Methods for sub-typing and treating cancer
11591658 · 2023-02-28
Assignee
Inventors
Cpc classification
A61K31/194
HUMAN NECESSITIES
C12Y101/01042
CHEMISTRY; METALLURGY
C12Y206/01042
CHEMISTRY; METALLURGY
C12Q2600/112
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
C12Q2600/106
CHEMISTRY; METALLURGY
C12Y101/01041
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
This invention relates to a novel approach for the identification and stratification of subtypes of cancer, particularly subtypes of cancer characterized by an increased expression of BCAT1, particularly Acute Myeloid Leukemia (AML). The invention furthermore relates to a novel approach with respect to the treatment of cancer, particularly subtypes of cancer characterized by an increased expression of BCAT1, particularly Acute Myeloid Leukemia (AML).
Claims
1. A method of treating Acute Myeloid Leukemia (AML) in a patient suffering from AML, wherein said AML is characterized by BCAT1.sup.high expression and IDH.sup.wtTET.sup.wt, comprising the step of administering a compound that increases intracellular levels of α-ketoglutarate, wherein the compound is (i) a BCAT1 inhibitor selected from: an antisense molecule, wherein said antisense molecule consists of a nucleotide sequence from 12 to 25 nucleotides, wherein the sequence corresponds to the antisense strand of the nucleic acid sequence coding for BCAT1, an siRNA molecule, wherein said siRNA molecule has between 20 and 25 based pairs being complementary to the mRNA coding for BCAT1, and a small molecule inhibitor selected from 1-(aminomethyl) cyclohexaneacetic acid, compound 2 and compound 8 ##STR00002## or (ii) wherein said compound is selected from α-ketoglutaric acid, a mono- or dibasic salt of α-ketoglutaric acid, or a derivative of α-ketoglutaric acid having at least one of its carboxylic acid groups derivatized as ester or amide.
2. The method of claim 1, wherein the compound is selected from 2-oxo-pentanedioic acid, 1-hexyl ester, 2-oxo-pentanedioic acid, 1-octyl ester, benzyl-α-ketoglutarate ester and 3-trifluoromethylbenzyl-α-ketoglutarate ester.
3. The method of claim 1, wherein said BCAT1.sup.high expression is determined by quantitative PCR.
4. The method of claim 3, wherein said BCAT1.sup.high expression is determined in relation to the expression of a reference.
5. The method of claim 1, wherein the compound in (ii) is a mono-ester of α-ketoglutaric acid or a di-ester of α-ketoglutaric acid.
6. The method of claim 4, wherein said reference is ABL1.
7. The method of claim 6, wherein BCAT1.sup.high expression is characterized by a ratio of BCAT1/ABL1 of greater than 0.90.
Description
FIGURES
(1)
(2)
(3)
DETAILED DESCRIPTION OF THE INVENTION
(4) The present invention may be understood more readily by reference to the following detailed description of the invention and the examples included therein.
(5) Thus, in one aspect, the present invention relates to a compound that increases intracellular levels of α-ketoglutarate for use in the treatment of a patient suffering from AML, wherein said AML is characterized by BCAT1.sup.high expression and IDH.sup.wtTET.sup.wt.
(6) In the context of the present invention, the term “comprises” or “comprising” means “including, but not limited to”. The term is intended to be open-ended, to specify the presence of any stated features, elements, integers, steps or components, but not to preclude the presence or addition of one or more other features, elements, integers, steps, components, or groups thereof. The term “comprising” thus includes the more restrictive terms “consisting of” and “consisting essentially of”.
(7) In certain embodiments, the compound is a BCAT1 inhibitor.
(8) In certain embodiments, said BCAT1 inhibitor is selected from: an antisense molecule, an siRNA molecule, an shRNA molecule, an inactive variant of BCAT1, and a small molecule inhibitor, particularly 1-(aminomethyl) cyclohexane acetic acid.
