Cyclic GMP-Chelating Peptides for Subcellular Targetting

20200299653 · 2020-09-24

Assignee

Inventors

Cpc classification

International classification

Abstract

The disclosure pertains to the field of molecular means capable of binding to, and preferably of chelating, cGMP, appropriate for use in vitro or in vivo and preferably capable of targeting specific cellular compartments. The polypeptides of the disclosure comprise a chimeric construction derived from the N terminus part of PKG-I and PKG-I, and the two cGMP binding sites of the wild type PKG.

Claims

1. A polypeptide comprising: a chimeric peptide derived from the sequence SEQ ID NO: 1 and from the sequence SEQ ID NO: 2; a cGMP binding domain comprising or consisting of the sequence SEQ ID NO: 6; and, wherein said polypeptide is devoid of any catalytic domain, and its functional variants.

2. The polypeptide of claim 1, wherein the chimeric peptide consists of or comprises the sequence SEQ II) NO: 3, 4 or 5, and its functional variants.

3. The polypeptide of claim 1, wherein the cGMP binding domain comprises or consists of the sequence SEQ ID NO: 7 or the sequence SEQ ID NO: 8, and its functional variants.

4. The polypeptide of claim 1, wherein the cGMP binding domain comprises or consists of the sequence SEQ II) NO: 9 or the sequence SEQ ID NO: 10, and its functional variants.

5. The polypeptide of claim 1, wherein the chimeric peptide and the cGMP binding domain form a contiguous sequence.

6. The polypeptide of claim 1, wherein the polypeptide comprises a peptide signal.

7. The polypeptide of claim 6, wherein the peptide signal which comprises tandem repeats of the sequence SEQ ID NO: 7 or its functional variants.

8. The polypeptide of claim 1, wherein the polypeptide comprises a fluorescent peptide.

9. A polynucleotide encoding the polypeptide of claim 1.

10. A recombinant vector comprising the polynucleotide of claim 9.

11. A host cell or a non-human organism transformed with the polynucleotide of claim 9 or a recombinant vector comprising the polynucleotide.

12. A pharmaceutical composition comprising at least one polypeptide according to claim 1, a polynucleotide encoding the polypeptide, a recombinant vector according to claim 10 comprising the polynucleotide, and/or a host cell transformed with the polynucleotide or the recombinant vector, and a pharmaceutically acceptable carrier.

13. A method of stabilizing cGMP concentration and/or of inhibiting cGMP signalization in vivo or in vitro, comprising contacting cGMP in vivo or in vitro with an effective amount of the polypeptide of claim 1, or contacting a cell with a polynucleotide encoding the polypeptide, a recombinant vector comprising the polynucleotide.

14. A method of treating a disorder in a subject treatable by chelating cGMP, comprising administering to the subject an effective amount of the polypeptide of claim 1, a polynucleotide encoding the polypeptide, a recombinant vector comprising the polynucleotide, a host cell transformed with the polynucleotide or the recombinant vector, or a pharmaceutical composition comprising one of the foregoing and a pharmaceutically acceptable carrier.

15. A method of treating or preventing a pathology associated with intracellular cGMP signaling dysfunction, comprising administering to a subject in need thereof a therapeutic amount of the polypeptide as recited in claim 1, a polynucleotide encoding the polypeptide, a recombinant vector comprising the polynucleotide. a host cell transformed with the polynucleotide or the recombinant vector, or a pharmaceutical composition comprising one of the foregoing and a pharmaceutically acceptable carrier.

16. The method of claim 15, wherein pathology associated with intracellular cGMP signaling dysfunction is selected from retinitis pigmentosa; cardiovascular diseases; schizophrenia; Huntington disease; achromatopia; cancer; erectile dysfunction and drug abuse.

17. The method of claim 16, wherein the cardiovascular diseases is selected from the group consisting of stroke, venous thrombosis, and arterial thrombosis, or wherein the cancer is selected from the group consisting of colorectal cancer, lung cancer, and lung disease.

18. The polypeptide of claim 2, wherein the chimeric peptide consists of or comprises the sequence SEQ ID NO: 3.

19. The polypeptide of claim 5, wherein a C-terminal end of the chimeric peptide is fused to a N-terminal end of the cGMP binding domain.

20. The polypeptide of claim 8, wherein the fluorescent peptide is selected from the group consisting of green fluorescent protein (GFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), and variants thereof.

Description

[0069] In addition to the preceding features, the invention further comprises other features which will emerge from the following description, which refers to examples illustrating the present invention, as well as to the appended figures.

