DNA-RESPONSIVE HYDROGELS, METHODS OF ALTERING A PROPERTY OF A HYDROGEL, AND APPLICATIONS THEREOF
20200308577 ยท 2020-10-01
Assignee
Inventors
- James J. Collins (Newton, MA)
- Helena DE PUIG GUIXE (Barcelona, ES)
- Luis Soenksen Martinez (Boston, MA, US)
- Max English (Cambridge, MA, US)
- Raphael Gayet (Cambridge, MA, US)
- Nicolaas Angenent-Mari (Somerville, MA, US)
- Angelo S. Mao (Somerville, MA, US)
- Peter Q. Nguyen (Malden, MA)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C08J2433/26
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C08J2405/00
CHEMISTRY; METALLURGY
C08J2205/022
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are hydrogels comprising a polynucleotide-based structural component. Methods of altering a property of a hydrogel based on user-defined nucleic acid input sequences are also disclosed. In addition, various applications are described that utilize these hydrogels and methods.
Claims
1. A method of altering a property of a hydrogel comprising contacting the hydrogel with a CRISPR component, wherein: (i) the hydrogel comprises a plurality of structural components, wherein one or more structural component is a nucleic acid molecule component comprising a polynucleotide sequence of at least 5 nucleotides; (ii) the CRISPR component comprises at least one guide RNA; and (iii) the polynucleotide sequence of at least one nucleic acid molecule component in (i) is cleaved when contacted with the CRISPR component of (ii), thereby altering a property of the hydrogel.
2. The method of claim 1, wherein two or more structural components are nucleic acid molecule components comprising a polynucleotide sequence of at least 5 nucleotides, optionally wherein two or more of the at least two or more structural components comprise different polynucleotide sequences.
3. (canceled)
4. The method of claim 1, wherein: at least one nucleic acid molecule component comprises a double-stranded polynucleotide sequence; at least one nucleic acid molecule component comprises a single-stranded polynucleotide sequence; or a combination thereof.
5. (canceled)
6. The method of claim 1, wherein: at least one nucleic acid molecule component comprises the polynucleotide sequence of a protospacer adjacent motif (PAM); at least one nucleic acid molecule component lacks the polynucleotide sequence of a PAM; or a combination thereof.
7. (canceled)
8. The method of claim 1, wherein a nucleic acid molecule component of the hydrogel further comprises: a monomer species selected from the group consisting of an ethylene glycol monomer and an acrylamide monomer; or polyethylene glycol, polyacrylamide, gelatin, a fibrillar protein, or a combination thereof.
9. (canceled)
10. The method of claim 1, wherein one or more structural component of the hydrogel is selected from the group consisting of a carbon black nanoparticle, a carbon nanocone, a carbon nanofiber, a carbon nanoscroll, a carbon nanothread, a diamondoid, a nanodiamond, a single-walled carbon nanohorn, a carbon nanotube, graphene, graphene oxide, and fullerene.
11. The method of claim 1, wherein at least one guide RNA of the CRISPR component comprises a spacer region that is at least 75% complementary to a polynucleotide sequence of: one or more nucleic acid molecule component of the hydrogel; a trigger molecule, optionally wherein the method further comprises contacting the CRISPR component with the trigger molecule; or a combination thereof.
12.-13. (canceled)
14. The method of claim 1, wherein one or more CRISPR protein of the CRISPR component comprises RNA-guided dsDNA endonuclease activity.
15. The method of claim 14, wherein: the CRISPR protein is Cas9, Cas12a, C2c1, C2c2, or C2c3; the CRISPR protein also comprises ssDNA endonuclease activity; or a combination thereof.
16.-17. (canceled)
18. A method of releasing a product of interest from a hydrogel comprising altering a property of the hydrogel according to the method of claim 1, thereby releasing the product of interest from the hydrogel.
19. The method of claim 18, wherein the product of interest is: a molecule that is anchored to the hydrogel; or encapsulated by the hydrogel, optionally wherein the product of interest is selected from the group consisting of a molecule, a nanoparticle, and a live cell.
20.-21. (canceled)
22. A method of modulating the flow of a product of interest through a hydrogel comprising altering a property of the hydrogel according to the method of claim 1, thereby modulating the flow of the product of interest through the hydrogel.
23. The method of claim 22, wherein the product of interest: is an electric signal; optionally, wherein the method further comprises detecting the electric signal; is a solution; optionally, wherein the solution conducts electric current and the method further comprises detecting an electric signal of the electric current.
24.-27. (canceled)
28. A composition comprising: (i) a hydrogel comprising a plurality of structural components, wherein one or more structural component is a nucleic acid molecule component comprising a polynucleotide sequence of at least 5 nucleotides; and (ii) a CRISPR component comprising: (a) a guide RNA comprising a polynucleotide sequence that complements a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel, wherein the composition lacks a CRISPR protein corresponding to the guide RNA; (b) a CRISPR protein, wherein the composition lacks a guide RNA comprising a polynucleotide sequence that complements a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel; (c) a trigger molecule, wherein the composition lacks a guide RNA comprising a polynucleotide sequence that complements the polynucleotide sequence of the trigger molecule; or (d) a guide RNA comprising a polynucleotide sequence that complements a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel and a CRISPR protein, wherein the composition lacks a trigger molecule.
29. The composition of claim 28, wherein: two or more structural components of the hydrogel in (i) are nucleic acid molecule components optionally wherein at least two of the two or more nucleic acid molecule components comprise different polynucleotide sequences; and/or wherein at least one nucleic acid molecule component of the hydrogel in (i) comprises a double-stranded polynucleotide sequence.
30.-31. (canceled)
32. The composition of claim 28, wherein at least one nucleic acid molecule component of the hydrogel in (i): comprises a single-stranded polynucleotide sequence; comprises the polynucleotide sequence of a protospacer adjacent motif (PAM); lacks the polynucleotide sequence of a PAM; further comprises at least one monomer species selected from the group consisting of an ethylene glycol monomer and an acrylamide monomer; further comprises polyethylene glycol, polyacrylamide, gelatin, a fibrillar protein, or a combination thereof; or a combination thereof.
33.-36. (canceled)
37. The composition of claim 28, wherein one or more structural component of the hydrogel in (i) is selected from the group consisting of a carbon black nanoparticle, a carbon nanocone, a carbon nanofiber, a carbon nanoscroll, a carbon nanothread, a diamondoid, a nanodiamond, a single-walled carbon nanohorn, a carbon nanotube, graphene, graphene oxide, and fullerene.
38. The composition of claim 28, wherein the CRISPR component: comprises a guide RNA, optionally wherein the guide RNA comprises a spacer region that is at least 75% complementary to a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel; or comprises a trigger molecule and a guide RNA, optionally wherein the guide RNA comprises a spacer region that is at least 75% complementary to the polynucleotide sequence of the trigger molecule; or comprises a CRISPR protein, optionally wherein the CRISPR protein comprises a RNA-guided endonuclease activity and/or ssDNA endonuclease activity.
39.-46. (canceled)
47. A CRISPR-responsive switch comprising a composition of claim 28.
48. A CRISPR-responsive switch comprising: (i) a first compartment, wherein the first compartment comprises a composition comprising: (a) a hydrogel comprising a plurality of structural components, wherein one or more structural component is a nucleic acid molecule component comprising a polynucleotide sequence of at least 5 nucleotides; and (b) a CRISPR component comprising a guide RNA comprising a polynucleotide sequence that complements a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel, wherein the composition lacks a CRISPR protein corresponding to the guide RNA; and (ii) a second compartment, wherein the second compartment comprises a CRISPR protein corresponding to the guide RNA of (i)(b); or (iii) a first compartment, wherein the first compartment comprises a composition comprising: (c) a hydrogel comprising a plurality of structural components, wherein one or more structural component is a nucleic acid molecule component comprising a polynucleotide sequence of at least 5 nucleotides; and (d) a CRISPR component comprising a CRISPR protein, wherein the composition lacks a guide RNA comprising a polynucleotide sequence that complements a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel of (iii)(c); and (iv) a second compartment, wherein the second compartment comprises a guide RNA comprising a polynucleotide sequence that complements a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel of (iii)(c); or (v) a first compartment, wherein the first compartment comprises a composition comprising: (e) a hydrogel comprising a plurality of structural components, wherein one or more structural component is a nucleic acid molecule component comprising a polynucleotide sequence of at least 5 nucleotides; and (f) a CRISPR component comprising a trigger molecule, wherein the composition lacks a guide RNA comprising a polynucleotide sequence that complements the polynucleotide sequence of the trigger molecule; and (vi) a second compartment, wherein the second compartment comprises a guide RNA that comprises a polynucleotide sequence that complements the polynucleotide sequence of the trigger molecule of (v)(e); or (vii) a first compartment, wherein the first compartment comprises a composition comprising: (g) a hydrogel comprising a plurality of structural components, wherein one or more structural component is a nucleic acid molecule component comprising a polynucleotide sequence of at least 5 nucleotides; and (h) a CRISPR component comprising a guide RNA comprising a polynucleotide sequence that complements a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel and a CRISPR protein, wherein the composition lacks a trigger molecule; and (viii) a second compartment, wherein the second compartment comprises the trigger molecule of (vii)(h).
49.-61. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It is to be understood that the data illustrated in the drawings in no way limit the scope of the disclosure.
[0043]
[0044]
[0045]
[0046]
[0047]
TABLE-US-00001 (SEQIDNO:17) GGGTAATTTCTACTAAGTGTAGATTTAAAGAAGATGGTATGTGGG; (SEQIDNO:18) GGGTAATTTCTACTAAGTGTAGATATTTTGTTAAAGAAGATGGT; (SEQIDNO:19) GGGTAATTTCTACTAAGTGTAGATACAAAATTAAATTGAACGTT.
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
DETAILED DESCRIPTION
[0092] Microbial clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) adaptive immune systems contain programmable RNA-guided endonucleases, some capable of multiple-turnover kinetics (1, 2). Due to their specificity, programmability, and enzymatic activity, CRISPR-Cas have been exploited as efficient genome editing tools (3), and more recently in diagnostic applications such as SHERLOCK (4, 5) and DETECTR (2). However, the use of CRISPR system components for effecting multiscale, programmable changes in the physical properties of macroscopic materials such as hydrogels remains unexplored.
[0093] As disclosed herein, CRISPR system components were used to control the properties of DNA-based hydrogels at multiple scales (from targeted payload release to bulk gel actuation) and in a modular fashion by eliminating the need to encode sequence specificity into the gel structure itself. Different hydrogels were engineered to demonstrate a variety of triggered responses for use in therapeutic, diagnostic and sensing applications, including the release of small molecules, nanoparticles (NPs), and live cells, as well as for the modulation of bulk electrical and permeability properties of DNA-hydrogels (
Hydrogel Compositions
[0094] In some aspects the disclosure relates to hydrogels. As used herein, the term hydrogel refers to three-dimensional polymeric network structure which can absorb and retain water. The hydrogels described herein may comprise a plurality of structural components (i.e., polymer chains), which may differ chemically. For example, a hydrogel my comprise polyacrylamide chains, polyethylene glycol chains, gelatin, fibrillary proteins, or a combination thereof. However, at least one structural component of each of the hydrogels described herein is a polynucleotide-based structural component (i.e., a nucleic acid molecule component). Of the total structural components of a hydrogel, the percentage that are nucleic acid molecule components may vary. For example, in some embodiments, at least 1, at least 2, at least 3, at least 4, at least 5, at least at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 55, at least 60, at least 65, at least 70, at least 80, at least 85, at least 85, at least 90, or at least 95 of the structural components are nucleic acid molecule components.
[0095] A nucleic acid molecule component may comprise a polynucleotide sequence of at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 75, at least 80, at least 85, at least 90, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 5000, or at least 10000 nucleotides. The polynucleotide sequence of the nucleic acid molecule components may vary. A hydrogel may comprise two or more nucleic acid molecule components that comprise the same polynucleotide sequence. Alternatively or in addition a hydrogel may comprise two or more nucleic acid molecule components that comprise different polynucleotide sequences (i.e., different in one or more nucleotides).
[0096] In some embodiments, at least one nucleic acid molecule component comprises the polynucleotide sequence of a protospacer adjacent motif (PAM). Examples of PAM sequences are known to those having skill in the art. In some embodiments, at least one nucleic acid molecule component lacks the polynucleotide sequence of a PAM.
[0097] A nucleic acid molecule component of a hydrogel may comprise a double-stranded nucleic acid region. In some embodiments, the double-stranded nucleic acid region is formed from two nucleic acid molecules. In other embodiments, the double-stranded nucleic acid region is formed from one nucleic acid molecule (e.g., a hairpin). Alternatively or in addition, a nucleic acid molecule component of a hydrogel may comprise a single-stranded nucleic acid region.
[0098] A nucleic acid molecule component of a hydrogel may comprise one or more monomer species selected from the group consisting of a ethylene glycol monomer (which when polymerized with another ethylene glycol monomer forms the polymer polyethylene glycol) and a acrylamide monomer (which when polymerized with another acrylamide monomer forms the polymer polyacrylamide). Mixtures of different monomers also can be polymerized to form copolymers, which also can be used in the hydrogels disclosed herein. Indeed, a nucleic acid molecule component may comprise any natural or synthetic polymeric matrix that can be functionalized with a nucleic acid. A nucleic acid molecule component of a hydrogel may comprise polyethylene glycol, polyacrylamide, gelatin, a fibrillar protein, or a combination thereof. As described in the Examples below, a nucleic acid molecule component may be manufactured by connecting a polynucleotide to a previously formed polymer (e.g., polyacrylamide or polyethylene glycol).
[0099] Alternatively or in addition, a hydrogel may comprise one or more structural component that comprises a nanostructured/microstructured conductive particle, such as metallic particles (gold, silver, etc.) or carbon particles. Example of nanostructured conductive particles are known to those having skill in the art. For example, in some embodiments, one or more structural component is selected from the group consisting of a carbon black nanoparticle, a carbon nanocone, a carbon nanofiber, a carbon nanoscroll, a carbon nanothread, a diamondoid, a nanodiamond, a single-walled carbon nanohorn, a carbon nanotube, graphene, graphene oxide, and fullerene.
[0100] In some embodiments, a hydrogel comprises a plurality of structural components, wherein: (i) three or more structural components of the plurality of structural components of the hydrogel are nucleic acid molecule components comprising at least 5 nucleotides and one or more species of monomers, wherein at least one monomer species is selected from the group consisting of an ethylene glycol monomer and an acrylamide monomer; and (ii) the three or more nucleic acid molecule components in (i) differ in sequence.
Methods of Altering a Property of a Hydrogel
[0101] In some aspects the disclosure relates to methods of altering a property of a hydrogel. A property of a hydrogel may be a physical property of the hydrogel. Physical properties include, but are not limited to, shape, volume, texture, color, odor, density, solubility, temperature, and charge. As described above, the hydrogels described herein have a polynucleotide-based structural component (i.e., a nucleic acid molecule component). A hydrogel property is altered according the methods described herein, when a chemical bond within a nucleic acid molecule component of the hydrogel is broken, for example, by enzymatic cleavage (e.g., CRISPR-mediated cleavage).
[0102] Accordingly, in some embodiments, the method of altering a property of a hydrogel comprises contacting the hydrogel with a CRISPR component comprising at least one clustered regularly interspaced short palindromic repeats (CRISPR) protein and at least one guide RNA, wherein the polynucleotide sequence of at least one nucleic acid molecule component in the hydrogel is cleaved when contacted with the CRISPR component, thereby altering a property of the hydrogel.