(9) In the context of the present invention, the term “antisense molecule” refers to an oligonucleotide consisting of from 8 to 30 nucleotides, particularly from 12 to 25 nucleotides, more particularly from 13 to 20 nucleotides, wherein the sequence of said oligonucleotide corresponds to the antisense strand of the nucleic acid sequence coding for a protein of interest to be inhibited. In particular embodiments one or more nucleotide(s) in said oligonucleotide and/or one or more of the phosphate linkage groups are modified.
(10) A nucleotide forms the building block of an oligonucleotide, and is for example composed of a nucleobase (nitrogenous base, e.g., purine or pyrimidine), a five-carbon sugar (e.g., ribose, 2-deoxyribose, arabinose, xylose, lyxose, allose, altrose, glucose, mannose, gulose, idose, galactose, talose or stabilized modifications of those sugars), and one or more phosphate groups. Examples of modified phosphate groups are phosphorothioate or methylphosphonate. Each compound of the nucleotide is modifiable, and is naturally or non-naturally occurring. Examples of the latter are: locked nucleic acid (LNA), 2′,4′ constrained ethyl nucleic acids (c-ET), 2′-0,4′-C-ethylene-bridged nucleic acid (ENA), polyalkylene oxide- (such as triethylene glycol (TEG)), 2′-fluoro-, 2′-deoxy-2′-fluoro-beta-D-arabinonucleic acid (FANA), 2′-0-methoxy- and 2′-O-methyl-modified nucleotides.
(11) An “LNA” is a modified RNA nucleotide, wherein the ribose moiety is modified with an extra bridge connecting the 2′ oxygen and 4′ carbon (2′-4′ribonucleoside). The bridge locks the ribose in the 3′-endo (North) conformation, which is often found in the A-form duplexes. LNA nucleosides and nucleotides, respectively, comprise for example the forms of thio-LNA, oxy-LNA, or amino-LNA, in alpha-D- or beta-L-configuration, and can be mixed or combined, respectively, with DNA or RNA residues in the oligonucleotide.
(12) A “bridged nucleic acid” is modified RNA nucleotide, sometimes also referred to as constrained or inaccessible RNA molecule, which may contain a five-membered, six-membered or even a seven-membered bridged structure with a “fixed” C3′-endo sugar puckering. The bridge is synthetically incorporated at the 2′,4′-position of the ribose to afford a 2′,4′-BNA monomer. Specific examples are “ENA” nucleotides, wherein the bridge is an ethylene bridge.
(13) In a particular embodiment, one or more nucleotide(s) in said oligonucleotide are modified, wherein the modified nucleotide contains a modified phosphate group, particularly selected from a phosphorothioate and a methylphosphonate, particularly a phosphorothioate. In particular embodiments, all phosphate groups of the oligonucleotide are modified phosphate groups, particularly independently selected from phosphorothioates and methylphosphonates, particularly wherein all phosphate groups are phosphorothioates.
(14) In a particular embodiment, one or more nucleotide(s) in said oligonucleotide are modified, wherein the modified nucleotide is an LNA, a c-ET, an ENA, a polyalkylene oxide-, a 2′-fluoro-, a 2′-O-methoxy-, a FANA and/or a 2′-O-methyl-modified nucleotide.
(15) In particular embodiments, the modified nucleotide(s) is/are located within the stretch of 5 nucleotides at the 5′- and/or 3′-end of the oligonucleotide, particularly at the 5′- and the 3′-end of the oligonucleotide.
(16) In particular embodiments, the oligonucleotides of the present invention comprise at least one modified nucleotide, particularly at least one LNA, c-ET and/or ENA, at the 5′- and/or 3′-end of the oligonucleotide. In a particular embodiment, the oligonucleotide comprises 1, 2, 3, or 4 LNAs or c-ETs or ENAs within the stretch of up to 5 nucleotides at the 5′-end, and 1, 2, 3, or 4 LNAs or c-ETs or ENAs within the stretch of up to 5 nucleotides at the 3 ‘-end. In another particular embodiment, the oligonucleotide comprises 1, 2, 3, or 4 LNAs, c-ETs, or ENAs at the within the stretch of 5 nucleotides 5’-end or 3′-end, and a polyalkylene oxide such as TEG within the stretch of 5 nucleotides at the 3′- or 5′-end.
