Method of allele specific silencing for the treatment of autosomal dominant Catecholaminergic Polymorphic Ventricular Tachycardia (CPVT)
11591602 · 2023-02-28
Assignee
Inventors
- Silvia G. Priori (Milan, IT)
- Rossana Bongianino (Cura Carpignano, IT)
- Marco Denegri (Stradella, IT)
- Carlo Napolitano (Milan, IT)
Cpc classification
C12N2750/14043
CHEMISTRY; METALLURGY
A61K9/127
HUMAN NECESSITIES
C12N15/1138
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C12N2320/32
CHEMISTRY; METALLURGY
C12N15/1136
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K9/127
HUMAN NECESSITIES
Abstract
The present invention provides a method for the treatment of autosomal dominant Catecholaminergic Polymorphic Ventricular Tachycardia associated with mutations in the cardiac ryanodine receptor type 2 (RYR2) gene, by the use of an AAV mediated RNA interference approach to induce allele specific silencing of mutant mRNA.
Claims
1. A double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a mutant allele of the cardiac ryanodine receptor type 2 (RYR2) gene, comprising a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, and wherein the sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 4 through 18; SEQ ID NOs: 21 through 35; SEQ ID NOs: 38 through 52; SEQ ID NOs: 55 through 69; SEQ ID NOs: 72 through 86; SEQ ID NOs: 89 through 104; and SEQ ID NOs: 107 through 119.
2. The siNA molecule according to claim 1, which is a short interfering RNA (siRNA), a double-stranded RNA (dsRNA), a short hairpin RNA (shRNA), or a circular RNA molecule.
3. The siNA molecule according to claim 1, wherein: a) the antisense strand comprises a sequence that is complementary to at least a part of an RNA associated with the expression of the mutant allele; b) at least some of the nucleotides comprise modifications; and/or c) in the siNA, at least one phosphothioate linkage is present.
4. The siNA molecule according to claim 1, wherein the sense strand comprises TABLE-US-00016 (SEQ ID NO: 112) 5′-UAUUUUGCUUGCAACUUUUAC-3′.
5. The siNA molecule according to claim 3, wherein the modifications comprise 2′0-methyl modifications.
6. The siNA molecule according to claim 5, wherein the modifications comprise a 2′fluoro modification.
7. A composition comprising a recombinant plasmid or viral vector, which expresses the siNA molecule according to claim 1 when delivered to target cells or tissues.
8. The composition according to claim 7, wherein the viral vector is a serotype 9 adeno-associated viral (AAV2/9) vector, a serotype 6 adeno-associated viral (AAV2/6) vector, or a serotype 8 adeno-associated viral (AAV2/8) vector.
9. The composition according to claim 7, further comprising a pharmaceutical carrier or diluent.
10. The composition according to claim 9, wherein the pharmaceutical carrier or diluent is selected from a cationic lipid and a liposome.
11. A method of therapeutically or prophylactically treating a subject suffering from a condition associated with a mutation in the cardiac RYR2 gene, or preventing or reverting structural abnormalities of the calcium release units (CRUs) and in the mitochondria of a subject, the method comprising administering to the subject the SiNA molecule according to claim 1, wherein a) the siNA molecule targets the RNA associated with the expression of the mutant allele of the RYR2 gene of the subject; b) the siNA molecule targets the RNA associated with the expression of a single nucleotide polymorphism (SNP) in the coding region of the RYR2 gene, and said SNP co-segregates with the mutation in the same allele or in the opposite, whereby the RYR2 allele that carries the mutation is silenced; and/or c) the abnormalities are associated with the R4496C mutation in the RYR2 gene.
12. The method according to claim 11, wherein: a) the siNA is expressed from a viral vector delivered to the subject; and/or b) the condition is a cardiac disease.
13. The method according to claim 12, wherein the viral vector is a serotype 9 adeno-associated viral (AAV2/9) vector, a serotype 6 adeno-associated viral (AAV2/6) vector, or a serotype 8 adeno-associated viral (AAV2/8) vector.
14. The method according to claim 13, wherein the AAV2/9 or AAV2/6 or AAV2/8 is delivered to the subject's cardiac myocytes.
15. The method according to claim 11, wherein the condition is catecholaminergic polymorphic ventricular tachycardia (CPVT), arrhythmogenic right ventricular cardiomyopathy (ARVC), idiopathic ventricular fibrillation (IVF) and Hypertrophic cardiomyopathy, or dilated cardiomyopathy due to RYR2 gene mutations.