[0103] A guide RNA of a CRISPR component may be a CRISPR RNA (crRNA), a trans-acting crRNA (tracrRNA), or a single guide RNA (sgRNA). A CRISPR component may comprise multiple guide RNAs comprising the same polynucleotide sequence. Alternatively or in addition, a CRISPR component may comprise multiple guide RNAs comprising different polynucleotide sequences. For example, in some embodiments a CRISPR component comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 200, at least 300, at least 400, or at least 500 different guide RNAs.
[0104] A guide RNA of a CRISPR component may comprise a spacer region that complements (i.e., comprises a polynucleotide sequence that complements) one or more nucleic acid molecule component of the hydrogel. In some embodiments, a spacer region of a guide RNA is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel. In some embodiments, a spacer region of a guide RNA comprises a polynucleotide sequence that is 100% complementary to a nucleic acid molecule component of the hydrogel.
[0105] Alternatively, a guide RNA of a CRISPR component may comprise a spacer region that complements (i.e., comprises a polynucleotide sequence that complements) a trigger molecule. As used herein, the term trigger molecule refers to a nucleic acid molecule that is not a structural component of a hydrogel and that, when cleaved my a CRISPR protein, increases the enzymatic activity of the CRISPR protein (e.g., single- and/or double-stranded endonuclease activity). A trigger molecule may increase one or more enzymatic activity of a CRISPR protein (e.g., single- and/or double-stranded endonuclease activity) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, at least 10000%, or at least 50000%. Methods of measuring the enzymatic activity of CRISPR proteins are known to those having skill in the art and are disclosed herein in Example 2.
[0106] In some embodiments, a spacer region of a guide RNA comprises a polynucleotide sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a polynucleotide sequence of a trigger molecule. In some embodiments, a spacer region of a guide RNA comprise a polynucleotide sequence that is 100% complementary to a polynucleotide sequence of a trigger molecule.
[0107] In some embodiments, the method further comprises contacting a CRISPR component with a trigger molecule. A trigger molecule may comprise a single-stranded region. A trigger molecule may comprise a double-stranded region. The length of a trigger molecule may vary. For example, a trigger molecule may be at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 75, at least 80, at least 85, at least 90, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, or at least 500 nucleotides in length.
[0108] Clustered regularly interspaced short palindromic repeats (CRISPR) proteins are a family of RNA-guided endonucleases. Various CRISPR proteins have been identified and characterized previously. Any CRISPR protein that can cut DNA/RNA may be utilized herein. A CRISPR protein may comprise RNA-guided dsDNA endonuclease activity. Alternatively or in addition, a CRISPR protein may comprise ssDNA endonuclease activity.
[0109] A CRISPR protein of a CRISPR component may comprise the amino acid sequence of Cas9, Cas12a, C2c1, C2c2, C2c3, or functional variants thereof. Examples of these CRISPR proteins (e.g., Cas9, Cas12a, C2c1, C2c2, C2c3) have been identified in various species.
[0110] The term functional variant includes polypeptides which are about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to a protein's native amino acid sequence (i.e., wild-type amino acid sequence) and which retain functionality.
[0111] The term functional variant also includes polypeptides which are shorter or longer than a protein's native amino acid sequence by about 5 amino acids, by about 10 amino acids, by about 15 amino acids, by about 20 amino acids, by about 30 amino acids, by about 40 amino acids, by about 50 amino acids, by about 75 amino acids, by about 100 amino acids or more and which retain functionality.
[0112] In the context of a CRISPR protein, the term retain functionality refers to a functional variant's ability to cleave a nucleic acid molecule at least about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, or more than 100% as efficiently as the respective non-variant (i.e., wild-type) protein. Methods of measuring the enzymatic activity of CRISPR proteins are known to those having skill in the art and are disclosed herein in Example 2.
Methods of Releasing a Property of Interest from a Hydrogel
[0113] In some aspects the disclosure relates to methods of releasing a product of interest from a hydrogel. In some embodiments, the method comprises altering a property of the hydrogel according to the methods described herein (e.g., Methods of Altering a Property of a Hydrogel), thereby releasing the product of interest from the hydrogel.
[0114] In some embodiments, the product of interest is a molecule that is anchored to the hydrogel. In some embodiments, the product of interest is encapsulated by the hydrogel.
[0115] In some embodiments, the product of interest is selected from the group consisting of a molecule, a nanoparticle, and a live cell.
Methods of Modulating the Flow of a Product of Interest Through a Hydrogel
[0116] In some aspects the disclosure relates to methods of modulating the flow of a product of interest through a hydrogel. In some embodiments, the method comprises altering a property of the hydrogel according to the methods described herein (e.g., Methods of Altering a Property of a Hydrogel), thereby modulating the flow of the product of interest through the hydrogel.
[0117] In some embodiments, the product of interest is an electric signal. In some embodiments, the electric signal is selected from the group consisting of voltage, impedance, capacitance, resistance and current.
[0118] In some embodiments, the product of interest is a solution. In some embodiments, the solution conducts an electric current.
[0119] In some embodiments, the method further comprises detecting the electric current/signal.
Compositions Comprising a Hydro Gel and a CRISPR Component
[0120] In some aspects the disclosure relates to compositions comprising a hydrogel and a CRISPR component.
[0121] In some embodiments, the composition comprises: (i) a hydrogel as described herein; and (ii) a CRISPR component comprising a guide RNA that complements a structural component of the hydrogel, wherein the composition lacks a CRISPR protein corresponding to the guide RNA. A CRISPR protein corresponds to a guide RNA, when it is capable of binding the guide RNA and mediating RNA-guided endonuclease activity. The composition may further comprise a triggering nucleic acid molecule.
[0122] In some embodiments, the composition comprises: (i) a hydrogel as described herein; and (ii) a CRISPR component comprising a CRISPR protein, wherein the composition lacks a guide RNA that complements a structural component of the hydrogel (i.e., the degree of complementation is insufficient to facilitate RNA-guided endonuclease activity of the CRISPR protein).
[0123] In some embodiments, the composition comprises: (i) a hydrogel as described herein; and (ii) a CRISPR component comprising a trigger molecule, wherein the composition lacks a guide RNA that complements the trigger molecule (i.e., the degree of complementation is insufficient to facilitate RNA-guided endonuclease activity of a CRISPR protein). In some embodiments, the composition further comprises a CRISPR protein.
[0124] In some embodiments, the composition comprises: (i) a hydrogel as described herein; and (ii) a CRISPR component comprising a guide RNA that complements a structural component of the hydrogel and a CRISPR protein, wherein the composition lacks a trigger molecule.
[0125] A guide RNA of a CRISPR component may be a CRISPR RNA (crRNA), a trans-acting crRNA (tracrRNA), or a single guide RNA (sgRNA). A CRISPR component may comprise multiple guide RNAs comprising the same polynucleotide sequence. Alternatively or in addition, a CRISPR component may comprise multiple guide RNAs comprising different polynucleotide sequences. For example, in some embodiments a CRISPR component comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 200, at least 300, at least 400, or at least 500 different guide RNAs.
[0126] A guide RNA of a CRISPR component may comprise a spacer region that complements (i.e., comprises a polynucleotide sequence that complements) one or more nucleic acid molecule component of the hydrogel. In some embodiments, a spacer region of a guide RNA is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a polynucleotide sequence of one or more nucleic acid molecule component of the hydrogel. In some embodiments, a spacer region of a guide RNA comprises a polynucleotide sequence that is 100% complementary to the nucleic acid molecule component of the hydrogel.
[0127] In some embodiments, a spacer region of a guide RNA is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a polynucleotide sequence of a trigger molecule. In some embodiments, a spacer region of a guide RNA comprises a polynucleotide sequence that is 100% complementary to a polynucleotide sequence of a trigger molecule.
[0128] A CRISPR component may comprise multiple trigger molecules comprising the same polynucleotide sequence. Alternatively or in addition, a CRISPR component may comprise multiple trigger molecules comprising different polynucleotide sequences. For example, in some embodiments a CRISPR component comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 200, at least 300, at least 400, or at least 500 different trigger molecules.
[0129] A trigger molecule may comprise a single stranded region. A trigger molecule may comprise a double stranded region. The length of a trigger molecule may vary. For example, a trigger molecule may be at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 75, at least 80, at least 85, at least 90, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, or at least 500 nucleotides in length.
[0130] A CRISPR protein of a CRISPR component may comprise the amino acid sequence of Cas9, Cas12a, C2c1, C2c3, C2c2, or functional variants thereof. Examples of these CRISPR proteins (i.e., Cas9, Cas12a, C2c1, C2c3, C2c2) have been identified in various species.
[0131] The term functional variant includes polypeptides which are about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to a protein's native amino acid sequence (i.e., wild-type amino acid sequence) and which retain functionality.
[0132] The term functional variant also includes polypeptides which are shorter or longer than a protein's native amino acid sequence by about 5 amino acids, by about 10 amino acids, by about 15 amino acids, by about 20 amino acids, by about 30 amino acids, by about 40 amino acids, by about 50 amino acids, by about 75 amino acids, by about 100 amino acids or more and which retain functionality.
[0133] In the context of a CRISPR protein, the term retain functionality refers to a functional variant's ability to cleave a nucleic acid molecule at least about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 100%, or more than 100% as efficiently as the respective non-variant (i.e., wild-type) protein. Methods of measuring the enzymatic activity of CRISPR proteins are known to those having skill in the art and are disclosed herein in Example 2.
CRISPR-Responsive Switches
[0134] In some aspects the disclosure relates to CRISPR-responsive switches. A CRISPR-responsive switch may comprise a composition as described above in Compositions Comprising a Hydrogel and a CRISPR Component.
[0135] In some embodiments, a CRISPR-responsive switch comprises: (i) a first compartment, wherein the first compartment comprises a composition comprising: (a) a hydrogel as described herein; and (b) a CRISPR component comprising a guide RNA, wherein the composition lacks a CRISPR protein corresponding to the guide RNA; and (ii) a second compartment, wherein the second compartment comprises a CRISPR protein corresponding to the guide RNA of (i)(b).
[0136] In some embodiments, a CRISPR-responsive switch comprises: (i) a first compartment, wherein the first compartment comprises a composition comprising: (a) a hydrogel as described herein; and (b) a CRISPR protein, wherein the composition lacks a guide RNA that complements a structural component of the hydrogel of (i)(a); and (ii) a second compartment, wherein the second compartment comprises a guide RNA that complements a structural component of the hydrogel of (i)(a).
[0137] In some embodiments, a CRISPR-responsive switch comprises: (i) a first compartment, wherein the first compartment comprises a composition comprising: (a) a hydrogel as described herein; and (b) a CRISPR component comprising a trigger molecule, wherein the composition lacks a guide RNA that complements the trigger molecule; (ii) a second compartment, wherein the second compartment comprises a guide RNA that complements the trigger molecule of (i)(b).
[0138] In some embodiments, a CRISPR-responsive switch comprises: (i) a first compartment, wherein the first compartment comprises a composition comprising: (a) a hydrogel as described herein; and (b) a CRISPR component comprising a guide RNA and a CRISPR protein, wherein the composition lacks a trigger molecule; (ii) a second compartment, wherein the second compartment comprises the trigger molecule of (i)(b).
[0139] In some embodiments, in the OFF state, the components of the first compartment are not in contact with the components of the second compartment; and wherein, in the ON state, the components of the first compartment are in contact with the components of the second compartment.
[0140] In some embodiments, turning the switch from OFF to ON releases a product of interest from the hydrogel. In some embodiments, turning the switch from OFF to ON alters the flow of a product of interest through the hydrogel.
[0141] In some embodiments, the product of interest is selected from the group consisting of a molecule, a nanoparticle, and a live cell. In some embodiments, the product of interest is selected from the group consisting of an electric signal and a solution.
[0142] In some aspects, the disclosure relates to devices comprising a CRISPR-responsive switch as described above.
EXAMPLES
Example 1. Programmable CRISPR-Responsive Smart Materials
[0143] Stimuli-responsive hydrogels activated by biological signals play an increasingly important role in biotechnology applications. Here, the programmability and specificity of CRISPR-associated nucleases is exploited to fabricate programmable DNA-based smart hydrogels (CRISPR-gels) that modulate their multiscale properties in response to specific DNA inputs. Four applications of CRISPR-gels are reported: (i) branched polyethylene glycol-based hydrogels for release of DNA-anchored compounds; (ii) polyacrylamide-DNA degradable hydrogels that release encapsulated molecules, nanoparticles, and live cells; (iii) conductive carbon black-DNA hydrogels that act as degradable electrical fuses; and (iv) a tunable polyacrylamide-DNA hydrogel crosslinking system operating as a fluidic valve with electrical readout for RFID remote signaling. These new functionalities of DNA-responsive smart materials will allow for a diverse range of novel applications in cell therapy, tissue engineering, drug delivery, bio-electronics, and nucleic acid diagnostics.
Example 2. Characterization of Cas12a Enzymatic Activity
[0144] Cas12a, a deoxyribonuclease (DNase) that can be programmed with CRISPR guide RNAs (crRNAs), was selected for its ability to sense specific DNA sequences and subsequently generate broad catalytic responses. A Cas12a ortholog from Lachnospiraceae bacterium ND2006 (LbaCas12a) (1, 2) that displays two activities: specific cleavage of dsDNA fragments matching the crRNA sequence (cis-cleavage) and subsequent indiscriminate ssDNA cleavage (trans-cleavage) was exploited. Once the Cas12a-crRNA complex binds and cleaves its dsDNA target, trans-cleavage of nearby ssDNA is multiple-turnover at a rate of 1250 s1 with a high catalytic efficiency (kcat/Km)1.7109 s1M1 (2). crRNAs were developed to detect specific fragments of the mecA antibiotic-resistance gene of methicillin-resistant Staphylococcus aureus (MRSA), as a clinically relevant model to demonstrate the target programmability of CRISPRgels.