(17) In particular embodiments, said oligonucleotide is a Gapmer comprising at least one LNA nucleotide within the stretch of 5 nucleotides at the 5′-end of said oligonucleotide, and at least one LNA nucleotide within the stretch of 5 nucleotides at the 3′-end of said oligonucleotide. In particular embodiments, said Gapmer comprises 2 or 3 LNA nucleotides within the stretch of 5 nucleotides at the 5′-end of said oligonucleotide, and 2 or 3 LNA nucleotides within the stretch of 5 nucleotides at the 3′-end of said oligonucleotide.
(18) In the context of the present invention, the term “Gapmer” refers to a chimeric antisense oligonucleotide that contains a central block of deoxynucleotide monomers sufficiently long to induce RNase H cleavage. The central block of a Gapmer is flanked by blocks of 2′-O modified ribonucleotides or other artificially modified ribonucleotide monomers such as bridged nucleic acids (BNAs) that protect the internal block from nuclease degradation. In many earlier studies modified DNA analogs were investigated for their stability in biological fluids. In the majority of these experiments phosphorothioate DNA analogs were used. More recently, several types of artificial nucleotide monomers including BNA monomers have been investigated for their usefulness in the design of Gapmers. Gapmers have been used to obtain RNase-H mediated cleavage of target RNAs, while reducing the number of phosphorothioate linkages. Phosphorothioates possess increased resistance to nucleases compared to unmodified DNA. However, they have several disadvantages. These include low binding capacity to complementary nucleic acids and non-specific binding to proteins that cause toxic side-effects limiting their applications. The occurrence of toxic side-effects together with non-specific binding causing off-target effects has stimulated the design of new artificial nucleic acids for the development of modified oligonucleotides that provide efficient and specific antisense activity in vivo without exhibiting toxic side-effects.
(19) LNA Gapmers are powerful tools for loss of function studies of proteins, mRNA and IncRNAs. These single strand antisense oligonucleotides catalyze RNase H-dependent degradation of complementary RNA targets. LNA Gapmers are typically 12-20 nucleotides long enriched with LNA in the flanking regions and DNA in a LNA free central gap-hence the name Gapmer. The LNA-containing flanking regions confers nuclease resistance to the antisense oligo while at the same time increases target binding affinity regardless of the GC content. The central DNA “gap” activates RNase H cleavage of the target RNA upon binding.
(20) Antisense molecules for the inhibition of BCAT1 have been described in the prior art (e.g. in EP 2 481 801 A1).
(21) In the context of the present invention, the term “siRNA” refers to small (or short) interfering RNA molecules, which are a class of double-stranded RNA molecules having between 20 and 30, particularly between 20 and 25 base pairs in length. siRNA molecules interfere with the expression of the mRNA of genes with complementary nucleotide sequences and cause that mRNA to be cleaved after transcription resulting in no translation. siRNA constructs for the inhibition of BCAT1 have been described in the prior art (e.g. in WO 2012/100957) and are commercially available (e.g. from ThermoFisher Scientific, SigmaAldrich or Dharmacon).
(22) In the context of the present invention, the term “shRNA” refers to small RNA-based molecules comprising sequences that form a small (or short) hairpin. Such shRNA sequence can be used to silence target gene expression via RNA interference (RNAi). Expression of shRNA in cells is typically accomplished by delivery of plasmids or through viral or bacterial vectors. shRNA constructs for the inhibition of BCAT1 have been described in the prior art (e.g. in Tönjes et al., Nature Medicine 19 (2013) 901-908) and are commercially available (e.g. from Origene, SigmaAldrich or Dharmacon).
(23) In the context of the present invention, the term “inactive variant of BCAT1” refers to protein variants of BCAT1 that have a strongly reduced or completely abolished enzymatic activity of wild-type BCAT1, in particular variants resulting from modification at, or in vicinity to, the active site (lysine at amino acid position 202) or the core CXXC motif (amino acid positions 315 to 318 of BCAT1). Such modifications include the oxidation or labeling of hBCATm with sulfhydryl reagents. Inactive variants of BCAT1 have been described in the prior art (e.g. in Coles et al., Biochemistry 48 (2009):645-56).
