DNA CONSTRUCT FOR STABLY PRODUCING EMPTY CAPSIDS OF THE FOOT-AND-MOUTH DISEASE VIRUS IN MAMMALIAN CELLS; PROCESSES, USES, AND COMPOSITIONS THEREOF
20240010686 ยท 2024-01-11
Assignee
- Instituto Nacional de Tecnologia Agropecuaria (Ciudad Automona de Buenos Aires, AR)
- National Research Council Of Canada (Ottawa, CA)
Inventors
- Ana Clara Mignaqui (Rio Negro, AR)
- Andres Wigodorovitz (Buenos Aires, AR)
- Yves Durocher (Montreal, CA)
Cpc classification
C12N7/045
CHEMISTRY; METALLURGY
International classification
C12N15/63
CHEMISTRY; METALLURGY
Abstract
Methods and compositions for increasing the production of large amounts of empty capsids of the foot-and-mouth disease virus (FMDV) in a stable manner in mammalian cells by regulating the expression of FMDV 3C protease. The instant methods and compositions are based on the fact that a decreased expression of 3C protease results in a reduced cell toxicity and an increased synthesis of viral capsid proteins, as well as production of recombinant empty capsids. The invention provides recombinant plasmids that direct the expression of P1, 3C, and the use of the plasmids for producing new stable cell lines capable of generating high titers of FMDV empty capsids. The invention provides methods for regulating the expression of the FMDV 3C protease gene at a transcriptional and translational level in order to achieve the required process level of 3C protease for the selection process, as well as the production process.
Claims
1. A DNA construct for producing empty capsids of the foot-and-mouth disease virus comprising: a) a nucleotide sequence encoding a P1 polyprotein, b) a nucleotide sequence encoding a 3C protease; and c) at least one promoter, wherein the nucleotide sequence encoding the 3C protease comprises a modified translation start codon.
2. The DNA construct according to claim 1, wherein the nucleotide sequence encoding the P1 polyprotein is a sequence having at least 70% identity to SEQ ID NO:12.
3. The DNA construct according to claim 1, wherein the nucleotide sequence encoding the 3C protease is a sequence having at least 90% identity to SEQ ID NO:2.
4. The DNA construct according to claim 1 wherein the nucleotide sequence encoding the P1 polyprotein is a sequence having at least 90% identity to SEQ ID NO:1.
5. The DNA construct according to claim 1, wherein the promoter regulating the 3C protease is a coumate-inducible promoter (CR1).
6. The DNA construct according to claim 1, wherein the promoter regulating the P1 polyprotein is a coumate-inducible promoter (CR5).
7. The DNA construct according to claim 1, wherein the modification of the translation start codon comprises changing ATG by ACG.
8. The DNA construct according to claim 1, further comprising: a coumate-inducible promoter (CR5) operably linked to the nucleotide sequence encoding a P1 polyprotein; a coumate-inducible promoter (CR1) operably linked to the nucleotide sequence encoding a 3C protease, wherein the nucleotide sequence encoding the 3C protease comprises a translation start codon sequence that is ACG.
9. A vector comprising the DNA construct of claim 1.
10. A cell transformed with the vector of claim 9.
11. The cell according to claim 10, wherein is a mammalian cell.
12. A process for producing empty capsids of the foot-and-mouth disease virus comprising the following steps: a. transfecting cells with the DNA construct of claim 1; b selecting the specific clones c. growing the cells; and d. recovering the empty capsids.
13. The process according to claim 12, wherein in step c. the cells are grown in the presence of an expression inducer.
14. The use of the empty capsids obtained with the process of claim 12, for preparing a vaccine against the foot-and-mouth disease.
15. A vaccine composition comprising empty capsids of the foot-and-mouth disease virus obtained using the process of claim 12; excipients, and/or adjuvants.
16. The composition according to claim 15, wherein the adjuvant is an oil adjuvant.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
DETAILED DESCRIPTION OF THE INVENTION
[0040] The different expression technologies have limitations when it comes to consider the production of a vaccine against the foot-and-mouth disease, in particular due to the great amount of doses required to meet market needs.
[0041] An inducible promoter, for example, coumate together with the use of a 3C protease with a mutation of its start codon of ATGxACG allows for developing stable lines which express higher levels and yields of empty capsids as compared to other heterologous expression systems.