[0070] FIG. 1. The polypeptide of the invention is a cGMP scavenger and alters cortical neuron migration in vivo. (A) 1 min Spermine-NONOate (NO) exposure induces an increase in the cGMP concentration of control H293 cells, monitored by the FRET/CFP ratio from the FRET bio sensor .sup.ThPDE5.sup.VV. In contrast, this elevation is drastically reduced when cells express .sup.cGmPSp/SponGee. (B) Both the amplitude and rising speed of cGMP elevation are reduced by .sup.cGMPSp/SponGee expression. (C) E14.5 eGFP and mRFP co-electroporated cortical neurons are packed into a dense layer close to the marginal zone at E18.5 (top row). In contrast .sup.cGMPSp/SponGee-expression prevents the development of this layer, with neurons scattered throughout the depth of the developing cortex, and the formation of heterotopia at the surface of the cortex (bottom row).

[0071] FIG. 2. Subcellular restriction of cGMP manipulation using the polypeptide of the invention .sup.cGMPSp/SponGee. A: subcellular localization of .sup.cGmPSp/SponGee, B: subcellular localization of Lyn-.sup.cGmPSp/SponGee, C: subcellular localization of .sup.cGMPSP/SponGee-Kras. .sup.cGmPSp/SponGee was either used to globally alter cGMP signaling when not targeted to any cellular compartment or to target specific compartments. Lyn-.sup.cGMPSP/SponGee aims to target to lipid rafts whether .sup.cGMPSp/SponGee-Kras is intended to be restricted to the non-raft fraction of the plasma membrane. (A) .sup.cGmPSp/SponGee was detected in the cytoplasm (top row) whether both Lyn-.sup.cGmPSp/SponGee and .sup.cGmPSp/SponGee p-Kras were found at the plasma membrane (middle and bottom row).

[0072] FIG. 3. Plasma membrane fractionation highlighted distinct subcellular localization of Lyn-.sup.cGmPSp/SponGee and .sup.cGmPSp/SponGee-Kras. A: Caveolin, B: Lyn-T .sup.ThPDE5.sup.VV, C: Lyn-.sup.cGmPSp/SponGee, D: Adaptin, E: T .sup.ThPDE5.sup.VV-Kras, F: .sup.cGMPSp/SponGee-Kras. Lyn-.sup.cGmPSp/SponGee was highly enriched in fraction 3 whether the localization of .sup.cGMPSp/SponGee-Kras was shifted towards higher density fractions (4 to 9).

[0073] FIG. 4. SponGee reduces the elevation of cGMP concentration induced by a prolonged pulse of Spermine-NONOate and delays massive and sustained elevation of intracellular cGMP concentration. (A-C) HEK293 cells were exposed to a 2 min pulse of spermine-NONOate. .sup.cGMPSp/SponGee-expressing cells display a reduction of both the FRET:CFP ratio amplitude and the rate of increase compared to controls. (D-F) A 15 min pulse of Spermine-NONOate induces a massive change in the .sup.ThPDE5.sup.VV FRET:CFP ratio. Cells expressing .sup.cGMPSp/SponGee exhibit a change in the FRET:CFP ratio of similar magnitude, but delayed as compared to cells devoid of SponGee (also see Movie S3). Scale bar, 20 m. (B,E) Data are means.e.m. (C,F) Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d. ***Pcustom-character0.001; Mann-Whitney test.

[0074] FIG. 5. SponGee does not affect cell survival. HEK293 cells were transfected with either .sup.cGmPSp/SponGee or RFP. Activated Caspase 3-positive cells were immunolabeled to evaluate the number of cells undergoing apoptosis. SponGee-expressing cells are not more prone to enter an apoptotic program than their RFP-expressing controls. (A) Scale bar, 50 m (B) Data are means.e.m. with individual data points, Mann-Whitney test.

[0075] FIG. 6. SponGee is highly specific for cGMP over cAMP. (A-C) HEK293 cells were exposed to a 20-second pulse of Fsk under constant ODQ perfusion. The .sup.cGMPSp/SponGee-positive cells co-expressing the cAMP biosensor H147 display a similar FRET:CFP ratio amplitude and rate of increase compared to controls (also see Movie S4). (D-F) Cells were exposed to Fsk to elevate their cAMP concentration and challenge the ability of SponGee to discriminate between cGMP and cAMP. Fsk-elevated cAMP concentration did not prevent .sup.cGMPSp/SponGee to reduce the amplitude of the Spermine-NONOate-induced cGMP signal detected by the cGMP sensor .sup.ThPDE5.sup.VV (also see Movie S5). Scale bar, 20 m. (B,E) Data are means.e.m. (C,F) Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d.; ***Pcustom-character0.001; Mann-Whitney test.