16. A kit comprising the siNA of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
CLINICAL APPROACH FOR THE APPLICATION OF ALLELE SPECIFIC SILENCING TARGETING SNPs TO SUPPRESS THE MUTANT TRANSCRIPT
(15) The flow chart depicting the steps that in the clinics will be used to choose the suitable siRNA to silence the allele containing the RYR2 mutation is shown in
(16) The therapy will be available in six different products to target the WT or the Mutant variant of each of the 3 SNPs, and siNAs will be developed to target the RNA regions containing the sequences of interest: 1359C; 1359T; 7806C; 7806T; 8873A; 8873G.
(17) Each CPVT patient carrier of a pathogenic mutation in the RYR2 gene who is a candidate for gene therapy through allele specific silencing will be genotyped to determine the co-segregation of the disease causing mutation and the three SNPs.
(18) Once the variant(s) that co-segregate with the mutation is (are) identified, the patient may be suitable to be treated with 1 or 2 or 3 products. The selection of the product to be used will be based on the sequence with the highest selectivity between mutant and WT allele.
(19) In human patients the double-stranded short interfering nucleic acid is targeted to common SNPs including, but not limited to, rs3765097 (c.1359C>T), rs684923 (c.7806C>T) and rs34967813 (c.8873A>G), when they are in heterozygosity, so that they can be used to discriminate the allele carrying the disease causing mutation from the wild-type. This makes possible to generate few siNA sequences that can silence different patient-specific mutations in the RYR2 gene.
(20) In a preferred aspect the engineered pre-siNA (e.g. pre-miRNA) expression cassette is inserted in a vector, preferably into a viral vector. The pre-siNA coding sequence is operably linked to a promoter, which could be CMV, or cardiac specific promoters such as: cTnT, TnC, α-MHC, MLC-2 and other tissue specific promoters.
(21) The engineered pre-siNA expression cassette may be advantageously inserted in the serotype 9 adeno-associated viral (AAV2/9) vector. Alternatively, the engineered pre-siNA expression cassette may be advantageously inserted in the serotype 6 adeno-associated viral (AAV2/6) vector or serotype 8 adeno-associated viral (AAV2/8) vector.
(22) Once the engineered pre-miRNA expression cassette is introduced into the cardiac cells for expression, the pre-miRNA forms an intramolecular stem loop structure similar to the structure of endogenous pre-miRNA that is then processed by the endogenous Dicer enzyme into a mature miRNA (Cullen et al., 2004).
(23) The method according to the present invention allows the correction of the bidirectional and polymorphic arrhythmias in animal models with autosomal dominant CPVT by a viral gene therapy method by which mutant Ryanodine receptor type 2 mRNA is selectively knocked down by an artificially expressed miRNA.
(24) Artificial miRNA expressing vector should be delivered preferably to the cardiac myocytes and expressed, whereby the normal and anti-arrhythmic contractile function of the heart is restored.
(25) In another embodiment, the invention provides a method of in vitro screening of multiple allele-specific siRNA duplexes under heterozygous conditions, comprising co-transfection of two reporter alleles and siRNAs duplexes with known sequence into cultured HEK-293 cells and determining if the mutant allele is substantially silenced while the wild-type allele retains substantially normal expression.
(26) Specifically, the invention provides a method for identifying an siNA capable of selectively silencing a mutant allele of the RYR2 gene compared to the wild-type allele of the RYR2 gene, comprising:
(27) i. co-transfecting HEK-293 cells with mutant and wild-type reporter alleles and a multiplicity of siNA duplexes,
(28) ii. determining if the mutant allele is substantially silenced relative to the wild-type allele, and
(29) iii. determining the siNA associated with the substantial silencing; thereby identifying the siNA capable of selectively silencing the mutant allele relative to the wild-type allele of the RYR2 gene.
(30) In another preferred aspect, the siNA molecule according to the present invention advantageously allows to prevent or revert structural abnormalities of the CRUs and in the mitochondria that are associated with the R4496C mutation in the RyR2 gene.
EXPERIMENTAL SETTING
(31) In this study, the gene is the murine RyR2 (NM_023868.2) and the targeted nucleotide variant is the C13483T on the protein coding mRNA leading to the R4496C amino acid change in the murine RyR2 protein.
(32) Allele specific targeting study to silence the allele that includes the R4496C mutation in the RYR2 gene.