Definitions
[0042] P1 may have the nucleotide sequence of SEQ ID NO:1 corresponding to the modified wild type sequence comprising expression codons in mammalian cells or any P1 sequence of any serotype of the foot-and-mouth disease virus, or modified or optimized sequences to be expressed in mammalian cells. In one embodiment, the nucleotide sequence encoding a P1 polyprotein has a sequence identity to SEQ ID NO:12 from 70% to 99%, or from 90 to 99% to SEQ ID NO:1. More specifically, the nucleotide sequence encoding a P1 polyprotein has a sequence identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to the full-length sequence of SEQ ID NO:12. [0043] 3C may have the nucleotide sequence of SEQ ID NO:2, or any known sequence of different serotypes of the foot-and-mouth disease virus, wherein the nucleotide sequence encoding the 3C protease has a sequence identity to SEQ ID NO:2 from 90% to 99%. More specifically, the sequence encoding a 3C protease has a sequence identity of at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to full-lenght SEQ ID NO:2 [0044] Apaf is a weak sequence (internal ribosome entry site (IRES) shown in SEQ ID NO:3 [0045] CR1 and CR5 are coumate-inducible promoters and are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively. [0046] CMV is a cytomegalovirus promoter [0047] CymR is a transcriptional regulator (Poulain et al., 2017, Journal of Biotechnology 255; 16-27)
[0048] VLPs or empty capsids are a virus-like particle. These particles are similar to a virus of, in this case, the foot-and-mouth disease but they are not infectious because they lack the viral genetic material.
[0049] As used herein, the term modified start codon refers to a translation start codon that is different from AUG (or, when referring to a DNA sequence, ATG). Examples of modified start codons that may start the translation in eukaryotes are provided in Kearse et al, Genes & Development, 2017, 31: 1717-1731, and include CUG, GUG, UUG, ACG, AUC, AUU, AAG, AUA, and AGG. The efficiency of translation start with a modified codon typically is lower than translation start efficiency when the start codon is AUG. From Kearse et al. (supra), it would appear that CUG generally is the most efficient start codon; followed by GUG, ACG, and AUU.
[0050] The following plasmids were constructed. They are summarized in
[0058] All plasmids were sequenced.
[0059] ATG 3C refers to the natural 3C sequence of SEQ ID NO:2 and ACG 3C refers to the mutated 3C sequence, where the translation start codon ATG was changed to the ACG codon.
[0060] Two experiments were carried out with the constructed plasmids to develop stable cell cultures.
[0061] The first experiment was performed with the plasmids pTT81-P13C and pTT81-P1. Six attempts to obtain stable cell cultures were carried out using these plasmids. On one hand, two concentrations of the selection agent were used, 25 and 50 M of MSX. [0062] i. On the other hand, the following combinations of plasmids were used: pTT81-P13C, pTT81-P1 and 95% pTT81-P1+5% pTT81-P13C (a combination that was selected because in transient expression experiments that combination resulted in increased yields of empty capsids in CHO cells).
[0063] That is, the following attempts were made:
[0064] Stable cell cultures obtained using a concentration of 50 M of MSX: [0065] 1. 100% pTT81-P13C [0066] 2. 100% pTT81-P1 [0067] 3. 95% pTT81-P1+5% pTT81-P13C
[0068] Stable cell cultures obtained using a concentration of 25 M of MSX: [0069] 1. 100% pTT81-P13C [0070] 2. 100% pTT81-P1 [0071] 3. 95% pTT81-P1+5% pTT81-P13C
[0072] In both cases, a parallel process was also performed using the plasmid pTT0-GFP that lacks the selection gene present in pTT81 and functions as a process control. In Table 1 and
TABLE-US-00001 TABLE 1 Cell viability in the cell selection process with MSX from the day of transfection (day 0). Viability (%) Viability (%) 50 um MSX 25 um MSX 95% + 95% + P13C P1 5% GFP P13C P1 5% GFP 0 99.5 99.5 99.5 99.5 0 99.5 99.5 99.5 99.5 1 54.1 62.3 67.2 79.2 1 54.1 62.3 67.2 79.2 4 19.8 50.8 37.7 79.2 4 19.8 50.8 37.7 79.2 6 1 60 30.9 3 6 11 54.6 48.1 8 8 0 70.7 34.2 2.3 8 7 70.1 61.4 2.3 11 0 90.4 72.6 0 11 15 91.7 85.1 0 13 0 96.8 89.4 0 13 41 96.9 95.6 0 15 0 97.6 96.8 0 15 77.1 98.7 98.4 0 18 0 98.5 98.6 0 18 97 99.1 98.7 0 20 0 98.9 99.3 0 20 99.2 99.5 99.5 0 22 0 99.2 99.3 0 22 99.7 98.9 99.7 0 26 0 99 99 0 26 99.1 99.5 99.2 0
[0073] Once the selection process concluded, two processes were carried out: on one hand, stable cell cultures were frozen for further cell cloning if promisory results were obtained and, on the other, induction assays were carried out with the stable cell cultures and protein expression was analyzed by Western Blot.
