Disease resistant <i>Brassica </i>plants
10787673 · 2020-09-29
Assignee
Inventors
- Mireille Maria Augusta Van Damme (Norwich, GB)
- Augustinus Franciscus Johannes Maria Van Den Ackerveken (Houten, NL)
- Mathieu André Pel (Enkhuizen, NL)
- Bartholomeus Laurentius Petrus Oud (Enkhuizen, NL)
- Tieme ZEILMAKER (Amersfoort, NL)
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12N15/01
CHEMISTRY; METALLURGY
C12N15/8279
CHEMISTRY; METALLURGY
C12N15/8218
CHEMISTRY; METALLURGY
C12Y114/11
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
C12N15/01
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a mutant Brassica plant, which is resistant to a pathogen of viral, bacterial, fungal or oomycete origin. The mutant Brassica plant has a reduced level, reduced activity or complete absence of DMR6-1 protein and DMR6-2 protein as compared to a wild type Brassica plant.
Claims
1. A mutant Brassica oleracea plant, wherein the plant has a reduced activity or a reduced level of a DMR6-1 polypeptide comprising at least 95% sequence identity to SEQ ID NO: 112 as compared to a corresponding wild type Brassica oleracea plant, and wherein the mutant Brassica oleracea plant has at least one non-natural mutation introduced into a DMR6-1 coding sequence comprising at least 95% sequence identity to SEQ ID NO: 114; wherein the mutant Brassica oleracea plant further has a reduced activity or a reduced level of a DMR6-2 polypeptide comprising at least 95% sequence identity to SEQ ID NO: 113 as compared to a corresponding wild type Brassica oleracea plant, and wherein the mutant Brassica oleracea plant has at least one non-natural mutation introduced into a DMR6-2 coding sequence comprising at least 95% sequence identity to SEQ ID NO: 115; and wherein the plant exhibits resistance to Hyaloperonospora parasitica/Hyaloperonospora brassicae.
2. The mutant Brassica oleracea plant of claim 1, wherein the DMR6-1 coding sequence comprises SEQ ID NO: 114; and wherein the DMR6-2 coding sequence comprises SEQ ID NO: 115.
3. The mutant Brassica oleracea plant of claim 1, wherein the DMR6-1 polypeptide comprises SEQ ID NO: 112; and wherein the DMR6-2 polypeptide comprises SEQ ID NO: 113.
4. The mutant Brassica oleracea plant of claim 1, wherein the plant further exhibits intermediate resistance to Xanthomonas campestris campestris.
5. The mutant Brassica oleracea plant of claim 1, wherein the at least one non-natural mutation introduced into the DMR6-1 coding sequence is a premature stop codon, and wherein the at least one non-natural mutation introduced into the DMR6-2 coding sequence is a premature stop codon.
6. The mutant Brassica oleracea plant of claim 1, wherein the at least one non-natural mutation introduced into the DMR6-1 coding sequence reduces an activity or a level of the DMR6-1 polypeptide as compared to a corresponding wild type Brassica oleracea plant; and wherein the at least one non-natural mutation introduced into the DMR6-2 coding sequence reduces an activity or a level of the DMR6-2 polypeptide as compared to a corresponding wild type Brassica oleracea plant.
7. The mutant Brassica oleracea plant of claim 6, wherein the DMR6-1 polypeptide comprises SEQ ID NO: 112; and wherein the DMR6-2 polypeptide comprises SEQ ID NO: 113.
8. The mutant Brassica oleracea plant of claim 6, wherein the DMR6-1 coding sequence comprises SEQ ID NO: 114; and wherein the DMR6-2 coding sequence comprises SEQ ID NO: 115.
9. The mutant Brassica oleracea plant of claim 6, wherein the at least one non-natural mutation introduced into the DMR6-1 polypeptide is selected from the group consisting of a premature stop codon introduced into the DMR6-1 coding sequence, a frameshift mutation introduced into the DMR6-1 coding sequence, an insertion introduced into the DMR6-1 coding sequence, a deletion of a part or a whole of the DMR6-1 coding sequence, an altered amino acid in a conserved domain of the DMR6-1 polypeptide, a modified upstream sequence, a mutated promoter element, and an activated repressor element; and wherein the at least one non-natural mutation that reduces the activity or level of the DMR6-2 polypeptide is selected from the group consisting of a premature stop codon introduced into the DMR6-2 coding sequence, a frameshift mutation introduced into the DMR6-2 coding sequence, an insertion introduced into the DMR6-2 coding sequence, a deletion of a part or a whole of the DMR6-2 coding sequence, an altered amino acid in a conserved domain of the DMR6-2 polypeptide, a modified upstream sequence, a mutated promoter element, and an activated repressor element.
10. The mutant Brassica oleracea plant of claim 1, wherein the plant is a Brassica oleracea cultivar selected from the group consisting of cabbage, kohlrabi, kale, Brussels sprouts, collard greens, broccoli, Romanesco broccoli, and cauliflower.
11. The mutant Brassica oleracea plant of claim 1, wherein the at least one non-natural mutation introduced into the DMR6-1 coding sequence is selected from the group consisting of a single nucleotide change from C to T at a position corresponding to nucleotide 181 of reference sequence SEQ ID NO: 114, a single nucleotide change from C to T at a position corresponding to nucleotide 691 of reference sequence SEQ ID NO: 114, a single nucleotide change from G to A at a position corresponding to nucleotide 714 of reference sequence SEQ ID NO: 114, and a deletion of five nucleotides starting at a position corresponding to nucleotide 601 of reference sequence SEQ ID NO: 114; and wherein the at least one non-natural mutation introduced into the DMR6-2 coding sequence is selected from the group consisting of a single nucleotide change from G to A at a position corresponding to nucleotide 368 of reference sequence SEQ ID NO: 115, and a deletion of the nucleotide at a position corresponding to nucleotide 600 of reference sequence SEQ ID NO: 115.
12. A seed, tissue, or plant part of the Brassica oleracea plant of claim 1, wherein the seed, tissue, or plant part comprises the reduced activity or the reduced level of the DMR6-1 polypeptide and the reduced activity or the reduced level of the DMR6-2 polypeptide, and wherein the seed, tissue, or plant part comprises at least one non-natural mutation in the DMR6-1 coding sequence and at least one non-natural mutation in the DMR6-2 coding sequence.
13. A method for obtaining a mutant Brassica oleracea plant which is resistant to Hyaloyeronosyora parasitica/Hyaloyeronosyora brassicae, comprising reducing an activity or a level of a DMR6-1 polypeptide comprising at least 95% sequence identity to SEQ ID NO: 112 in a Brassica oleracea plant as compared to a corresponding wild type Brassica oleracea plant by introducing at least one non-natural mutation into a DMR6-1 coding sequence comprising at least 95% sequence identity to SEQ ID NO: 114, and reducing an activity or a level of a DMR6-2 polypeptide comprising at least 95% sequence identity to SEQ ID NO: 113 in a Brassica oleracea plant as compared to a corresponding wild type Brassica oleracea plant by introducing at least one non-natural mutation into a DMR6-2 coding sequence comprising at least 95% sequence identity to SEQ ID NO: 115.
14. The method of claim 13, wherein the at least one non-natural mutation introduced into the DMR6-1 coding sequence is achieved by a mutagenic treatment, a radiation treatment, or a gene editing technique, and wherein the at least one non-natural mutation introduced into the DMR6-2 coding sequence is achieved by a mutagenic treatment, a radiation treatment, or a gene editing technique.
15. The method of claim 13, wherein the mutant Brassica oleracea plant further exhibits intermediate resistance to Xanthomonas camyestris camyestris.
16. A mutant Brassica oleracea plant produced from the method of claim 13, wherein the plant comprises at least one non-natural mutation in the DMR6-1 coding sequence and at least one non-natural mutation in the DMR6-2 coding sequence, and wherein the plant comprises the reduced activity or the reduced level of the DMR6-1 polypeptide and the reduced activity or the reduced level of the DMR6-2 polypeptide.
17. The mutant Brassica oleracea plant of claim 16, wherein the plant is a Brassica oleracea cultivar selected from the group consisting of cabbage, kohlrabi, kale, Brussels sprouts, collard greens, broccoli, Romanesco broccoli, and cauliflower.
18. The mutant Brassica oleracea plant of claim 16, wherein the DMR6-1 polypeptide comprises SEQ ID NO: 112; and wherein the DMR6-2 polypeptide comprises SEQ ID NO: 113.
19. The mutant Brassica oleracea plant of claim 16, wherein the DMR6-1 coding sequence comprises SEQ ID NO: 114; and wherein the DMR6-2 coding sequence comprises SEQ ID NO: 115.
20. A seed, tissue, or plant part of the mutant Brassica oleracea plant of claim 16, wherein the seed, tissue, or plant part comprises at least one non-natural mutation in the DMR6-1 coding sequence and at least one non-natural mutation in the DMR6-2 coding sequence, and wherein the seed, tissue, or plant part comprises the reduced activity or the reduced level of the DMR6-1 polypeptide and the reduced activity or the reduced level of the DMR6-2 polypeptide.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
DETAILED DESCRIPTION OF THE INVENTION
(27)
(28) Once the DNA sequence of the gene is known this information is used to prepare the means to modulate the expression of the DMR6 gene.
(29) To achieve a reduced DMR6 protein level, the expression of the DMR6 gene can be down-regulated or the enzymatic activity of the DMR6 protein can be reduced by amino acid substitutions resulting from nucleotide changes in the DMR6 coding sequence.
(30) In a particular embodiment of the invention, downregulation of DMR6 gene expression is achieved by gene-silencing using RNAi. For this, transgenic plants are generated expressing a DMR6 anti-sense construct, an optimized micro-RNA construct, an inverted repeat construct, or a combined sense-anti-sense construct, so as to generate dsRNA corresponding to DMR6 that leads to gene silencing.
(31) In an alternative embodiment, one or more regulators of the DMR6 gene are downregulated (in case of transcriptional activators) by RNAi.
(32) In another embodiment regulators are upregulated (in case of repressor proteins) by transgenic overexpression. Overexpression is achieved in a particular embodiment by expressing repressor proteins of the DMR6 gene from a strong promoter, e.g. the 35S promoter that is commonly used in plant biotechnology.
(33) The downregulation of the DMR6 gene can also be achieved by mutagenesis of the regulatory elements in the promoter, terminator region, or potential introns. Mutations in the DMR6 coding sequence in many cases leads to amino acid substitutions or premature stop codons that negatively affect the expression or activity of the encoded DMR6 protein. In a particular embodiment of the invention, the mutations in the DMR6 coding sequence are the introduction of a premature stop codon. In a further embodiment, mutations in the two cabbage DMR6 genes (i.e., DMR6-1 and DMR6-2) introduce a premature stop codon into each of the cabbage DMR6 genes.
(34) These mutations are induced in plants by using mutagenic chemicals such as ethyl methane sulfonate (EMS), by irradiation of plant material with gamma rays or fast neutrons, or by other means. The resulting nucleotide changes are random, but in a large collection of mutagenized plants the mutations in the DMR6 gene can be readily identified by using the TILLING (Targeting Induced Local Lesions IN Genomes) method (McCallum et al. (2000) Targeted screening for induced mutations. Nat. Biotechnol. 18, 455-457, and Henikoff et al. (2004) TILLING. Traditional mutagenesis meets functional genomics. Plant Physiol. 135, 630-636). The principle of this method is based on the PCR amplification of the gene of interest from genomic DNA of a large collection of mutagenized plants in the M2 generation. By DNA sequencing or by looking for point mutations using a single-strand specific nuclease, such as the CEL-I nuclease (Till et al. (2004) Mismatch cleavage by single-strand specific nucleases. Nucleic Acids Res. 32, 2632-2641) the individual plants that have a mutation in the gene of interest are identified.