[0076] FIG. 7. SponGee alters cortical neuron migration in vivo. (A,B) Control cortical neurons electroporated at E14.5 are packed into a dense layer close to the marginal zone at E18.5. In contrast .sup.cGMPSp/SponGee-expression prevents the development of this layer, with (A) neurons scattered throughout the depth of the developing cortex (arrowhead), and (B) the formation of heterotopias (arrowhead) at the surface of the cortex. (C) At P10, .sup.cGMPSp/SponGee -electroporated neurons and their mRFP-electroporated controls are both found in the superficial layers of the cortex. (D) Heterotopias induced by .sup.cGMPSp/SponGee at embryonic stages are maintained in P10 pups (arrowhead), indicating that altering cGMP signaling interferes with cortical neuron migration. Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d. Scale bars, (A) 250 m, (B) 100 m, (C) 500 m, (D) 200 m. **Pcustom-character0.01; Two-way ANOVA and Bonferroni post hoc tests.

[0077] FIG. 8. Subcellular restriction of cGMP manipulation using SponGee. (A) .sup.cGMPSp/SponGee was either used to alter cGMP signaling in the entire cell when not targeted to any cellular compartment or to prevent the activation of cGMP downstream effectors in specific compartments. Lyn-.sup.cGMPSp/SponGee aims to be confined to lipid rafts whereas .sup.cGMPSp/SponGee e-Kras is intended to be restricted to the non-raft fraction of the plasma membrane. (B) .sup.cGMPSp/SponGee is detected in the cytoplasm (top row) whereas both Lyn-.sup.cGMPSp/SponGee and .sup.cGMPSp/SponGee-Kras are found at the plasma membrane (middle and bottom row). (C,D) Plasma membrane fractionation highlights distinct subcellular localization of Lyn-.sup.cGMPSp/SponGee and .sup.cGMPSp/SponGee-Kras. Lyn-.sup.cGMPSp/SponGee is highly enriched in fraction 4 whereas the localization of SponGee-Kras is shifted towards higher density fractions (7 to 9) (also see Figure S2). (E) Slit1 and (F) ephrinA5 induce growth cone collapse in control axons. SponGee and Lyn-SponGee prevents the collapse of growth cone. In contrast, SponGee-Kras does not affect axonal response to slit1 and ephrinA5 (also see Figures S3 and S4). Box-and-whisker plot elements: center line, mean; box limits, upper and lower quartiles; whiskers, s.d. Scale bars, (B) 20 M, (E) 10 m. (C,D) *P110.05, **P110.01, ***P110.001; Two-way ANOVA followed by Bonferroni post hoc tests. (E,F) *Pcustom-character0.01,**Pcustom-character0.01, ***Pcustom-character0.001; Kruskal-Wallis test followed by Mann-Whitney post hoc tests.

EXAMPLE 1

Constructs

[0078] A polynucleotide encoding an example of a polypeptide according to the invention, hereafter designated .sup.cGmPSp, cGMP Sponge, SponGee .sup.or cGmPSp/SponGee, all these terms designating the very same polypeptide, further comprising a FLAG tag in 5 was prepared using [0079] the sequence SEQ ID NO: 15:

TABLE-US-00001 ATGAGCGAGCTGGAGGAAGACTTTGCCAAGATTCTCATGCTCAAGGAGGAG AGGATCAAAGAGCTGGAGAAGCGGCTGTCAGAGAAGGAGGAAGAAATCCAG GAGCTGAAGAGGAAACTCCATAAATGCCAGTCAGTGCTGCCCGTGCCCTCG ACCCACATCGGCCCCCGGACCACCCGGGCACAGGGCATCTCGGCCGAGCCG CAGACCTACAGGTCCTTCCACGACCTCCGAGTGACCCTGCCCTTCTACCCC AAGAGTCCACAGTCCAAGATCGATCTCATAAAGGAGGCCATCCTTGACAAT GACTTTATGAAGAACTTGGAGCTGTCACAGATCCAAGAGATTGTGGATTGT ATGTACCCAGTGGAGTACGGCAAAGACAGCTGCATCATCAAAGAAGGAGAT GTGGGGTCACTGGTGTATGTCATGGAAGATGGTAAGGTTGAAGTTACAAAA GAAGGCGTGAAGCTGTGCACAATGGGTCCTGGTAAAGTGTTTGGAGAGTTG GCTATCCTTTACAACTGTACCCGGACGGCGACCGTCAAAACTCTTGTAAAT GTGAAACTCTGGGCCATTGATCGACAATGTTTTCAGACGATAATGATGAGG ACAGGACTTATCAAGCATACCGAGTATATGGAATTTTTAAAAAGCGTTCCA ACATTCCAGAGCCTTCCTGAAGAGATCCTCAGTAAACTTGCTGACGTCCTT GAAGAGACCCACTATGAAAATGGGGAATATATCATCAGGCAAGGTGCAAGA GGGGACACCTTCTTTATCATCAGTAAAGGAAAGGTTAATGTCACTCGTGAA GACTCGCCCAATGAAGACCCAGTCTTTCTTAGAACCTTAGGAAAAGGAGAT TGGTTTGGAGAGAAAGCCTTGCAGGGGGAAGATGTGAGAACAGCGAATGTA ATTGCGGCAGAAGCTGTAACCTGCCTTGTGATCGACAGAGACTCTTTCAAA CATTTGATTGGAGGATTAGATGATGTTTCTAAAAAGCATATGAAGATGCAG AAGCTAAG
in frame with a tandem repeat of the Lyn Kinase N-terminus domain encoded by the sequence SEQ ID NO: 16:

TABLE-US-00002 ATGGGCTGCATCAAGAGCAAGCGCAAGGACAAGATGGGCTGCATCAAGAGC AAGCGCAAGGACAAG

[0080] The oligos were annealed and cloned into pcDNA3-mRFP in frame with the reporter sequence. Lipid-raft-excluded and cytosolic forms of the .sup.cGmPSp/SponGee variants were obtained by subcloning into pcDNA3 with or without the CaaX-polylysine motif of Kras encoded by the sequence SEQ ID NO: 17:

TABLE-US-00003 CAAGAAGAAGAAGAAGAAGAAGAGCAAGACCAAGTGCGTGATCATG
respectively.

[0081] For expression on RGCs, the constructs were subcloned into pcX. .sup.ThPDE5.sup.VV was targeted to the membrane microdomains using the In-Fusion HD cloning kit (Clontech) and subcloned into pcDNA3 or pcX.

[0082] The sequence of the truncated human PDESA1 (hPDE5) was obtained by gene synthesis in the pUC57 vector (Genscript) and digested with SmaI and NheI enzymes (New England Biolabs). The Epac1 sequence was removed from the .sup.TEpac.sup.VV vector (obtained from Dr Kees Jalink, NKI-AVL, Amsterdam, Netherlands) by digestion with EcoRV and Nhel (New England Biolabs) and replaced by hPDE5. Cell culture: HEK293T cells were kept in a 37 C., 5% CO2 incubator and transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturers protocol and imaged the day following transfection or fixed and processed for immunocytofluorescence.

[0083] Membrane fractionation by detergent-free method: Electroporated retinas were pelleted (195 g for 5 min at 4 C.) and resuspended in 1.34 mL of 0.5 M sodium carbonate, pH 11.5, with protease inhibitor cocktail and phosphatase inhibitor cocktail 1, 2 and 3 (Sigma-Aldrich). The homogenate was sheared through a 26-gauge needle and sonicated three times for 20 s bursts. The homogenate was adjusted to 40% sucrose by adding 2.06 mL of 60% sucrose in MBS (25 mM MES, pH 6.4, 150 mMNaCl, and 250 mM sodium carbonate), placed under a 5-30% discontinuous sucrose gradient, and centrifuged at 34,000 rpm for 15-18 h at 4 C. in a Beckman SW 41Ti rotor. Nine fractions (1.24 mL each) were harvested from the top of the tube mixed with 9 volumes of MBS, and centrifuged at 40,000 rpm for 1 h at 4 C. (Beckman SW-41Ti rotor). Supernatants were discarded, and membrane pellets were resuspended in 100 l of 1% SDS.

[0084] For immunoblotting, samples were separated on 4-15% Mini-Protean TGX Tris-Glycine-buffer SDS PAGE (Biorad) and transferred onto 0.2 m Trans-Blot Turbo nitrocellulose membranes (Biorad). Membranes were blocked for one hour at room temperature in 1TBS (10 mMTris pH 8.0, 150 mMNaCl,) supplemented with 5% (w/v) dried skim milk powder. Primary antibody incubation was carried out overnight at 4 C., with the following antibodies: rabbit anti-GFP (1/200; A11122; Life Technologies), rabbit anti-DsRed (1/200; 632476; Clontech), rabbit anti-custom-character-Adaptin (1/200; sc-10762; Santa Cruz) and rabbit anti-Caveolin (1/500; 610060; BD Transduction Laboratories). A goat anti-rabbit-HRP coupled secondary antibody was used for detection (Jackson ImmunoResearch, West Grove, Pa.). After antibody incubations, membranes were extensively washed in TBS T (TBS containing 2.5% Tween-20). Western blots were visualized using the enhanced chemiluminescence method (ECL prime Western Blotting detection reagent, Amersham).