[0145] The trans-cleavage activity of Cas12a-crRNA in solution was validated by incubating the LbaCas12a with crRNA, a MRSA-specific dsDNA trigger, and a quenched fluorescently labeled ssDNA as the reporter. All tested MRSA crRNA and dsDNA trigger pairs showed comparable performances (
Example 3. Polyethylene Glycol-Based DNA Hydrogels and Uses Thereof
[0146] Programmable, biocompatible materials capable of the controlled release of soluble compounds, as well as encapsulated cells, have broad utility in various therapeutic and research applications (14-17). To model specific, orthogonal small molecule release from CRISPR-gels, poly(ethylene glycol) (PEG)-based DNA hydrogels were fabricated with dsDNA anchors (
Example 4. Polyacrylamide-Based DNA Hydrogels and Uses Thereof
[0147] Recognizing the potential to utilize Cas12a trans-cleavage to modulate properties of DNA-based materials at a larger scale, polyacrylamide-DNA hydrogels were designed next (9). Two non-complementary methacryl-modified oligonucleotides were separately conjugated into polyacrylamide (PA) chains (Ps-X and Ps-Y) (
[0148] The triggered release of nanoparticles (NPs) was tested by encapsulating 18-nm PEG-coated gold NPs (
Example 5. Carbon Black-Based DNA Hydrogels and Uses Thereof
[0149] For the third CRISPR-gel design, the degradation of a conductive DNA-based hydrogel was sought to be modulated to act as an electrical fuse capable of changing conductivity upon exposure to a specific DNA trigger (
[0150] To test this system, CB-DNA droplets were spotted onto silver printed 50 m-gap interdigitated electrodes (IDEs) and lyophilized (
[0151] Before Cas12a-mediated degradation, lyophilized CB-DNA hydrogels showed high conductivity (4 mS/cm), comparable to that reported for graphene-DNA gels of similar compositions (22). After initial electrical testing, IDEs spotted with CB-DNA hydrogels were incubated in Cas12acrRNA solutions containing dsDNA triggers or scrambled dsDNA. Samples incubated in increasing concentrations of specific dsDNA triggers showed higher degradation and higher resistivity than controls incubated with nonspecific scrambled dsDNA (
Example 6. DNA Hydrogel Switches and Uses Thereof
[0152] To demonstrate the use of CRISPR-gels in biological sensors, a tunable PA-DNA hydrogel was used to control the permeability and electrical readout of a paper-based microfluidic device (
[0153] The paper layers of the device were folded in an accordion arrangement to create a three-dimensional, multilayered structure where the hydrophilic regions are topologically aligned. Capillary-driven fluid movement through the device terminated in a fifth and final layer where the output was measured (
[0154] In the presence of a specific dsDNA trigger, colored dye in the channel confirmed that the hydrogel did not form; that is, the ssDNA cross-linker had been degraded by Cas12a during the pre-incubation step. In contrast, when nonspecific dsDNA trigger was present during preincubation, ssDNA cross-linkers were not cleaved, allowing for hydrogel assembly in the microchannel (
[0155] Visual readouts of buffer flow are commonly used, yet they are difficult to couple to downstream hardware for data processing and transmission. To overcome this limitation, the CRISPR-actuated fluidic system was modified to read buffer flow directly as an electric signal (
[0156] The electrical conductivity was directly correlated to the buffer penetration length in the PAD channel: as expected, the evolution of signal across time in the presence of dsDNA activated Cas12a could be described by a Washburn equation (
[0157] To demonstrate the feasibility of interfacing CRISPR-Cas reactions with larger electronic systems through hydrogel actuation, a wireless radio-frequency identification (RFID) module was incorporated into the CRISPR-gel PAD (
Example 7. Discussion
[0158] Taken together, several strategies to interface biological signals with materials that combine the inherent programmability of CRISPR-associated enzymes with simple hydrogel designs were demonstrated. These strategies offer control over a variety of complex behaviors and properties, including the release of small molecules, nanoparticles, and live cells, as well as bulk hydrogel degradation, electronic signal transduction, and microfluidic valve actuation. By exploiting the enzymatic properties of Cas12a, novel formulations that substantively improve on existing hydrogel capabilities were designed. This includes increasing programmability, as well as providing new forms of output for these platforms. These new capabilities of CRISPR-responsive materials are expected to enhance existing biomaterial-based approaches for cell therapy (32, 33), drug delivery (14), regenerative medicine (5), molecular diagnostics, and novel bio-electronic interfaces with programmable readouts.
Example 8. Materials and Methods for Examples 1-7
[0159] In Vitro Cas12a Reagent Validation with ssDNA
[0160] Trans-degradation of non-target ssDNA upon Cas12a activation was measured in solution by mixing trigger dsDNA with Cas12a-crRNA complex and using a quenched, fluorescently labeled reporter. Cas12a-crRNA complex was assembled by incubating 200 nM Cas12a with 250 nM crRNA in 1NEB 2.1 buffer at 37 C. for 10 min. The reaction initiated upon mixing the Cas12a complexes with dsDNA triggers and ssDNA-quenched, fluorescently labeled reporter (FQ reporter) to a final concentration of 50 nM Cas12a: 62.5 nM crRNA: 750 nM FQ reporter and dsDNA triggers in NEB 2.1 buffer. Reactions (3 l, 384-well microplate) were incubated in a fluorescence plate reader (Biotek NEO HTS) for 120 minutes at 37 C. Fluorescence readings were recorded every 2 min (Ex: 485 nm; Em: 535 nm).
Synthesis of Gelatin-PEG Gels and Controlled Release Experiments
[0161] N-hydroxysuccinimide (NHS)-activated 8-arm PEG (40 kDa, NOF Corporation) were dissolved at 5% w/v in PBS. The solution was mixed with DNA duplexes with 5 overhangs (one amine-terminated strand, the other FAM-terminated, IDT) to yield a solution of 4% PEG, 12 M DNA, which was incubated for 30 min at room temperature to allow the reaction of amines with NHS. Then, equal volumes of this solution were mixed with a warm gelatin (bovine, type B alkali-treated, Sigma) solution at 1% w/v in PBS; 50 L volumes of this gel precursor were transferred on the side of clear-bottom tissue-culture wells and the cross-linking reaction was allowed to occur on ice for 1 h, then at room temperature for 1 h. The gels were finally incubated in Tris reaction buffer (1NEB 2.1) for 1 h at room temperature to block unreacted NHS moieties and remove most unbound DNA molecules. Digestion by Cas12a was performed overnight at 37 C. in 500 L 1NEB 2.1 buffer, with 50 nM Cas12a, 200 nM crRNA, and 400 nM of the trigger or scrambled dsDNA. Fluorescence was measured in a plate reader as described for the DNA-polyacrylamide gels (Ex: 485 nm; Em: 525 nm); data were smoothened with a first-order Savitzky-Golay filter.
Sequence-Specific Release of dsDNA-Anchored Molecules Using Cis-Cleavage Activity
[0162] Both N-hydroxysuccinimide (NHS)-activated 8-arm PEG (40 kDa, NOF Corporation) and amine-activated 8-arm PEG (20 kDa, JenKem) were dissolved at 8% w/v in water. Each pair of oligonucleotides was pre-hybridized functionalized with 5-amine groups or 5-fluorophores, to a final concentration of 50 M dsDNA for each duplex. To form functionalized hydrogels, the dsDNA probes were first incubated with NHS-PEG: 1 volume of each 50 M dsDNA solution was added to 4 volumes of 125 mM triethanolamine buffer (pH 7); this solution was then mixed with 3 volumes of PEG-NHS stock. The solution was incubated for 15 min at room temperature to graft DNA molecules on the PEG through NHS-amine reactions. Finally, hydrogel polymerization was started by adding one volume of PEH-Amine stock; 10 L volumes of gel precursor were immediately pipetted into 0.2 mL microtubes and the reaction was allowed to complete in the dark at room temperature overnight. To remove TAE buffer and unbound DNA, the gels were pre-incubated at 37 C. in excess of 1NEB 2.1 buffer for 24 h, replacing the buffer after 8 and 20 h. At the end of the incubation, the equilibrated supernatant was stored and the volume of gels (after swelling) were estimated based on their weight and the density of water; the gels were covered with an equivalent volume of equilibrated buffer supplemented with 2 M Cas12a enzyme and a 4 excess of crRNA specific to one of the two dsDNA anchors. The reaction was incubated overnight at 37 C., after which the amount of each fluorophore released in the supernatant was estimated by measuring the fluorescence in aliquots (wavelengths were chosen to minimize spectral overlaps: for FAM, Ex: 485 nm/Em: 520 nm; and for HEX, Ex: 530 nm/Em: 560 nm) and comparing to dilution standards.
Synthesis of Carbon Black-DNA Gels
[0163] Aqueous suspensions of carbon black according to a modified version of the protocol by Parant et al. were prepared (34). A stock of 1.5 wt % Arabic gum (Sigma, CAS: 9000-01-5) was prepared by dissolving for 2 h in water at 80 C. 8 wt % acetylene black particles (>99.9%, Alfa Aesar, AA3972430) were then added and resuspended by ultrasonication for 15 minutes (Fisher Scientific FB505 Sonic Dismembrator). Carbon black-DNA hydrogels were prepared according to the protocol described by Xu et al. (35), but an 8 wt % carbon black suspension in place of the reduced graphene oxide was used. Briefly, the 8 wt % carbon black (with 1.5 wt % Arabic gum) was mixed in a 1:1 ratio with a solution of 20 mg/ml salmon sperm DNA (Sigma, CAS: 438545-06-3). The mixture was heated to 90 C. with shaking at 1400 rpm for 10 min, before depositing 1-3 L via pipette onto inkjet-printed, interdigitated silver electrodes (IDEs). After 5 sec (before significant evaporation could occur), the gel-coated electrodes were submerged in liquid nitrogen and lyophilized for 18-24 h in a benchtop freeze-dryer (Labconco, USA).
Conductivity Measurements of Carbon Black-DNA Gels
[0164] To estimate the conductivity of the lyophilized carbon black-DNA gels, samples were prepared on inkjet-printed silver electrodes with an adhesive silicone isolator as a mold. The gels were cast with a length of 2.00 mm, width of 2.00 mm, and height above substrate of 1.00 mm. They were cast such that they spanned a 0.43 mm gap between two printed silver electrodes, and lyophilized in the molds for 24 h. An ohmmeter (Fluke, USA) was used to measure the resistance reading between the silver electrodes spanned by the gel. The two-contact probe method described by Sun et al. (36) was used to calculate the conductivity using the cross-sectional area of the gel and the distance between the probes (Eq. 1), where L is the separation distance (0.43 mm), w is the width (2.00 mm) and t is the height (1.00 mm). By measuring the conductivity of 10 samples, a mean value of 4.20.8 mS/cm was obtained:
In Vitro Reaction of Cas12a with Carbon Black-DNA Gels
[0165] To measure the detachment of lyophilized carbon black-DNA gels from a surface, gels were deposited on flexible, inkjet-printed silver electrodes. After lyophilization of the gels for 18 h, the electrodes were placed individually in the bottom of 1.5 ml Eppendorf tubes and then submerged in 75 uL of the Cas12a reaction mix to ensure the gels were completely covered. The aqueous Cas12a reaction mix contained 1NEB 2.1 buffer, 0.75 M Ca12a, 1.3 M gRNA and varying concentrations of the dsDNA trigger (0.05, 0.1, 0.5 and 1.0 M). A control reaction mix was also prepared that contained 1.0 M of a scrambled trigger dsDNA sequence. The lyophilized gels were incubated in the Cas12a reaction mixtures at 37 C. for 21 h, with six replicates for each dsDNA trigger concentration (including the control). At 30-min intervals, the Eppendorf tubes were shaken for 10 sec at 800 rpm. After shaking, the silver electrodes were visually inspected and the complete detachment of any gels from the substrate recorded. This experiment was then repeated an additional two times. For the first repeat, dsDNA concentrations of 1.0 and 0.5 M were used as well as a 1.0 M scrambled dsDNA control (n=6 for each condition); after 10 h, the reaction was stopped, dried the electrodes in air, and took a resistance measurement. using a multimeter (Model 179, Fluke, USA). For the second repeat, dsDNA concentrations of 0.1 and 0.05 M were used, as well as a 1.0 M scrambled dsDNA control (n=6 for each condition); after 21 h, the reaction was stopped, the electrodes were dried in air, and a resistance measurement was taken.
Synthesis of Acrylamide-DNA Gel Precursors
[0166] Acrylamide-DNA hydrogels were produced using a modified version of a previously described method (37). HPLC-purified single-stranded oligos (Oligo-X and Oligo-Y, described below) functionalized with a methacryl group at their 5-end were resuspended in water to a final concentration of 3 mM. Linker oligos without functionalization (L0, L5, and L15, described below) were also resuspended in water to a final concentration of 3 mM. A 10 concentrated stock of the reaction buffer was prepared from Bio-Rad 50TAE buffer supplemented with magnesium acetate (125 mM) such that the final concentrations in the reaction were 1TAE and 12.5 mM Mg.sup.2+. Fresh aqueous solutions of 20 v/v % N,N,N,N-tetramethylethane-1,2-diamine (TEMED, Millipore Sigma, USA) and 2 wt % ammonium persulfate (APS, Millipore Sigma, USA) were prepared before each reaction.
Production of Oligo Functionalized Acrylamide Polymers Ps-X and Ps-Y
[0167] Separate reactions of between 50-400 L were prepared for each oligo X and Y in 1.5 mL Eppendorf tubes (final concentration in brackets). Methacryl-functionalized oligos (1 mM), TAE/Mg2+ buffer (1) and 40% acrylamide (4%) were mixed in water at room temperature, vortexed briefly to mix, and de-gassed under vacuum for 15 min. APS (0.05 wt %) was then added, the tube was inverted to mix, and the contents were collected by spinning down briefly. TEMED (0.5 v/v %) was then added and the mixing repeated. The reactions were allowed to proceed under vacuum at room temperature for 20 min. Incorporation of DNA oligos into the polymer strands was confirmed by agarose gel electrophoresis. To confirm incorporation of ssDNA into the polyacrylamide backbone, the pre- and post-reaction mixtures were run on an agarose gel (
Bulk Gelation of Polyacrylamide (PA)-DNA with ssDNA Linker
[0168] Polymer crosslinking can be achieved by mixing a 1:1:0.6 volume ratio of polymer X (PA-DNA-X), polymer Y (PA-DNA-Y) and ssDNA linker (3 mM), respectively, under room temperature conditions, which should produce a reasonably fluid mix. X-Y Polymer solution should be thoroughly mixed and deposited on the desired substrate (e.g., paper) at room temperature. Embedder substrate can be lyophilized or air-dried under ambient conditions for 30 min. Gel crosslinking is triggered by addition of ssDNA linker to X-Y Polymer at room temperature in less than 1 min.
Bulk Degradation of Polyacrylamide-DNA Gels
[0169] 15 L gel mixtures were prepared by combining (in order): Ps-X & -Y (4.6 L), 10NEB 2.1 buffer (0.75 L), 2.5 mg/ml FITC-Dextran (500 kDa, 0.75 L), Cas12a reaction master mix (0.75 L), 100 M trigger or scrambled dsDNA (0.75 l) and 3 mM linker DNA (L-15, 2.8 L). The Cas12a master mix was prepared on ice and consisted of NEB LbaCas12a (10 M) and an MRSA crRNA (15 M) in 1NEB 2.1 buffer. The final concentrations of the reagents in the 15 L gels were as follows: 0.5 M Cas12a, 0.75 M MRSA crRNA, 0.125 mg/ml FITC-Dextran, 5 M trigger or scrambled DNA. To enable gelation, the mixtures were heated in 1.5 ml Eppendorf tubes to 37 C. for 10 min and then cooled to room temperature, and then at 4 C. for 5 min. After gelation, a supernatant consisting of 750 L of 1NEB 2.1 buffer was added. The final concentrations of the reagents in the wells were as follows: 9.8 nM Cas12a, 14.7 nM MRSA crRNA, 2.45 g/ml FITC-Dextran, 98.0 nM trigger or scrambled DNA. The reaction tubes were incubated at 37 C. for 18 h, inverted once, and imaged under UV light (Ex: 385 nm; Em: 525 nm) using a G:Box gel imager (Syngene USA). Results are shown in
Gold Nanoparticle Synthesis and PEG Functionalization
[0170] Gold NPs were synthesized by reducing chloroauric acid (HAuC14, Sigma) with sodium citrate (Sigma), following the Turkevich method (38). Briefly, 1 ml of a 6.8 mM sodium citrate solution was added to 50 ml of 0.25 mM gold (III) chloride, while the gold chloride solution was boiling. Samples were stirred and heated for 15 min during which the gold crystals formed. Nanoparticles were left to cool down to room temperature while stirring continued. 0.33 ml of 2 mM, 5 kDa thiol-terminated poly(ethylene glycol) methyl ether (mPEG, Nanocs, USA) was added to the synthesized NPs and allowed to conjugate overnight to thoroughly coat the gold surfaces. NP characterization after synthesis was performed by assessing optical absorption. Spectra of the NPs were obtained on a Cary 300 UV-Vis (Agilent Technologies, USA). Morphology of the NPs was characterized with a FEI Tecnai G2 TEM at 120 kV. ImageJ was used to process the images and measure the dimensions of the NPs. A Zetasizer Nano Zen3600 (Malvern Instruments, UK) was used to measure the hydrodynamic diameter (DH) and the zeta potential (0 of the NPs.