(35) By screening many plants, a large collection of mutant alleles is obtained, each giving a different effect on gene expression or enzyme activity. The gene expression or protein levels can for example be tested by analysis of DMR6 transcript levels (e.g. by RT-PCR) or by quantification of DMR6 protein levels with antibodies.
(36) Plants with the desired reduced DMR6 level or DMR6 expression are then back-crossed or crossed to other breeding lines to transfer only the desired new allele into the background of the crop wanted.
(37) The invention further relates to mutated DMR6 genes. In a particular embodiment, the invention relates to dmr6 alleles with premature stop codons, such as the dmr6-1 allele and the dmr6-2 allele.
(38) In another embodiment, the invention relates to mutated versions of the DMR6 genes of Lactuca sativa, Cucumis sativus, and Spinacia oleracea as shown in
(39) The present invention demonstrates that plants having no or a reduced level of functional DMR6 gene product show resistance to pathogens, in particular of oomycete and fungal origin. With such knowledge the skilled person can identify so far unknown natural variants of a given plant species that have variants of the DMR6 gene that lead to a reduced level or absence of a functional DMR6 protein, or mutated versions of the DMR6 protein, and to use these natural variants according to the invention.
(40) The present invention further relates to the use of a DMR6 promoter for providing disease resistance into plants, i.e. for providing plants with a resistance to a pathogen of viral, bacterial, fungal or oomycete origin. According to the present invention, the transcriptional up-regulation of DMR6 in response to pathogen infection has been demonstrated. Both transcript analysis as well as promoter DMR6-reporter lines support this finding (see Example 1, below). The pathogen-inducible DMR6 promoter according to the invention thus is particularly useful to control the expression of inducible systems that lead to disease resistance in plants.
(41) One example of such inducible system that leads to disease resistance in plants, and in which the DMR6 promoter according to the present invention may be effective, has e.g. been described in WO 99/45125, wherein an antisense nucleotide sequence for a gene involved in the regulation of the C-5 porphyrin metabolic pathway is operably linked to a pathogen-inducible promoter and used to transform plant cells. Expression of the antisense nucleotide sequence in response to the pathogen effectively disrupts porphyrin metabolism of the transformed plant cell, and development of a localized lesion wherein the spread of the pathogen is contained. WO 96/36697 also discloses inducible systems leading to disease resistance in plants, wherein an inducible promoter controls the expression of a protein capable of evoking the hypersensitivity response in a plant. EP 0474857 furthermore discloses a method for the induction of pathogen resistance in plants, comprising transforming plants with polynucleotide sequences encoding a pair of pathogen-derived-avirulence-gene/plant-derived-resistance gene, wherein the expression of one of or both the elicitor peptide and the resistance gene is regulated by a pathogen inducible promoter. Further examples of inducible systems leading to resistance to pathogens in plants have been described in e.g. WO 98/32325.
(42) In a particular preferred embodiment, the present invention relates to a method of providing disease resistance in a plant, comprising transforming a plant cell with a DNA construct comprising at least one expressible nucleic acid which is operably linked to a pathogen-inducible promoter that is operable within a plant cell, and regenerating transformed plants from said plant cells, wherein the pathogen-inducible promoter is a DMR6 promoter, and wherein the expression of the expressible nucleic acid confers disease resistance to the transgenic plant.
(43) The invention also relates to disease resistance plants, obtainable by said method, as well as to plant tissue, and seeds obtained from said plants.
(44) The invention in particular relates to plants, which are resistant to a pathogen of viral, bacterial, fungal or oomycete origin, wherein the plant comprises in its genome a DNA construct, comprising at least one expressible nucleic acid which is operably linked to a pathogen-inducible promoter, wherein the pathogen-inducible promoter is a DMR6 promoter.
(45) The present invention also relates to the DNA construct per se, comprising at least one expressible nucleic acid which is operably linked to a pathogen-inducible promoter, wherein the pathogen-inducible promoter is a DMR6 promoter. The construct of the invention can be used to transform plant cells which may be regenerated into transformed plants. Furthermore, transformed plant tissue and seed may be obtained. Suitable methods for introducing the construct of the invention into plant cells are known to the skilled person.
(46) According to the invention, by operably linked is meant that a promoter and an expressible nucleic acid, e.g. a gene, are connected in such way as to permit initiation of transcription of the expressible nucleic acid (e.g. gene) by the promoter.
(47) By expressible nucleic acid is meant a nucleic acid (e.g. a gene, or part of a gene) that can be expressed in the cell, i.e., that can be transcribed into mRNA, and eventually may be translated into a protein. The expressible nucleic acid may be genomic DNA, cDNA, or chemically synthesized DNA or any combination thereof.
(48) According to the present invention, a DNA construct comprises all necessary nucleic acid elements which permit expression (i.e. transcription) of a particular nucleic acid in a cell. Typically, the construct includes an expressible nucleic acid, i.e. a nucleic acid to be transcribed, and a promoter. The construct can suitably be incorporated into e.g. a plasmid or vector.
(49) The expressible nucleic acid preferably is a gene involved in a plant defence response, e.g. a gene associated with the hypersensitivity response of a plant. In the hypersensitivity response (HR) of a plant, the site in the plant where the pathogen invades undergoes localized cell death by the induced expression of a suicide mechanism that triggers said localized cell death in response to pathogens. In this way, only a few plant cells are sacrificed and the spread of the pathogen is effectively arrested. Examples of said genes involved in a plant defence response are the regulatory protein NPR1/NIM1 (Friedrich et al., Mol. Plant Microbe Interact. 14(9): 1114-1124, 2001) and the transcription factor MYB30 (Vailleau et al., Proc. Natl. Acad. Sci. USA 99(15): 10179-10184, 2002).
(50) In a particular embodiment, the expressible nucleic acid encodes an autologous or heterologous polypeptide capable of conferring disease-resistance to a plant. By autologous polypeptide is meant any polypeptide that is expressed in a transformed plant cell from a gene that naturally occurs in the transformed plant cell. By heterologous polypeptide is meant any polypeptide that is expressed in a transformed plant cell from a gene that is partly or entirely foreign (i.e. does not naturally occur in) to the transformed plant cell. Examples of such polypeptides are the mammalian Bax protein, which encodes a pro-apoptotic protein and results in cell death in plants (Lacomme and Santa Cruz, Proc. Natl. Acad. Sci. USA 96(14): 7956-61, 1999) and fungal chitinases (de las Mercedes Dana et al., Plant Physiol. 142(2): 722-730, 2006).
(51) Preferably, the DMR6 promoter is the Arabidopsis DMR6 promoter. The DMR6 promoter comprises a region of 3000 bp that is upstream of the Arabidopsis DMR6 coding sequence (ATG start codon) and includes the 5UTR. Preferably the DMR6 promoter comprises a nucleotide sequence as defined in
(52) In a further preferred embodiment, the DMR6 promoter is an orthologous DMR6 promoter, i.e. a promoter of an orthologous DMR6 gene. Methods for identifying DMR6 orthologs have been described in Example 2 below. Once the DMR6 orthologs have been identified, the skilled person will be able to isolate the respective promoter of said orthologs, using standard molecular biological techniques.
(53) According to the present invention, the DMR6 promoter has been shown to be strongly pathogen-induced, and the DMR6 promoter is not highly expressed in other non-infected tissues. Thus, it is a very suitable promoter for use in inducible systems for providing resistance to pathogens of viral, bacterial, fungal or oomycete origin in plants. Examples of specific pathogens and plants for which the inducible system, using the DMR6 promoter of the present invention, suitably can be used, have been given above.
(54) In a particular embodiment, downregulation of DMR6 gene expression is achieved by gene silencing, RNA interference (RNAi), virus-induced gene silencing (VIGS), small RNA-mediated post-transcriptional gene silencing, transcription activator-like effector nuclease (TALEN) gene editing techniques, clustered Regularly Interspaced Short Palindromic Repeat (CRISPR/Cas9) gene editing techniques, and/or zinc-finger nuclease (ZFN) gene editing techniques. For this, transgenic plants are generated expressing one or more constructs targeting DMR6. These constructs may include, without limitation, an anti-sense construct, an optimized small-RNA construct, an inverted repeat construct, a targeting construct, a guide RNA construct, a construct encoding a targeting protein, and/or a combined sense-anti-sense construct, and may work in conjunction with a nuclease, an endonuclease, and/or an enzyme, so as to downregulate DMR6 gene expression.
(55) In an alternative embodiment, one or more regulators of the DMR6 gene are downregulated (in case of transcriptional activators) by RNA interference (RNAi), virus-induced gene silencing (VIGS), small RNA-mediated post-transcriptional gene silencing, transcription activator-like effector nuclease (TALEN) gene editing techniques, clustered Regularly Interspaced Short Palindromic Repeat (CRISPR/Cas9) gene editing techniques, and/or zinc-finger nuclease (ZFN) gene editing techniques.
(56) Brassica Plants of the Present Disclosure
(57) Accordingly, certain aspects of the present disclosure relate to a mutant Brassica plant, wherein the plant has a reduced activity or a reduced level of a DMR6-1 polypeptide as compared to a corresponding wild type Brassica plant, and wherein the mutant Brassica plant has at least one non-natural mutation introduced into the DMR6-1 gene; and wherein the mutant Brassica plant has a reduced activity or a reduced level of a DMR6-2 polypeptide as compared to a corresponding wild type Brassica plant, and wherein the mutant Brassica plant has at least one non-natural mutation introduced into the DMR6-2 gene. In some embodiments, the plant exhibits resistance selected from the group of resistance to Hyaloperonospora parasitica/Hyaloperonospora brassicae, intermediate resistance to Xanthomonas campestris campestris, or any combination thereof. In some embodiments, the DMR6-1 polypeptide is selected from the group of a polypeptide with at least 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 112; and wherein the DMR6-2 polypeptide is a polypeptide selected from the group of a protein with at least 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 113. In some embodiments that may be combined with any of the above embodiments, the DMR6-1 gene is selected from the group of a nucleotide with at least 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 114; and wherein the DMR6-2 gene is selected from the group of a nucleotide with 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 115. In some embodiments that may be combined with any of the above embodiments, the non-natural mutation in DMR6-1 is a premature stop codon, and the non-natural mutation in DMR6-2 is a premature stop codon.
(58) In some embodiments, the at least one non-natural mutation introduced into the DMR6-1 gene reduces an activity or a level of a DMR6-1 polypeptide as compared to a corresponding wild type Brassica plant; and the at least one non-natural mutation introduced into the DMR6-2 gene reduces an activity or a level of a DMR6-2 polypeptide as compared to a corresponding wild type Brassica plant. In some embodiments, the DMR6-1 polypeptide is selected from the group of a polypeptide with 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 112; and wherein the DMR6-2 polypeptide is a polypeptide selected from the group of a protein with at least 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 113. In some embodiments that may be combined with any of the above embodiments, the DMR6-1 gene is selected from the group of a nucleotide with at least 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 114; and wherein the DMR6-2 gene is selected from the group of a nucleotide with 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 115.
(59) In some embodiments, the at least one non-natural mutation that reduces the activity or level of the DMR6-1 protein is selected from the group of a premature stop codon introduced into the DMR6-1 coding sequence, a frameshift mutation introduced into the DMR6-1 coding sequence, an insertion introduced into the DMR6-1 coding sequence, a deletion of a part or a whole of the DMR6-1 coding sequence, an altered amino acid in a conserved domain of the DMR6-1 protein, a modified upstream sequence, a mutated promoter element, or an activated repressor element; and the at least one non-natural mutation that reduces the activity or level of the DMR6-2 protein is selected from the group of a premature stop codon introduced into the DMR6-2 coding sequence, a frameshift mutation introduced into the DMR6-2 coding sequence, an insertion introduced into the DMR6-2 coding sequence, a deletion of a part or a whole of the DMR6-2 coding sequence, an altered amino acid in a conserved domain of the DMR6-2 protein, a modified upstream sequence, a mutated promoter element, or an activated repressor element.