[0085] Collapse assay: Retinas of E14 mice were electroporated with mRFP, Lyn-.sup.cGMPSp/SponGee, .sup.cGMPSp/SponGee or .sup.cGMPSp/SponGee-Kras using two poring pulses (square wave, 175V, 5 ms duration, with 50 ms interval) followed by four transfer pulses (40V, 50 ms and 950 ms interpulse). Retinas were dissected and kept 24 hours in culture medium (DMEM-F12 supplemented with glutamine (Sigma Aldrich), penicillin/streptomicin (Sigma Aldrich), BSA (Sigma Aldrich) and glucose), in a humidified incubator at 37 C. and 5% CO2. The day after, they were cut into 200 m squares with a Tissue-Chopper (Mcllwan) and explants were plated on glass coverslips coated with poly-L-lysine and Laminin (Sigma Aldrich). Cells were cultured for 24 hours in culture medium supplemented with 0.4% methyl cellulose and treated with rmSlit-1 (R&D Systems) for 1 hour.

Immunodetection

[0086] Retinal explants, or HEK cells coexpressing the targeted versions of SponGee and GFP, were fixed with 4% PFA in PB for 30 minutes, permeabilized and blocked and with 1% Triton and 3% BSA in PBS, then incubated with antobodies agains DsRed (Clontech, lot #1306037, previously used in a similar assay, (Averaimo et al., Nat Commun., 7:12896, 2016) followed by a secondary antibody coupled to AlexaFluor 594 (Life Technologies) and GFP (Life Technologies, lot #1789911, previously validated in Nicol et al., Nat. Neurosci:, 10: 340-347, 2007) or -Tubulin (Sigma, lot # T6199, previously validated in Nicol et al., Nat. Neurosci:, 10: 340-347, 2007) followed by a secondary antibody coupled to AlexaFluor 488 (Life Technologies).

[0087] Imaging: Images were acquired with an inverted DMI6000B epifluorescence microscope (Leica) coupled to a 40 oil-immersion objective (N.A. 1.3) and the software Metamorph (Molecular Devices). For live imaging experiments, cells were perfused with HBS buffer with 0.2 or 2 mM CaCl. Thapsigargin was used at 1 mM). Images were acquired simultaneously for the CFP (483/32 nm) and YFP (542/27) channels every 20 seconds. Images were processed in ImageJ, corrected for background and bleedthrough and then the ratio CFP/YFP was calculated. Confocal images were acquired with a 63 oil immersion objective (N.A. 1.45) and a Z-stack containing the whole specimen was sampled at nyquist frequency. Images were rendered in ImageJ and Photoshop.

[0088] Animals: Pregnant C57BL6/J and RjOrl:SWISS mice and Sprague-Dawley rats were purchased from Janvier Labs. All animal procedures were performed in accordance with institutional guidelines and approved by local ethics committees (C57BL6/J mice, C2EA-05: Comit dthique en experimentation animale Charles Darwin; Sprague-Dawley rats, ethics committee C2EA-59: Comit dthique en matire dexprimentation animale Paris Centre et Sud). Animals were housed under 12 h light/12 h dark cycle. Embryos from dated matings (developmental stage stated in each section describing individual experiments) were not sexed during the experiments and the female over male ratio is expected to be close to 1.

Cell Death Assay

[0089] HEK293 Cells were plated on poly-lysine-coated coverslips and transfected the following day with a pCX-mRFP or a pCX-SponGee vector using Lipofectamine 2000 (Thermo Fisher) following the manufacturers instructions. Three days after plating, cells were either fixed with 4% paraformaldehyde and processed for immunocytochemistry with the antibodies against Cleaved Caspase 3 (Asp175; Cell Signaling; lot #0043) and -tubulin (Sigma) or treated with the CellEvent Caspase 3/7 Green Detection Reagent (Thermo Fisher) for 30 minutes and then fixed and labeled with an -tubulin antibody. For each experiment, the proportion of Caspase3-positive over unlabeled cells in the population of mRFP- or SponGee-positive cells was computed from 10 randomly chosen fields acquired on a 20 air objective in a DM6000 microscope (Leica Microsystems).