Gold Nanoparticle Release from Acrylamide Gels
[0171] 15 L gel mixtures were prepared by combining (in order): Ps-X & -Y (4.6 L), 10NEB 2.1 buffer (0.75 L), 555 nM PEG-stabilized AuNPs (0.75 L), Cas12a reaction master mix (0.75 L), 100 M trigger or scrambled dsDNA (0.75 l) and 3 mM linker DNA (L-15, 2.8 L). The Cas12a master mix was prepared on ice and consisted of NEB LbaCas12a (10 M) and an MRSA crRNA (15 M) in NEB 2.1 buffer. The final concentrations of the reagents in the 15 L gels were as follows: 0.5 M Cas12a, 0.75 M MRSA crRNA, 27.75 nM PEG-AuNPs, 5 M trigger or scrambled DNA. 2.52.0 mm Press-to-Seal silicone isolators (ThermoFisher Scientific, USA) were cut into single units and attached to the bottom of individual wells in a 24-well tissue culture plate, adjacent to the edge of the wells. The gel mixtures were heated to 37 C. for 10 min and mixed with a pipette tip before being deposited into the isolators in the 24-well plate. The plate was then moved to 4 C. for 15 min to set the gels, and 750 L of 1NEB 2.1 buffer added to each well as a supernatant. The final concentrations of the reagents in the wells were as follows: 9.8 nM Cas12a, 14.7 nM MRSA crRNA, 0.54 nM PEG-AuNPs, 98.0 nM trigger or scrambled DNA. Absorbance readings (520 nm) from the 24-well plate were measured every 5 min for 16 h in a plate reader at 37 C.; data was smoothened with a first-order Savitzky-Golay filter.
Cell Encapsulation and Release from DNA Polyacrylamide Gels
[0172] All cell encapsulation and release tests were conducted with K562 cells (American Type Culture Collection, Manassas Va.), expanded in RPMI 1640+GlutaMAX Medium (Thermo Fisher Scientific, Waltham, Mass.) supplemented with 10% fetal bovine serum. Cell viability was assessed with calcein-AM and ethidium homodimer-1 (Invitrogen) or Trypan Blue exclusion (Beckman Coulter). Cell encapsulation and viability imaging were performed with a Nikon E800 upright microscope for single-shot bright-field and fluorescence acquisition, and with a Zeiss TIRF/LSM 710 confocal microscope for 3D slice rendering.
Fabrication of CRISPR-Gel Pad Stop Flow System with Electrical Readout
[0173] Paper PADs were fabricated according to a modified version of the protocol published by Wei, X. et al. (39), using a double-sided wax printing pattern. The top and bottom PAD wax layers were designed using Illustrator CC (Adobe Inc. San Jose, Calif.), and printed on Whatman Grade 1 chromatographic filter paper (Thermo Fisher Scientific, Waltham, Mass.) using a Xerox Phaser 8560 printer. Printed PAD sheets were wax reflowed through hot pressing for 15 sec at 125 C. using a Cricut EasyPress (Cricut Inc., Fork, Utah), and then cooled to room temperature. Individual PADs were then cut and folded as shown in
Flow and Conductivity Measurements in Pad
[0174] At the time of testing, layer 2 of the PADs was filled with 0.3 L of ssDNA linker (100 M) pre-incubated for 4 hrs at 37 C. in a cutting solution containing Cas12a (300 nM), MRSA crRNA (1 M), dsDNA MRSA Trigger (0 nM, 0.4 nM, 2 nM, 10 nM, 50 nM) and NEB Buffer 2.1 (1). Positive controls to validate enzyme activity during Cas12a-mediated cleavage were performed in parallel reactions and contained Cas12a (300 nM), MRSA crRNA (1 M), dsDNA MRSA Trigger (0 nM, 0.4 nM, 2 nM, 10 nM, 50 nM) and NEB Buffer 2.1 (1), as well as 750 nM ssDNA quenched fluorescently labeled reporter. The products of these reactions are not used in PAD measurements. However, the fluorescence readings were used as a proxy to estimate the cleavage yield of the ssDNA bridge upon Cas12a activation (
RFID Integration in CRISPR-Mediated Stop Flow Pad
[0175] A CRISPR-active RFID sensor was constructed by modifying a 1070 mm flexible WRL-14147 ultrahigh-frequency (UHF) RFID tag (SparkFun Electronics Inc., Niwot, Colo.) with a flexible interdigitated electrode capable of short-circuiting the tag antenna in the presence of conductive buffer at the fourth layer of the previously described PAD. The flexible interdigitated electrode was fabricated using a silver nanoparticle ink pattern (
DNA and RNA Sequences
[0176] For this study, all DNA oligonucleotides were obtained from Integrated DNA Technologies. Cas12a crRNA was produced by in vitro transcription using an HiScribe T7 transcription kit (NEB) and oligonucleotide templates; gRNAs were subsequently purified using an RNA Clean & Concentrator kit (Zymo Research).
[0177] The guide had the following sequence:
TABLE-US-00002 (SEQIDNO:1) 5GGGUAAUUUCUACUAAGUGUAGAUUUAAAGAAGAUGGUAUGUGG3.
[0178] dsDNA triggers were ordered pre-hybridized and had the following sequences:
[0179] Matching Trigger dsDNA:
TABLE-US-00003 (SEQIDNO:2) 5TTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATT3.
[0180] Scrambled dsDNA sequence (obtained by randomly rearranging the sequence of the dsDNA trigger, while preserving length and overall GC content):
TABLE-US-00004 (SEQIDNO:3) 5TAGTAGTGATTATGTTAGATAGTGAATAGGTTTAATGTAT3.
[0181] Single-Mismatch dsDNA Trigger:
TABLE-US-00005 (SEQIDNO:4) 5TTTAATTTTGTTAAAGAAGATGTTATGTGGAAGTTAGATT3.
[0182] Three-Mismatch dsDNA Trigger:
TABLE-US-00006 (SEQIDNO:5) 5TTTAATTTTGTTAAATAAGATGTTATGTAGAAGTTAGATT3.
[0183] The quenched fluorescently-labeled reporter for Cas12a cleavage experiments in solution: 5(6FAM)TTATT(Iowa Black FQ)3
[0184] For Cas12a-mediated release from PEG-based hydrogels, the following oligonucleotides were used:
[0185] For ssDNA Degradation-Mediated Release:
TABLE-US-00007 (SEQIDNO:6) 5(C6Amine)AGCTTGTCTGCCATGGACATGCAGACTATACTGTTATT GTTGTACAGACCGAATTCCC3. (SEQIDNO:7) 5(6FAM)AGGGAATTCGGTCTGTACAACAATAAC3.
[0186] For dsDNA Degradation-Mediated Release:
TABLE-US-00008 (SEQIDNO:8) 5(C6Amine)TTTAATTTTGTTAAAGAAGATGGTATGTGGACGTATGG AATAAGTG; (SEQIDNO:9) 5(6FAM)TCACTTATTCCATACGTCCACATACCATCTTCTTTAACAAA ATTAA; And: (SEQIDNO:10) 5(C6Amine)TTATTATTTACAACGTCGTGACTGGGAAAACCCTTGGA ATAAGTG; (SEQIDNO:11) 5(HEX)TCACTTATTCCAAGGGTTTTCCCAGTCACGACGTTGTAAATA ATA.
[0187] Oligonucleotides used for the fabrication of polyacrylamide-DNA gels:
TABLE-US-00009 Oligo-X: (SEQIDNO:12) 5(Acrydite)TTATTCTTGTCTCCCGAGAT3; Oligo-Y: (SEQIDNO:13) 5(Acrydite)TTATTTCACAGATGAGTATC3; L0: (SEQIDNO:14) GATACTCATCTGTGAATCTCGGGAGACAAG; L5: (SEQIDNO:15) GATACTCATCTGTGATTATTATCTCGGGAGACAAG; L15: (SEQIDNO:16) GATACTCATCTGTGATTATTTTATTTTATTATCTCGGGAGACAAG.
Example 9. Introduction
[0188] Microbial clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) adaptive immune systems contain RNA-guided endonucleases capable of multiple-turnover nucleic acid hydrolysis (1, 2). Due to their specificity and programmability CRISPR-Cas enzymes have been exploited as efficient genome editing tools (3) and more recently in nucleic acid diagnostic applications such as SHERLOCK (4, 5) and DETECTR (2).
[0189] Biologically responsive materials are important for biotechnology applications, including the fabrication of scaffolds for tissue engineering (6), the actuation of microfluidic valves (7), and the detection of analytes in sensors (8, 9). DNA-responsive hydrogels are well suited to interface with synthetic DNA constructs or naturally occurring extracellular DNA (10). Current DNA-responsive hydrogels typically rely on strand-displacement or structural changes in DNA cross-linkers (11, 12), which require high concentrations of DNA triggers for actuation. Adapting such DNA-hydrogels for activation with new trigger sequences involves the modification of nucleic acid components which can conflict with the structural requirements (e.g., length, secondary structure) imposed by the material. This limits the programmability of these systems, and highlights the need for a strategy that uncouples structural and sensing constraints in DNA-based materials.
[0190] As described herein, CRISPR-associated enzymes were used to control the properties of hydrogels with integrated DNA components at multiple scales and in a modular fashion. The need to encode target sequence specificity into the gel structure is, thus, eliminated. The material platform is able to induce changes in hydrogels in response to user-defined target nucleic acid sequences by replacing a single componenta CRISPR guide RNA (gRNA) that governs sequence-specific Cas activation. Different DNA-based materials were engineered to demonstrate a variety of nuclease-mediated responses including the release of small molecules, enzymes, nanoparticles (NPs) and live cells, as well as the modulation of bulk electrical and permeability properties of DNA-hydrogels for sensing and diagnostics (
Example 10. Cas12a has Both Targeted and Collateral DNase Activities
[0191] The Cas12a from Lachnospiraceae bacterium ND2006 (LbaCas12a) (1, 2) was used that displays two activities: a specific cleavage activity towards double-stranded DNA (dsDNA) fragments matching the gRNA spacer sequence (targeted cleavage) and a subsequent indiscriminate single-stranded DNA (ssDNA) hydrolysis activity (collateral cleavage) (
[0192] Validation of the collateral cleavage activity of Cas12a-gRNA in solution was first performed. Cleavage of a ssDNA reporter containing a quenched fluorophore by Cas12a in response to mecA dsDNA triggers confirmed the performance of the MRSA1 gRNA (
[0193] Programmable materials capable of the controlled release of soluble compounds, as well as encapsulated cells, have broad utility in various therapeutic and research applications (14-17). Due to the diversity of DNA-based hydrogels in the literature (TABLE 1), material formulations were selected that span a wide range of physical properties to demonstrate that they could be actuated by Cas proteins (TABLE 2): (1) poly(ethylene glycol) (PEG) hydrogels with covalently bound nonstructural DNA pendants that are released by Cas12a nuclease activity without degrading the overall hydrogel structure; (2) acrylamide hydrogels with structural ssDNA cross-links that could be cleaved by Cas12a resulting in bulk gel degradation, as well as particle or cell release; and (3) conductive hydrogels loaded with carbon black that were cleaved from the surface of electrodes by Cas12a, thus behaving like an electronic fuse.
TABLE-US-00010 TABLE 1 Examples of DNA hydrogels in the literature. Actuation Publication Material mechanism Readout Sensitivity Timescale Application 53 DNA- Hg2+ Electrochemistry 0.042 pM 120 minutes electrochemical acrylamide dependent for impedance hydrogel DNAzyme hybridization biosensor chain for detection reaction of Hg2+ 54 DNA-only Thermal Sol-gel 1.5 U/l 48 hour Thermal and hydrogel control transition BamHI/EcoRI digestion enzymatic from Enzymatic responsive scaffold degradation materials and linker 55 DNA-metal Magnetic Remote- 45 U 48 hour Degradable, nanoparticle field controlled EcoRI digestion magnetically hydrogel Enzymatic gel 52N 48 hour controllable from degradation movement magnet exposure material scaffold Sol-gel to magnet and linker transition 56 DNA- Enzymatic Oligonucleotide 10 U/l 10 hour Release of acrylamide cleavage & release BamHI/EcoRI digestion tethered hydrogel triggered using anti-HIV release electrophoresis deoxyribozyme 57 DNA-only Triggered gel Gel is a signal 3.5 fM 120 minute Electrochemical hydrogel formation blocker for PDGF (10 incubation detection of electrochemical fM-10 nM time PDGF readout linear range) 58 DNA and DNA strand- Release in FITC- DNA: 56 TCEP: 82% Sequence- disulfide displacement dextran from M release in specific cross- and chemical hydrogels TCEP: ~60 10 hours, DNA linked reduction Rheological mM 95% in triggered acrylamide (TCEP) measurements 149 hours release from hydrogels DNA: 43% hydrogels release in 10 hours, 70% in 149 hours 59 DNA- Toehold Interferometry Trigger ~1.5 hour Bioresponsive acrylamide/ strand measurement ssDNA: 20 incubation materials bis- displacement of gel M acrylamide swelling hydrogel 60 Polyacrylamide Enzymatic Microscopy 5 U/L 30 minute Sequence- functionalized degradation detection of BamHI incubation specific with DNA, capture and release of hybridized release of CCRF-CEM to a DNA live cells and Ramos aptamer cells from a gel surface 49 DNA-PEG Enzymatic Fluorescence 0.03 U/uL 9 hour Enzymatic hydrogel degradation microscopy DNase I digestion responsive and quartz materials crystal microbalance analysis 39 DNA- Small- Stopped-flow Cocaine: 6 minutes Low-cost, acrylamide molecule and microfluidic 50 M paper-based hydrogel metal-ion device with Adenosine: sensor for aptamers colorimetric 100 M small cross linking readout Pb2+: 200 molecules aDNA- nM and metal acrylamide (simultaneously) ions hydrogel 7 DNA-only Gel formation Colorimetric ssDNA: 15-30 minute Low-cost hydrogel on readout 0.019 pM incubation fluidic from RCA hybridization of flow (Dengue, sensor for of pathogen using dye MERS, detection of ssDNA and Ebola, Zika pathogen initiation of sequence) ssDNA RCA results in blockage of a fluidic channel
TABLE-US-00011 TABLE 2 Summary of materials. PEG Gel DNA-Carbon PA Gel Anchored- PA Gel Black Gel uPAD molecule AuNP PA Gel Bulk PAEncapsulated Degradation On Flow-Based Release Release Degradation Cell Release Electrodes Detection LOD 80 pM In-gel: 3.3 M 200 nM 200 nM 500 nM 400 pM Total: 40 nM Unamplified, (includes 11 aM Pre- supernatant) Amplified Payload/ Small Nanoparticles Small Live Cells Conductivity Conductivity Signal Type Molecule, Molecule (Human, Change Change, Protein (Bound to Primary) Visual Gel) Change in Dye Flow Trigger Supernatant Gel (pre- Supernatant Supernatant Supernatant Diagnostic location loaded) sample Cas12a- Supernatant Gel (pre- Supernatant Supernatant Supernatant Pre- gRNA loaded) incubation location mix Time to 50% 1.5 Hours 5 Hours 1 Hour <1 Hour 5 Hours N/A Change/ (fluorophore Signal release) Sample-to- 10 min N/A N/A N/A N/A 4 h decision time reaction + incubation + 5 min 1 min read colorimetric detection (HRP release) Conductive? Non- Non- Non- Non- Conductive Conductive conductive conductive conductive conductive (dry) buffer flow Gel Cross- Anchor Cross-linker Cross-linker Cross-linker Gel Cross-linker linker Degradation Degradation Degradation Degradation detachment Degradation Degradation vs Anchor Degradation Material Simple Moderate Moderate Moderate Simple Moderate Synthesis (Additional Complexity Wash Steps) PA: polyacrylamide.