(24) Specific small-molecule inhibitors of BCAT1 are known in the art. For example, 1-(aminomethyl) cyclohexane acetic acid is described in WO 2012/100957. Additional small-molecule inhibitors being derivatives of 5-keto valeric acid are described in US 2016/368862, including the compounds 2 and 8:
(25) ##STR00001##
(26) In certain other embodiments, said compound is selected from α-ketoglutaric acid, a mono- or dibasic salt of α-ketoglutaric acid, or a derivative of α-ketoglutaric acid having at least one of the carboxlic acid groups derivatized as ester or amide, particularly a mono-ester of α-ketoglutaric acid or a di-ester of α-ketoglutaric acid.
(27) The compound α-ketoglutarate is known as a “molecule with pleiotropic activity”, and its use in a number of therapeutic indications have been studied or at least suggested (for a review see Zdzisińnska et al. Arch Immunol Ther Exp (Warsz). 65 (2017) 21-36),
(28) In certain such embodiments, said compound is selected from 2-oxo-pentanedioic acid, 1-hexyl ester, 2-oxo-pentanedioic acid, 1-octyl ester, benzyl-α-ketoglutarate ester and 3-trifluoromethylbenzyl-α-ketoglutarate ester.
(29) The synthesis of derivatives of α-ketoglutaric acid has been published (see, for example, Zengeya et al., Org Lett. 17 (2015):2326-9; MacKenzie et al., Mol Cell Biol. 27 (2007) 3282-3289)
(30) In the context of the present invention, “characterized by BCAT1.sup.high expression and IDH.sup.wtTET.sup.wt” refers to BCAT1 expression above median in normal karyotype AML patients devoid of IDH and TET2 mutations.
(31) In certain embodiments, said BCAT1.sup.high expression is determined by quantitative PCR.
(32) In certain embodiments, said BCAT1.sup.high expression is determined in relation to the expression of a reference, particularly wherein said reference is ABL1, particularly wherein BCAT1.sup.high expression is characterized by a ratio of BCAT1/ABL1 of greater than 0.90. In particular embodiments, BCAT1.sup.high expression is characterized by a ratio of BCAT1/ABL1 of greater than 0.95, in particular greater than 1.00.
(33) In another aspect, the present invention relates to a method of treating a patient suffering from AML, wherein said AML is characterized by BCAT1.sup.high expression and IDH.sup.wtTET.sup.wt, comprising the step of administering a compound that increases intracellular levels of α-ketoglutarate.
(34) In certain embodiments, the compound is a BCAT1 inhibitor.
(35) In certain embodiments, said BCAT1 inhibitor is selected from: an antisense molecule, an siRNA molecule, an shRNA molecule, an inactive variant of BCAT1, and a small molecule inhibitor, particularly 1-(aminomethyl) cyclohexaneacetic acid.
(36) In certain other embodiments, said compound is selected from α-ketoglutaric acid, a mono- or dibasic salt of α-ketoglutaric acid, or a derivative of α-ketoglutaric acid having at least one of the carboxlic acid groups derivatized as ester or amide, particularly a mono-ester of α-ketoglutaric acid or a di-ester of α-ketoglutaric acid.
(37) In certain such embodiments, said compound is selected from 2-oxo-pentanedioic acid, 1-hexyl ester and 2-oxo-pentanedioic acid, 1-octyl ester.
(38) In certain embodiments, said BCAT1.sup.high expression is determined by quantitative PCR.
(39) In certain such embodiments, said BCAT1.sup.high expression is determined in relation to the expression of a reference, particularly wherein said reference is ABL1, particularly wherein BCAT1.sup.high expression is characterized by a ratio of BCAT1/ABL1 of greater than 0.90. In particular embodiments, BCAT1.sup.high expression is characterized by a ratio of BCAT1/ABL1 of greater than 0.95, in particular greater than 1.00.