(60) In one embodiment, the plant of the present disclosure may be obtained through introduction of a premature stop codon into Brassica DMR6-1 and DMR6-2 genes. In some embodiments, the introduction of a premature stop codon may be through a single nucleotide change, a single nucleotide deletion, the deletion of five nucleotides, the deletion of nucleotides such that a frameshift mutation is produced, or the insertion of nucleotides such that a frameshift mutation is produced. In a particular embodiment, the Cytosine (C) is replaced with a Thymine (T) at a position of DMR6-1 corresponding to nucleotide 181 of the reference sequence SEQ ID NO: 114 (e.g., producing SEQ ID NO: 128), resulting in a change from Arginine (R) to a stop codon (e.g., producing SEQ ID NO: 141). In another particular embodiment, the C is replaced with a T at a position of DMR6-1 corresponding to nucleotide 691 of the reference sequence SEQ ID NO: 114 (e.g., producing SEQ ID NO: 129), resulting in a change from Glutamine (Q) to a stop codon (e.g., producing SEQ ID NO: 142). In a further particular embodiment, the Guanine (G) is replaced with an Adenine (A) at a position of DMR6-1 corresponding to nucleotide 714 of the reference sequence of the reference sequence SEQ ID NO: 114 (e.g., producing SEQ ID NO: 130) resulting in a change from Tryptophan (W) to a stop codon (e.g., producing SEQ ID NO: 143). In yet another particular embodiment, five nucleotides (e.g., CCTGA) are deleted beginning at a position of DMR6-1 corresponding to nucleotide 601 of the reference sequence SEQ ID NO: 114 (e.g., producing SEQ ID NO: 137), producing a frameshift mutation and a premature stop codon (e.g., producing SEQ ID NO: 139). In an additional particular embodiment, the G is replaced with an A at a position of DMR6-2 corresponding to nucleotide 368 of the reference sequence SEQ ID NO: 115 (e.g., producing SEQ ID NO: 131) resulting in a change from W to a stop codon (e.g., producing SEQ ID NO: 144). In a further particular embodiment, the nucleotide is deleted at a position of DMR6-2 corresponding to nucleotide 600 of the reference sequence SEQ ID NO: 115 (e.g., producing SEQ ID NO: 138), producing a frameshift mutation and a premature stop codon (e.g., producing SEQ ID NO: 140). In some embodiments, the non-natural mutation introduced into the DMR6-1 gene is selected from the group of a C to T mutation at a position corresponding to nucleotide 181 of reference sequence SEQ ID NO: 114, a C to T mutation at a position corresponding to nucleotide 691 of reference sequence SEQ ID NO: 114, a G to A mutation at a position corresponding to nucleotide 714 of reference sequence SEQ ID NO: 114, or a deletion of five nucleotides starting at a position corresponding to nucleotide 601 of reference sequence SEQ ID NO: 114; and the non-natural mutation introduced into the DMR6-2 gene is selected from the group of a G to A mutation at a position corresponding to nucleotide 368 of reference sequence SEQ ID NO: 115, or a deletion of the nucleotide at a position corresponding to nucleotide 600 of reference sequence SEQ ID NO: 115.
(61) Without wishing to be limited by theory, in some embodiments, the premature stop codon is located before or within the essential iron binding residue conserved in all 2OG oxygenases such as DMR6 (Wilmouth et al. (2002), Structure, 10:93-103). Without wishing to be limited by theory, in another embodiment, the plant of the present disclosure may be obtained through introduction of at least one amino acid change in the essential iron binding residue of DMR6-1 and the introduction of at least one amino acid change in the essential iron binding residue of DMR6-2. Without wishing to be limited by theory, in a further embodiment, the plant of the present disclosure may be obtained through introduction of at least one mutation in DMR6-1 and at least one mutation in DMR6-2 resulting in altered DMR6-1 function and altered DMR6-2 function that can be detected as an increase of salicylic acid (SA) accumulation.
(62) In some embodiments, the non-natural mutation introduced into the DMR6-1 gene is selected from the group of a C to T mutation at position 181 corresponding to the reference sequence SEQ ID NO: 128, a C to T mutation at position 691 corresponding to the reference sequence SEQ ID NO: 129, a G to A mutation at position 714 corresponding to the reference sequence SEQ ID NO: 130, or deletion of CCTGA at position 601 corresponding to reference sequence SEQ ID NO: 137; and wherein the non-natural mutation introduced into the DMR6-2 gene is selected from the group of a G to A mutation at position 368 corresponding to reference sequence SEQ ID NO: 131, or deletion of T at position 600 corresponding to reference sequence SEQ ID NO: 138.
(63) In some embodiments that may be combined with any of the above embodiments, the Brassica plant is a plant of the family Brassicaceae (i.e., Cruciferae). In some embodiments, the plant is Brassica oleracea. In some embodiments, the plant is a Brassica oleracea cultivar selected from the group of cabbage, kohlrabi, kale, Brussels sprouts, collard greens, broccoli, Romanesco broccoli, or cauliflower.
(64) In some embodiments, the present disclosure relates to a seed, tissue, or plant part of the Brassica plant of any of the above embodiments that includes a reduced activity or a reduced level of a DMR6-1 polypeptide as compared to a corresponding wild type Brassica plant and a reduced activity or a reduced level of a DMR6-2 polypeptide as compared to a corresponding wild type Brassica plant, and wherein the seed, tissue, or plant part includes at least one non-natural mutation in the DMR6-1 gene and at least one non-natural mutation in the DMR6-2 gene.
(65) In some embodiments of any of the above embodiments, the present disclosure relates to a plant part, wherein the plant part is a leaf, a stem, a root, a flower, a seed, a fruit, a cell, or a portion thereof. In some embodiments, the plant part is a leaf.
(66) In some aspects, the present disclosure relates to a pollen grain or an ovule of the plant of any of the above embodiments. In some aspects, the present disclosure relates to a protoplast produced from the plant of any of the above embodiments. In some aspects, the present disclosure relates to a tissue culture produced from protoplasts or cells from the plant of any of the above embodiments, wherein the cells or protoplasts are produced from a plant part selected from the group of leaf, anther, pistil, stem, petiole, root, root primordia, root tip, fruit, seed, flower, cotyledon, hypocotyl, embryo, or meristematic cell. In some aspects, the present disclosure relates to a plant seed produced from the plant of any of the above embodiments.
(67) In order to determine whether a plant is a plant of the present disclosure, and therefore whether said plant has the same alleles as plants of the present disclosure, the phenotype of the plant can be compared with the phenotype of a known plant of the present disclosure. In one embodiment, the phenotype can be assessed by, for example, the susceptibility to downy mildew in a whole plant test assay.
(68) In the whole plant assay, plant with the 1.sup.st leaf pair are inoculated with 210.sup.4 spores (20,000 spores/mL) of a downy mildew isolate (e.g., Hyaloperonospora parasitica/Hyaloperonospora brassicae Y113). Inoculated plants are kept in a climate cell kept at 15 C. with a day-night cycle of 16 hours light-8 hours dark (16:8 cycle). Then, the whole plant downy mildew test results are scored 8 to 9 days after inoculation using the scoring scale in Table 6.
(69) In another embodiment, the phenotype can be assessed by measuring salicylic acid (SA) accumulation in the plant leaves. A plant of the present disclosure will have increased SA accumulation as compared to a WT plant. Methods of measuring SA accumulation are described in Zeilmaker et al. (2015), The Plant Journal, 81: 210-222 and Zhang et al. (2017), Plant Physiology, DOI:10.1104/pp. 17.00695.
(70) In addition to phenotypic observations, the genotype of a plant can also be examined. There are many laboratory-based techniques known in the art that are available for the analysis, comparison and characterization of plant genotype. Such techniques include, without limitation, Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs), Amplified Fragment Length polymorphisms (AFLPs), Simple Sequence Repeats (SSRs, which are also referred to as Microsatellites), and Single Nucleotide Polymorphisms (SNPs). By using these techniques, it is possible to assess the presence of the alleles, genes, and/or loci involved in the downy mildew resistance phenotype of the plants of the present disclosure.
(71) Methods for Obtaining Brassica Plants of the Present Disclosure
(72) Further aspects of the present disclosure relate to methods for obtaining a mutant Brassica plant including: introducing at least one non-natural mutation into the DMR6-1 gene and introducing at least one non-natural mutation into the DMR6-2 gene to produce a mutant Brassica plant with a reduced activity or a reduced level of a DMR6-1 polypeptide as compared to a corresponding wild type Brassica plant and a reduced activity or a reduced level of a DMR6-2 polypeptide as compared to a corresponding wild type Brassica plant. In some embodiments, the mutant Brassica plant exhibits resistance selected from the group of resistance to Hyaloperonospora parasitica/Hyaloperonospora brassicae, intermediate resistance to Xanthomonas campestris campestris, or any combination thereof. In some embodiments, the non-natural mutation is achieved by a mutagenic treatment (e.g., EMS), a radiation treatment, or a gene editing technique. In some embodiments, the gene editing technique is selected from the group of transcription activator-like effector nuclease (TALEN) gene editing techniques, clustered Regularly Interspaced Short Palindromic Repeat (CRISPR/Cas9) gene editing techniques, or zinc-finger nuclease (ZFN) gene editing techniques.
(73) In some embodiments, the mutant Brassica plant produced from the above methods includes at least one non-natural mutation in the DMR6-1 gene and at least one non-natural mutation in the DMR6-2 gene, wherein the plant further comprises a reduced activity or a reduced level of a DMR6-1 polypeptide as compared to a corresponding wild type Brassica plant and a reduced activity or a reduced level of a DMR6-2 polypeptide as compared to a corresponding wild type Brassica plant, and wherein the plant exhibits resistance selected from the group of resistance to Hyaloperonospora parasitica/Hyaloperonospora brassicae, intermediate resistance to Xanthomonas campestris campestris, or any combination thereof. In some embodiments, the mutant Brassica plant produced from the above methods includes least one non-natural mutation in the DMR6-1 gene that reduces an activity or a level of a DMR6-1 polypeptide as compared to a corresponding wild type Brassica plant; wherein the plant includes at least one non-natural mutation in the DMR6-2 gene that reduces an activity or a level of a DMR6-2 polypeptide as compared to a corresponding wild type Brassica plant; and wherein the plant exhibits resistance selected from the group of resistance to Hyaloperonospora parasitica/Hyaloperonospora brassicae, intermediate resistance to Xanthomonas campestris campestris, or any combination thereof. In some embodiments, the DMR6-1 polypeptide is selected from the group of a polypeptide with 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 112; and wherein the DMR6-2 polypeptide is a polypeptide selected from the group of a protein with 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 113. In some embodiments, the DMR6-1 gene is selected from the group of a nucleotide with 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 114; and wherein the DMR6-2 gene is selected from the group of a nucleotide with 85% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 115. In some embodiments that may be combined with any of the above embodiments, the Brassica plant produced from any of the above methods is a plant of the family Brassicaceae (i.e., Cruciferae). In some embodiments, the Brassica plant produced from any of the above methods is Brassica oleracea. In some embodiments, the Brassica plant produced from any of the above methods is a Brassica oleracea cultivar selected from the group of cabbage, kohlrabi, kale, Brussels sprouts, collard greens, broccoli, Romanesco broccoli, or cauliflower. In some embodiments, the present disclosure relates to a seed, tissue, or plant part of the Brassica plant produced from any of the above methods.