Example 11. Collateral Cas12a Activity Releases ssDNA-Anchored Cargos from Hydrogel Matrices
[0194] The targeted dsDNA cleavage activity of Cas12a can be used to preferentially release anchored cargos with near-single turnover (
[0195] To demonstrate that changes to the gRNA were sufficient to entirely reprogram the target responsiveness of the material, gRNAs were designed to target a panel of genes involved in S. aureus antibiotic-resistance mechanisms (
[0196] For many applications, the rate at which a molecule is delivered from a carrier conveys important biological information (14). It was found that the speed of CRISPR-mediated hydrogel actuation corresponds to the amount of input dsDNA (
[0197] In addition to controlling global dynamics of ssDNA cleavage through bulk material properties, the sequence-defined, addressable nature of the ssDNA linkers and the collateral cleavage activity of Cas12a for ssDNA over dsDNA was capitalized upon. (1, 2).
[0198] Two orthogonal reporter molecules (Cy3 and 6-carboxyfluorescein fluorophores) were attached into PEG hydrogels with distinct ssDNA linkers. The differential sensitivity of one linker was then pre-programmed over the other to Cas12a collateral degradation by hybridizing it with a complementary blocking strand in situ. While the release of the unprotected fluorophore was unaffected, the speed of release of the hybridized reporter was significantly reduced (
Example 12. Collateral Cas12a Activity Alters the Large-Scale Mechanical Properties of DNA Hydrogels
[0199] The high catalytic efficiency of dsDNA-activated Cas12a-gRNA (k.sub.cat/K.sub.m1.710.sup.9 s.sup.1M.sup.1) (2) makes it well-suited for converting dsDNA signals into bulk material changes. To demonstrate this, DNA cross-linked polyacrylamide (PA) hydrogels (9, 47) were designed by separately incorporating two non-complementary oligonucleotides into polyacrylamide chains (
[0200] The Cas12a-induced degradation of PA-based CRISPR-gels was initially evaluated with a DNA-intercalating dye to label bridge sequences in PA-DNA gels and track gel integrity. The bridges were degraded upon exposure to gRNA-Cas12a and trigger dsDNA, as revealed by the dissipation of gel fluorescence at rates dependent on trigger concentration (
[0201] Programmable degradation of PA-DNA hydrogels was assessed by testing 25 combinations of different gRNAs and dsDNA triggers. Consistent with the non-destructive cargo release experiments (
[0202] Though biomolecules can be tethered to materials through well-defined, single linkers, physical entrapment in a polymer matrix represents a more general strategy to control the release of larger payloads. The dsDNA-triggered, Cas12-mediated release of nanoparticles was tested by encapsulating 18-nm PEG-coated gold NPs (AuNPs) (
[0203] The complex interactions between cells and surrounding materials have implications for tissue engineering and other therapeutic applications. It was reasoned that if Cas12a-gRNA would have the capacity to modify the extracellular matrix of cells encapsulated in DNA materials in response to pre-defined cues. The reversible encapsulation of human primary peripheral blood mononuclear (PBMC) cells in PA-DNA hydrogels was tested by exposing the gels to activated gRNA-Cas12a. Complete gel degradation and cell release were observed within 2 hours in the presence of 1 M dsDNA trigger (
Example 13. Conductive DNA-Based Materials Act as Cas12a-Actuated Electronic Fuses
[0204] Cas12a was used to modulate the attachment of a conductive DNA-based hydrogel to an electrode surface to act as an electrical fuse triggered by specific DNA sequences (
[0205] It was hypothesized that cleavage of the ssDNA at the electrode-material interface by Cas12a would disrupt the conductive path. To test this system, CB-DNA droplets were spotted onto printed interdigitated silver electrodes and lyophilized (
Example 14. Cas12a-Controlled Hydrogel Formation in a Paper Fluidic Device Enables Diagnostic Readouts
[0206] A tunable PA-DNA hydrogel was used to control the permeability and electrical readout of a paper-based microfluidic device (
[0207] The layers of the device were folded to create a multilayered structure in which the hydrophilic regions are topologically aligned. Capillary-driven flow through the device terminated in a fifth layer where the output was measured (
[0208] When nonspecific dsDNA trigger is present during pre-incubation, ssDNA cross-linkers are not cleaved, allowing for hydrogel assembly in the microchannel (
[0209] To optimize the CRISPR-PAD for field diagnostic applications, reverse transcription (RT) was used to expand the range of detectable biomarkers to RNA, and coupled the RT to an isothermal amplification (RPA) step to improve the limit of detection. RT-RPA followed by a PAD readout was used to detect synthetic Ebola genomic RNA (52) down to 11 aM (
[0210] Visual readouts of buffer flow are commonly used, yet they are difficult to couple to downstream hardware for data processing. To overcome this limitation, the CRISPR-actuated fluidic system was modified to read buffer flow as an electric signal (
[0211] The wireless, decentralized logging of individual clinical tests during infectious disease outbreaks could address challenges with record keeping and logistics. To integrate CRISPR-Cas reactions with electronic monitoring systems through hydrogel actuation, a wireless radio-frequency identification (RFID) module was incorporated into the PAD. The original design was modified such that buffer flow would short-circuit an interdigitated silver electrode, thereby modulating the efficiency of signal transmission by a flexible RFID tag (
[0212] An experimenter-blinded trial was then conducted consisting of twelve samples (containing either 11 aM or 0 aM Ebola ssRNA amplified by RT-RPA) divided across three geographic locations (
TABLE-US-00012 TABLE 3 Comparison of diagnostic technologies. CRISPR- Toehold uPAD-CRISPR qPCR NGS MA/FB FISH chip switches SD materials Cost High High High High Mid Low Low Low Ease of Spec Spec Spec Spec Spec Simple Simple Simple Use Readout Fluor Fluor Fluor Fluor Spec Visual/ Visual/ Digital and/or Fluor Fluor Visual Sensitivity atto atto atto atto Femto femto atto atto Time ~3 Hour days 1 day 4-16 h 15 min 1-4 Hour ~1-3 Hour ~1-4 Hour (read) Multiplex Yes Yes Yes Yes No Yes Yes Yes Quant. Yes Yes Yes yes Limited Limited Limited Yes (for visual output) NGS: Next Generation Sequencing; MA: microarray; FB: fluorescent barcodes; FISH; fluorescence in situ hybridization; SD: Sherlock detector; spec: specialist; fluor: fluorescent; atto: attomolar; femto; femtomolar
Example 15. Discussion
[0213] Taken together, these studies demonstrated several strategies to interface biological signals with materials that combine the inherent programmability of CRISPR-associated enzymes with hydrogel systems. These strategies offer control over a variety of complex behaviors and properties, including the release of molecules, nanoparticles, and live cells, as well as bulk hydrogel degradation, electronic signal transduction, and microfluidic valve actuation. By exploiting the enzymatic properties of Cas12a, a platform has been designed that improves upon hydrogel programmability and versatility as only the gRNA molecule needs to be changed to allow hydrogel response to a user-defined DNA sequence. The catalytic activity of Cas12a improves sensitivity compared to DNA-responsive hydrogels requiring stoichiometric amounts of DNA triggers for material activation. Finally, these studies demonstrate various forms of output that expand the capabilities of CRISPR-responsive materials and enhance existing biomaterial-based approaches for tissue engineering, molecular diagnostics, and bioelectronic interfaces with programmable readouts.
Example 16. Materials and Methods for Examples 9-15
[0214] In Vitro Cas12a Reagent Validation with ssDNA
[0215] Collateral degradation of non-target ssDNA upon Cas12a was measured in solution by mixing trigger dsDNA with Cas12a-gRNA complex and using a quenched, fluorescently labeled reporter. The Cas12a-gRNA complex was assembled by incubating 200 nM Cas12a with 250 nM gRNA in 1NEB 2.1 buffer at 37 C. for 10 min. To initiate the reaction, the Cas12a complexes were mixed with dsDNA triggers and a quenched, ssDNA fluorescently labeled reporter (FQ reporter: 5(6FAM)-TTATT-(Iowa Black FQ)3) to final concentrations of 50 nM Cas12a, 62.5 nM gRNA, 750 nM FQ reporter and dsDNA triggers in NEB 2.1 buffer. Reactions (3 l, 384-well microplate) were incubated in a fluorescence plate reader (Biotek NEO HTS) for 120 min at 37 C. Fluorescence readings were recorded every 2 min (Ex: 485 nm; Em: 535 nm).
Synthesis and Digestion of PEG Hydrogels with Reporter DNA (General Method for
[0216] With the exception of explicitly mentioned protocol variations, DNA-decorated PEG hydrogels were produced as follows:
[0217] a. DNA-Thiol Reduction.
[0218] 0.5 l of tris(2-carboxyethyl)phosphine (TCEP, 0.5M solution, pH7, Millipore Sigma) was mixed with 10 l of double-functionalized reporter oligonucleotides (5-C6-Thiol,3-Cy3 oligos, custom-synthesized, HPLC purified, Integrated DNA Technologies) resuspended at 500 M in water. The solution was then incubated for 3.5 h in the dark at room temperature to reduce the disulfide groups on the DNA.
[0219] b. DNA Grafting on PEG Precursors.
[0220] A fresh stock of 8-arm vinyl sulfone-activated PEG (PEG-VS, MW10 kDa, JenKem Technology) was prepared by resuspending aliquots of PEG-VS powder at 4% w/v (assuming a PEG density of 1.1) in 1 M triethanolamine (pH 8). 125 l of PEG-VS stock was added to the reduced DNA solution and incubated in the dark at room temperature for about 18 h, to allow the base-catalyzed Michael addition of thiols on the vinyl sulfones. A large amount of PEG reactive ends (800-fold relative to DNA thiols) were included to capture the majority of DNA molecules and guarantee the availability of extra vinyl sulfone moieties in the subsequent polymerization step.
[0221] c. Hydrogel Polymerization.
[0222] A fresh stock of 4-arm thiol-activated PEG (PEG-SH, MW10 kDa, JenKem Technology) was prepared by resuspending aliquots of PEG-SH powder at 4% w/v (assuming a PEG density of 1.1) in water. On ice, 125 l of PEG-SH stock was added to the DNA/PEG-VS solution and 239.5 l of water to reach a volume of 500 l. The final gel contained 2% w/v PEG (1% w/v of each precursor), had a cross-linking density of 4 mM and harbored 10 M immobilized ssDNA. The gel precursor remained liquid for several minutes, during which individual 5 l hydrogels were cast either in microtubes or non-treated, clear flat bottom 96-well plates. The containers were sealed, and the gels were allowed to polymerize for 1 h at room temperature.
[0223] d. Hydrogel Washing and Swelling.
[0224] After polymerization, the gels were washed three times to eliminate unbound precursors and polymerization buffer; these steps also allowed the swelling of hydrogels to their equilibrium volume. Washing steps lasted at least 4 h each, and were performed in an excess (>30-fold relative to gel precursor volume) of washing buffer (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl.sub.2, pH 8) at 37 C.
[0225] e. In-Gel Cleavage of ssDNA Anchors.
[0226] Unless mentioned otherwise, PEG cargo release assays were performed as follows: 50 nM of Cas12a was mixed with a two-fold excess of the appropriate guide RNA and 50 nM of dsDNA trigger or scrambled sequence. The reactions were assembled in NEBuffer 2.1 (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl.sub.2, 100 g/ml BSA, pH 7.9). For quantitative experiments, a 20-fold volume excess of reaction mix was used relative to hydrogel pre-swelling volume; e.g., 100 l of reaction mix was added on top of 5 l gels. All digestions were performed at 37 C. with periodic shaking (1 s/min). The progression of ssDNA cutting in the gels was observed on a plate reader (M5 SpectraMax, Molecular Devices) by continuously measuring fluorescence accumulation in the supernatant, caused by the release of the DNA-bound Cy3 dye. Wavelengths (Ex.554/Em.625) maximizing the signal-to-noise ratio of the fluorophore were used. The data was normalized versus complete (100%) cleavage, defined by measuring fluorescence in a solution of fluorophore-bound oligonucleotides, diluted so as to match the expected molarity of anchors in the buffer+gel system, assuming perfect functionalization and release. First-order Savitzky-Golay filters were applied to correct for measurement noise.
Spike-in Experiments in PEG Gels (FIG. 17C)
[0227] To test the dynamic response of Cy3-DNA-decorated gels upon activation of Cas12a, followed the basic gel synthesis and Cas12a-mediated degradation protocols, with small variations. Larger gels (20 l on the sides of 48-well TCPS plates) overlaid with 250 l of supernatant were used. During the experiment, reaction buffer was initially introduced without enzymes or nucleic acids. At time point t=1 h, a concentrated (200) solution of primed enzyme (10 M Cas12a, 15 M gRNA in 1NEB 2.1 NEB 2.1 buffer) was spiked in, and the response of the system was monitored.
Grafting and Release of Horseradish Peroxidase (HRP) on PEG Gels (FIG. 17D)
[0228] 3 l PEG hydrogels were synthesized in microtubes following the method described above, with smaller final concentrations of PEG (1.5% w/v, as described below for
[0229] Digestion of the gels was then done using Cas12a; the hydrogels were overlaid with 20 l of pre-warmed reaction mix (10 nM Cas12a, 20 nM gRNA, 10 nM trigger or scrambled dsDNA in 1NEBuffer 2.1) and incubated the gels at 37 C. with gentle rocking. At each time point, the supernatant was pipetted out, which was stored at 4 C. until the end of the experiment. After the last sampling, 10 l of each supernatant was pipetted into 40 l of TMB substrate solution dispensed in a 96-well plate, incubated the reaction at 37 C. with shaking for 10 min and blocked the reaction with 50 l of 1M H.sub.2SO.sub.4. Relative enzymatic activity was quantified in the supernatant by measuring absorbance (=450 nm).
[0230] When testing for the ability to discriminate between trigger and scrambled sequences, a 100 nM stock of Cas12a, gRNA and dsDNA (1:2:1 molar ratio) was diluted to the appropriate desired concentrations and used 50 l of supernatant on the DNA-HRP decorated gels, which was incubated for 3 h at 37 C. before testing for enzymatic activity in the supernatant by incubation with TMB substrate and absorbance monitoring at 650 nm.
Input dsDNA Sequence Specificity of Cas12a-Mediated Cleavage in PEG Hydrogels (
[0231] All the cross-reactivity tests were performed on 5 l PEG gels (2% w/v) synthesized as described above in a 96-well plate, using the same digestion protocol: all enzymes and dsDNA fragments were introduced at 50 nM with a two-fold molar excess of gRNA, and reactions were monitored by fluorimetry for 12 h.
Measuring PEG-DNA Cutting Kinetics for Various Amounts of dsDNA Input (
[0232] The experiment was performed as described above, with successive 5-fold dilutions of dsDNA trigger while maintaining constant the molarity of enzyme and guide (50 nM and 100 nM, respectively).
Modulation of Cas12a Activity Through Alterations of PEG Gel Physical Properties (FIG. 17G)
[0233] The following changes were made to the general PEG hydrogel synthesis strategy: only half of the usual volume of PEG-VS stock at 4% (w/v) was added for reaction with the reduced DNA; at the end of the grafting reaction, another half-volume of PEG-VS diluted in 1 M triethanolamine (stock concentration: 2, 2.4, 2.8, 3.2, 3.6 and 4%) was added, thereby decreasing the final PEG-VS concentration by up to 25% while maintaining the DNA concentration constant. A full volume of PEG-SH stock diluted accordingly (stock concentrations: 3, 3.2, 3.4, 3.6, 3.8 and 4%, respectively) was then added, and the volume was adjusted with water before casting the gels in a 96-well plate; the resulting hydrogels had concentrations ranging from 1.5 to 2%. The gels were then washed and digested following the usual procedure described above.