(33) AAV Mediated RNA Interference Approach to Induce Allele Specific Silencing of Mutant Gene in a RyR2.sup.R4496C/+ Mouse Model of Catecholaminergic Polymorphic Ventricular Tachycardia
(34) 1) Screening Multiple siRNAs in a Transient Expression System Using Reporter Alleles
(35) Cellular models were used to test whether it is possible to target mutant allele in a transient expression system. We performed a series of in vitro mRNA and protein based assays to screen multiple potential siRNAs in order to identify siRNAs that would both recognize and efficiently silence the mutated allele preferentially over the wild-type allele.
(36) Using this system, the effects of a series of siRNA duplexes on mutant alleles in allele-specific silencing, as well as off-target silencing against WT alleles, can be examined under heterozygous conditions generated by co-transfecting two reporter alleles and siRNA duplexes into cultured HEK-293 cells (
(37) 1) CMV promoter followed by a reporter gene (Red Fluorescent Protein, RFP) in-frame linked with the murine cDNA sequence, corresponding to the WT-mRYR2 (exons 91 to 96), and to a tag sequence (3xHA) (
(38) 2) CMV promoter followed by a reporter gene (Green Fluorescent Protein, GFP) in-frame linked with the murine cDNA sequence, corresponding to the R4496C-mRYR2 (exons 91 to 96), and to a tag sequence (3xFLAG) (
(39) To induce such allele specific-RNAi, we designed siRNAs that carry nucleotide variations characterizing target disease allele in order to discriminate it from corresponding wild-type allele. Nucleotide sequences of wild-type and mutant RYR2 mRNAs and designed siRNAs are represented below (Table 8) and are based on the sequence of the 5′.fwdarw.3′ sense-strand (passenger) siRNA element; mutant recognition site (MRS) is underlined (Table 8).
(40) TABLE-US-00014 Wild Type RYR2 mRNA: (SEQ ID NO: 105) 5′-AACAGAAGCTGCTGAACTATTTTGCTCGCAACTTTTACAACATGAGA ATGCTGGCC-3′ Mutant RYR2 mRNA: (SEQ ID NO: 106) 5′-AACAGAAGCTGCTGAACTATTTTGCTTGCAACTTTTACAACATGAGA ATGCTGGCC-3′
(41) TABLE-US-00015 TABLE 8 sequences of portion of the wild type and mutant RYR2 cDNA and of the tested siRNA duplexes name Seq 5′.fwdarw.3′ 3′overhang siRYR2-U5 UGCUUGCAACUUUUACAACAU -TT (SEQ ID NO: 107) siRYR2-U6 UUGCUUGCAACUUUUACAACA -TT (SEQ ID NO: 108) siRYR2-U7 UUUGCUUGCAACUUUUACAAC -TT (SEQ ID NO: 109) siRYR2-U8 UUUUGCUUGCAACUUUUACAA -TT (SEQ ID NO: 110) siRYR2-U9 AUUUUGCUUGCAACUUUUACA -TT (SEQ ID NO: 111) siRYR2-U10 UAUUUUGCUUGCAACUUUUAC -TT (SEQ ID NO: 112) siRYR2-U11 CUAUUUUGCUUGCAACUUUUA -TT (SEQ ID NO: 113) siRYR2-U12 ACUAUUUUGCUUGCAACUUUU -TT (SEQ ID NO: 114) siRYR2-U13 AACUAUUUUGCUUGCAACUUU -TT (SEQ ID NO: 115) siRYR2-U14 GAACUAUUUUGCUUGCAACUU -TT (SEQ ID NO: 116) siRYR2-U15 UGAACUAUUUUGCUUGCAACU -TT (SEQ ID NO: 117) siRYR2-U16 CUGAACUAUUUUGCUUGCAAC -TT (SEQ ID NO: 118) siRYR2-U17 GCUGAACUAUUUUGCUUGCAA -TT (SEQ ID NO: 119)
(42) 2) Assessment of Wild Type and Mutant Allele Expression by RealTime PCR, Fluorescence Microscopy and Western Blot in Transiently Transfected Hek293 Cells
(43) The effects of the designed siRNA duplexes on suppression of both the mutant and wild-type alleles have been subsequently examined by RealTime PCR, amplifying with specific primers GFP and RFP gene, to quantify the wild type and mutated allele mRNA respectively (Expression data have been analyzed using the 2.sup.−ΔΔct method, normalized on GAPDH expression and relative to the cells treated with scramble siRNA) (
(44) Most of siRNA duplexes have demonstrated a strong effect in suppressing RYR2 mRNA expression. Moreover, some of them were quite selective for the mutant allele.