(74) The present invention is illustrated in the following examples that are not intended to limit the invention in any way. In the examples reference is made to the figures described above.
EXAMPLE 1
(75) The Arabidopsis DMR6 (At5g24530) Gene is Required for Downy Mildew Susceptibility
(76) Experimental Procedures
(77) Hyaloperonospora parasitica Growth and Infection
(78) H. parasitica isolate Waco9 was provided by Dr. M. Aarts (WUR, Wageningen, NL) and isolate Cala2 provided by Dr. E. Holub (Warwick HRI, Wellsboume, UK) and maintained on Arabidopsis Ws-0 and Ler, respectively. Inocula (400,000 spores per ml) were weekly transferred to 10 day old healthy seedlings (Holub, E. B. et al., Mol. Plant Microbe Interact. 7: 223-239, 1994) by use of a spray gun. Seedlings were air-dried for approximately 45 minutes and incubated under a sealed lid at 100% relative humidity in a growth chamber at 16 C. with 9 hours of light per day (100mE/m2/s). The sporulation levels were quantified 7 days post inoculation (dpi) by counting the number of sporangiophores per seedling, for at least 40 seedlings per tested line (
(79) Generation of Backcrossed Dmr6 Lines
(80) The dmr6 mutants were back crossed twice (BC2) to the parental line Ler eds 1-2 as well as Ler. The BC2 lines generated with Ler were selected for the presence of the wild type EDS1 gene by PCR analysis.
(81) Cloning DMR6
(82) Fine mapping of the dmr6 gene was done with PCR markers designed using the Cereon database to identify insertion and deletion (IND) differences between Col-0 and Ler. The markers: IND_MOP9 in gene At5G24210; IND_K16H17 in gene At5G24420; IND_T4C12 in gene At5G24820; IND_T11H3 in between genes At5G24950_60 and IND_F21J6 in gene At5G25270 were used for mapping (Table 2). An additional screen for new recombinants was initiated on 300 F2 plants resulting in eight F2 recombinant plants between the two IND based markers IND_MOP9 and IND_T4C12, which flanked a region of 61 genes. Seven additional markers (M450-M590; Table 2) reduced the region to eighteen candidate genes for the dmr6 locus, between At5g24420 and At5g24590. Sequence analysis of At5g24530 indicated a point mutation leading to a stop codon in exon 2 in the dmr6-1 mutant.
(83) TABLE-US-00001 TABLE2 PCRprimersforthemarkersusedforthemap-basedcloningofDMR6. INDEL/ Nameprimer Gene enzyme Forwardprimer Reverseprimer IND_MOP9 At5G24210 tttgggaacagaaaaagt catattcaaaagggaaaatc tggaggt(SEQID ccaga(SEQIDNO: NO:37) 38) IND_K16H17 At5g24420 tggggttgtggtttattctg tggccaatagtagttgatac ttgac(SEQID gcaaga(SEQID NO:39) NO:40) IND_T4C12 At5g24820 tctcgggtaagacacaa tattccaacttgcgacgtag gtcgagat(SEQID agcat(SEQIDNO: NO:41) 42) IND_T11H3 At5g24950-60 cggcttttaacaacatattttc ccaattgggttatttacttc gat(SEQIDNO: ca(SEQIDNO:44) 43) IND_F21J6 At5g25270 aacacatcaccaagatg cctctgccccaagaaatatt aatccaga(SEQID gagat(SEQIDNO: NO:45) 46) M450 At5G24450 18 agctttgtatggtagtgcc gcggtatacgggggttaaa aatga(SEQID atcta(SEQIDNO: NO:47) 48) M490 At5g24490 TaqI atggccaaccactctttgt acaagcaagaagaacagc tac(SEQIDNO: gaag(SEQIDNO: 49) 50) M525 At5g24520-30 TaqI gaaatttggttgttggcat tcaagatcttcatattctcatt ttatc(SEQIDNO: cca(SEQIDNO:52 51) M545 At5G24540/50 41 cagctgaagtatgtttcat cttgcaattgttgggactag cccttt(SEQID gtaa(SEQIDNO: NO:53) 54) M555 At5G24550/60 14 tcactaaccagtgaaaaa tatacagcgaatagcaaag ggttgc(SEQID ccaag(SEQIDNO: NO:55) 56) M470 At5g24470 HphI ccgcgagtgtaatatatct cagtttaacgcatgaagtgc ctcct(SEQIDNO: tagt(SEQIDNO: 57) 58) M590 At5g24590 PdmI gcatcatttgtaccgtact tagtggatactctgtccctg gagtc(SEQID aggt(SEQIDNO: NO:59 60)
Identification of a Dmr6 T-DNA Insertion Line
(84) A second dmr6 allele was identified, 445D09 a FLAG T-DNA insertion line generated by INRA Versailles in the Ws-4 accession background. The T-DNA insertion was confirmed by PCR using a primer designed in the At5g24530 gene, LP primer (5-caggtttatggcatatctcacgtc-3) (SEQ ID NO: 108), in combination with the T-DNA right border primer, Tag3 (5-tgataccagacgttgcccgcataa-3) (SEQ ID NO: 109) or RB4 (5-tcacgggttggggtttctacaggac-3) (SEQ ID NO: 110). The exact T-DNA insertion in the second intron of At5g24530 was confirmed by sequencing of amplicons generated with the T-DNA primers from both the left and right border in combination with the gene specific primers LP or RP (5-atgtccaagtccaatagccacaag-3) (SEQ ID NO: 111).
(85) cDNA Synthesis
(86) RNA was isolated (from approximately 100 mg leaf tissue from 10 day old seedlings) with the RNaesy kit (Qiagen, Venlo, The Netherlands) and treated with the RNase-free DNase set (Qiagen). Total RNA was quantified using an UVmini-1240 spectrophotometer (Shimadzu, Kyoto, Japan). cDNA was synthesized with Superscript III reverse transcriptase (Invitrogen, Carlsbad, Calif., USA) and oligo(dT)15 (Promega, Madison, Wis., USA), according to the manufacturer's instructions.
(87) Complementation of the Dmr6-1 Mutant
(88) Complementation lines were generated by transforming dmr6 plants by the floral dip method with Agrobacterium tumefaciens (Clough and Bent, 1998) containing the At5g24530 gene from Col-0 behind the 35S promoter. The construct was generated by PCR amplification of the full length At5g24530 from Col-0 cDNA with primers which included restriction sites that were used for directional cloning. A forward primer (5-ttctgggatccaATGGCGGCAAAGCTGATATC-3) (SEQ ID NO: 1) containing a BamHI restriction site near the start codon (ATG), amplified the 5-end of DMR6 and at the 3-end after the stop codon an EcoRI site was generated with a reverse primer (5-gatatatgaattcttagttgtttagaaaattctcgaggc-3) (SEQ ID NO: 2). The 35S-DMR6-Tn was cloned into the pGreenII0229 (Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S., and Mullineaux, P. M. (2000)). pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 42, 819-832). 300 M DL-Phosphinothricin (BASTA) resistant seedlings were isolated and analyzed for H. parasitica susceptibility and for DMR6 expression levels by RT-PCR.
(89) Knock Down Lines of DMR6 by RNAi
(90) RNAi lines were generated in the Ler eds 1-2 and Col-0 background. A 782 bp long cDNA amplicon of Col-0 At5g24530 gene was generated. The PCR was done with the Phusion DNA polymerase (2 U/L) and two different primer combinations. The amplicon from the first DMR6 gene specific primer combination
(91) TABLE-US-00002 (RNAiDMR6F: (SEQIDNO:3) 5-aaaaagcaggctGACCGTCCACGTCTCTCTGAA-3 and RNAiDMR6R: (SEQIDNO:4) 5-AGAAAGCTGGGTGAAACGATGCGACCGATAGTC-3)
was used as a template for the second PCR amplification with general primers allowing recombination into the pDONR7 vector of the GateWay cloning system. For the second PCR 10 l of the first PCR (denaturation for 30 sec. at 98 C. followed by 10 cycles of: 10 sec. at 98 C.; 30 sec. at 58 C.; 30 sec. at 72 C.) in a total volume of 20 l was used as template. The second PCR (denaturation for 30 sec. at 98 C. followed by 5 cycles of: 10 sec. at 98 C.; 30 sec. at 45 C.; 30 sec. at 72 C. and 20 cycles of 10 sec. at 98 C.; 30 sec. at 55 C.; 30 sec. at 72 C. finished by a final extension of 10 min. at 72 C.) with the attB1 (5-GGGACAAGTTTGTACAAAAAAGCAGGCT-3) (SEQ ID NO: 5) and the
(92) TABLE-US-00003 attB2 (SEQIDNO:6) (5-ggggaccactttgtacaagaaagctgggt-3)
were performed in a 50 l reaction volume. PCR product was gel purified and 50 g insert was recombined into 150 g pDONR7 vector with the clonase BP enzyme. The vector was transformed into electrocompotent DH5a E. coli cells and plasmids containing the correct insert were isolated and 100 g of the pDONR7 with the DMR6 amplicon were used in the LR reaction to recombine the insert in two opposite direction into 150 g3g pHellsgate8 vector. After transformation into E. coli, Spectomycin resistant clones were selected and the isolated plasmids were verified by a NotI digest for the right insert size and by colony PCR with a single internal primer for At5G24530 (DfragmentF: 5-gagaagtgggatttaaaatagaggaa-3) (SEQ ID NO: 7), if the inserts was inserted twice in opposite direction an amplicon of 1420 bp could be detected. Correct pHellsgate8 plasmids with the double insert in opposite directions were transformed into electrocompotent Agrobacterium strain, C58C1. Plasmids were isolated from the Agrobacterium and retransformed into the E. coli to confirm the right size of the plasmid and the insert by NotI digestion. The reconfirmed Agrobacterium strains were used for the floral dip transformation of the Col-0 and Ler eds 1-2 plants. The developed seeds were screened for Kanamycin resistance on GM plates, the T1 seedlings were transferred and the next generation of seeds the T2 was analysed for DMR6 expression and H. parasitica susceptibility.
Gene Expression Profiling of the Dmr6 Mutant
(93) Total RNA was isolated as described above. mRNA was amplified with the MessageAmp aRNA kit (Ambion). CATMA array (Crowe et al., 2003) slides containing approximately 25,000 gene specific tags were hybridized according to standardized conditions described by de Jong et al. (de Jong M., van Breukelen B., Wittink, F. R., Menke, F. L., Weisbeek, P. J., and Van den Ackerveken G. (2006). Membrane-associated transcripts in Arabidopsis; their isolation and characterization by DNA microarray analysis and bioinformatics. Plant J. 46, 708-721). For quantitative PCR, cDNA templates were generated as described previously. Cycle thresholds were determined per transcript in triplicate using the ABI PRISM 7700 sequence detection system (Applied Biosystems, Foster City, Calif., USA) using SYBR Green I (Applied Biosystems, Foster City, Calif., USA) as reporter dye. Primer sets for the transcripts are DMR6 (QDMR6F:5-TGTCATCAACATAGGTGACCAG-3 (SEQ ID NO: 8) and QDMR6R: 5-CGATAGTCACGGATTTTCTGTG-3) (SEQ ID NO: 9), At1g14880 (QAt1g14880F:5-CTCAAGGAGAATGGTCCACA-3 (SEQ ID NO: 10) and QAt1g14880R: 5-CGACTTGGCCAAATGTGATA-3) (SEQ ID NO: 11), At4g14365 (QAt4g14365F: 5-TGGTTTTCTGAGGCATGTAAA-3 (SEQ ID NO: 12) and QAt4g14365R:5-AGTGCAGGAACATTGGTTGT-3) (SEQ ID NO: 13), ACD6 (QACD6F:5-TGGACAGTTCTGGAGCAGAT-3 (SEQ ID NO: 14) and QACD6R: 5-CAACTCCTCCGCTGTGAG-3) (SEQ ID NO: 15), PR-5 (QPR-5F:5-GGCAAATATCTCCAGTATTCACA-3 (SEQ ID NO: 16) and QPR-5R: 5-GGTAGGGCAATTGTTCCTTAGA-3) (SEQ ID NO: 17), PR-2 (QPR-2 F:5-AAGGAGCTTAGCCTCACCAC-3 (SEQ ID NO: 18) and QPR-2R: 5-GAGGGAAGCAAGAATGGAAC-3) (SEQ ID NO: 19), PR-1 (QPR-1F:5-GAACACGTGCAATGGAGTTT-3 (SEQ ID NO: 20) and QPR-1R: 5-GGTTCCACCATTGTTACACCT-3) (SEQ ID NO: 21) and ACT-2 (QACT2 F:5-AATCACAGCACTTGCACCA-3 (SEQ ID NO: 22) and QACT2R: 5-GAGGGAAGCAAGAATGGAAC-3) (SEQ ID NO: 23) generating 100 base pair fragments.