Hybridization-Mediated Protection Against Cas12a Cutting in PEG Gels (FIG. 17H)
[0234] Protection assays were performed in 1.5% (w/v) PEG gels harboring 2.5 M of reporter oligonucleotides functionalized on the gel-distal end with 6-carboxyfluorescein (6-FAM). After casting, swelling and washing the DNA-decorated hydrogels, they were incubated in wash buffer supplemented with oligonucleotides complementary to the 6-FAM anchors, or containing an identical amount of non-matching DNA as a control. Three orders of magnitude of anchor to free oligos ratios were tested; for instance, 5 l hydrogels with 2.5 M of immobilized reporter DNA were covered with 50 L of complementary or non-complementary oligonucleotides at 250 nM in buffer solution. Hydrogels were incubated at 37 C. overnight (16 h) with the DNA solutions for hybridization, then washed (32 h) with wash buffer without DNA to remove unbound oligonucleotides. Cas12a sensitivity was assayed following the general method outlined above.
Synthesis of NHS-Amine PEG Gels and dsDNA Cis-Cleavage Experiments (S4)
[0235] N-hydroxysuccinimide (NHS)-activated 8-arm PEG (40 kDa, NOF Corporation) and amine-activated 8-arm PEG (20 kDa, JenKem) were dissolved at 8% w/v in water. Each pair of oligonucleotides functionalized with 5-amine groups or 5-fluorophores (6-FAM and 6-HEX) was pre-hybridized, to a final concentration of 50 M dsDNA for each duplex. To form double-functionalized hydrogels, the dsDNA probes were first incubated with NHS-PEG: 1 volume of each 50 M dsDNA solution was added to 4 volumes of 125 mM triethanolamine buffer (pH 7); this solution was mixed with 3 volumes of PEG-NHS stock. The solution was incubated for 15 min at room temperature to graft DNA molecules on the PEG through NHS-amine reactions. Finally, hydrogel polymerization was started by adding one volume of PEG-Amine stock; 10 L volumes of gel precursor were immediately pipetted into 0.2 ml microtubes and let the reaction complete in the dark at room temperature overnight. To remove buffer and unbound DNA, the gels were pre-incubated at 37 C. in excess of 1NEBuffer 2.1, washing 3 times over the course of 24 h. At the end of the incubation, the equilibrated supernatant was stored, and the volume of gels was estimated (after swelling) based on their weight and the density of water; the gels were covered with an equivalent volume of equilibrated buffer supplemented with 2 M Cas12a enzyme and a 4-fold excess of gRNA specific to none or one of the two dsDNA anchors. The reaction was incubated overnight at 37 C., after which the amount of each fluorophore released in the supernatant was estimated by measuring the fluorescence in aliquots (FAM, Ex: 485 nm/Em: 520 nm; HEX, Ex: 530 nm/Em: 560 nm) and comparing to dilution standards.
Synthesis of Carbon Black-DNA Gels (FIGS. 19A-19D)
[0236] Aqueous suspensions of carbon black were prepared according to a modified version of the protocol by Parant et al. (18). A stock of 1.5% (w/v) Arabic gum (Sigma, CAS: 9000-01-5) was prepared by dissolving for 2 h in water at 80 C. 8% (w/v) acetylene black particles (>99.9%, Alfa Aesar, AA3972430) were then added and resuspended by ultrasonication for 15 min (Fisher Scientific FB505 Sonic Dismembrator). Carbon black-DNA hydrogels were prepared according to the protocol described by Xu et al. (22), but 8% (w/v) carbon black suspension was used in place of the reduced graphene oxide. Briefly, the 8% (w/v) carbon black (with 1.5% (w/v) Arabic gum) in a 1:1 ratio was mixed with a solution of 20 mg/ml salmon sperm DNA (Sigma, CAS: 438545-06-3). The mixture was heated to 90 C. with shaking at 1400 rpm for 5 min, before depositing 1-3 L via pipette onto inkjet-printed, interdigitated silver electrodes (IDEs). After 5 sec (before significant evaporation could occur), the gel-coated electrodes were submerged in liquid nitrogen and lyophilized them for 18-24 h in a benchtop freeze-dryer (Labconco, USA). The flexible interdigitated electrode were fabricated using a silver nanoparticle ink pattern deposited over a polyethylene terephthalate NanoBenefit 3G Series film (Mitsubishi Imaging MPM Inc., Rye, N.Y.) using a previously reported conductive inkjet printing method (40).
Conductivity Measurements of Carbon Black-DNA Gels (FIGS. 19A-19D)
[0237] To estimate the conductivity of the lyophilized carbon black-DNA gels, samples were prepared on inkjet-printed silver electrodes with an adhesive silicone isolator as a mold. The gels were cast with a length of 2.00 mm, width of 2.00 mm, and height above substrate of 1.00 mm such that they spanned a 0.43 mm gap between two printed silver electrodes, and lyophilized the gels in the molds for 24 h. A multimeter (Fluke, USA) was used to measure the resistance reading between the silver electrodes spanned by the gel. Specifically, the two-contact probe method described by Sun et al. (36) was used to calculate the conductivity using the cross-sectional area of the gel and the distance between the probes (Eq. 1), where L is the separation distance (0.43 mm), w is the width (2.00 mm) and t is the height (1.00 mm). By measuring the conductivity of 10 samples, a mean value of 4.20.8 mS/cm was obtained:
In Vitro Reaction of Cas12a with Carbon Black-DNA Gels (
[0238] To measure the detachment of lyophilized carbon black-DNA gels from a surface, gels were deposited on flexible, inkjet-printed silver electrodes. After lyophilization of the gels for 18 h, resistance was measured using a multimeter (Model 179, Fluke, USA) and any electrodes with a reading >1 k were excluded as defective before assigning the electrodes to the test groups. Electrodes were then placed individually in the bottom of 1.5 ml Eppendorf tubes and then submerged in 75 l of the Cas12a reaction mix to ensure the gels were completely covered. The aqueous Cas12a reaction mix contained 1NEB 2.1 buffer, 0.75 M Ca12a, 1.3 M gRNA and varying concentrations of the dsDNA trigger (0.05, 0.1, 0.5 and 1.0 M). The control reaction mixes contained 1 M of a scrambled trigger dsDNA sequence and 0 M dsDNA (Cas12a-gRNA only control). The lyophilized gels were incubated in the Cas12a reaction mixtures at 37 C. for 24 h, with five replicates for each dsDNA trigger concentration (including the control). At 1 h intervals, the Eppendorf tubes were shaken for 10 sec at 800 rpm. After shaking, the silver electrodes were visually inspected, and the complete detachment of any gels from the substrate was recorded. Upon detachment of a gel, the corresponding electrode was removed from the reaction and allowed it to dry. Images of the electrode were recorded with a Leica MZ10 F microscope (brightfield mode, 100 ms exposure, gain=2.0, saturation=1.0) and resistance was measured with a multimeter. At the 24 h time point, all remaining electrodes were removed from the reactions, and recorded images and resistance measurements as above. Finally, the area of the gels remaining on the electrodes was manually quantified (in pixels) relative to the area of the electrode itself using ImageJ version 1.52a.
[0239] This experiment was then repeated an additional two times, with the modification that all electrodes were removed from the reaction at a single, set time point (10 h and 21 h, respectively). For the first repeat, dsDNA trigger concentrations of 1.0 and 0.5 M as well as a 1.0 M scrambled dsDNA control (n=6 for each condition) were used; after 10 h, the reaction was stopped, the electrodes were dried in air, and resistance was measured using a multimeter (Model 179, Fluke, USA). For the second repeat, dsDNA trigger concentrations of 0.1 and 0.05 M were used, as well as a 1.0 M scrambled dsDNA control (n=6 for each condition); after 21 h, the reaction was stopped, the electrodes were dried in air, and resistance was measured.
In Vitro Reaction of Carbon Black-DNA Gels with Mung Bean Nuclease (MBN) (SI)
[0240] PET/Ag Electrodes with carbon black-DNA gels were prepared as above and initial resistance measurements taken using a multimeter (Model 179, Fluke, USA). The electrodes were placed in 1.5 ml Eppendorf tubes and submerged in 75 ul of reaction mix. Reactions (n=10 for each condition) were prepared containing 0.2 U/l MBN (NEB), 0.2 U/l heat-inactivated MBN (HI MBN), and no MBN all in 1 Mung Bean Nuclease buffer (NEB). The HI MBN was produced by incubating a 1 ml solution of 0.2 U/l MBN in 1MBN buffer at 95 C. for 2 h before allowing it to cool to room temperature before the experiment. The lyophilized carbon black-DNA gels were incubated in the reaction mixtures at 30 C. for 2 h, at which point all the electrodes were removed and allowed to dry. Images were recorded of each electrode with a Leica MZ10 F microscope (100 ms exposure, gain=2.0, saturation=1.0) and took resistance measurements with a multimeter.
Synthesis of Acrylamide-DNA Gel Precursors (FIGS. 18A-18E and FIGS. 20A-20E)
[0241] Acrylamide-DNA hydrogels were produced using a modified version of a previously described method (37). HPLC-purified single-stranded oligos (Oligo-X and Oligo-Y, described below) functionalized with a methacryl group at their 5-end (IDT) were resuspended in water to a final concentration of 3 mM. Linker oligos (IDT) without functionalization (L15, described below) were also resuspended in water to a final concentration of 3 mM. A 10 concentrated stock of the reaction buffer from Bio-Rad 50TAE buffer supplemented with magnesium acetate (125 mM) was prepared such that the final concentrations in the reaction were 1TAE and 12.5 mM Mg.sup.2+. Fresh aqueous solutions of 20 v/v % N,N,N,N-tetramethylethane-1,2-diamine (TEMED, Millipore Sigma, USA) and 2% (w/v) ammonium persulfate (APS, Millipore Sigma, USA) were prepared before each reaction.
Production of Oligo Functionalized Acrylamide Polymers Ps-X and Ps-Y (FIGS. 18A-18E and FIGS. 20A-20E)
[0242] Separate reactions of between 50-400 L were prepared for each oligo X and Y in 1.5 mL Eppendorf tubes (final concentration in brackets). Methacryl-functionalized oligos (1 mM), TAE/Mg.sup.2+ buffer (1) and 40% acrylamide (4%) were mixed in water at room temperature and vortexed briefly to mix, and the reactions were de-gassed under vacuum for 15 min. APS (0.05% (w/v)) was then added, the tube was inverted to mix, and the contents were collected by spinning down briefly. TEMED (0.5 v/v %) was then added and the mixing repeated. The reactions were allowed to proceed under vacuum at room temperature for 20 min. Incorporation of DNA oligos into the polymer strands was confirmed by agarose gel electrophoresis. To confirm incorporation of ssDNA into the polyacrylamide backbone, the pre- and post-reaction mixtures were run on an agarose gel (
Bulk Degradation of Polyacrylamide-DNA Gels Using FITC-Dextran Microparticles (FIGS. 18A-18E)
[0243] 10 L gel mixtures were prepared in 1.5 ml Eppendorf tubes by combining (in order): 4% or 7% Ps-X & -Y (3.00 l), 10NEB 2.1 buffer (0.67 l), 2.5 mg/ml FITC-Dextran (500 kDa, 1.00 l), Cas12a reaction master mix (1.00 l), 100 M trigger or scrambled dsDNA (0.33 l) and 3 mM linker DNA (L-15, 1.0 l). The Cas12a master mix was prepared on ice and consisted of NEB LbaCas12a (10 M) and an MRSA gRNA (15 M) in 1NEB 2.1 buffer. The final concentrations of the reagents in the 10 L gels were as follows: 1.0 M Cas12a, 1.5 M MRSA gRNA, 0.25 mg/ml FITC-Dextran, 3.3 M trigger or scrambled DNA. To enable gelation, the mixtures were incubated at room temperature for 20 min. After gelation, a supernatant consisting of 850 L of 1NEB 2.1 buffer was added. The final concentrations of the reagents in the wells were as follows: 11.6 nM Cas12a, 17.4 nM MRSA gRNA, 2.90 g/ml FITC-Dextran, 38.4 nM trigger or scrambled DNA. The reaction tubes were incubated at 37 C. for 20 h. Every 4 h, the tubes were inverted once, and imaged under UV light (Ex: 385 nm; Em: 525 nm) using a G:Box gel imager (Syngene USA). Results are shown in
Gold Nanoparticle Synthesis and PEG Functionalization (FIGS. 18A-18E)
[0244] Gold NPs (AuNPs) were produced by reducing chloroauric acid (HAuC14, Sigma) with sodium citrate (Sigma), following the Turkevich method (39). Briefly, 1 ml of a 6.8 mM sodium citrate solution was added to 50 ml of 0.25 mM gold (III) chloride, while the gold chloride solution was boiling. The samples were stirred and heated for 15 min during which the gold crystals formed. Nanoparticles were left to cool down to room temperature while stirring continued. To functionalize the AuNPs with PEG, 0.33 ml of 2 mM, 5 kDa thiol-terminated poly(ethylene glycol) methyl ether (mPEG, Nanocs, USA) was added to the synthesized AuNPs. AuNP characterization was performed after synthesis by assessing optical absorption. Spectra of the AuNPs was obtained on a Cary 300 UV-Vis (Agilent Technologies, USA). The morphology of the AuNPs was characterized with a FEI Tecnai G2 TEM at 120 kV. ImageJ was used to process the images and measure the dimensions of the AuNPs. Finally, a Zetasizer Nano Zen3600 (Malvern Instruments, UK) was used to measure the hydrodynamic diameter (D.sub.H) and the zeta potential (0 of the NPs.
Gold Nanoparticle Release from Acrylamide Gels (
[0245] 9 l gel mixtures were prepared in PCR tubes by combining (in order): 4% or 7% Ps-X & -Y (3.00 l), 10NEB 2.1 buffer (0.67 l), 5 M PEG-AuNPs (1.00 l), Cas12a reaction master mix (1.00 l), and 100 M trigger or scrambled dsDNA (0.33 l). The Cas12a master mix was prepared on ice and consisted of NEB LbaCas12a (10 M) and an MRSA gRNA (15 M) in 1NEB 2.1 buffer. The final concentrations of the reagents in the 10 l gels were as follows: 1.0 M Cas12a, 1.5 M MRSA gRNA, 0.5 M PEG-AuNPs, and 3.3 M trigger or scrambled DNA. Press-to-Seal silicone isolators (round, 2.0 mm diameter, 1.7 mm depth, ThermoFisher Scientific, USA) were cut into single units and attached to the center of the bottom of individual wells in a 24-well tissue culture plate. The 9 l gel mixtures were pipetted into the silicone isolators, and 3 mM linker DNA (L-15, 1.0 l) was then added. The mixtures were stirred briefly with a pipette tip and then incubated at room temperature for 20 min. After gelation, a supernatant was added consisting of 850 L of 1NEB 2.1 buffer to each well. The final concentrations of the reagents in the wells were as follows: 11.6 nM Cas12a, 17.4 nM MRSA gRNA, 5.81 nM PEG-AuNPs, 38.4 nM trigger or scrambled DNA. We then transferred the 24-well plate to a plate reader and recorded absorbance readings (520 nm) from the center of the 24-well plate (i.e. through the gel itself,
Preparation of Polyacrylamide-DNA Gels for Bulk Degradation Using EVAGREEN and Cell Release (FIGS. 18A-18E)
[0246] A pre-gel stock was prepared with a 1:1:0.6 ratio of Ps-X, Ps-Y and 10 M bridge and incubated to cross-link for 10 min. An Amicon 10 kDa spin filter was used to centrifuge and resuspend the pre-gel stock to remove free acrylamide monomers. Washing and spin filtering were performed two additional times prior to EVAGREEN bulk degradation or cell release. A nanodrop was used to normalize the concentration of the final pre-gel stock mix to 1.8 mg/ml of ssDNA.