(45) Therefore, we choose five siRNAs from this first screening (siRyR-U8, U9, U10, U14 and U16) and deeply analyzed their effect by confocal microscopy, to visualize green and red fluorescence (
(46) 3) Cloning and Validation of the Candidate siRNA into an Artificial miRNA-Expressing AAV Backbone Plasmid
(47) From the previous step we selected siRyR-U10 as the candidate to be cloned into an artificial miRNA expression vector that allows the continuous and long term expression of the silencing molecule.
(48) This siRNA was promising since it induces a weak suppression on the Wild Type allele but a strong silencing on the mutant one.
(49) As an intermediate vector we used the BLOCK-iT™ Pol II miR RNAi Expression Vector (Life Technologies). This vector has a triple advantage over the conventionale Pol III-shRNA expression plasmids:
(50) 1. Polimerase II transcribed artificial miRNAs are expressed at tolerability levels while maintaining potent gene silencing capacities compared to shRNA, that can induce toxicity because of their unregulated and massive expression from Pol III promoters.
(51) 2. Co-cistronic expression of Emerald GFP (EmGFP), results in correlation of EmGFP expression with knockdown from our mi-RNAi.
(52) 3. Strong expression from the CMV immediate early promoter, with the option to use tissue-specific or other regulated promoters (or tissue specific).
(53) Subsequently, a fragment consisting in CMV promoter, EmGFP, pre-miRNA sequence and TKpolyA was amplified from the BLOCK-iT™ Pol II miR RNAi Expression Vector (Life Technologies) and sub-cloned into the adeno associated viral backbone vector pAAV2.1 provided by the Adeno-Associated Virus (AAV) vector Core facility (Tigem, Napoli, Italy) (
(54) The resulting plasmid has been validated by RealTime (
(55) 4) In Vivo Infection of Cardiac Murine Myocytes Using the AAV219 Vector for Efficient miRYR2-U10 Transfer
(56) We infected, by intraperitoneal (I.P.) injection, neonates (P8/P9 after birth) RyR2.sup.R4496C/+ heterozygous mice using 100 μl of serotype 9 adeno-associated viral (AAV2/9) vector containing miRYR2-U10 expressing cassette (
(57) 5) AAV219-miRYR2-U10 Infection Restores the Functional Phenotype of RyR2.sup.R4496C/+ Heterozygous Cardiac Cells
(58) From our previous investigation we knew that CPVT arrhythmias are caused by delayed after depolarizations (DADs) and triggered activity (TA) at the level of a single cardiomyocyte. Using patch clamp techniques (in current clamp mode) we analyzed the development of the DADs and/or TA in basal condition and after adrenergic stimulation.
(59) Epifluorescence signal (from the EmGFP present in our viral construct) was used to differentiate between non-infected (i.e. non-fluorescent) and infected (i.e. green fluorescent) cells and to perform comparative assay of DAD and TA occurrence. Isolated myocytes were paced at 5 Hz frequency at 1.5-fold the diastolic threshold and action potential was continuously recorded. An average of 67% of GFP negative (non-fluorescent) cells presented TA after ISO (30 nM) stimulation, while in the same experimental condition, only 6% of the GFP positive infected cells did (
(60) 6) In Vivo Correction of the Dysfunctional Properties Observed in the RyR2.sup.R4496C/+ mice
(61) We used subcutaneous ECG telemeters to monitor and compare the incidence of arrhythmias in resting conditions and during adrenergic stress induced by epinephrine and caffeine injection.
(62) We know from the previous characterization of our autosomal dominant CPVT mouse model that at least 50%-60% of RyR2.sup.R4496C/+ heterozygous mice present bidirectional ventricular tachycardia during adrenergic stress induced by epinephrine and caffeine injection (Cerrone M et al., 2005). Conversely, when we performed in vivo characterization of the arrhythmogenic substrate in our RyR2.sup.R4496C/+ heterozygous CPVT mouse model infected with AAV9-miRYR2-U10 we observed that on 10 treated mice only one developed ventricular arrhythmias (10%).
(63) We performed experiments to assess whether administration of the therapeutic construct tested in neonatal mice would also be able to revert the arrhythmic substrate in adult mice. We therefore studied a new set of animals comparing arrhythmic events occurring in 8-week old RyR2.sup.R4496C/+ heterozygous mice (Het) versus those observed AAV9-miRYR2-U10 (Het-U10) and AAV9-miRNA-Scramble (Het-SCR) infected RyR2.sup.R4496C/+ heterozygous mice two months after infection (
(64) 7) Morphological Alterations of CRUs in RYR2.sup.R4497C/WT Hearts are Rescued by the AAV2/9-miRYR2-U10 Viral Infection.