[0074] It should be noted that with plasmid pTT81-P13C and 50 M of MSX no clone could be selected. That is, all cells died during the selection process. In the case of plasmid pTT81-P13C and 25 M of MSX, cultures could be recovered although extremely low viabilities were achieved.
[0075] These results are attributable to the expression of the 3C protease, since although the system is inducible there is always a base expression that may affect the selection process in case the protein is toxic and does not lead to stable cultures.
[0076] The first induction assay was carried out with the stable cell cultures obtained after transfection with pTT81-P1 and with the combination of 95% pTT81-P1 and 5% pTT81-P13C, both selected with 25 as well as 50 M of MSX. Cells were seeded at 0.510.sup.6 cells/mL 15 days post-transfection (dpt) and were induced 18 dpt with 2 g/mL of coumate. Samples were taken the day of the induction and 1, 2, 3, and 4 days post-induction (dpi). Samples were processed to extract proteins from the cells. In addition, cell lysates were analyzed by Western Blot (
[0077] As shown in
[0078] The second induction assay was carried out with all the stable cell cultures obtained after transfection with pTT81-P1 and with the combination of 95% pTT81-P1 and 5% pTT81-P13C, selected with 25 as well as 50 M of MSX and with pTT81-P13C only selected with 25 M of MSX. Cells were seeded at 110.sup.6 cells/mL 18 dpt and induced 20 dpt with 2 g/mL of coumate. Samples were collected on the day of induction and 1 and 2 dpi. Samples were processed to extract proteins from the cells. In addition, cell lysates were analyzed by Western Blot (
[0079] Again, it was only possible to detect a P1 polyprotein by Western Blot both in cells transfected with pTT81-P1 as well as in cells transfected with the combination of 95% pTT81-P1 and 5% pTT81-P13C.
[0080] In the case of a stable culture selected by transfection with plasmid pTT81-P13C it was not possible to detect specific bands by Western Blot. However, after analyzing the samples by ELISA it was possible to detect the specific protein 1 dpi but with a very low yield (100 ng/mL).
[0081] Interestingly, it is worth noting that a base expression of about 10 ng/mL could be detected by ELISA on the day of induction in stable cultures obtained with the plasmid pTT81-P13C. This might indicate that the cells only tolerate a very low base expression of 3C protease. In view of these results, subsequent approaches of stable cell cultures were performed in such a way that expression of 3C protease was reduced and toxicity levels tolerated by the cells were achieved.
[0082] In order to obtain FMDV VLPs, it was essential to work with a construct comprising in the same plasmid both the polyprotein and the 3C protease but regulated in such a manner that more P1 polyprotein than 3C protease was obtained, so that the level of 3C protease would be sufficiently low as to be tolerated by the cells during the selection process and in the induction assays, but at the same time high enough to achieve a complete cleavage of the P1 polyprotein. In these cases, plasmids pTT81-P13C, pTT81-P1 Apaf ATG 3C, pTT81-P1 Apaf ACG 3C, pTT81-P1-CR1 ATG 3C, pTT81-P1-CR1 ACG 3C were used. These plasmids were designed to express P1 polyprotein and 3C protease in unequal amounts. In turn, since it was necessary to decrease base expression levels of 3C protease, plasmid pTT81-CMV-CymR was also constructed encoding a repressor under a constitutive promoter, but in a plasmid with MSX as selection agent. Increasing the repressor levels could help to decrease the base expression of the system and achieve production of stable cell cultures expressing FMDV empty capsids. This repressor was already expressed in the CHO.sup.BRI cell line, but this strategy allows for increasing its levels. In this assay, the process was performed using a single concentration of 50 M of MSX and, as in the previous experiment, a parallel process was carried out with the pTTO-GFP plasmid that does not have the selection gene present in pTT81 and that acts as a process control.