(40) In another aspect, the present invention relates to an in vitro method for the characterization of the status of a patient suffering from AML, characterized by the steps of (i) measuring expression of BCAT1 and (ii) determining the genotype with respect to IDH and TET, in a sample comprising AML cells from said patient.
(41) In another aspect, the present invention relates to an in vitro method of stratifying a patient suffering from AML, the method comprising the steps of: in vitro measuring expression of BCAT1 in AML tumor cells obtained from said patient; determining the status of said AML tumor cells with respect to IDH and TET; and stratifying said patient into a drug treatment cohort based on the status determined in steps (a) and (b); wherein a patient characterized by BCAT1.sup.high expression and IDH.sup.wtTET.sup.wt may be treated by a compound that increases intracellular levels of α-ketoglutarate.
(42) In certain embodiments, said BCAT1.sup.high expression is determined by quantitative PCR.
(43) In certain embodiments, said BCAT1.sup.high expression is determined in relation to the expression of a reference, particularly wherein said reference is ABL1, particularly wherein BCAT1.sup.high expression is characterized by a ratio of BCAT1/ABL1 of greater than 0.90. In particular embodiments, BCAT1.sup.high expression is characterized by a ratio of BCAT1/ABL1 of greater than 0.95, in particular greater than 1.00.
(44) In certain embodiments, said tumor cells are cells from a tumor sample.
(45) In certain embodiments, said sample is obtained from a mammal, particularly a human.
(46) In the context of the present invention, the term “stratifying” or “stratification” relates to the identification of a group of patients with shared “biological” characteristics by using molecular and biochemical diagnostic testing to select the optimal management for the patients.
(47) In certain embodiments, said tumor cells are obtained by purifying tumor cells from a tumor sample from said patient, particularly wherein the purification comprises flow sorting or laser capture microdissection.
(48) In a particular embodiment, the patient sample is selected from blood, serum, and plasma. In a particular embodiment, the patient sample is a collection of circulating tumor cells (CTCs), particularly isolated from the blood of a patient. In particular embodiments, the CTCs are isolated by apheresis.
(49) In certain embodiments, said tumor cells are (i) isolated from the blood of said patient; or (ii) isolated from a tumor sample, which is a tumor biopsy.
EXAMPLES
Example 1
Branched Chain Amino Acid Catabolism is Overactivated in Leukemic Stem Cells Mimicking Epigenetic Changes Induced By Mutations in IDH and TET2
(50) In an unbiased high-resolution proteomics analysis of leukemic stem cell (LSC+) and non-LSC (LSC−) populations of human Acute Myeloid Leukemia (AML) samples, we identified the BCAA pathway and BCAT1 as commonly overexpressed in LSCs. Knockdown (KD) of BCAT1 in leukemic cells caused an accumulation of αKG resulting in HIF1 protein degradation mediated by EGLN1 activity. BCAT1-KD cells display decreased leukaemia-initiating potential and a growth and survival defect rescued by overexpression of HIF1 or knockdown of EGLN1. In contrast, overexpression (OE) of BCAT1 in leukemic cells decreases intracellular αKG levels and results in DNA hypermethylation mediated by decreased αKG dependent DNA demeythylase activity. BCAT1.sup.high AML samples displayed a DNA hypermethylation phenotype similar to IDH.sup.mut cases in which αKG is inhibited by the oncometabolite 2-HG. High levels of BCAT1 is strongly correlated with shorter overall survival in IDH.sup.wtTET.sup.wt, but not IDH.sup.mutAMLs. Gene sets characteristic for IDH.sup.mut AMLs and LSCs were enriched both in IDH.sup.wtTET.sup.wtBCAT1.sup.high patients and in BCAT1-OE leukemic cells. In summary, BCAT1 influences the cellular methylome by controlling intracellular αKG and the associated activity of αKG-dependent dioxygenases. High BCAT1 expression partially mimics IDH mutations in AML and BCAT1-derived αKG functions as a naturally occurring tumour suppressor metabolite. Therapeutic strategies to increase αKG by inhibition of BCAT1 in order to compromise LSC function, may lead to lower relapse rates and improved survival of AML patients.