(65) We performed electron microscopy on cardiac tissue of WT and RyR2.sup.R4496C/+ heterozygous mice to investigate whether in analogy with mice with recessive CPVT (Denegri M et al., 2014) also mice with the dominant form of CPVT present ultrastructural abnormalities and we observed abnormalities in the structure of the calcium release units (CRUs) (
(66) 8) In Vitro Identification of Allele Specific Silencing Molecules Able to Suppress Expression of Transcripts Containing the rs3765097 (c.1359C>T; p.S453S) or its WT Counterpart in the Human RYR2 Gene.
(67) To transfer the method above described also to the human RYR2 gene and common SNPs that co-segregate with the mutations in the same allele or in the opposite, in a way that the hRYR2 allele in which the mutation is present is silenced, leaving almost unaltered the expression of the wild type RYR2 transcript, we performed a series of in vitro mRNA- and protein-based assays to screen multiple potential siRNAs in order to identify molecules that would both recognize and efficiently silence the SNP containing allele preferentially over the wild-type allele (mimicking the situation in which the SNP is in cis with the mutation) and vice versa (mimicking the situation in which the SNP is in trans with the mutation). The siRNA tested are sequences from SEQ ID NO:4 to SEQ ID NO:18 to target the T-containing allele and from SEQ ID NO:21 to SEQ ID NO:35 to target the C-containing allele.
(68) The effects of tested siRNA duplexes in allele-specific silencing, as well as off-target effects, have been examined under heterozygous conditions generated by co-transfecting two reporter alleles and siRNA duplexes into cultured HEK-293 cells. As reporter alleles, two plasmids were generated containing:
(69) 1) CMV promoter followed by a reporter gene (Red Fluorescent Protein, RFP) in-frame linked with the murine cDNA sequence, corresponding to the WT-hRYR2 (exons 11 to 15), and to a tag sequence (3xHA).
(70) 2) CMV promoter followed by a reporter gene (Green Fluorescent Protein, GFP) in-frame linked with the murine cDNA sequence, corresponding to the S453S-hRYR2 (exons 11 to 15), and to a tag sequence (3xFLAG).
(71) Of interest, several siRNAs targeted to rs3765097 in exon 15 of human RYR2 gene are able to suppress expression of the polymorphism carrier allele leaving minimally altered the expression of the non-carrier one (see
(72) Materials and Methods
(73) Animal Use
(74) Animals were maintained and bred at the Charles River Laboratories in Calco, Italy, and transferred to the Maugeri Foundation for characterization of the phenotype. Animals were maintained and studied according to the protocols approved by the Animal Care and Use facility at the Maugeri Foundation. The adeno-associated virus delivery was via intra-caudal vein and/or intraperitoneal injection of 100-200 μl of purified virus in adult mice (8 weeks old) and/or neonatal mice (before the 9.sup.th day after birth, P9) with a 25 gauge syringe.
(75) Quantitative Real-Time PCR
(76) Real-time PCR was performed using the Bio-Rad CFX96 Real-Time PCR Detection System and analyzed using the Bio-Rad CFX Manager software package (Bio-Rad Laboratories, Inc., USA). Briefly, total RNA was purified with Rneasy mini kit (Qiagen) from Hek293 cells transiently transfected with reporter alleles and siRNA duplexes or with reporter alleles and pAAV2.1-miRyRU10 or pAAV2.1-miRNAscramble. Absorbance at 260 nm (A260) was measured for each RNA sample using the NanoDrop (ND-1000) spectrophotometer (NanoDrop Technologies, Wilmington, Del., USA). A total amount of 1 μg template RNA was used for retrotranscription performed with iScript cDNA Synthesis kit (Bio-Rad Laboratories, Inc., USA). Quantitative real-time PCR analysis was performed in optical 96-well plates using CFX96 detection module (Bio-Rad Laboratories, Inc.) in triplicate with SsoFast EvaGreen Supermix using specific primer mix to selectively amplify GFP or RFP sequence (Forward: 5′-CTATATCATGGCCGACAAGCAG-3′ (SEQ ID NO:120), 5′-GCGTGATGAACTTCGAGGACG-3′ (SEQ ID NO:121) Reverse: 5′-GCTCGTCCATGCCGAGCGTG-3′ (SEQ ID NO:122), 5′-CAGCCCATGGTCTTCTTCTGC (SEQ ID NO:123), FLAG or HA (Forward: 5′-GAACCTCCAGCGATACTGC-3′ (SEQ ID NO:124), Reverse: 5′-CTGGTACCCTTGTCATCGTCATCCTTGTAATCG-3′ (SEQ ID NO:125), 5′-CTGGTAACCTATTAAGCGTAGTCAGGTAC (SEQ ID NO:126), to quantify mutated allele or wild type mRNA respectively, and 20 ng of cDNA template. Values for threshold cycle (Ct) determination were generated automatically by the Bio-Rad CFX Manager software 1.5. GAPDH was used as internal reference using the following primers: Forward: 5′-AAATCCCATCACCATCTTCC-3′ (SEQ ID NO:127) and Reverse: 5′-GGTTCACACCCATGACGAAC-3′ (SEQ ID NO:128).