Rat Hippocampal Culture

[0090] Hippocampal neuronal cultures were performed essentially as described previously (Leterrier et al., J. Neurosci., 26: 3141-3153, 2006). Briefly, hippocampi of rat embryos were dissected at embryonic day 18. After trypsinization, dissociation was achieved with a fire-polished Pasteur pipette. Cells were counted and plated on poly-D-lysine-coated 18-mm diameter glass coverslips, at a density of 300-400 cells.Math.mm.sup.2. The plating medium was Neurobasal (Life Technologies) supplemented with 2% B27 (Life Technologies) and containing stabilized Glutamine (0.5 mM) and penicillin G (10 U.Math.ml.sup.1)/streptomycin (10 g.Math.ml.sup.1). Four hours after plating, the coverslips were transferred into Petri dishes containing supplemented Neurobasal medium that had been conditioned for 24 h on an 80% confluent glia layer. Neurons were transfected after 6 days in vitro (DIV) using Lipofectamine 2000 (Life Technologies), following the manufacturers instructions.

In Utero Electroporation

[0091] Timed pregnant females (Janvier Labs) were delivered to the animal facility a week prior to the surgery in order to allow a minimum of 5-days adaptation. In utero electroporation was performed as described previously (Loulier et al., PLoS Biol., 7: e1000176, 2009). E14.5 females were anesthetized with Ketamine/Xylazine and a midline laparotomy was performed, exposing uterine horns and allowing visualization of embryos under oblique illumination. 1 custom-character of DNA containing two plasmids vectors combined 3:1 with sterile Fast Green dye (Sigma) was injected with a glass capillary pipette (75-125 custom-character outer diameter with beveled tip) driven by a INJECT+MATIC (INJECT+MATIC) microinjector into the lateral ventricle of each embryo. Two different plasmid vectors were injected simultaneously. The first was a plasmid encoding green fluorescent protein under the control of the chicken beta actin promoter (pCX-eGFP), used as a control of electroporation. The second was either a plasmid encoding red fluorescent protein (mRFP) control construct or SponGee-mRFP. The anode of 5 mm diameter tweezertrodes (Sonidel Limited) was placed above the dorsal telencephalon and four 35-V pulses of 50 ms duration were applied across the uterine sac. Following intrauterine surgery, the incision site was closed with sutures (4-0, Ethicon) and the mouse was allowed to recover in a clean cage. Mice were either euthanized 4 days after surgery to harvest E18.5 embryonic brains, or allowed to give birth for analysis at P10 postnatal stage. Embryonic brains were dissected out, immersed overnight in Antigenfix (Diapath) fixative solution and rinsed in PBS prior to sectioning. P10 mice were deeply anesthetized with sodium pentobarbital (150 mg.Math.kg.sup.1), perfused transcardially with Antigenfix (Diapath), brains dissected out and postfixed overnight in the same solution. Embryonic and postnatal brain samples were sectioned at 200 custom-character thickness on a vibrating blade microtome (Leica VT 1000S). Finally, sections were either mounted in Vectashield+Dapi (Vector laboratories) or incubated 2 hours in 10 g.Math.mL.sup.1 bis-benzimide (Sigma Aldrich) and mounted in Mowiol 4-88 (Sigma Aldrich). Confocal images were acquired with a 10 objective (N.A. 0.4) and a Z-stack containing the whole specimen was sampled at Nyquist frequency. Images were rendered in ImageJ and Photoshop.

FRET Imaging and Analysis (HEK Cells)

[0092] Images were acquired with an inverted DMI6000B epifluorescence microscope (Leica) coupled to a 40 oil-immersion objective (N.A. 1.3) and the software Metamorph (Molecular Devices). For live imaging experiments, cells transfected with .sup.ThPDE5.sup.VV or H147, and co-expressing mRFP or SponGee were perfused with 1 mM CaCl.sub.2, 0.3 custom-character MgCl.sub.2, 0.5 mM Na.sub.2HPO.sub.4, 0.5 mM NaH.sub.2PO.sub.4, 0.4 custom-character MgSO.sub.4, 4.25 mM KCl, 14 custom-character NaHCO.sub.3, 120 mM NaCl, 0.0004% CuSO.sub.4, 1.24 custom-character Fe (NO.sub.3)3, 1.5 custom-character FeSO.sub.4, 1.5 custom-character thymidine, 0.51 mM lipoic acid, 1.5 mM ZnSO.sub.4, 0.5 custom-character sodium pyruvate (all from Sigma), 1 MEM Amino Acids (Life Technologies), 1 non-essential amino acids (Life Technologies), 25 mM HEPES (Sigma), 0.5 mM putrescine (Sigma), 0.01% BSA (Sigma), 0.46% glucose (Sigma), 1 mM glutamine (Life Technologies), 2% penicillin streptomicin (Life Technologies). Vitamin B12 and riboflavin were omitted because of their autofluorescence. SpermineNONOate was used at 50 M, ODQ (Tocris) at 10 M and Forskolin (Sigma) at 10 M. Images were acquired simultaneously for the CFP (483/32 nm) and YFP (542/27) channels every 20 seconds. Images were processed in ImageJ, corrected for background and bleedthrough and then the ratio CFP/YFP was computed. Confocal images were acquired with a 63 oil immersion objective (N.A. 1.45) and a Z-stack containing the whole specimen was sampled at Nyquist frequency. Images were rendered in ImageJ and Photoshop.