[0083] In brief, the following experiments were carried out, with transfection of CHO cells using the following plasmids and plasmid combinations: [0084] 1. pTT81-P13C [0085] 2. pTT81-P1 Apaf ATG 3C [0086] 3. pTT81-P1 Apaf ACG 3C [0087] 4. pTT81-P1-CR1 ATG 3C [0088] 5. pTT81-P1-CR1 ACG 3C [0089] 6. pTT81-P13C+10% pTT81-CMV-CymR [0090] 7. pTT81-P1 Apaf ATG 3C+10% pTT81-CMV-CymR [0091] 8. pTT81-P1 Apaf ACG 3C+10% pTT81-CMV-CymR [0092] 9. pTT81-P1-CR1 ATG 3C+10% pTT81-CMV-CymR [0093] 10. pTT81-P1-CR1 ACG 3C+10% pTT81-CMV-CymR [0094] 11. pTT0-GFP
[0095] Cell viability of the cultures was tested during the selection process; see Table 2 and
TABLE-US-00002 TABLE 2 Cell viability in the cell selection process with MSX from the day of transfection (day 0). Viability (%) 50 um MSX 1 2 3 4 5 6 7 8 9 10 11 0 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 98.8 1 68.3 78.4 77.4 56.7 68.3 70.7 73.1 81.1 67.6 77.4 75.0 4 39.4 57.5 67.6 28.7 37.8 38.2 64.9 86.2 35.6 50.0 54.1 6 17.0 71.2 71.9 13.0 43.3 21.9 72.7 86.6 20.8 62.1 9.7 8 7.8 79.5 82.0 6.6 59.4 14.6 84.4 91.5 11.9 61.2 2.8 11 0.0 94.7 90.5 0.0 86.1 26.3 94.5 95.7 21.0 85.4 0.0 13 0.0 98.6 97.0 0.0 94.7 59.6 98.2 98.0 45.2 95.2 0.0 15 0.0 98.7 98.5 0.0 96.9 86.3 98.7 99.1 76.2 97.5 0.0 18 0.0 99.1 99.2 0.0 97.2 97.8 99.3 98.8 97.4 98.5 0.0 20 0 99.6 99.3 0 98.7 98.7 99.4 99.4 98.5 99.2 0 22 0 99.7 99.7 0 97.7 99.2 99.8 99.8 99.3 99.5 0
[0096] After the selection process, two procedures were carried out as in the first selection assay. On one hand, stable cultures were frozen for their conservation and subsequent cell cloning and, on the other, stable cultures were induced and protein expression was analyzed.
[0097] The first induction assay was carried out with the stable cultures that survived the selection process. Cells were induced with 2 g/mL of coumate. Samples were taken on the day of the induction and 1, 2 and 3 dpi. Samples were processed to extract proteins from the cells and the cell lysates were analyzed by Western Blot. In the first Western Blot only times 0, 1 and 2 dpi were analyzed (
[0098]
[0099] To determine the expression curve of VLPs in the system of stable inducible cell cultures, lysates of culture No. 5 (P1-CR1-ACG3C) were analyzed by Western Blot at harvest times of 0, 1, 2 and 3 dpi (
[0100] In an additional experiment, the stable cell cultures obtained with the plasmid pTT81-P1-CR1-ACG-3C, with and without the addition of pTT81-CMV-CymR, were induced with two inducer concentrations (2 and 5 g/mL of coumate) to determine if an increase of inducer concentration had any effect on the achieved expression levels (
[0101] The cell lysates obtained in the induction assays using the stable cell cultures obtained with construct pTT81-P1-CR1-ACG-3C and with construct pTT81-P1-CR1-ACG-3C and addition of 10% pTT81-CMV-CymR were analyzed by sucrose gradient to evaluate a correct formation of the VLPs (
[0102] The yield obtained by ELISA in induction assay No. 1 was evaluated at 24 hpi with the stable cell culture obtained with construct pTT81-P1-CR1-ACG-3C and with construct pTT81-P1-CR1-ACG-3C and the addition of 10% pTT81-CMV-CymR (No. 5 and No. 10). Yields thus obtained were of 3.6 and 3.3 g/mL, respectively, and in other assays using productive and cell cloning strategies, an increase of 3-15 was achieved. (about 10 to 50 g/mL).
[0103] As can be seen in
[0104] It is important to note that the invention uses mammalian cells as an expression platform. The use of mammalian cells represents an advantage as it implies the use of the platform traditionally employed for producing vaccines against the foot-and-mouth disease, with all the advantages it implies at an industrial level as well as in terms of safety regarding regularly applying the vaccine.