(51) Primary AML samples of two different subgroups (FLT3.sup.ITD/NPM1.sup.mut and FLT3.sup.wt/NPM1.sup.wt) were fractionated according to CD34 and CD38 surface expression and functionally tested for the presence of leukaemia stem cells (LSCs) by xenotransplantation into NOD.Prkdc.sup.scid.ll2rg.sup.null (NSG) mice (
(52) Cytosolic BCAT1 transfers an α-amino group from BCAAs to α-ketoglutarate (αKG) yielding glutamate and the respective branched-chain α-ketoacid (BCKA).sup.10. After this transamination, BCKAs are thought to be further catabolised to acetyl- and succinyl-CoA, which enter the tricarboxylic acid (TCA) cycle (
(53) To gain additional mechanistic insight into cellular pathways affected by BCAT1, we utilized the HL-60 AML cell line. Both, defective growth (
(54) Mutations in Isocitrate Dehydroxygenase (IDH) 1 and 2 genes frequently occur in AMLs.sup.17 and result in the production of the oncometabolite 2-hydroxyglutarate (2-HG).sup.18. 2-HG acts as competitive inhibitor of αKG-dependent dioxygenases such as TET2.sup.19, thus mimicking a state of low intracellular αKG levels. We therefore hypothesised that BCAT1 expression levels may impact on the clinical outcome only in IDHwt and TET2wt (TET2 mutations are mutually exclusive to IDH mutations.sup.20) AML patients. Indeed, BCAT1 expression above median (BCAT1.sup.high) in normal karyotype AML patients devoid of IDH and TET2 mutations was associated with a strikingly shorter overall survival in two independent cohorts (Bullinger and Delwel, GSE14468) (402 days vs. undefined; p=0.0009, HR=2.57 and 306 vs. 1279 days, p=0.0002, HR=2.11) compared to BCAT1.sup.low patients. As expected, the BCAT1.sup.high group in patients carrying IDH or TET2 mutations had a non-significant trend towards better OS (380 vs. 306 days, p=0.35, HR=0.76 and 1708 vs. 1046 days, p=0.58, HR=0.79) (
(55) Together, high levels of BCAT1 expression in primary AMLs and overexpression of BCAT1 in HL-60 cells is associated with alterations in DNA methylation characteristic for IDH.sup.mut AMLs. A prognostic effect of BCAT1 expression levels was observed only for IDH.sup.wt cases, as IDH.sup.mut AMLs per se show a reduced activity of αKG-dependent dioxygenases (via competitive inhibition by 2-HG.sup.19) and lowering of intracellular αKG levels by BCAT1 may not further decrease the activity of these enzymes.
(56) AML patient survival is usually associated with sensitivity to standard chemotherapy.sup.23,24. In AML cells with long-term BCAT1-overexpression we observed increased resistance to daunorubicin (
(57) In summary, our study identifies BCAT1 as a critical enzyme for αKG homeostasis and thus specifically links branched chain amino acids metabolism to epigenetic and post-translational regulation though the regulation of αKG-dependent dioxygenases. BCAT1 acts upstream of mutations in the epigenetic modifiers IDH and TET2 and αKG may act as a naturally occurring tumour suppressor metabolite. While we cannot formally prove that αKG levels are lower in BCAT1high primary AML cells due to technical limitations our results strongly support that causative link. A recent publication suggested LSC fractions to be hypomethylated.sup.25. However, when analysing the subgroup of cases with a hierarchical organisation, i.e. presence of LSC+ and LSC− populations within one individual, LSC+ populations were more methylated, in line with our results.
(58) While high intracellular αKG levels maintain the pluripotenty of mouse embryonic stem cells.sup.26 leukemia stem cells maintain high BCAT1 levels to suppress αKG. For the future, therapeutic strategies to increase αKG in order to compromise LSC function i.e. by inhibition of BCAT1, may lead to lower relapse rates and improved survival of AML patients.