(77) Florescence Microscopy
(78) Hek293 cells transiently transfected with reporter alleles and siRNA duplexes were fixed on coverslips in 3.7% paraformaldehyde for 10 minutes at room temperature. Coverslips were then washed in PBS with gentle shaking. The cells were washed several times in PBS and mounted on slides with mounting medium (Dako Fluorescent Mounting Medium, Dako North America, Inc, CA). Confocal microscopy was performed with a Leica TCS-SP2 digital scanning confocal microscope equipped with a HCX PL APO 40×/numerical aperture=1.25 oil immersion objective. We used the 488-nm Argon laser line for excitation of EmGFP and 594 nm He/Ne laser line for excitation of RFP. The pinhole diameter was kept at Airy 1. Images were exported to Adobe Photoshop CS3 (Adobe Systems, Mountain View, Calif.).
(79) Immunoblotting
(80) Hek293 cells transiently transfected with reporter alleles and siRNA duplexes or with reporter alleles and pAAV2.1-miRyRU10 or pAAV2.1-miRNAscramble have been lysated in RIPA buffer and total proteins extracted. Total proteins (30 μg/sample, quantified by the BCA assay) were resolved by SDS-gel electrophoresis, Mini PROTEAN TGX Stain-Free 4-15% gradient Gels (BIORAD) using 10× Tris/Glycine/SDS buffer (BIORAD), and blotted on 0.2 μm nitrocellulose using Trans Blot Turbo Transfer System (BIORAD). The membranes were probed with different antibodies: anti-FLAG (F3165, SIGMA), anti-HA (H3663, SIGMA) and anti-Actin (A1978, SIGMA) as reference protein. Secondary antibodies were conjugated with HRP (1:5000, Promega). Specific signals were developed using the Clarity Western ECL substrate (BIORAD) and detected using ChemiDoc MP Imaging System (BIORAD).
(81) ECG Monitoring and Drug Testing
(82) ECG radiotelemetry monitors (Data Sciences International) were implanted subcutaneously under general anaesthesia (Avertin 0.025 mg/kg). Body temperature was maintained at 37° C. by use of a thermally controlled heating pad (Harvard Apparatus). After 72 hours of recovery from surgery, phenotype characterization was performed. First, basal ECG was recorded for 10 minutes looking for the presence of arrhythmias. Subsequently, mice were injected with epinephrine and caffeine (2 and 120 mg/kg, respectively, by I.P.) to induce ventricular arrhythmias under a controlled stimulus. All animal were freely moving while ECG recordings were performed.
(83) Isolation of Adult Mice Ventricular Myocytes
(84) Ventricular myocytes were isolated using an established enzymatic digestion protocol (Hilal-Dandan et al., 2000) from RyR2.sup.R4496C/+ heterozygous mice, RyR2.sup.R4496C/+ heterozygous mice infected with AAV9-miRyR2-U10 and wild-type (WT) mice (8 weeks) of either sex.