[0105] Particularly, the CHO cells that were used grow in suspension in certain fetal bovine serum-free media, where they reach high cell densities, yielding high productivity and low risks associated with the use of products of animal origin. Due to the extensive experience in the biopharmaceutical industry regarding production of recombinant proteins in CHO cells (70% of the approved products are produced in CHO cells), there is great availability and variety of media that may be used to perform the claimed process.
[0106] After completing the development, it is only required to grow the cells and add the inducer to start the production. When working with a clonal line, repeatability among batches is granted.
[0107] Finally, since the 3C protease is widely conserved among the various FMDV serotypes, the 3C protease gene mutated in the start codon, ATGACG, yields stable lines producing empty capsids of all viral serotypes only by replacing the polyprotein in the plasmid used for the transfection. This ability of 3C protease of one serotype to cleave the P1 polyprotein of various serotypes is shown in
[0108] This invention is better illustrated in the following examples, which should not be construed as a limitation of its scope. On the contrary, it should be clearly understood that after reading the present description other embodiments, modifications and equivalents thereof may be possible, which may be envisioned by a person skilled in the art without departing from the spirit of the present invention and/or the scope of the appended claims.
EXAMPLES
Example 1: Cells and Bacteria
[0109] In transfection and stable cell selection assays in mammalian cells grown in suspension, CHO.sup.BRI cells (cells derived from the CHO DUXB11 cell line adapted to grow in suspension in a serum free medium, and stably expressing the cymene (CymR) repressor and the coumate reverse transactivator (rcTA)), were used. These cells have been created and supplied by NRCC National Research Council of Canada.
[0110] DH5 Eschericha coli competent bacteria were used for all cloning procedures and for large scale plasmid production.
[0111] Mammalian cell culture: For the culture of cells grown in suspension, the following serum free media were used:
[0112] CHO.sup.BRI: PowerCHO2 medium (Lonza, Walkersville, MD, USA) and BalanCD Growth A (Irvine Scientific, Irvine, CA USA) supplemented with MSX 25 or 50 M, CD DG44 medium (Life Technologies Inc., Burlington, ON, Canada), supplemented with 4 mM glutamine and 0.1% Kolliphor P 188.
[0113] Cells were grown in Erlenmeyer flasks of various sizes in an incubator with 5% CO.sub.2 at 37 C. stirred at 120 rpm. For culture maintenance, cell passages were done by dilution.
[0114] Count of cells grown in suspension was done by the Trypan blue exclusion method using a CEDEX (Roche, Laval, Qc) cell counter.
[0115] D H5 E. coli bacteria were grown at 37 C. in Circle Grown (MP Biomedicals, Solon OH) medium supplemented with 50 g/ml ampicillin for selecting and growing those clones resistant to that antibiotic. For solid cultures, 2% agar was added to the medium. Petri plates were used for culture in solid medium 90 mm-diameter, and, for liquid culture, 15 mL conic tubes, and 250- and 500-mL Erlenmeyer flaks with constant agitation at 200 rpm, were utilized.
Example 2: Recombinant DNA Techniques
Plasmids
[0116] To construct those plasmids utilized in the present approach, traditional recombinant DNA techniques, briefly detailed below, were used. Previously synthesized plasmids were used: pTT5-P13C (A2001 wild type sequence) and pTT5-3C (A2001 wild type sequence), synthetic genes from GenScript with sequences optimized for expression in mammalian cells, and genes amplified by PCR [Rowlands D J, Sangar D V, Brown F (1975) J Gen Virol 26:227-238 and S. Misaghi, J. Chang, B. Biotechnol. Prog., 30 (2014), pp. 1432-1440].
TABLE-US-00003 TABLE 3 Plasmids used in the assays of stable expression under inducible promoters Plasmid: Viral serotype: Feature: pTT81-P13C VFA A2001 P1 optimized for expression in mammalian cells pTT81-P1 VFA A2001 P1 optimized for expression in mammalian cells pTT81- VFA A2001 P1 optimized for expression in P1ApafATG3C mammalian cells pTT81- VFA A2001 P1 optimized for expression in P1ApafACG3C mammalian cells and modified 3C pTT81- VFA A2001 P1 optimized for expression in CR5P1CR1ATG3C mammalian cells pTT81- VFA A2001 P1 optimized for expression in CR5P1CR1ACG3C mammalian cells and modified 3C pTT81-CMVCymR Constitutive repressor expression
Agarose Gel Electrophoresis
[0117] Agarose gels were used for separating DNA samples. For the preparation of 1% agarose gel, the appropriate amount of agarose was weighed and dissolved in TAE buffer (Tris-acetate 10 mM, 1 mM EDTA) using a microwave oven until the agarose was completely melted. Once the solution reached the suitable temperature, a specific dye was added for DNA visualization. This solution was placed on a suitable support with a comb that allowed the generation of lanes for loading the samples. Samples were prepared with 10 loading buffer (50% glycerol, 10 TAE, 1% bromophenol blue). 100 pb and 1 kb molecular weight markers were used.