FRET Imaging (Rat Hippocampal Cultures)

[0093] Neurons transfected with .sup.ThPDE5.sup.VV probe were imaged by videomicroscopy between DIV8 and DIV11 on a motorized Nikon Eclipse Ti-E/B inverted microscope with the Perfect Focus System (PFS) in a 37 C. thermostated chamber, using an oil immersion CFI Plan APO VC 60, NA 1.4 objective (Nikon). Acquisitions were carried out at the excitation wavelength of the CFP (434 nm+/15 nm) using an Intensilight (Nikon). Emitted light passed through an Optosplit II beam-splitter (Cairn Research) equipped with a FF509-FDi01 dichroic mirror, a FF01-483/32-25 CFP filter and a FF01-542/27-25 YFP filter and was collected by an EM-CCD camera (Evolve 512, Photometrics), mounted behind a 2 magnification lens. Acquisitions were performed by piloting the set-up with Metamorph 7.7 (Molecular Devices). All filter sets were purchased from Semrock. Cultured neurons on 18-mm coverslips were placed in a closed imaging chamber containing an imaging medium: 120 mM NaCl, 3 mM KCl, 10 mM HEPES, 2 mM CaCl.sub.2, 2 mM MgCl.sub.2, 10 mM D-glucose, 2% B27, 0,001% BSA. The acquisition lasted 70 minutes registering one image every 2 minutes, registering in parallel 4 to 6 neurons on the same coverslip. 30 minutes after the beginning of the acquisition, vehicle solution or ODQ 100 M (R&D Systems) was applied 40 minutes after the onset of acquisition, DEA NONOate (Sigma) 50 M or Forskolin (Sigma) 10 M was applied.

FRET Data Analysis (Rat Hippocampal Culture)

[0094] Images were divided in two parts on ImageJ to separate the CFP channel from the YFP channel. Data were then analyzed on Matlab by calculating the FRET ratio at each time point for one or several Regions Of Interest (ROIs). The user defined ROIs for each position. For each image, the value of the FRET ratio corresponds to (IY-BY)/(IC-BC), where IY is the mean intensity of the ROI in the YFP channel; BY is the mean intensity of the background in the YFP channel; IC is the mean intensity of the ROI in the CFP channel; BC is the value of the background in the CFP channel. For each ROI, the FRET ratio was then normalized by the baseline mean, defined as the 7 time points before first treatment injection. FRET Ratio=100*(RcRo)/Ro, where Rc is the value of the crude FRET ratio and Ro is the mean of the baseline. The quantitative results obtained for each neuronal compartment were grouped together and the mean FRET ratio normalized to baseline and SEM were calculated for each time point. Deviation was corrected for somata and dendrites on Matlab. The mean slope was calculated for all neurons in the somata and dendrites, respectively, for the last 7 time points before addition of treatment and subtracted from all FRET ratio time points.

Analysis and Statistics

[0095] No data were excluded from the analysis. No sample size calculation was performed. Sample size was considered sufficient after three reproducible and independent experiments, leading to n 3 since several animals, coverslips, or biochemical assays were often analyzed for the same experimental condition. Animals or cultures were equivalent and not distinguishable one from another before treatment, de facto randomizing the sample without the need of a formal randomization process. Photomicrographs were often easily traceable by eye to its experimental condition, making blind analysis of the data difficult to achieve. When careful blinding was performed, experiments reproduced the results obtained in non-blinded experiments with identical experimental conditions. Image calculation and analysis were performed using ImageJ, except for the validation of the .sup.ThPDE5.sup.VV sensor for which Matlab was used. Statistical tests were calculated using GraphPad Prism (GraphPad Software Inc.).

Results

[0096] An example of a polypeptide according to the invention (herein designed .sup.cGMPSp, cGMP Sponge, SponGee or .sup.cGMPSp/SponGee) was designed based on a high affinity chimeric variant of cGMP-dependent Protein Kinase (PKG) containing portions of PKG-I and PKG-Icustom-character. .sup.cGMPSp/SponGee contains the binding sites and the chimeric affinity domain and excludes the kinase domain to prevent the activation of downstream effectors (FIG. 1). This construct was further fused to the fluorescent protein mRFP for easy identification of .sup.cGMPSp/SponGee -expressing cells.