(94) Results
(95) Characterization of the Gene Responsible for Pathogen Resistance in the Dmr6 Mutant
(96) Van Damme et al., 2005, supra disclose a dmr6 mutant that is resistant to H. parasitica. The level of resistance can be examined by counting the number of sporangiophores per seedling seven day post inoculation with the H. parasitica (isolate Waco9 or Cala2, obtainable from Dr. G. Van den Ackerveken, Plant-Microbe Interactions Group, University of Utrecht, Utrecht, NL). The parental line, Ler eds 1-2 (Parker et al., 1996, Plant Cell 8:2033-2046), which is highly susceptible, is used as a positive control (and is set at 100%).
(97) The reduction in sporangiophore formation on the infected dmr6 mutants compared to seedlings of the parental lines is shown in
(98) According to the invention, the gene responsible for resistance to H. parasitica in the dmr6 mutants of van Damme et al., 2005, supra, has been cloned by a combination of mapping and sequencing of candidate genes. Previously, the recessive dmr6 mutation was mapped near the nga139 marker on chromosome 5 to a region encompassing 74 genes. Fine mapping linked the dmr6 locus to a mapping interval containing the BACs T13K7 and K18P6 between the markers At5g24420 and At5g24590 located in the corresponding genes. This allowed the dmr6 interval to be confined to a region of 18 candidate genes. Comparative sequence analysis of the 18 genes in dmr6 and the parental line, Ler eds 1-2 revealed a point mutation in the second exon of the At5g24530 gene. This single base change of G to A, typical for an EMS mutation, changes a TGG a (trp codon) to a TGA (premature stop codon) at nucleotide position 691 of the coding sequence (
(99) At5g24530 is DMR6
(100) A second allele, dmr6-2, was identified in a T-DNA insertion line (FLAG_445D09) from the mutant collection from INRA, Versailles. The presence and location of the T-DNA insert in the second intron of At5g24530 (
(101) To corroborate the idea that At5g24530 is required for susceptibility to H. parasitica the dmr6-1 mutant was transformed with the cDNA from At5g24530 cloned under control of the 35S promoter. In five independent dmr6-1 T2 seedlings the strong overexpression of At5g24530 was confirmed by RT-PCR (data not shown). All T3 lines, homozygous for the transgene, showed restoration of susceptibility to H. parasitica isolate Cala2 (
(102) DMR6 is Transcriptionally Activated During H. parasitica Infection
(103) To study the expression of DMR6 during infection with H. parasitica relative transcript levels were measured by quantitative PCR at six different time points from 0 days (2 hours) post inoculation to 5 days post inoculation (dpi) (
(104) To investigate in more detail how the expression of DMR6 is activated during biotic and abiotic stress, DMR6 reporter lines were generated. The localisation of DMR6 expression was studied in transgenic Col-0 and Ler eds 1-2 plants containing the DMR6 promoter linked to the uidA (-glucuronidase, GUS) reporter gene (pDMR6::GUS). To visualise both H. parasitica hyphal growth, by staining with trypan blue, as well as GUS activity, magenta-Xgluc was used as a 0-glucuronidase substrate yielding a magenta precipitate. In uninfected plants no GUS expression could be detected in the different plant organelles; roots, meristem, flower, pollen and seed. The expression of DMR6 was induced in the compatible interactions, Ler eds 1-2 infected with Cala2 (
(105) The Dmr6-1 Mutant Constitutively Expresses Defence Associated Transcripts
(106) To elucidate how the lack of DMR6 results in H. parasitica resistance, the transcriptome of the dmr6-1 mutant compared to the Ler eds 1-2 parental line was analysed. Probes derived from mRNA of the above-ground parts of 14 day old dmr6-1 and Ler eds 1-2 seedlings were hybridised on whole genome CATMA micro arrays. A total of 58 genes were found to be significantly differentially expressed in dmr6-1, of which 51 genes had elevated and 7 genes had reduced transcript levels. A pronounced set of the 51 induced transcripts have been identified as genes associated with activated plant defence responses, e.g., ACD6, PR-5, PR-4/HEL and PAD4. These data indicate that the loss of DMR6 results in the activation of a specific set of defence-associated transcripts. The finding that DMR6 is among the dmr6-1-induced genes corroborates the idea that DMR6 is defence-associated. To test if the induced expression of the defence-associated genes was due to the loss of DMR6 and not due to additional ethane methyl sulfonate (EMS) mutations remaining in the backcrossed dmr6-1 mutant the transcript level of a selection of genes (At4g14365, At1g14880, ACD6, PR-1, PR-2 and PR-5) was verified by quantitative PCR in both the dmr6-1 and dmr6-2 mutant (
EXAMPLE 2
(107) Identification of DMR6 Orthologs in Crops
(108) 1. Screening of Libraries on the Basis of Sequence Homology
(109) The nucleotide and amino acid sequences of the DMR6 coding sequence and protein of Arabidopsis thaliana are shown in
(110) Table 1 lists the GI numbers (GenInfo identifier) and Genbank accession number for Expressed Sequence Tags (ESTs) and mRNA or protein sequences of the Arabidopsis DMR6 mRNA and orthologous sequences from other plant species. A GI number (GenInfo identifier, sometimes written in lower case, gi) is a unique integer which identifies a particular sequence. The GI number is a series of digits that are assigned consecutively to each sequence record processed by NCBI. The GI number will thus change every time the sequence changes. The NCBI assigns GI numbers to all sequences processed into Entrez, including nucleotide sequences from DDBJ/EMBL/GenBank, protein sequences from SWISS-PROT, PIR and many others. The GI number thus provides a unique sequence identifier which is independent of the database source that specifies an exact sequence. If a sequence in GenBank is modified, even by a single base pair, a new GI number is assigned to the updated sequence. The accession number stays the same. The GI number is always stable and retrievable. Thus, the reference to GI numbers in the table provides a clear and unambiguous identification of the corresponding sequence.
(111) TABLE-US-00004 TABLE 1 Genbank accession numbers and GenInfo identifiers of the Arabidopsis Arabidopsis DMR6 mRNA and orthologous sequences from other plant species Species Common name Detail GI number Genbank Arabidopsis thaliana Thale cress mRNA 42568064 NM_122361 Aquilegia_sp Aquilegia ESTs 75461114 DT768847.1 74538666 DT745001.1 74562677 DT760187.1 75461112 DT768846.1 74562675 DT760186.1 Citrus sinensis Sweet Orange ESTs 5793134 CX672037.1 57933368 CX673829.1 63078039 CX309185.1 Coffea canephora Coffea ESTs 82485203 DV705375.1 82458236 DV684837.1 82461999 DV688600.1 82487627 DV707799.1 Gossypium hirsutum Cotton ESTs 109842586 DW241146.1 48751103 CO081622.1 Sorghum bicolor Sorghum ESTs 45992638 CN150358.1 57813436 CX614669.1 45985339 CN145819.1 57821006 CX622219.1 45989371 CN148311.1 57821495 CX622708.1 45959033 CN130459.1 45985193 CN145752.1 18058986 BM322209.1 45958822 CN130381.1 30164583 CB928312.1 Medicago truncatula Barrel medic Genome MtrDRAFT_AC119415g1v1 draft protein 92878635 ABE85154 Oryza sativa 1 Rice Genome OSJNBb0060I05.4 protein 18057095 AAL58118.1 Oryza sativa 2 mRNA 115450396 NM_001055334 protein 115450397 NP_001048799 Oryza sativa 3 mRNA 115460101 NM_001060186 protein 115460102 NP_001053651 Populus trichocarpa 1 Poplar Genome: LG_XII: 3095392-3103694 protein: Poptr1_1: 569679, eugene3.00120332 Populus trichocarpa 2 Poplar Genome: LG_XV: 201426-209590 protein: Poptr1_1: 732726, estExt_Genewise1_v1.C_LG_XV0083 Solarium lycopersicum 1 Tomato ESTs 62932307 BW689896.1 58229384 BP885913.1 117682646 DB678879.1 5894550 AW035794.1 117708809 DB703617.1 62934028 BW691617.1 15197716 BI422913.1 4381742 AI486371.1 5601946 AI896044.1 4387964 AI484040.1 4383017 AI487646. 5278230 AI780189.1 12633558 BG133370.1 76572794 DV105461.1 117692514 DB718569.1 4385331 AI489960.1 4383253 AI487882.1 4384827 AI489456.1 Solarium lycopersicum 2 Tomato ESTs 47104686 BT013271.1 14685038 BI207314.1 14684816 BI207092.1 Zea mays Maize ESTs 110215403 EC897301.1 76291496 DV031064.1 91050479 EB160897.1 91874282 EB404239.1 110540753 EE044673.1 78111856 DV530253.1 94477588 EB706546.1 71441483 DR822533.1 78111699 DV530096.1 78107139 DV525557.1 76017449 DT944619.1 91048249 EB158667.1 78104908 DV523326.1 78088214 DV516607.1 76291495 DV031063.1 71441482 DR822532.1 78088213 DV516606.1 Vitis vinifera Grape ESTs 33396402 CF202029.1 33399765 CF205392.1 45770972 CN006824.1 45770784 CN006636.1 45770528 CN006380.1 45770631 CN006483.1 33400623 CF206250.1 33396335 CF201962.1 30134763 CB920101.1 30305300 CB982094.1 71857419 DT006474.1 30305235 CB982029.1 Zingiber officinale Ginger ESTs 87108948 DY375732.1 87095447 DY362231.1 87095448 DY362232.1 87094804 DY361588.1 87095449 DY362233.1 87094803 DY361587.1 Lactuca sativa Lettuce Sequence described in this patent application Spinacia oleracea Spinach Sequence described in this patent application Cucumis sativus Cucumber Sequence described in this patent application Nicotiana benthamiana Tobacco Sequence described in this patent application
Identification of Orthologs by Means of Heterologous Hybridisation
(112) The DMR6 DNA sequence of Arabidopsis thaliana as shown in
(113) 3. Identification of Orthologs by Means of PCR
(114) For many crop species, partial DMR6 mRNA or gene sequences are available that are used to design primers to subsequently PCR amplify the complete cDNA or genomic sequence. When 5 and 3 sequences are available the missing internal sequence is PCR amplified by a DMR6 specific 5 forward primer and 3 reverse primer. In cases where only 5, internal or 3 sequences are available, both forward and reverse primers are designed. In combination with available plasmid polylinker primers, inserts are amplified from genomic and cDNA libraries of the plant species of interest. In a similar way, missing 5 or 3 sequences are amplified by advanced PCR techniques; 5RACE, 3 RACE, TAIL-PCR, RLM-RACE or vectorette PCR.