[0118] Electrophoretic runs were performed at room temperature using TAE buffer and applying a voltage of about 100 V. Gels were visualized and registered with Molecular Imager Gel Doc (Bio-Rad) system with the Image Lab (Bio-Rad) software.
DNA Purification From Agarose Gels
[0119] For purifying DNA bands from agarose gels, at the end of the runs, DNA bands of specific sizes were excised by using a scalpel and purified using the QIAEX II Agarose Gel Extraction (QIAGEN) kit, following the manufacturer's instructions. Purified DNA was recovered in a TE buffer solution.
Plasmid DNA Preparation
[0120] In order to obtain high quality plasmids to be used for the transfections, low- and medium-scale DNA preparations were done with commercial Plasmid Purification Mini/midi Kit (Qiagen), following the manufacturer's instructions. Purified DNA was resuspended in sterile bi-distilled water at 65 C.
Quantification of DNA Fragments and Plasmids
[0121] To quantify DNA and to determine the purity of the preparations, a NanoDrop nd-1000 (Thermo Scientific) spectrophotometer was used. For those plasmids to be used in transfections, plasmid purity was assessed by 260/280 nm absorbance (Abs 260/Abs 280) ratio, accepting only those preparations with values in the range of 1.8-2.
Enzymatic Digestions
[0122] DNA digestions with restriction enzymes were performed under the conditions of each enzyme in terms of reaction buffers and temperatures, following the manufacturer's instructions. Approximately 1 to 5 U of enzyme per g of DNA in a final volume of 20 l, were used.
Ligation Reactions
[0123] Ligations of DNA fragment to the plasmids were perfomed maintaining a 3:1 ratio of DNA fragment:plasmid in a 10 l final volume. All reactions were performed with T4 DNA Ligase enzyme and following the manufacturer's instructions.
Gene Amplification
[0124] To construct the following plasmids: pTT81-P1ApafATG3C, pTT81-P1ApafACG3C, pTT81-P1CR1ATG3C, and pTT81-P1CR1ACG3C, PCR reactions were perfomed in order to amplify the fragments: ApafATG3C, ApafACG3C, ATG3C and ACG3C using the primers listed in table 4.
TABLE-US-00004 TABLE4 PrimersusedinPCRreactionsforamplifying fragments:ApafATG3C,ApafACG3C,ATG3C,andACG3C. Primername Primersequence OG521 AAACAATTGGGCCGGCCACCATGAGTGGTGCCCCAC SEQIDNo6 CGACCG OG522 AAACAATTGGGCCGGCCACCACGAGTGGTGCCCCAC SEQIDNo7 CGACCG OG523 AAAAGATCTACGCGTTCATTACATCACGTGGACTCG SEQIDNo8 TTCTTCCACATCTCTG OG524 AAAGCGGCCGCTCCACTATTCGAGGCCGTTCGTTAA SEQIDNo9 TACTTGTTGCGTTCCTAGCCGCTATTAGGCGCAAA GGCTTGGCTCATGGTTGACAGCTCAGAGAGAGAAAG ATCTGAGGGAGGCCGGCCGCCACCATGAGTGGTGCC CCACCGACCGACCTGCAGAAGATGGTC OG525 AAAGGATCCTCATTACATCACGTGGACTCGTTCTTC SEQIDNo10 CACATCTCTG OG526 AAAGCGGCCGCTCCACTATTCGAGGCCGTTCGTTAA SEQIDNo11 TACTTGTTGCGTTCCTAGCCGCTATTAGGCGCAAAG GCTTGGCTCATGGTTGACAGCTCAGAGAGAGAAAGA TCTGAGGGAGGCCGGCCGCCACCACGAGTGGTGCCC CACCGACCGACCTGCAGAAGATGGTC
[0125] Table 5 describes in detail the PCRs performed and table 6 shows the reaction mixture used for the various reactions.