(85) Electrophysiological Recordings in Isolated Ventricular Myocytes
(86) Cardiomyocytes were seeded on a glass bottom perfusion chamber mounted on the stage of an inverted microscope. After 5 minutes, the myocytes were bathed with the solution containing (in mmol/L): 140 NaCl, 4 KCl, 2 CaCl.sub.2, 1 MgCl.sub.2, 10 HEPES, and 5 glucose, pH 7.4, with NaOH. A thermostatically controlled heating ring surrounding the dish was used to maintain the bath solution at 35° C. Transmembrane potentials were recorded in whole cell current clamp mode using a MultiClamp 700B amplifier (Axon Instruments). Patch electrodes were pulled from borosilicate glass (WPI, Inc.) on a P-97 horizontal puller (Sutter Instruments). The electrodes had a resistance of 2 to 3 MΩ when filled with patch electrode solutions containing (in mmol/L): 120 potassium aspartate, 20 KCl, 1 MgCl.sub.2, 4 Na.sub.2ATP, 0.1 GTP, 10 HEPES, 10 glucose, pH 7.2, with NaOH. All signals were acquired at 10 kHz (Digidata 1322A, Axon Instruments) and analyzed with the use of personal computer running pCLAMP version 9.2 software (Axon Instruments). Only quiescent, calcium-tolerant, rod-shaped cells with clear cross striations and a resting potential of less than or equal to −80 mV were used for electrophysiological recordings. Myocytes were electrically stimulated by intracellular current injection through patch electrodes using depolarizing pulses with duration of 3 ms and amplitude of 1.5 times the minimal current needed to evoke and action potential. The liquid junction potential between pipette and bath solution was calculated with pCLAMP software and corrected after experiments.
(87) Vector Design and Production
(88) The siRYR2-U10 siRNA duplex sequence, designed to target RYR2 mRNA (NM_023868.2) containing the R4496C mutation, was cloned into an artificial miRNA expression vector, BLOCK-iT™ Pol II miR RNAi Expression vector (Life Technologies, Cat. No: K4936-00), that allows continuous and long term expression of the silencing molecule. The cloning procedure was based on ligation of annealed oligonucleotides (5′TGCTGTAAAAGTTGCAAGCAAAATAGTTTTG 3′ (SEQ ID NO:129), 5′GCCACTGACTGACTATTTTGCGCAACTTTTAC 3′ (SEQ ID NO:130), 5′CCTGGTAAAAGTTGCGCAAAATAGTCAGTCA 3′ (SEQ ID NO:131), 5′GTGGCCAAAACTATTTTGCTTGCAACTTTTAC 3′ (SEQ ID NO:132) with the linearized vector (pcDNA™6.2-GW/EmGFPmiR-(Life Technologies, Cat. No: K4936-00)).
(89) From the obtained plasmid, a fragment consisting in CMV promoter, EmGFP, premiRNA sequence and TKpolyA was amplified by PCR with specific primers (Forward: 5′ TAGCTAGCTGCTTCGCGATGTACGG 3′ (SEQ ID NO:133) and Reverse 5′ GTGAATTCGAACAAACGACCCAACACCCG 3′ (SEQ ID NO:134) including the NheI (Forward) and Eco RI (Reverse) cloning site and inserted into the pre-digested Nhe I-Eco RI sites adeno associated viral backbone vector pAAV-2.1 provided by the Adeno-Associated Virus (AAV) vector Core facility (Tigem, Napoli, Italy). All the used plasmids were sequenced.
(90) The AAV production was done in collaboration with the Tigem core facility (http://www.tigem.it/core-facilities/adeno-associated-virus-aav-vector-core). The AAV vectors were produced using a transient transfection of 3 plasmids in 293 cells: pAd helper, pAAV rep-cap (packaging), pAAV Cis (including our insert, miRYR2, cloned in the pAAV2.1-CMV-eGFP plasmid MCS). The vectors were purified by CsCl centrifugation and undergo quality control such as Real Time PCR and Dot Blot analysis for physical titer, or Comassie staining of SDS PAGE to evaluate the presence and purity of capsid proteins, the infectivity (eGFP.sup.+ cells/ml, only for CMV-eGFP preps) and the sterility (for preps to be used in large animals). The service returned with a viral preparation in PBS with a total yield >1×10.sup.12 genome copies. All AAV stocks were frozen at −80° C. in single vial and thawed during the surgical procedure.
(91) Electron Microscopy
(92) Hearts isolated from WT, heterozygous RyR2.sup.R4496C/+ and infected heterozygous RyR2.sup.R4496C/+ mice, were fixed by retrograde aortic perfusion with 3.5% glutaraldehyde in 0.1 mol/L NaCaCo buffer (pH 7.2) and analyzed. Small bundles of papillary muscles were post-fixed in 2% OsO.sub.4 in NaCaCo buffer for 2 hours and then block-stained in saturated uranyl acetate. After dehydration, specimens were embedded in an epoxy resin (Epon 812). Ultrathin sections were cut in a Leica Ultracut R microtome (Leica Microsystem, Austria) using a Diatome diamond knife (Diatome Ltd. CH-2501 Biel, Switzerland) and double stained with uranyl acetate and lead citrate. All sections were examined with an FP 505 Morgagni Series 268D electron microscope (FEI Company, Brno, Czech Republic), equipped with Megaview III digital camera and Soft Imaging System (Munster, Germany). The percentage of cardiac cells exhibiting severe structural alterations was quantified. Cells considered severely damaged are characterized by severe structural abnormalities affecting mitochondria in the majority of the interior. In most cases cardiac cells with severely altered mitochondria also present large area of apparently empty cytoplasmic spaces and alterations affecting contractile elements.
