tgaacaaccactgacgtttc ttttcaaatg ataaattagg ggtggatggg 240 gccaaactac tctatatcaagtgcaacttt tgcattctga attcagctaa ccacattatt 300 aagggtgaag ctgtaagtatctcctaaact ctgtttggta gacttctctt ctggttctac 360 tttattagac tgtcttgtctttcccctaaa cctttca 397 SEQIDNO:31ArtificialSequence(fromBrassicanapus)meganuclease recognitionsiteofKas2mutant gggtggatgg ggccaaactactctatatca agtgcaactt ttgcattctg aat 53 SEQIDNO:32ArtificialSequence(fromBrassicanapus)aminoacid translationofmeganucleaserecognitionsiteofKas2mutant GlyTrpMetGlyProAsnTyrSerIleSerSerAlaThrPheAlaPhe 151015 SEQIDNO:33(Brassicanapus)meganucleaserecognitionsiteofwildtype Kas2 gggtggatgg ggccaaactactctatatca agtgcttgtg ctacaagcaa cttttgcatt 60 ctgaat 66 SEQIDNO:34(Brassicanapus)aminoacidtranslationofmeganuclease recognitionsiteofwildtypeKas2 GlyTrpMetGlyProAsnTyrSerIleSerSerAlaCysAlaThrSer 151015 AsnPheCysIleLeuAsn 20