Example 2
Determination of BCAT1 Expression Levels
(59) The BCAT1 expression level and the determination of BCAT1.sup.high or BCAT1.sup.low status, in particular by using the ratio of BCAT1/ABL1 expression, can be determined by qPCR, particularly by qRT-PCR as shown in the literature, e.g. as in Tönjes et al., Nat Med. 2013 July; 19(7): 901-908.
(60) In particular, total RNA can be extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer's instructions. FirstChoice Human Brain Reference Total RNA from Ambion can serve as the normal brain RNA pool. Total RNA (500 ng) can be reverse transcribed using random primers and superscript II (Invitrogen) according to the manufacturer's instructions. Each cDNA sample can be analyzed in triplicate with the Applied Biosystems Prism 7900HT Fast Real-Time PCR System using Absolute SYBR Green ROX Mix (ABgene). The relative amount of specific BCAT1 mRNA can be normalized to ABL1 mRNA. Alternatively, the relative amount of specific BCAT1 mRNA can be normalized to ARF1, B2M or TBP mRNA. Primer sequences are shown below in Table 1.
(61) TABLE-US-00001 TABLE 1 Primer Sequences primers BCAT1 Forward CAACTATGGAGAATGGTCCTAAGCT (all isoforms) Reverse TGTCCAGTCGCTCTCTTCTCTTC BCAT1 T1 Forward GCTACGACCCTTGGGATCT (ENST00000261192) BCAT1 T4 Forward GTGCCACTGCCGCTCTCT (ENST00000539282) BCAT1 T6 Forward TGGTTGTCTGAGCCTCCTTT (ENST00000538118) BCAT1 Exon 2 Reverse AAGTCCCCACCACCTCTTTT BCAT1 Exon 5 Reverse CCCATTCTTGATCCAATTTCA HEY1 Forward CGAGCTGGACGAGACCAT Reverse GAGCCGAACTCAAGTTTCCA ARF Forward GACCACGATCCTCTACAAGC Reverse TCCCACACAGTGAAGCTGATG B2M Forward ACTGAATTCACCCCCACTGA Reverse CCTCCATGATGCTGCTTACA TBP Forward GAACCACGGCACTGATTTTC Reverse CCCCACCATGTTCTGAATCT ABL1 Forward TTCAGCGGCCAGTAGCATCTGACTT Reverse GATGTAGTTGCTTGGGACCCA
REFERENCES
(62) 1. Tonjes, M. et al. BCAT1 promotes cell proliferation through amino acid catabolism in gliomas carrying wild-type IDH1. Nat Med 19, 901-908, doi:10.1038/nm.3217 (2013). 2. Wang, Z. Q. et al. BCAT1 expression associates with ovarian cancer progression: possible implications in altered disease metabolism. Oncotarget 6, 31522-31543, doi:10.18632/oncotarget.5159 (2015). 3. Zheng, Y. H. et al. BCAT1, a key prognostic predictor of hepatocellular carcinoma, promotes cell proliferation and induces chemoresistance to cisplatin. Liver Int 36, 1836-1847, doi:10.1111/liv.13178 (2016). 4. Mayers, J. R. et al. Tissue of origin dictates branched-chain amino acid metabolism in mutant Kras-driven cancers. Science 353, 1161-1165, doi:10.1126/science.aaf5171 (2016). 5. Eppert, K. et al. Stem cell gene expression programs influence clinical outcome in human leukemia. Nat Med 17, 1086-1093, doi:10.1038/nm.2415 (2011). 6. Sarry, J. E. et al. Human acute myelogenous leukemia stem cells are rare and heterogeneous when assayed in NOD/SCID/IL2Rgammac-deficient mice. J Clin Invest 121, 384-395, doi:10.1172/JC141495 (2011). 7. Ng, S. W. et al. A 17-gene sternness score for rapid determination of risk in acute leukaemia. Nature 540, 433-437, doi:10.1038/nature20598 (2016). 8. Guan, Y., Gerhard, B. & Hogge, D. E. Detection, isolation, and stimulation of quiescent primitive leukemic progenitor cells from patients with acute myeloid leukemia (AML). Blood 101, 3142-3149, doi:10.1182/blood-2002-10-3062 (2003). 9. Oburoglu, L. et al. Glucose and glutamine metabolism regulate human hematopoietic stern cell lineage specification. Cell Stem Cell 15, 169-184, doi:10.1016/j.stem.2014.06.002 (2014). 