(115) As an example the sequencing of the Lactuca sativa (lettuce) DMR6 cDNA is provided. From the Genbank EST database at NCBI several Lactuca DMR6 ESTs were identified using the tblastn tool starting with the Arabidopsis DMR6 amino acid sequence. Clustering and alignment of the ESTs resulted in a consensus sequence for a 5 DMR6 fragment. To obtain the complete lettuce DMR6 cDNA the RLM-RACE kit (Ambion) was used on mRNA from lettuce seedlings. The 3 mRNA sequence was obtained by using two primers that were designed in the 5 DMR6 consensus sequence derived from ESTs (Lsat_dmr6_fw1: CGATCAAGGTCAACACATGG (SEQ ID NO: 24), and Lsat_dmr6_fw2: TCAACCATTACCCAGTGTGC) (SEQ ID NO: 25) and the 3RACE primers from the kit. Based on the assembled sequence new primers were designed to amplify the complete DMR6 coding sequence from cDNA to provide the nucleotide sequence and derived protein sequence as presented in
(116) The complete DMR6 coding sequences from more than 10 different plants species have been identified from genomic and EST databases. From the alignment of the DNA sequences, conserved regions in the coding sequence were selected for the design of degenerate oligonucleotide primers (for the degenerate nucleotides the abbreviations are according to the IUB nucleotide symbols that are standard codes used by all companies synthesizing oligonucleotides; G=Guanine, A=Adenine, T=Thymine, C=Cytosine, R=A or G, Y=C or T, M=A or C, K=G or T, S=C or G, W=A or T, B=C or G or T, D=G or A or T, H=A or C or T, V=A or C or G, N=A or C or G or T).
(117) The procedure for obtaining internal DMR6 cDNA sequences of a given plant species is as follows:
(118) 1. mRNA is isolated using standard methods,
(119) 2. cDNA is synthesized using an oligo dT primer and standard methods,
(120) 3. using degenerate forward and reverse oligonucleotides a PCR reaction is carried out,
(121) 4. PCR fragments are separated by standard agarose gel electrophoresis and fragments of the expected size are isolated from the gel,
(122) 5. isolated PCR fragments are cloned in a plasmid vector using standard methods,
(123) 6. plasmids with correct insert sizes, as determined by PCR, are analyzed by DNA sequencing,
(124) 7. Sequence analysis using blastX reveals which fragments contain the correct internal DMR6 sequences,
(125) 8. The internal DNA sequence can then be used to design gene- and species-specific primers for 5 and 3 RACE to obtain the complete DMR6 coding sequence by RLM-RACE (as described above).
(126) As an example the sequencing of the Cucumis sativus (cucumber) DMR6 cDNA is provided. For cucumber several primer combinations between the following primers were successful in amplifying a stretch of internal coding sequence from cDNA; forward primers dmr6_deg_fw1B (TTCCAGGTDATTAAYCAYGG) (SEQ ID NO: 26), dmr6_deg_fw2B CATAAYTGGAGRGAYTAYCT) (SEQ ID NO: 27), dmr6_deg_fw3B (GARCAAGGRCARCAYATGGC) (SEQ ID NO: 28) and dmr6_deg_fw4 (AATCCTCCTTCHTTCAAGGA) (SEQ ID NO: 29) and reverse primers dmr6_deg_rv3B (AGTGCATTKGGGTCHGTRTG) (SEQ ID NO: 30), dmr6_deg_rv4 (AATGTTRATGACAAARGCAT) (SEQ ID NO: 31) and dmr6_deg_rv5 (GCCATRTGYTGYCCTTGYTC) (SEQ ID NO: 32). After cloning and sequencing of the amplified fragments cucumber DMR6-specific primers were designed for 5 RACE (Cuc_dmr6_rv1: TCCGGACATTGAAACTTGTG (SEQ ID NO: 33) and Cuc_dmr6 rv2: TCAAAGAACTGCTTGCCAAC) (SEQ ID NO: 34) and 3 RACE (Cuc_dmr6_fw1: CGCACTCACCATTCTCCTTC (SEQ ID NO: 35) and Cuc_dmr6_fw2: GGCCTCCAAGTCCTCAAAG) (SEQ ID NO: 36). Finally the complete cucumber DMR6 cDNA sequence was amplified and sequenced (
(127) Orthologs identified as described in this example can be modified using well-known techniques to induce mutations that reduce the DMR6 expression or activity, to obtain non-genetically modified plants resistant to Fungi or Oomycota. Alternatively, the genetic information of the orthologs can be used to design vehicles for gene silencing, and to transform the corresponding crop plants to obtain plants that are resistant to Oomycota.
EXAMPLE 3
(128) Mutation of Seeds
(129) Seeds of the plant species of interest are treated with a mutagen in order to introduce random point mutations in the genome. Mutated plants are grown to produce seeds and the next generation is screened for the absence of reduction of DMR6 transcript levels or activity. This is achieved by monitoring the level of DMR6 gene expression, or by searching for nucleotide changes (mutations) by the TILLING method, by DNA sequencing, or by any other method to identify nucleotide changes. The selected plants are homozygous or are made homozygous by selfing or inter-crossing. The selected homozygous plants with absent or reduced DMR6 transcript activity are tested for increased resistance to the pathogen of interest to confirm the increased disease resistance.
EXAMPLE 4
(130) Transfer of a Mutated Allele into the Background of a Desired Crop
(131) Introgression of the desired mutant allele into a crop is achieved by crossing and genotypic screening of the mutant allele. This is a standard procedure in current-day marker assistant breeding of crops.
EXAMPLE 5
(132) Use of the DMR6 Promoter for Pathogen-Induced Gene Expression and the Generation of Disease Resistant Plants
(133) Precise control of transgene expression is pivotal to the engineering of plants with increased disease resistance. In the past, constitutive overexpression of transgenes frequently has resulted in poor quality plants. It has therefor been suggested to use pathogen-inducible promoters, by which the transgenes are expressed only when and where they are neededat infection sites.
(134) Local and inducible expression of engineered genes, e.g. master switch genes, elicitor or Avr genes, anti-microbial genes, or toxic genes, results in the activation of defence or cell death that will lead to pathogen resistance, such as described by Gurr and Rushton (Trends in Biotechnology 23: 275-282, 2005). A good example is provided by De wit (Annu. Rev. Phytopathol. 30: 391-418, 1992) who proposes the use of the Avr9-Cf9 combination to achieve induced cell death leading to disease resistance. The tissue-specificity and inducibility of expression is of prime importance for such approaches, as described by Gurr and Rushton (Trends in Biotechnology 23: 283-290, 2005).
(135) According to the present invention, the DMR6 promoter has been demonstrated to show a strong, inducible, localized expression based on promoter-GUS analysis. Thus, the DMR6 promoter is very suitable for engineering disease resistance in transgenic plants. The DMR6 promoter consists of a region of 2.5 kb that is upstream of the Arabidopsis DMR6 coding sequence (ATG start codon) and includes the 5UTR (as depicted in
(136) Using orthologous DNA sequences from a given plant species primers are designed for PCR. These are then used to screen genomic libraries of the plant species of interest to identify the genomic clones that contain the DMR6 ortholog with its promoter and regulatory sequences. Alternatively, the genomic clones are isolated by screening a library with a labelled PCR fragment corresponding to the DMR6 orthologous gene. Sequencing reveals the nucleotide sequence of the promoter. The region of 2-5 kb upstream the DMR6 orthologous coding sequence (ATG start codon), so including the 5UTR, is then amplified by PCR to engineer transgene constructs for plant transformation.
EXAMPLE 6
(137) This example demonstrates the complementation of mutant dmr6-1 in Arabidopsis thaliana by DMR6 orthologs from 4 different crop species. For this, DMR6 orthologs of Cucumis sativa (Cs), Spinacia oleracea (So), Lactuca sativa (Ls) and Solanum lycopersicum (Sl) were cloned into a plant expression vector under the control of the 35S promoter and, subsequently, this vector was transformed into a Arabidopsis thaliana mutant dmr6-1.
(138) Briefly, mRNA was isolated using standard methods and cDNA was synthesized using an oligo dT primer and standard methods. Subsequently, PCR fragments were generated using primer pairs for each crop as depicted in Table 3 below. The generated PCR products were cloned into a pENTR/D-TOPO vector using the pENTR/D-TOPO cloning kit from Invitrogen and resulting plasmids with correct insert sizes, as determined by PCR, were analyzed by DNA sequencing. Recombination to the pB7WG2,0 vector was done using LR clonase II from Invitrogen and the resulting plasmids were analyzed by PCR and digestion with restriction enzymes. Suitable plasmids were transformed into Agrobacterium tumefaciens C58C1 PGV2260 and plasmids from Agrobacterium were analyzed by PCR and digestion with restriction enzymes.
(139) TABLE-US-00005 TABLE3 Primerpairsforcloningdmr6orthologsinasuitableplant expressionvector. Arabidopsis AtDMR6_fw CACCATGGCGGCAAAGCTGAT thaliana A(SEQIDNO:85) AtDMR6UTR_rv GACAAACACAAAGGCCAAAGA (SEQIDNO:86) Cucumissativa cuc_fw CACCATGAGCAGTGTGATGGA GAT(SEQIDNO:87) cucUTR_rv TGGGCCAAAAAGTTTATCCA (SEQIDNO:88) Spinaciaoleracea spi_fw CACCATGGCAAACAAGATATT ATCCAC(SEQIDNO:89) spiUTR_rv TTGCTGCCTACAAAAGTACAA A(SEQIDNO:90) Lactucasativa Lsat_fw CACCATGGCCGCAAAAGTCAT CTC(SEQIDNO:91) LsatUTR_rv CATGGAAACACATATTCCTTCA (SEQIDNO:92) Solanum Slyc1dmr6_fw CACCATGGAAACCAAAGTTAT lycopersicum TTCTAGC(SEQIDNO:93) Slyc1dmr6UTR_rv GGGACATCCCTATGAACCAA (SEQIDNO:94)
(140) Arabidopsis thaliana dmr6-1 plants were transformed with the above constructs by dipping into Agrobacterium solution and overexpression of crops DMR6 in Arabidopsis T1 plants is verified by RT-PCR using the crops DMR6 cloning primers (Table 3). Finally, Arabidopsis T2 and T3 plants were infected with Hyaloperonospora parasitica Cala2 to confirm complementation. The results are shown in
(141) As shown in
EXAMPLE 7
(142) Mutations in the Brassica oleracea DMR6 Genes, DMR6-1 and DMR6-2, Result in Downy Mildew Resistance
(143) Experimental Procedures
(144) Mutation of Seeds
(145) A rapid cycling Brassica oleracea line that is fully susceptible to downy mildew (i.e., Hyaloperonospora parasitica/Hyaloperonospora brassicae) (FastPlantsR, https://fastplants.org/origin/) was used to generate DMR6 mutant lines. B. oleracea contains two DMR6 genes, designated DMR6-1 (BoDMR6_Scf108) and DMR6-2 (BoDMR6_Scf155). The rapid cycling B. oleracea is used as a model plant and as a research tool for B. oleracea, since it is representative of all B. oleracea species. The rapid cycling line is able to interbreed with each other B. oleracea species. It is well known in the art that results obtained using the rapid cycling B. oleracea line are predictive for all B. oleracea species. Knock out mutants with premature stop codons were generated in both genes using EMS mutagenesis, and the mutants in DMR6-1 were designated bodmr6-1 while the mutants in DMR6-2 were designated bodmr6-2. Table 4 shows the sequence details for the mutations in the DMR6-1 and DMR6-2 genes of B. oleracea, whereby three different mutations were identified in the DMR6-1 gene and only one mutation was identified in DMR6-2.