Abbreviations
(93) The following abbreviations have been used in the present specification: CASQ2, calsequestrin 2; CPVT, Catecholaminergic Polymorphic Ventricular Tachycardia; CICR, Calcium Induced Calcium Release; CRU, calcium release unit; DAD, Delayed afterdepolarization; EC coupling, excitation-contraction coupling; ECG, electrocardiogram; CMV, Citomegalovirus; GFP, green fluorescent protein; RFP, red fluorescent protein; AAV, Adeno Associated Virus; EP, electrophysiology; I.P., intraperitoneal; ISO, isoproterenol; RYR2, ryanodine receptor type 2; WT, Wild type; siRNA, small interfering RNA; miRNA, microRNA; SNP, Single Nucleotide Polimorphisms; HA, Human influenza hemagglutinin; MRS, Mutant Recognition Site; RNAi, RNA interference; TK polyA, HSV thymidine kinase (TK) polyadenylation signal sequence.
REFERENCES
(94) 1. Priori S G, Napolitano C, Colombo B, Memmi M, Bloise R. Mutations of the cardiac Ryanodine receptor (RYR2) gene are associated to heterogeneous clinical phenotypes and high lethality. Circulation 2001; 104 (suppl II):335. 2. Lahat H, Pras E, Olender T, Avidan N, Ben Asher E, Man O, Levy-Nissenbaum E, Khoury A, Lorber A, Goldman B, Lancet D, Eldar M. A missense mutation in a highly conserved region of CASQ2 is associated with autosomal recessive catecholamine-induced polymorphic ventricular tachycardia in Bedouin families from Israel. Am J Hum. Genet. 2001; 69:1378-1384. 3. Bers, D. M. Cardiac excitation-contraction coupling. Nature 415, 198-205 (2002). 4. Franzini-Armstrong, C., Protasi, F. & Tijskens, P. The assembly of calcium release units in cardiac muscle. Ann. NY Acad. Sci. 1047, 76-85 (2005). 5. Pieske, B., Maier, L. S., Bers, D. M. & Hassenfuss, G. Ca.sup.2+ handling and sarcoplasmic reticulum Ca.sup.2+ content in isolated failing and nonfailing human myocardium. Circ. Res. 85, 38-46 (1999). 6. Venetucci L, Denegri M, Napolitano C, Priori S G. Inherited calcium channelopathies in the pathophysiology of arrhythmias. Nat Rev Cardiol. 9(10), 561-75 (2012). 7. Liu N, Colombi B, Memmi M, Zissimopoulos S, Rizzi N, Negri S, Imbriani M, Napolitano C, Lai F A, Priori S G. Arrhythmogenesis in Catecholaminergic Polymorphic Ventricular Tachycardia. Insights From a RyR2 R4496C Knock-In Mouse Model. Circulation Research 2006; 99:292-298. 8. Cerrone M, Colombi B, Santoro M, Raffale di Barletta M, Scelsi M, Villani L, Napolitano C, Priori S G. Bidirectional Ventricular Tachycardia and Fibrillation Elicited in a Knock-In Mouse Model Carrier of a Mutation in the Cardiac Ryanodine Receptor (RyR2). Circulation Research 2005; 96:e77-e82. 9. Denegri M, Bongianino R, Lodola F, Boncompagni S, DeGiusti V C, Avelino-Cruz J E, Liu N, Persampieri S, Curcio A, Esposito F, Pietrangelo L, Marty I, Villani L, Moyaho A, Baiardi P, Auricchio A, Protasi F, Napolitano C, Priori S G. A single delivery of an adeno-associated construct to transfer casq2 gene to knock-in mice affected by catecholaminergic polymorphic ventricular tachycardia is able to cure the disease from birth to advanced age Circulation. 2014; 129(25):267381 10. Elbashir S M, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001 May 24; 411(6836):494-8 11. Hilal-Dandan, R., Kanter, J. R. & Brunton, L. L. Characterization of G-protein signaling in ventricular myocytes from the adult mouse heart: differences from the rat. J. Mol. Cell. Cardiol. 32, 1211-1221 (2000).