Gelation of Polyacrylamide (PA)-DNA with EVAGREEN for Bulk Hydrogel Degradation (
[0247] 150 l gel mixtures were prepared by combining 1000 of the pre-gel stock mix at 1.8 mg/ml ssDNA with 5 l of 3 mM bridge, 15 l of 10NEB 2.1 solution, 7.5 l of 20 EVAGREEN and 22.5 l of PBS. The mixture was kept at 37 C. to minimize cross-linking while the gels were spotted on a 384-well plate. The 1 l gels were dropped at the bottom of the 384-well plate and allowed to cross-link for 20 min. For gel-degradation experiments, 20 l of a solution containing 1 M Cas12a, 1.5 M gRNA and dsDNA trigger (5 M, 2 M, 1 M, 0.2 l) was added on top of the PA-DNA hydrogels, and EVAGREEN fluorescence was recorded on a Synergy Neo at 37 C. (Ex: 490 nm, Em: 535 nm).
Primary Cells for DNA Polyacrylamide Gel Release (FIGS. 18A-18E)
[0248] Cell release experiments were performed using primary peripheral blood mononuclear cells (PBMCs). Mobilized peripheral blood and leukapheresis product were anonymously collected from donors undergoing stem cell mobilization at the Massachusetts General Hospital (MGH) under Institutional Review Board approved protocol #2015P001859. The mononuclear cells were purified via Histopaque 1077 gradient (Sigma, 10771). PBMCs were expanded in RPMI 1640+GlutaMAX Medium (Thermo Fisher Scientific, Waltham, Mass.) supplemented with 10% fetal bovine serum and 2 ng/ml recombinant IL-2. The cell suspension was prepared by spinning down the cell culture at 300 g for 5 min and resuspending cells at 10.sup.7 cells/ml.
Gelation of Polyacrylamide (PA)-DNA with Encapsulated Cells (
[0249] 30 l of washed pre-gel stock was combined with 30 l of cell-bridge mixture containing 270 M bridge, 30 M fluorescently labeled bridge, 210.sup.6 cells and 30 mM MgCl.sub.2 in 1PBS. The solution was mixed until gelling appeared homogeneous and the pipette flow became highly viscous. Hydrogel droplets (2 ul) were deposited at the center of each well in a sterile 96-well plate with flat clear bottom, and incubated at 37 C. for 2 min. After droplet incubation, 100 ul of RPMI was added with 10% FBS (R10) or OMEM media with 10% FBS and 10 mM MgCl.sub.2 (O10+MgCl2) with Cas degradation reagents gently from the side of the well to avoid pressure driven hydrogel dislodgement. In the representative cell-encapsulation image of
Cell Release from DNA-Polyacrylamide Gel and Viability Analysis (
[0250] The hydrogels were incubated with encapsulated PMBCs at 37 C. with 100 l Cas12a solutions containing 0.5 M Cas12a, 1 M gRNA, 0.1NEB buffer 2.1, scrambled dsDNA at 5 or trigger dsDNA at 5 M, 1 M, and 0.2 M. Negative controls contained RPMI media with 10% FBS, as well as OMEM media with 10% FBS and 10 mM MgCl.sub.2. Gel degradation started upon addition of the Cas solution, and hydrogels were monitored to assess degradation kinetics (
[0251] After Cas-mediated hydrogel degradation and PBMC release, cell viability was assessed using ethidium homodimer-1 (Invitrogen) and calcein blue-AM (
[0252] The cell-encapsulation and cell-release imaging was performed using an EVOS FL digital inverted imaging system with four-color fluorescence and transmitted-light capabilities. Images of PA-DNA hydrogel macroscopic morphology were acquired before and after Cas degradation using an EVOS FL digital inverted microscope set for GFP fluorescence (excitation=470 nm, emission=525 nm) using a 4 magnification objective, 30% LED illumination intensity and 50% contrast. After gel degradation we acquired images of released PBMCs from PA-DNA hydrogels using an EVOS FL digital inverted microscope with a 20 objective. Imaging of live cells was performed using DAPI mode (excitation=360 nm, emission=447 nm) with 40% LED illumination intensity and 90% contrast. Dead cells were imaged using the RFP mode (excitation=530 nm, emission=593 nm) with 50% LED illumination intensity and 90% contrast. GFP channel was also acquired at this magnification to assess degraded gel bulk. Live, dead and degraded gel bulk images were merged using the EVOS FL color overlay mode. Representative images of this process are shown in
Cell Viability in Cas12a Reaction Conditions (FIG. 42)
[0253] Viability was assessed after 24 h incubation at 37 C. by staining cells with calcein-AM and ethidium homodimer-1 (Invitrogen, Eugene, Oreg.). Cells were incubated in the following conditions: R10 media (RPMI with 10% FBS), O10 test media containing OMEM media, 10% FBS and 10 mM MgCl.sub.2, and O10 test media with 0.5 M Cas12a, 1 M gRNA, 0.1NEBuffer 2.1 and 1 M scrambled or trigger dsDNA.
Fabrication of CRISPR-Gel Pad Stop Flow System with Electrical Readout (
[0254] Paper PADs were fabricated according to a modified version of the protocol published by Wei, X. et al. (29), using a double-sided wax printing pattern. Top and bottom PAD wax layers were designed using Illustrator CC v23.0.4 (Adobe Inc. San Jose, Calif.) and printed on Whatman Grade 1 chromatographic filter paper (Thermo Fisher Scientific, Waltham, Mass.) using a Xerox Phaser 8560 printer. Printed PAD sheets were wax reflowed through hot pressing for 15 sec at 125 C. using a Cricut EasyPress (Cricut Inc., Fork, Utah), and then cooled to room temperature. Individual PADs were cut and folded as shown in
Flow and Conductivity Measurements in Pad (FIGS. 20A-20E, FIGS. 44A-44B, and FIG. 46)
[0255] At the time of testing, layer 2 of the PADs was filled with 0.3 l of ssDNA linker (100 M) that had been pre-incubated for 4 h at 37 C. in a cutting solution containing 300 nM Cas12a, 1 M MRSA gRNA, and dsDNA MRSA Trigger (at concentrations 0 nM, 0.4 nM, 2 nM, 10 nM, 50 nM) in 1NEB Buffer 2.1. Negative control reactions were performed with scrambled MRSA dsDNA. After the pre-digested ssDNA bridge solution had been deposited and air dried for 1 min, the PAD was collapsed to fluidically connect all hydrophilic regions with layer 1 acting as a protective cover for all other layers and as the inlet for running PBS buffer. MRSA PAD experiments were conducted using 10 l of running PBS buffer, while EBOV PAD experiments were done using 2 uL running PBS buffer. PAD channel resistance was continuously monitored using a 34411A Digital Multimeter (Keysight Technologies Inc., Santa Rosa, Calif.) for dynamic measurements (
[0256] Positive controls were performed to validate enzyme activity during Cas12a-mediated cleavage of the polyacrylamide gel linker in reactions that contained 300 nM Cas12a, 1 M MRSA gRNA, and increasing concentrations of dsDNA MRSA Trigger (0 nM, 0.4 nM, 2 nM, 10 nM, 50 nM) and NEB Buffer 2.1 (1), as well as 750 nM ssDNA quenched fluorescently labeled reporter. Fluorescence readings were used as a proxy to confirm the activity of Cas12a in the pre-incubation reaction (
RFID Integration in CRISPR-Mediated Stop Flow Pad (FIGS. 20A-20E)
[0257] To construct the CRISPR-active RFID sensor, a 1070 mm flexible WRL-14147 ultrahigh-frequency (UHF) RFID tag (SparkFun Electronics Inc., Niwot, Colo.) was modified with a flexible interdigitated electrode capable of short-circuiting an inner loop of the tag antenna in the presence of conductive buffer at a specific vertical layer or lateral flow distance of the previously described PAD. The flexible interdigitated electrode was fabricated using a silver nanoparticle ink pattern (
Ebola Diagnostic and EBOV RT-RPA CRISPR PAD (FIGS. 20A-20E)
[0258] To demonstrate applicability of the CRISPR PAD RFID mode of sensing, a sensitive Ebola virus RT-RPA CRISPR PAD was developed. To achieve this, a dsDNA fragment encoding for Zaire strain Ebola virus VP30 protein was obtained from IDT, which was then amplified by PCR and transcribed in vitro using HighScribe Quick (NEB). Serial dilutions of the RNA by RT-RPA were tested followed by Cas12a detection. Superscript (Invitrogen) was used for the RT step using EBOV-R primer, following manufacturer's instructions. Then, 5 l of the reverse-transcribed RNA was added to 50 l of RPA basic (TwistDx) lyophilized reactions that contained 480 M of each RPA primer and 14 mM magnesium acetate, as per manufacturer's instructions. The RPA reaction was incubated for 40 min at 37 C. After amplification, the ssDNA linker, gRNA and Cas12a were added to final concentrations of 300 M, 0.9 M and 0.5 M, respectively. The samples were incubated for 4 h, and then diluted 1:1 with nuclease-free water (all called RT-RPA/linker mix) and tested in the PADs.
[0259] To assemble the PAD, 0.3 l of RT-RPA/linker mix was deposited in layer 2, 0.3 l of 4% Ps-XY was deposited in layer 3 and 0.3 l 1PBS with red dye was deposited in layer 4. Lateral flow region in layer 5 was placed in contact with the interdigitated electrode of the modified RFID tag starting at 2 mm from channel entry. Reagents were air dried for 2 minutes and PAD was collapsed to allow for contact of hydrophilic sections. Running 1PBS buffer (2 uL) was added to the Layer 1 (top) of the PAD to start readings. Colorimetric readings of the EBOV RT-RPA CRISPR PAD detection system were obtained at increasing concentrations of input EBOV RNA trigger (0 aM, 2 aM, 11 aM, 53 aM, 255 aM, 1.4 fM, 6.8 fM, 34.1 fM, 170 fM, 853 fM, 4.2 nM and 21 nM) and are shown in
RFID Readings of EBOV RT-RPA CRISPR PAD (FIGS. 20A-20E)
[0260] The detection of an RFID signal change from the EBOV RT-RPA CRISPR-active PADs is caused by conductive buffer flow through layer 5, which is located in contact with the inkjet-printed interdigitated electrodes that are in turn connected to the first antenna loop of the RFID tags. The received signal strength indicator (RSSI) was measured in the testing RFID PAD in combination with an attached unmodified reference tag using an ultra-high frequency (UHF) RFID antenna positioned around 0.5 m from RFID PAD arrangement (
[0261] An experimenter blinded multi-center evaluation (n=12, 6 positive and 6 blank) of the fuse-like behavior of the EBOV RT-RPA CRISPR RFID PAD is shown in
DNA and RNA Sequences
[0262] For this study, all DNA oligonucleotides were obtained from Integrated DNA Technologies. Cas12a gRNAs were produced by in vitro transcription using an HiScribe T7 transcription kit (NEB) and oligonucleotide templates; gRNAs were subsequently purified using an RNA Clean & Concentrator kit (Zymo Research). The sequences used are provided in TABLE 4.
TABLE-US-00013 TABLE4 DNAandRNAsequencesusedinthisstudy. SEQ Name Sequence(5to3) IDNO: Modifications Notes mecAgRNA GGGUAAUUUCUACU 1 N/A Cas12aguideRNA AAGUGUAGAUUUAA targetingafragmentof AGAAGAUGGUAUGU mecAgene.Synthesizedby GG invitroT7transcription. AlsoreferredtoasMRSA1 gRNAintheSI mecAdsDNA TTTAATTTTGTTAAAG 2 N/A Triggersequencefor trigger AAGATGGTATGTGGA Cas12aprimedwithmecA AGTTAGATT gRNA.Doublestranded ScrambleddsDNA TAGTAGTGATTATGT 3 N/A Obtainedbyrandom trigger TAGATAGTGAATAGG permutationofthemecA TTTAATGTAT triggersequence.Double stranded mecA-1mismatch TTTAATTTTGTTAAAG 4 N/A Singlesubstitutionvariant AAGATGTTATGTGGA ofmecA AGTTAGATT mecA-3 TTTAATTTTGTTAAAT 5 N/A Triplesubstitutionvariantof mismatches AAGATGTTATGTAGA mecA AGTTAGATT Fluorophore- TTATT 5-6FAM,3- Generatesafluorescent quencherreporter IowaBlackFQ signalwhencleaved;used forCas12aactivationassays insolution AcryditeoligoX TTATTCTTGTCTCCCG 12 5Acrydite Acrylamide-DNAgels AGAT AcryditeoligoY TTATTTCACAGATGA 13 5Acrydite Acrylamide-DNAgels GTATC Linker-15 GATACTCATCTGTGA 16 N/A Acrylamide-DNAgels, TTATTTTATTTTATTA cross-linker TCTCGGGAGACAAG Linker-15-F TGATACTCATCTGTG 16 5-6FAM Fluorescentacrylamide- ATTATTTTATTTTATT DNAgels,cross-linker ATCTCGGGAGACAAG PEGgelreporter TTATTATTACTATCTA 20 5-C6-thiol3- PEG-DNAgelsmainmodel TTATCATTATCATT Cy3 molecule,usedinmost PEG-basedexperiments PEGgelreporterA TTTACACAAGCACTA 21 5-DTPA,3- PEG-DNAgels,anneals CGTACACTACCACAT 6FAM withProtectorsequenceA Protectorsequence ATGTGGTAGTGTACG 22 N/A PEG-DNAgels,anneals A TAGTGCTTGTGTAAA withPEGgelreporterA PEGgelreporterB TTTTTATTTATCTATC 23 5-C6-thiol3- PEG-DNAgels,anneals TGACGA Cy3 withProtectorsequenceB Protectorsequence TCGTCAGATAGATAA 24 N/A PEG-DNAgels,anneals B ATAAAAA withPEGgelreporterB Biotinanchor TTATTATTACTATCTA 25 5-C6-thiol,3- PEG-DNAgels TTATCATTATCATT biotin ermAgRNA GGGUAAUUUCUACU 26 N/A Cas12aguideRNA AAGUGUAGAUCUAU targetingafragmentof UAAUGGUGGAGAUG ermAgene.Synthesizedby GA invitroT7transcription ermCgRNA GGGUAAUUUCUACU 27 N/A Cas12aguideRNA AAGUGUAGAUAAUC targetingafragmentof GUCAAUUCCUGCAUG vermCgene.Synthesizedby U invitroT7transcription spagRNA GGGUAAUUUCUACU 28 N/A Cas12aguideRNA AAGUGUAGAUUGGU targetingafragmentofspa AAUGCUUGAGCUUU gene.Synthesizedbyin GU vitroT7transcription vanAgRNA GGGUAAUUUCUACU 29 N/A Cas12aguideRNA AAGUGUAGAUGUAU targetingafragmentofvanA UCAUCAGGAAGUCG gene.Synthesizedbyin AG vitroT7transcription ermA-dsDNA GCTTTGGGTTTACTAT 30 N/A Triggersequencefor trigger TAATGGTGGAGATGG Cas12aprimedwithermA ATATAAAAA gRNA.Doublestranded ermCdsDNA TAATATTGTTTAAATC 31 N/A Triggersequencefor trigger GTCAATTCCTGCATG Cas12aprimedwithermC TTTTAAGGA gRNA.Doublestranded spadsDNAtrigger TTCACCAGTTTCTGGT 32 N/A Triggersequencefor AATGCTTGAGCTTTG Cas12aprimedwithspa TTAGCATCT gRNA.Doublestranded vanAdsDNAtrigger ACGGAATCTTTCGTA 33 N/A Triggersequencefor TTCATCAGGAAGTCG Cas12aprimedwithvanA AGCCGGAAAA gRNA.Doublestranded ZEBOVgblock GTGCGCGTTCCTACT 34 N/A FragmentoftheVP30gene GTATTTCATAAGAAG ofZaireebolavirus;ordered AGAGTTGAACCATTA asadsDNAgenefragment ACAGTTCCTCCAGCA CCTAAAGACATATGT CCGACCTTGAAAAAA GGATTTTTGTGTGAC AGTAGTTTTTGCAAA AAAGACCACCAGTTA GAAAGTTTAACTGAT AGGGAATTACTCCTA CTAATCGCCCGTAAG ACTTGTGGATCAGTA GAACAACAATTAAAT ATAACTGCACCCAAG GACTCG ZEBOVRPA-1 CTACTGTATTTCATAA 35 N/A RPAforwardprimer-Ebola GAAGAGAGTTGAACC ZEBOVRPA-2 AATTGTTGTTCTACTG 36 N/A RPAreverseprimer-Ebola ATCCACAAGTCTTAC ZEBOV-T7 GCGCTAATACGACTC 37 N/A PCRprimerfortheZEBOV ACTATAGGGTGCGCG gblock,withT7forinvitro TTCCTACTGTATT transcription qPCR-ZEBOV-F GTGCGCGTTCCTACT 38 N/A qPCRprimerEbola GTATT qPCRT-ZEBOV-R GAGTCCTTGGGTGCA 39 N/A qPCRreverseprimerEbola. GTTATATT AlsousedasRTreverse primer ZEBOVgRNA GGGTAATTTCTACTA 40 N/A Cas12aguideRNA AGTGTAGATGGTGCT targetingafragmentof GGAGGAACTGTTAA ZaireebolavirusVP30gene. SynthesizedbyinvitroT7 transcription MRSA2gRNA GGGUAAUUUCUACU 41 N/A AlternativeCas12aguide AAGUGUAGAUAUUU RNAtargetingafragment UGUUAAAGAAGAUG ofmecAgene. GU MRSA3gRNA GGGUAAUUUCUACU 42 N/A AlternativeCas12aguide AAGUGUAGAUACAA RNAtargetingafragment AAUUAAAUUGAACG ofmecAgene. UU MRSA2trigger ATTTTGTTAAAGAAG 43 N/A Triggersequencefor ATGGT Cas12aprimedwith MRSA2gRNA.Double stranded MRSA3trigger ACAAAATTAAATTGA 44 N/A Triggersequencefor ACGTT Cas12aprimedwith MRSA3gRNA.Double stranded ControlgRNAfor GGGUAAUUUCUACU 45 N/A Cas12aguideRNA dsDNAtargeted AAGUGUAGAUGUAU targetingafragmentofthe cutting GGCUUCAUUCAGCUC ampRgene.Synthesizedby C invitroT7transcription dsDNArelease TTTAATTTTGTTAAAG 8 5-C6-amine HybridizeswithdsDNA probeX AAGATGGTATGTGGA probeX;containsamecA CGTATGGAATAAGTG sequencefordsDNA recognitionandcutting dsDNArelease TCACTTATTCCATACG 9 5-6FAM HybridizeswithdsDNA probeX TCCACATACCATCTTC probeX;containsamecA TTTAACAAAATTAA sequencefordsDNA recognitionandcutting dsDNArelease TTATTATTTACAACGT 10 5-C6-amine HybridizeswithdsDNA probeY CGTGACTGGGAAAAC probeY CCTTGGAATAAGTG dsDNArelease TCACTTATTCCAAGG 11 5-HEX HybridizeswithdsDNA probeY GTTTTCCCAGTCACG probeY ACGTTGTAAATAATA ControlgRNAfor GGGUAAUUUCUACU 46 N/A Cas12aguideRNA cutting AAGUGUAGAUGUAU targetingafragmentofthe GGCUUCAUUCAGCUC ampRgene.Synthesizedby C invitroT7transcription