(146) TABLE-US-00006 TABLE 4 Mutations in the DMR6-1 and DMR6-2 genes of the Brassica oleracea rapid cycling line CDS Nucleotide Amino Acid SNP Name in Allele Position Change Change Protein bodmr6-1-1 181 C to T R to STOP R61* bodmr6-1-2 691 C to T Q to STOP Q234* bodmr6-1-3 714 G to A W to STOP W201* bodmr6-2 368 G to A W to STOP W123*
(147) Briefly, the bodmr6-1-1 mutation was at position 181 in the DMR6-1 gene, and it turned a Cytosine (C) into a Thymine (C to T mutation). This mutation resulted in a change at the amino acid level, converting an Arginine (R) at position 61 in the protein into a premature stop codon (R61*). The bodmr6-1-2 mutation was a C to T mutation at position 691 in the DMR6-1 gene that resulted in a change at the amino acid level from a Glutamine (Q) at position 234 in the protein to a premature stop codon (Q234*). The bodmr6-1-3 mutation was a Guanine (G) to an Adenine (G to A mutation) at position 714 in the DMR6-1 gene that resulted in a change at the amino acid level from a Tryptophan (W) at position 201 in the protein to a premature stop codon (W201*). Finally, the bodmr6-2 mutation was a G to A mutation at position 368 in the DMR6-2 gene, which resulted in a change at the amino acid level from a W at position 123 in the protein to a premature stop codon (W123*). These identified mutations are located before an essential iron binding residue which is conserved in all 20G oxygenases; without this residue, 20G oxygenases such as DMR6 are catalytically inactive (Wilmouth et al. (2002), Structure, 10:93-103). Therefore, these premature stop codons cause a complete loss of enzyme function.
(148)
(149) Creating Homozygous DMR6 Mutant Plants
(150) Plants carrying the bodmr6-1-1 and bodmr6-2 mutant alleles were crossed to produce a first segregating F2 population (F2 pop. 1). This F2 population was genotyped to identify the presence of the mutant DMR6-1 and mutant DMR6-2 alleles. Two different genotypes were distinguished, as follows: wild type (i.e., DMR6-1R6-DMR6-1; DMR6-2/DMR6-2), referred to as AA BB, and homozygous double mutant (bodmr6-1-1/bodmr6-1-1; bodmr6-2/bodmr6-2). Plants with these two genotypes were then used in test assays.
(151) Plants carrying the bodmr6-1-2 allele were crossed with plants carrying the bodmr6-2 mutant allele to produce a second segregating F2 population (F2 pop. 2). This F2 population was genotyped to identify the presence of the mutant DMR6-1 and mutant DMR6-2 alleles. Two different genotypes were distinguished, as follows: wild type (i.e., DMR6-1R6-1/DMR6-1; DMR6-2/DMR6-2), referred to as AA BB, and homozygous double mutant (bodmr6-1-2 bodmr6-1-2; bodmr6-2 bodmr6-2). Plants with these two genotypes were then used in test assays.
(152) Plants carrying the bodmr6-1-3 allele were crossed with plants carrying the bodmr6-2 mutant allele to produce a third segregating F2 population (F2 pop. 3). This F2 population was genotyped to identify the presence of the mutant DMR6-1 and mutant DMR6-2 alleles. Two different genotypes were distinguished, as follows: wild type (i.e., DMR6-1/DMR6-1; DMR6-2/DMR6-2), referred to as AA BB, and homozygous double mutant (bodmr6-1-3 bodmr6-1-3; bodmr6-2 bodmr6-2). Plants with these two genotypes were then used in test assays.
(153) Genotyping
(154) Plants were genotyped by PCR and High-Resolution Melting Curve (HRM) using primers and probes (listed in Table 5A and Table 5B) designed to identify the mutant alleles listed in Table 4.
(155) TABLE-US-00007 TABLE5A Primersusedforgenotyping Allele Forward Reverse bodmr6- AGTCCAACAAATCCACCAAGC CCTTTTCAGGCACATAAGTTCA 1-1 (SEQIDNO:116) (SEQIDNO:117) bodmr6- ATTCTTCTCCAAGATGCTACCG GGATTAACGGCGAACCACT 1-2 (SEQIDNO:118) (SEQIDNO:119) bodmr6- CCAAGATGCTACCGTTTGTG TTGATGACAAAAGCATCAGGA 1-3 (SEQIDNO:120) (SEQIDNO:121) bodmr6- CCGAGATTATCGACGAGCTT TTGTCGATAGGATAACAATGA 2 (SEQIDNO:122) AGTC(SEQIDNO:123)
(156) TABLE-US-00008 TABLE5B Probesusedforgenotyping Allele Probe bodmr6-1-1 GCTTGCTCCTGATTCGGGC(SEQIDNO:124) bodmr6-1-2 CGTTTGTGGTCTATAGATCTTGATCGT(SEQID NO:125) bodmr6-1-3 CAGTGATTCGCCGTTAATCCACC(SEQID NO:126) bodmr6-2 GAAGAGGTTAATAATTAGAGAGACTATCTC(SEQ IDNO:127)
(157) The full sequence of the dmr6-1-1 mutant allele is SEQ ID NO: 128, the full sequence of the dmr6-1-2 mutant allele is SEQ ID NO: 129, the full sequence of the dmr6-1-3 mutant allele is SEQ ID NO: 130, and the full sequence of the dmr6-2 mutant allele is SEQ ID NO: 131.
(158) Whole Plant Downy Mildew Test
(159) The F2 pop. 1 B. oleracea plants described above were used to perform the whole plant downy mildew test, which enables phenotyping without wounding or damaging plant tissues. Plants with the first leaf pair were used, as this is the optimal developmental stage for a downy mildew test. Thirteen homozygous mutant plants and fifteen wild type plants were tested.
(160) Plants were inoculated with downy mildew isolate Hyaloperonospora parasitica/Hyaloperonospora brassicae Y113 (collected on B. oleracea in Dannstadt, Germany). At time point 0, plants were inoculated with 210.sup.4 spores (20,000 spores/mL). Once infected, plants were kept in a plastic tent built in a climate cell, which was kept at 15 C. with a day-night cycle of 16 hours light-8 hours dark (16:8 cycle). The plants were scored 8 to 9 days after inoculation using the scoring scale shown in Table 6, below.
(161) TABLE-US-00009 TABLE 6 Whole plant downy mildew test and leaf disc test scoring scale Score Phenotype leaves/leaf discs Assessment 1 100% sporulation, covered with spores Susceptible on both side of the leaf tissue 3 50% sporulation on both side of the leaf Susceptible tissue 5 Less than 25% sporulation on one side Susceptible of the leaf tissue 7 No sporulation, some necrosis Resistant 9 No sporulation/no necrosis Resistant *Even disease scores of 2, 4, 6, and 8 are used to designate intermediate disease severity, i.e., a severity that is in between the neighbouring odd scores.
Leaf Disc Downy Mildew Test
(162) The F2 pop. 1, F2 pop. 2, and F2 pop. 3 B. oleracea plants described above were used in the leaf disc assay, which allows high-throughput disease testing. Plants with four true leaves were used, as this is the optimal developmental stage for leaf disc sampling.
(163) Plants were inoculated with downy mildew isolate Hyaloperonospora parasitica/Hyaloperonospora brassicae Y113 (collected on B. oleracea in Dannstadt, Germany). At time point 0, plants were inoculated with 210.sup.4 spores (20,000 spores/mL). Once infected, plants were kept in a plastic tent built in a climate cell, which was kept at 15 C. with a day-night cycle of 16 hours light-8 hours dark (16:8 cycle). The plants were scored 8 to 9 days after inoculation using the scoring scale shown in Table 6.
(164) Results
(165)
(166)
(167) These results show that homozygous double mutants with all three combinations of mutant alleles (bodmr6-1-1 and bodmr6-2; bodmr6-1-2 and bodmr6-2; or bodmr6-1-3 and bodmr6-2) in B. oleracea are resistant to downy mildew when measured using the leaf disc test. In addition, homozygous double mutants with the alleles bodmr6-1-1 and bodmr6-2 in B. oleracea are resistant to downy mildew when measured using the whole plant test.
EXAMPLE 8
(168) Brassica oleracea Plants with a Double Knockout of DMR6-1 and DMR6-2 have Intermediate Resistance to Xanthomonas campestris Campestris and Resistance to Downy Mildew
(169) Background
(170) The bacterial pathogen Xanthomonas campestris campestris (Xcc) is a major problem in areas with warm and wet conditions. Xcc infects plant leaves by wounds or through the hydathodes, and Xcc race 1 (Xcc 1) and race 4 (Xcc 4) are the most prevalent Xcc races in areas where Brassica crops are grown. Xcc race determination is based on Vicente et al. (2013), Molecular Plant Pathology, 14(1): 2-18.
(171) Experimental Procedures
(172) Plasmids for Gene Editing
(173) Plasmids obtained and methods used were essentially as described by Belhaj et al. (2013), Plant Methods, 9:39. A plasmid with a customized single guide RNA (sgRNA) was created using an oligo (SEQ ID NO: 132). The newly created plasmid and plasmid pICSL11021 (containing CAS9; https://www.addgene.org/49771/) were harvested from E. coli cultures using the Qiagen Maxi prep kit. Plasmids were checked via both Sanger sequencing and restriction analysis and subsequently used for transfection. Mutations obtained in the DMR6-1 and DMR6-2 genes via gene editing (GE) all resulted in frameshift mutations leading to premature stop codons.
(174) Protoplast Transfection and Regeneration
(175) The starting material used for protoplast isolation was 16 to 19 day old leaves of cauliflower (i.e., Brassica oleracea) double haploid (DH) line 194190 in vitro seedlings (susceptible to downy mildew and Xcc). The protoplast isolation protocol was as follows: 1. Cut leaves feather-like in TVL, and keep in dark for 1 hour. 2. Replace TVL with 15 ml 0.6% enzyme solution, and incubate overnight in the dark at 25 C. 3. Filter liquids and tissue residue through 100 m filter (yellow Greiner) and rinse with 30 ml CPW 20S. 4. Transfer to 4 round-bottom tubes. 5. Centrifuge for 10 minutes at 600 rpm without brakes. 6. Collect the floating protoplasts with a pasteur-pipet and transfer them to glass tubes containing W5. 7. Centrifuge for 6 min at 600 rpm with brakes. 8. Discard supernatant, collect the pellets in a glass tube, and fill the tube up with 10 ml of W5. Centrifuge for 6 minutes at 600 rpm with brakes. Repeat once. 9. Count the protoplasts (pps) and adjust to 1,000,000 pps/ml with MaMg.
(176) The isolated protoplasts were then transfected using the CRISPR plasmids. The protoplast transfection protocol was as follows: 1. Add plasmid DNA, 5 g CAS-9-2+20 g gRNA15 sgRNA to the bottom of al0 ml red-capped round-bottom tube. 2. Add 0.5 ml of the 1,000,000 pps/ml MaMg preparation (see step 9 of protoplast isolation protocol), and mix gently. 3. Add 0.5 ml PEG4000 Fluka solution (using a P1000 with a cut-off tip), mix immediately, and leave at room temperature for 20 min. 4. Add 9 ml of W5 and mix carefully. Centrifuge for 6 min at 600 rpm with brakes and repeat once. 5. Take up 80,000 pps/ml B-medium. Add 3 ml per 3 cm TC petri dish and close with parafilm. 6. Place dishes in the dark at 25 C.
(177) Next, the transfected protoplasts were regenerated. The cell division and regeneration protocol was as follows: 1. 9 days after transfection, add 1.5 ml C-medium. 2. 23 days after transfection, transfer calli and medium contained in 1 small dish to 1 deep 9 cm petri dish with 15 ml K3-soft medium. 3. When the calli are 3 mm in size, transfer them to K3-solid medium for regenerating shoots. 4. When shoots formed transfer them to MS20 for rooting.