10. Ichihara, A. & Koyama, E. Transaminase of branched chain amino acids. I. Branched chain amino acids-alpha-ketoglutarate transaminase. J Biochem 59, 160-169 (1966). 11. Green, C. R. et al. Branched-chain amino acid catabolism fuels adipocyte differentiation and lipogenesis. Nat Chem Biol 12, 15-21, doi:10.1038/nchembio.1961 (2016). 12. Loenarz, C. & Schofield, C. J. Expanding chemical biology of 2-oxoglutarate oxygenases. Nat Chem Biol 4, 152-156, doi:10.1038/nchembio0308-152 (2008). 13. Kaelin, W. G., Jr. & McKnight, S. L. Influence of metabolism on epigenetics and disease. Cell 153, 56-69, doi:10.1016/j.ce11.2013.03.004 (2013). 14. Epstein, A. C. et al. C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 107, 43-54 (2001). 15. Tahiliani, M. et al. Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 324, 930-935, doi:10.1126/science.1170116 (2009). 16. Wang, Y., Liu, Y., Malek, S. N., Zheng, P. & Liu, Y. Targeting HIF1alpha eliminates cancer stern cells in hematological malignancies. Cell Stem Cell 8, 399-411, doi:10.1016/j.stem.2011.02.006 (2011). 17. Paschka, P. et al. IDH1 and IDH2 mutations are frequent genetic alterations in acute myeloid leukemia and confer adverse prognosis in cytogenetically normal acute myeloid leukemia with NPM1 mutation without FLT3 internal tandem duplication. J Clin Oncol 28, 3636-3643, doi:10.1200/JC0.2010.28.3762 (2010). 18. Dang, L. et al. Cancer-associated IDH1 mutations produce 2-hydroxyglutarate. Nature 462, 739-744, doi:10.1038/nature08617 (2009). 19. Xu, W. et al. Oncometabolite 2-hydroxyglutarate is a competitive inhibitor of alpha-ketoglutarate-dependent dioxygenases. Cancer Cell 19, 17-30, doi:10.1016/j.ccr.2010.12.014 (2011). 20. Figueroa, M. E. et al. Leukemic IDH1 and IDH2 mutations result in a hypermethylation phenotype, disrupt TET2 function, and impair hematopoietic differentiation. Cancer Cell 18, 553-567, doi:10.1016/j.ccr.2010.11.015 (2010). 21. Cancer Genome Atlas Research, N. Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N Engl J Med 368, 2059-2074, doi:10.1056/NEJMoa1301689 (2013). 22. Marcucci, G. et al. IDH1 and IDH2 gene mutations identify novel molecular subsets within de novo cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B study. J Clin Oncol 28, 2348-2355, doi:10.1200/JC0.2009.27.3730 (2010). 23. Elliott, M. A. et al. Early peripheral blood blast clearance during induction chemotherapy for acute myeloid leukemia predicts superior relapse-free survival. Blood 110, 4172-4174, doi:10.1182/blood-2007-07-104091 (2007). 24. Kern, W. et al. Early blast clearance by remission induction therapy is a major independent prognostic factor for both achievement of complete remission and long-term outcome in acute myeloid leukemia: data from the German AML Cooperative Group (AMLCG) 1992 Trial. Blood 101, 64-70, doi:10.1182/blood-2002-02-0532 (2003). 25. Jung, N., Dai, B., Gentles, A. J., Majeti, R. & Feinberg, A. P. An LSC epigenetic signature is largely mutation independent and implicates the HOXA cluster in AML pathogenesis. Nat Commun 6, 8489, doi:10.1038/ncomms9489 (2015). Carey, B. W., Finley, L. W., Cross, J. R., Allis, C. D. & Thompson, C. B. Intracellular alpha-ketoglutarate maintains the pluripotency of embryonic stem cells. Nature 518, 413-416, doi:10.1038/nature13981 (2015).