REFERENCES
[0263] 1. S. Y. Li et al., CRISPR-Cas12a has both cis- and trans-cleavage activities on single stranded DNA. Cell Research 28, 491-493 (2018). [0264] 2. J. S. Chen et al., CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 360, 436-439 (2018). [0265] 3. G. J. Knott, J. A. Doudna, CRISPR-Cas guides the future of genetic engineering. Science 361, 866-869 (2018). [0266] 4. J. S. Gootenberg et al., Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 356, 438-442 (2017). [0267] 5. J. S. Gootenberg et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 360, 439-444 (2018). [0268] 6. N. Glorevski et al., Designer matrices for intestinal stem cell and organoid culture. Nature 539, 560-564 (2016). [0269] 7. W. Na, D. Nam, H. Lee, S. Shin, Rapid molecular diagnosis of infectious viruses in microfluidics using DNA hydrogel formation. Biosensors & Bioelectronics 108, 9-13 (2018). [0270] 8. M. Qin et al., Bioinspired Hydrogel Interferometer for Adaptive Coloration and Chemical Sensing. Advanced Materials 30, (2018). [0271] 9. J. S. Kahn et al., Integration of Switchable DNA-Based Hydrogels with Surfaces by the Hybridization Chain Reaction. Nano Letters 15, 7773-7778 (2015). [0272] 10. E. Heitzer, P. Ulz, J. B. Geigl, Circulating Tumor DNA as a Liquid Biopsy for Cancer. Clinical Chemistry 61, 112-123 (2015). [0273] 11. H. H. Yang, H. P. Liu, H. Z. Kang, W. H. Tan, Engineering target-responsive hydrogels based on aptamertarget interactions. Journal of the American Chemical Society 130, 6320-6321 (2008). [0274] 12. A. Cangialosi et al., DNA sequence-directed shape change of photopatterned hydrogels via high-degree swelling. Science 357, 1126-1129 (2017). [0275] 13. B. P. Kleinstiver et al., Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nature Biotechnology 34, 869-+(2016). [0276] 14. J. Y. Li, D. J. Mooney, Designing hydrogels for controlled drug delivery. Nature Reviews Materials 1, 16071 (2016). [0277] 15. A. M. Rosales, K. S. Anseth, The design of reversible hydrogels to capture extracellular matrix dynamics. Nature Reviews Materials 1, 15012 (2016). [0278] 16. B. P. Purcell et al., Injectable and bioresponsive hydrogels for on-demand matrix metalloproteinase inhibition. Nature Materials 13, 653-661 (2014). [0279] 17. M. M. Martino et al., Growth Factors Engineered for Super-Affinity to the Extracellular Matrix Enhance Tissue Healing. Science 343, 885-888 (2014). [0280] 18. H. Parant et al., Flowing suspensions of carbon black with high electronic conductivity for flow applications: Comparison between carbons black and exhibition of specific aggregation of carbon particles. Carbon 119, 10-20 (2017). [0281] 19. M. Pawlyta, J. N. Rouzaud, S. Duber, Raman microspectroscopy characterization of carbon blacks: Spectral analysis and structural information. Carbon 84, 479-490 (2015). [0282] 20. M. Spahr, R. Gilardi, D. Bonacchi., Carbon black for electrically conductive polymer applications in Fillers for Polymer Applications, R. Rothon, Ed. (Springer, Berlin, Heidelberg, Polymers and Polymeric Composites: A Reference Series, 2016). [0283] 21. C. H. Lu, H. H. Yang, C. L. Zhu, X. Chen, G. N. Chen, A Graphene Platform for Sensing Biomolecules. Angewandte Chemie-International Edition 48, 4785-4787 (2009). [0284] 22. Y. X. Xu, K. X. Sheng, C. Li, G. Q. Shi, Self-Assembled Graphene Hydrogel via a One-Step Hydrothermal Process. Acs Nano 4, 4324-4330 (2010). [0285] 23. B. W. Liu, S. Salgado, V. Maheshwari, J. W. Liu, DNA adsorbed on graphene and graphene oxide: Fundamental interactions, desorption and applications. Current Opinion in Colloid & Interface Science 26, 41-49 (2016). [0286] 24. S. Manohar et al., Peeling Single-Stranded DNA from Graphite Surface to Determine Oligonucleotide Binding Energy by Force Spectroscopy. Nano Letters 8, 4365-4372 (2008). [0287] 25. Y. X. Xu, Q. O. Wu, Y. Q. Sun, H. Bai, G. Q. Shi, Three-Dimensional Self-Assembly of Graphene Oxide and DNA into Multifunctional Hydrogels. Acs Nano 4, 7358-7362 (2010). [0288] 26. K. Pardee et al., Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell 165, 1255-1266 (2016). [0289] 27. K. Pardee et al., Paper-Based Synthetic Gene Networks. Cell 159, 940-954 (2014). [0290] 28. Y. He, Y. Wu, J. Z. Fu, W. B. Wu, Fabrication of paper-based microfluidic analysis devices: a review. Rsc Advances 5, 78109-78127 (2015). [0291] 29. X. F. Wei et al., Target-Responsive DNA Hydrogel Mediated Stop-Flow Microfluidic Paper-Based Analytic Device for Rapid, Portable and Visual Detection of Multiple Targets. Analytical Chemistry 87, 4275-4282 (2015). [0292] 30. A. K. Badu-Tawiah et al., Polymerization-based signal amplification for paper-based immunoassays. Lab on a Chip 15, 655-659 (2015). [0293] 31. E. Fu, B. Lutz, P. Kauffman, P. Yager, Controlled reagent transport in disposable 2D paper networks. Lab on a Chip 10, 918-920 (2010). [0294] 32. S. B. Stephan et al., Biopolymer implants enhance the efficacy of adoptive T-cell therapy. Nature Biotechnology 33, 97-U277 (2015). [0295] 33. A. S. Mao et al., Deterministic encapsulation of single cells in thin tunable microgels for niche modelling and therapeutic delivery. Nature Materials 16, 236-243 (2017). [0296] 34. H. Parant et al., Flowing suspensions of carbon black with high electronic conductivity for flow applications: Comparison between carbons black and exhibition of specific aggregation of carbon particles. Carbon 119, 10-20 (2017). [0297] 35. Y. X. Xu, K. X. Sheng, C. Li, G. Q. Shi, Self-Assembled Graphene Hydrogel via a One-Step Hydrothermal Process. Acs Nano 4, 4324-4330 (2010). [0298] 36. L. Sun, S. S. Park, D. Sheberla, M. Dinca, Measuring and Reporting Electrical Conductivity in Metal Organic Frameworks: Cd-2(TTFTB) as a Case Study. Journal of the American Chemical Society 138, 14772-14782 (2016). [0299] 37. M. L. Previtera, N. A. Langrana, Preparation of DNA-crosslinked Polyacrylamide Hydrogels. Jove-Journal of Visualized Experiments, (2014). [0300] 38. J. Turkevich, P. C. Stevenson, J. Hillier, A study of the nucleation and growth processes in the synthesis of colloidal gold. Discussions of the Faraday Society, 55-& (1951). [0301] 39. X. F. Wei et al., Target-Responsive DNA Hydrogel Mediated Stop-Flow Microfluidic Paper-Based Analytic Device for Rapid, Portable and Visual Detection of Multiple Targets. Analytical Chemistry 87, 4275-4282 (2015). [0302] 40. H. H. Lee, K. S. Chou, K. C. Huang, Inkjet printing of nanosized silver colloids. Nanotechnology 16, 2436-2441 (2005). [0303] 41. S. Sugimoto et al., Broad impact of extracellular DNA on biofilm formation by clinically isolated Methicillin-resistant and -sensitive strains of Staphylococcus aureus. Scientific Reports 8, 2254 (2018). [0304] 42 M. Arthur, C. Molinas, C. Mabilat, P. Courvalin, Detection of erythromycin resistance by the polymerase-chain reaction using primers in conserved regions of erm ribosomal-RNA methylase genes. Antimicrobial Agents and Chemotherapy 34, 2024-2026 (1990). [0305] 43. B. Strommenger, C. Kettlitz, G. Werner, W. Witte, Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. Journal of Clinical Microbiology 41, 4089-4094 (2003). [0306] 44. C. E. Okolie, K. G. Wooldridge, D. P. J. Turner, A. Cockayne, R. James, Development of a heptaplex PCR assay for identification of Staphylococcus aureus and CoNS with simultaneous detection of virulence and antibiotic resistance genes. BMC Microbiology 15, 157 (2015). [0307] 45. N. K. Qureshi, S. H. Yin, S. Boyle-Vavra, The Role of the Staphylococcal VraTSR Regulatory System on Vancomycin Resistance and vanA Operon Expression in Vancomycin-Resistant Staphylococcus aureus. PLoS One 9, e85873 (2014). [0308] 46. K. W. Wang, T. Betancourt, C. K. Hall, Computational Study of DNA-Cross-Linked Hydrogel Formation for Drug Delivery Applications. Macromolecules 51, 9758-9768 (2018). [0309] 47. D. C. Lin, B. Yurke, N. A. Langrana, Mechanical properties of a reversible, DNA-crosslinked polyacrylamide hydrogel. Journal of Biomechanical Engineering-Transactions of the ASME 126, 104-110 (2004). [0310] 48. B. Wei, I. Cheng, K. Q. Luo, Y. L. Mi, Capture and release of protein by a reversible DNA-induced sol-gel transition system. Angewandte Chemie-International Edition 47, 331-333 (2008). [0311] 49. K. Barker et al., Biodegradable DNA-enabled poly(ethylene glycol) hydrogels prepared by copper-free click chemistry. Journal of Biomaterials Science-Polymer Edition 27, 22-39 (2016). [0312] 50. Z. Zhu et al., An Aptamer Cross-Linked Hydrogel as a Colorimetric Platform for Visual Detection. Angewandte Chemie-International Edition 49, 1052-1056 (2010). [0313] 51. R. Hajian et al., Detection of unamplified target genes via CRISPR-Cas9 immobilized on a graphene field-effect transistor. Nature Biomedical Engineering. Advance online publication. doi: 10.1038/s41551-019-0371-x (2019). [0314] 52. L. Magro et al., Paper-based RNA detection and multiplexed analysis for Ebola virus diagnostics. Scientific Reports 7, 1347 (2017). [0315] 53. W. Cai, S. B. Xie, J. Zhang, D. Y. Tang, Y. Tang, An electrochemical impedance biosensor for Hg2+ detection based on DNA hydrogel by coupling with DNAzyme-assisted target recycling and hybridization chain reaction. Biosens. Bioelectron. 98, 466-472 (2017). [0316] 54. Y. Z. Xing et al., Self-assembled DNA hydrogels with designable thermal and enzymatic responsiveness. Adv. Mater. 23, 1117-1121 (2011). [0317] 55. X. Z. Ma et al., Remote controlling DNA hydrogel by magnetic field. ACS Appl. Mater. Inter. 9, 1995-2000 (2017). [0318] 56. S. Venkatesh, J. Wower, M. E. Byrne, Nucleic acid therapeutic carriers with on-demand triggered release. Bioconjugate Chem. 20, 1773-1782 (2009). [0319] 57. Y. Y. Chang et al., Homogeneous entropy catalytic-driven DNA hydrogel as strong signal blocker for highly sensitive electrochemical detection of platelet-derived growth factor. Anal. Chem. 90, 8241-8247 (2018). [0320] 58. G. Sicilia et al., Programmable polymer-DNA hydrogels with dual input and multiscale responses. Biomater. Sci. 2, 203-211 (2014). [0321] 59. M. Gao, K. Gawel, B. T. Stokke, Toehold of dsDNA exchange affects the hydrogel swelling kinetics of a polymer-dsDNA hybrid hydrogel. Soft Matter 7, 1741-1746 (2011). [0322] 60. S. H. Li, N. C. Chen, Z. Y. Zhang, Y. Wang, Endonuclease-responsive aptamer-functionalized hydrogel coating for sequential catch and release of cancer cells. Biomaterials 34, 460-469 (2013).
Other Embodiments
[0323] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0324] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
EQUIVALENTS
[0325] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0326] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0327] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0328] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
[0329] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0330] As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0331] As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0332] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0333] In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., comprising) are also contemplated, in alternative embodiments, as consisting of and consisting essentially of the feature described by the open-ended transitional phrase. For example, if the disclosure describes a composition comprising A and B, the disclosure also contemplates the alternative embodiments a composition consisting of A and B and a composition consisting essentially of A and B.