(178) The composition of the media and stocks used in the protoplast transfection and regeneration processes are shown in Tables 7A and 7B, below.
(179) TABLE-US-00010 TABLE 7A Composition of media and stocks used for protoplast protocols 1 l 0.6% enzyme solution.sup.1,3 10x K3 stock 100 ml Cellulase onozuka R-10 6 g Macerozyme R-10 10 g Sucrose 136.9 g MES 586 mg 2,4-D 1 mg BAP 0.5 mg CPW 20S.sup.1 10x CPW stock 100 ml Sucrose 200 g pH 5.8 MaMg.sup.1 500 ml Mannitol 45 g MgCl.sub.26H.sub.2O 1520 mg MES 500 mg pH 5.6-5.8 1 l K3-soft.sup.2 10x K3 stock 100 ml Sucrose 68.4 g Sea-plaque agarose 2 g BAP 0.5 mg 2,4-D 0.1 mg NAA 0.1 mg pH 5.8 K3-solid.sup.2 10x K3 stock 100 ml Sucrose 5 g Sea-plaque agarose 7 g Zeatin 1 mg BAP 0.5 mg IAA 0.1 mg pH 5.8 .sup.1Filter sterilize; .sup.2Autoclave; .sup.3Store in freezer
(180) TABLE-US-00011 TABLE 7B Composition of media and stocks used for protoplast protocols TVL.sup.2 g/l Sorbitol 54.65 CaCl.sub.22H.sub.2O 7.35 MES 0.586 pH 5.8 mg/l 10x K3 stock.sup.1,3 NH.sub.4NO.sub.3 2500 CaCl.sub.22H.sub.20 3000 KNO.sub.3 25000 MgSO.sub.47H.sub.20 2500 (NH.sub.4).sub.2SO.sub.4 1340 NaH.sub.2PO.sub.4 1500 NaFeEDTA 430 MnSO.sub.41H.sub.2O 100 H.sub.3BO.sub.3 30 ZnSO.sub.47H.sub.2O 20 KI 10 Na.sub.2MoO.sub.42H.sub.2O 2.5 CoCl.sub.26H.sub.20 0.25 CuSO.sub.45H.sub.2O 0.25 Xylose 2500 Myo inositol 1000 ThiamineHCl 100 Nicotinic acid 10 PyridoxinHCl 10 10x CPW stock solution.sup.1,3 KH.sub.2PO.sub.4 272 KNO.sub.3 1010 CaCl.sub.22H.sub.2O 14800 MgSO.sub.47H.sub.2O 2460 KI 1.6 CuSO.sub.45H.sub.2O 0.25 W5.sup.1 g/l CaCl.sub.22H.sub.2O 18.4 NaCl 9 KCl 0.8 Glucose 1 pH 5.8 mg/l B-medium.sup.1 CaCl.sub.22H.sub.2O 750 KNO.sub.3 2500 MgSO.sub.47H.sub.2O 250 (NH.sub.4).sub.2SO.sub.4 134 NaH.sub.2PO.sub.4 150 Na.sub.2EDTA 37.3 FeSO.sub.47H.sub.2O 27.8 MnSO.sub.41H.sub.2O 10 H.sub.3BO.sub.3 3 ZnSO.sub.47H.sub.2O 2 KI 0.75 Na.sub.2MoO.sub.42H.sub.2O 0.25 CoCl.sub.26H.sub.2O 0.025 CuSO.sub.45H.sub.2O 0.025 Myo-inositol 100 ThiamineHCl 10 Nicotinic acid 1 PyridoxineHCl 1 Glucose 20000 Mannitol 70000 NAA 1 BAP 1 2,4-D 0.25 pH 5.8 C-medium.sup.1 NH.sub.4NO.sub.3 200 KH.sub.2PO.sub.4 75 CaCl.sub.22H.sub.2O 525 KNO.sub.3 1250 MgSO.sub.47H.sub.2O 250 (NH.sub.4).sub.2SO.sub.4 67 NaH.sub.2PO.sub.4 75 Na.sub.2EDTA 37.3 FeSO.sub.47H.sub.20 27.8 MnSO.sub.41H.sub.2O 10 H.sub.3BO.sub.3 3 ZnSO.sub.47H.sub.2O 2 KI 0.75 Na.sub.2MoO.sub.42H.sub.2O 0.25 COCl.sub.26H.sub.2O 0.025 CuSO.sub.45H.sub.2O 0.025 Myo-inositol 100 ThiamineHCl 10 Nicotinic acid 1 PyridoxineHCl 1 Glucose 40000 Mannitol 20000 NAA 0.2 BAP 1 pH 5.8 .sup.1Filter sterilize; .sup.2Autoclave; .sup.3Do not adjust pH and store at 0-5 C.
Genotyping of Regenerated Plants
(181) After multiple prescreening rounds of both calli and microcalli, plantlets were genotyped. DNA was isolated from the leaves of plantlets, and two independent DNA isolations were sequenced using amplicon deep sequencing (at least 100 coverage) and results were analyzed using CRISPRESSO (http://crispresso.rocks/) with default settings. The sequencing primers used are shown in Table 8, below, whereby primers B09 and F02 were used together and primers BoDMR6.12ex3f1 BC and BoDMR6.12ex3f1 BC were used together. In addition to genotyping, ploidv of the selected plants was confirmed to be 2N via flow cytometry.
(182) TABLE-US-00012 TABLE8 Sequencingprimersforplantletgenotyping Primername Primersequence B09 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCTTTTG CAGGGAAGTTGTG(SEQIDNO:133) F02 CTCGGCATTCCTGCTGAACCGCTCTTCCGATCTACCGCAA ACGGTAGCATCT(SEQIDNO:134) BoDMR6.12ex3f1 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCAACA BC CATGGCAGTCAAC(SEQIDNO:135) BoDMR6.12ex3r1 CTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGTCGGTA BC TGAGCAGGTAAAC(SEQIDNO:136)
(183) A double knockout (i.e., knockout mutations in both DMR6-1 and DMR6-2) line was generated using the above methods.
(184) Preparation for Xcc Test
(185) The plants used in the Xcc test were control plants, GE plants, and GE.WT plants. The control plants were a panel of three lines: KT38 (susceptible to Xcc), Resistant line 1 (R1; resistant to Xcc 1 and Xcc 4), and Resistant line 2 (R2; resistant to Xcc 1 and Xcc 4). R1 and R2 have been used in Brassica oleracea breeding as sources of resistance, and it is thought that their resistances are classical resistance genes that are race-specific. The control plants were first sown, and then transferred to 1 liter pots. These pots were placed in a clean greenhouse for development. Plants were considered sufficiently mature for testing when they had at least 5 to 6 true leaves.
(186) The GE plants and GE.WT plants were produced as described above. GE plants (cuttings) from in vitro tissue culture were transferred to a GMO greenhouse. The plants were potted in 1 liter pots, and grown in the GMO greenhouse. Plants were considered sufficiently mature for testing when they had at least 5 to 6 expanded leaves.
(187) The pathogens used in the Xcc test were Xcc race 1 (Xcc 1) and Xcc race 4 (Xcc 4) isolates from the pathogen collection. If there were doubts about the purity of the isolate, it was plated on semi-selective media to check whether it was clean before beginning the preparation. For preparation, the chosen isolate was plated on KB plates and grown for 2 days. Then, the bacteria were washed off of the plates and diluted with normal tap water to an OD of 0.4. In these tests, Xcc 1 and Xcc 4 were used, as they are the most prevalent in B. oleracea growing areas, but Xcc 1 and Xcc 6 would have been another option (Vicente et al. (2013), Molecular Plant Pathology, 14(1): 2-18).
(188) Xcc Test Protocol
(189) For testing, a climate cell or greenhouse was used that was kept at 25 C. with a day-night cycle of 16 hours light-8 hours dark (16:8 cycle). In this climate cell or greenhouse, a tent was built to cover the plants so that they could be maintained at high humidity. Inside the tent, containers were used to create a surface for the plants to stand in that could be filled with water. The day before infection, plants were placed in the containers, and the containers were filled with water so that the plants were standing in a shallow layer of water. At this point, a ring was placed on the youngest formed true leaf of the plants if needed.
(190) The plants were infected by spraying them with a fine mist of the bacterial suspension (preparation described above). Then, the tent was closed to maintain humidity. The day after infection, the tent was slightly opened to avoid secondary infections. In order to keep the humidity high during the test, a layer of water was kept in the containers during the first 2 to 3 weeks. After that, the water layer was not maintained so that secondary infections and/or rotting would not occur.
(191) Scoring of local infection began as soon as the first symptoms appeared. Local infection symptoms were scored for all of the leaves that were fully developed at the time of infection. Scoring of systemic infection was done one, two, and three weeks after infection. Systemic infection symptoms were scored for any new leaves that emerged after the infection.
(192) For both local and systemic infections, a scale of 1 to 9 was used to score the severity of infection. Table 9 provides a detailed description of the Xcc test scoring scale. A score of 9 corresponded to a plant that was completely healthy with an absence of symptoms. A score of 1 corresponded to a plant that was completely wilted/dead. At the end of systemic infection scoring, susceptible plants scored 1.
(193) TABLE-US-00013 TABLE 9 Xcc test scoring scale Local infection Systemic infection Infection Infection severity Phenotype severity Phenotype 1 All leaves are more than 1 Plant is dead 50% infected 3 All leaves are less than 50% 3 All new leaves are infected infected 4 More than 2, but not all 4 More than 2, but not all new leaves infected leaves infected 5 1 or 2 leaves infected with 5 1 or 2 new leaves infected with V-shaped lesions V-shaped lesions 7 No clear infection, but some 7 No clear infection, but older leaves show spots leaves show some symptoms 9 Nothing to see, completely 9 Nothing to see, completely clean plant clean plant
Downy Mildew Whole Plant Test G
(194) The downy mildew whole plant test was performed as described in Example 7.
(195) Results
(196)
(197)
(198) For both Xcc 1 and Xcc 4, the local infection score results showed that GE plants were more resistant than GE.WT and KT38 plants. The resistant control plants, R1 and R2, were more resistant than GE plants. The systemic infection score results for both Xcc 1 and Xcc 4 showed that GE plants were more resistant than GE.WT and KT38. The comparison to the resistant controls revealed differences between Xcc 1 and Xcc 4: R1 and R2 plants were more resistant to Xcc 4 than GE plants, but GE, R1, and R2 plants all had a similar resistance to Xcc 1.
(199)
(200) Taken together, these results show that DMR6-1 and DMR6-2 double knockout plants have intermediate resistance to Xcc (i.e., Xcc 1 and Xcc 4) and resistance to downy mildew.
EXAMPLE 9
(201) Testing a Double Knockout of DMR6-1 and DMR6-2 in Brassica Species for Resistance to Downy Mildew and Xcc
(202) Experimental Procedures
(203) Additional cauliflower lines, broccoli lines, and kohlrabi lines containing a double knockout of DMR6-1 and DMR6-2 will be produced using the mutant alleles described in Examples 7 and 8. These double knockout lines will be tested for resistance to downy mildew and Xcc as described in Examples 7 and 8.
(204) Successful lines will be combined with resistant QTL identified from known resistant lines R1 and R2. These lines containing stacked resistant traits will be developed commercially.
(205) Results
(206) The cauliflower lines, broccoli lines, and kohlrabi lines containing a double knockout of DMR6-1 and DMR6-2 are resistant to downy mildew and are intermediate resistant to Xcc. The lines containing stacked resistant traits are resistant to downy mildew and are intermediate resistant to Xcc.