TABLE-US-00005 TABLE 5 Fragment Primer F Primer R Size Tm C. 1- 3C Apaf ACG OG526 OG525 836 72 2- 3C Apaf ATG OG524 OG525 836 72 3- 3C ACG for CR1 OG522 OG523 731 72 4- 3C ATG forCR1 OG521 OG523 731 72
TABLE-US-00006 TABLE 6 Reaction mixture used in the PCR. PCR Final Vol 50 l Vol (l) 5X Q5 reaction buffer 10 l 10 mM dNTPs 1 l Primer F 2 l (final cc 0.2 M) Primer R 2 l (final cc 0.2 M) Template (1/1000 dilution of maxi DNA) 1 l Q5 High-Fidelity DNA Polymerase (NEB) 0.5 l Q5 enhancer 10 l MilliQ water 23.5 l
Competent Bacteria Transformation
[0126] Competent DH5 bacteria were kept frozen at 70 C. until further use. They were then thawed and kept in ice for 10 min. 2-5 l of the product of the various ligation reactions or 1 l of closed plasmid were added to 100 l of bacteria, gently mixed and ice-cold incubated for 20 min. Subsequently, a thermal shock was applied at 42 C. for 60 s and left on ice for an additional 2 min. Then, 900 l of LB media were added and incubated for one hour at 37 C. with gentle shaking. Then, tubes were centrifuged at 2000 rpm for 10 min. After centrifugation was completed, 800 l of the supernatant were discarded and the remaining 200 l were used for suspending the bacteria that were then plated on LB agar plates supplemented with ampicillin at a final concentration of 100 g/ml (since this is the bacterial resistance presented by the plasmids used in the present work). Plates were incubated at 37 C. overnight. The resulting colonies were stabbed and inoculated in 3 ml LB/ampicillin liquid cultures and incubated overnight at 37 C.
Plasmid Sequencing
[0127] The appropriate recombinant plasmid construct was confirmed by automatic sequencing of the cloned genes.
Example 3: Transfections
Transfection Reagents
[0128] Transfections were performed by chemical methods. LPEI-MAX polyethyleneimine (Polysciences) was used for transfecting cells grown in suspension.
[0129] Transfection and selection of stable cells from CHO.sup.BRI cells grown in suspension.
[0130] Cells were prepared for transfection at an appropriate concentration of cells per ml and were transfected only when they showed a viability of more than 95% and appropriate cell densities on transfection day. Both plasmids and PEI were diluted in culture media. The PEI dilution was added to the plasmid dilution, shaken, and incubated at room temperature for a specified time. Then, DNA:PEI mixture was added to the cells. The selection process was initiated with MSX at 24 hpt. For more details about these protocols, see Poulain et al 2017 Journal of Biotechnology 255; 16-27 and Rowlands D J, Sangar D V, Brown F (1975) J Gen Virol 26:227-238. Once the selection process was completed, cell vials were frozen and cultures were prepared to be induced with coumate and to assess the expression. For protein expression analysis, cells were collected by centrifugation and the cell pellet was suspended in lysis buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 1% Thesit, 0.5% sodium deoxycholate) supplemented with Complete, EDTA-free (Roche) protease inhibitor. Lysis was carried out on ice for 30 min with successive shaking steps for a few seconds. The lysate was then separated from the cell debris by centrifugation at 12.000 g for 10 min at 4 C.
Fluorescent Protein Expression Analysis
[0131] Cells transfected with plasmids codifying for the fluorescent protein were observed under an Olympus IX71 inverted microscope.
[0132] A Cellometer (Nexcelom) was used to analyze the enhanced green fluorescent protein (EGFP) expression in the assays.
Example 4: Protein Expression, Quantification, and Structural Analysis of the VFA Recombinant Proteins in CHO.SUP.BRI .Cells
Recombinant Protein Quantification by ELISA
[0133] ELISA plates (Immunolon II) were sensitized overnight at 4 C. with a 1/3000 dilution of an anti-VFA A/Arg/01 rabbit serum in carbonate-bicarbonate buffer pH 9.6. Then, three washes were done with washing solution (0.1% PBS Tween-20) and plates were blocked with blocking solution (0.1% PBS Tween-20, 1% ovalbumin) for 1 hour at 37 C. Then, serial dilutions of assay samples and control samples in blocking solution were added. Serial dilutions in blocking solution of a solution of VFA A/Arg/01 purified by sucrose gradient and quantified taking into account its extinction coefficient were used as standard curve. Both the samples and standard curve were incubated for 1 h at 37 C. After three washes, plates were incubated for 30 min at 37 C. with a 1/3000 dilution of anti-VFA A/Arg/01 guinea pig serum in diluent solution (0.1% PBS Tween-20, 5% normal equine serum). After three washes, anti-guinea pig IgG goat antibodies conjugated with peroxidase enzyme (KPL) diluted in diluent solution were added. Finally, TMB developing solution was added and incubated at room temperature for 20 min. The reaction was quenched with a 12% sulfuric acid solution. Absorbance was read at 492 nm in a Thermo Scientifics Multiskan FC plate reader.
[0134] Western Blot: After the addition of 5 Laemmli buffer (60 mM Tris-Cl pH 6.8, 2% SDS, 10% glycerol, 5% mercaptoethanol, 0.01% bromophenol blue) to the samples, they were boiled for 5 min. These prepared samples were loaded on 12% polyacrylamide denaturing gels. Samples were subjected to electrophoresis under a constant voltage of 100 V in running buffer (25 mM Tris-HCl, pH 8.8, 190 mM glycine, 0.1% SDS). At the end of the electrophoretic run, gels were equilibrated with transfer buffer before transferring the separated samples to nitrocellulose membranes. The molecular weight marker used was Precision plus protein TM dual color standard (Biorad). After the transfer, membranes were blocked with a blocking solution at room temperature for 30 min. For immunochemistry detection, anti-VFA A/Arg/01 guinea pig sera diluted 1/500 in blocking solution were used overnight at room temperature. Subsequently, membranes were washed three times with washing solution (PBS, 0.1% Tween-20) for 10 min and then incubated with peroxidase enzyme-conjugated anti-guinea pig IgG antibody (KPL) in blocking solution for 1 h. Membranes were then washed three times with washing solution for 10 min and developed by using a chemiluminescence kit (Biorad).
Recombinant Structure Characterization by 45-15% Sucrose Gradients
[0135] For setting of gradients, in Beckman Ultra-Clear tubes 2 in (1351 mm) ultracentrifuge tubes for SW 55 Ti rotor, four PBS solutions with different sucrose concentrations were loaded: 45, 35, 25, and 15% sucrose (W/V). The most concentrated solution was loaded at the bottom of the tube and the most diluted at the top. The loading volume was 1 ml for each solution. Samples were loaded on the top of the gradient. Tubes were centrifuged in a Beckman Optima-LP X-100 Ultracentrifuge with a SW 55 Ti rotor for 2 h at 45000 rpm at 4 C. Acceleration: 9, deceleration: 9. Once the centrifugation was completed, 0.5 mL aliquots were collected. Aliquots were analyzed to detect VFA specific protein by ELISA. Gradient setting and sample collection were done manually.
Example 5: Mouse Assay
[0136] 8-week-old female BALB/c inbred strain mice provided by the Animal Facility of the School of Veterinary Sciences of La Plata, Argentina, were used. All laboratory animal experiments were perfomed according to the protocols approved by INTA's Animal Protection Committee. Vaccines were formulated with an oil adjuvant. A 50:50 ratio of antigen:adjuvant was used. BALB/c mice were divided into three groups of five animals each and administered with an intraperitoneal vaccine comprising 50 g of VLP. At 19-days post-vaccination mice were exsanguinated and serum stored for further analysis.
[0137] Sera were analyzed by an ELISA assay that allowed measurement of anti-VFA A001 specific mouse antibodies. Briefly, ELISA plates (Immunolon II) were sensitized overnight at 4 C. with a 1/3000 dilution of an anti-VFA A/Arg/01 rabbit serum in carbonate-bicarbonate buffer pH 9.6. Then, three washing steps with washing solution (PBS 0.1% Tween-20) were done and plates were blocked with blocking solution (PBS 0.1% Tween-20, ovalbumin 1%) for 1 hour at 37 C. Then, a solution with purified and inactivated VFA A/Arg/01 in blocking solution was added before incubating for 1 hour at 37 C. Following three washing steps, plates were incubated for 30 min at 37 C. with various dilutions of mouse sera under evaluation in diluent solution (PBS 0.1% Tween-20, 5% horse normal serum). Following three washing steps, peroxidase enzyme-conjugated goat anti-mouse IgG antibodies (KPL) diluted in diluent solution, were added. Finally, TMB developing solution was added and incubated at room temperature for 20 min. Reaction was stopped with a 12% sulfuric acid solution. Absorbance was measured at 492 nm by means of a Thermo Scientifics MultiskanFC plate reader. The absorbance value is proportional to the level of specific antibodies present in the analyzed mouse serum.