[0097] The buffering properties of .sup.cGMPSp/SponGee were tested with .sup.ThPDE5.sup.VV, a FRET sensor for cGMP based on the human version of PDE5 fused to an optimized CFP (Turquoise) and a tandem of a YFP variant (Venus) as the FRET donor and acceptors, respectively. .sup.ThPDE5.sup.VV is similar to cGES-DE5, a previously described cGMP biosensor (Nikolaev et al., Nat. Methods., 3: 23-25, 2006). The donor and acceptor fluorescent proteins of cGES-DE5 have been replaced by their optimized variants mTurquoise and a tandem of mVenus respectively, following a previously described strategy (Klarenbeek et al., PLoS ONE 6, e19170, 2011). .sup.ThPDE5.sup.VV was expressed in vitro in rat hippocampal neurons exposed to DEA-NONOate, a donor of NO, which activates cGMP synthesis by soluble guanylyl cyclases (Bhargava et al., Front Mol Neurosci., 6, 26, 2013).

[0098] Monitoring the FRET over CFP ratio in .sup.ThPDE5.sup.VV-expressing cells reflects the intracellular variation in cGMP concentration. H293 cells exhibit an increase in the FRET over CFP ratio when exposed to a short pulse of Spermine-NONOate, a donor of NO, which in turn activates cGMP synthesis by soluble guanylyl cyclases, revealing an increase in intracellular cGMP concentration. Cells were exposed to a sustained Spermine-NONOate stimulation at the end of the experiment to induce a massive cGMP synthesis and control their viability. A 1 minute pulse of Spermine-NONOate induced a 20% increase in the FRET/CFP ratio with a 1 minute delay since the start of the stimulation. This delay is partially explained by the dead volume in the perfusion line. Expressing .sup.cGMPSp/SponGee largely reduced the Spermine-NONOate-induced FRET/CFP change, reflecting a reduction of cGMP molecules available to the bind the biosensors. This observation demonstrate that .sup.cGMPSp/SponGee is a cGMP scavenger and reduces the availability of this second messenger for its downstream pathways. The .sup.cGMPSp/SponGee -induced reduction in the FRET/CFP elevation was less marked with longer (2 minutes) Spermine-NONOate exposure, suggesting that prolonged increase in cGMP concentration leads to the saturation of the cGMP binding sites.

[0099] To evaluate .sup.cGMPSp/SponGee capability to interfere with a physiological process in vivo and thus its potential to be used as a tool to investigate cellular function in an intact organism, .sup.cGMPSp/SponGee was electroporated in utero in the lateral brain ventricle of E14.5 mice embryos. The migration of electroporated cortical neurons was analyzed at gestational day 18. In E18 eGFP and mRFP co-electroporated animals, neurons display an archetypical migration with the majority of transfected cells accumulated at the cortical plate near the marginal zone (FIG. 1). In contrast, neurons co-electroporated with .sup.cGMPSp/SponGee -mRFP and GFP exhibit a delayed migration, with numerous neurons lost throughout the neocortex, including the subventricular zone. Furthermore, several electroporated cells failed to stall at the cortical plate, overshooting towards the marginal zone. This demonstrates that cGMP buffering by .sup.cGMPSp/SponGee is sufficient to alter the physiological cGMP modulation required for the sound neuronal migration in vivo.

[0100] Guanylyl cyclases, the cGMP-synthesizing enzymes, are restricted in subcellular compartments leading to compartmentalization of cGMP signals whithin cells. Since genetic-encoding confers the ability to restrict the expression of the constructs to a specific organelle using targeting sequences, the functionality of .sup.cGMPSp/SponGee was assessed in this scenario. The cGMP buffer was targeted to the membrane, its expression being further restricted to the lipid raft microdomain by the N-Terminus fusion of a tandem of palmitoylation-myristoylation targeting peptides from Lyn Kinase (Lyn-.sup.cGMPSp/SponGee), or being further ex cluded from the lipid raft domain by the C-Terminus fusion of the CaaX-polylysine motif derived from K-Ras (.sup.cGMPSp/SponGee -Kras). Lyn-.sup.cGMPSp/SponGee and .sup.cGMPSp/SponGee-Kras expression was restricted to the membrane, in contrast to .sup.cGMPSp/SponGee (FIG. 2). The localization of Lyn-.sup.cGMPSp/SponGee and .sup.cGMPSp/SponGee-Kras in distinct membrane compartments was analyzed using membrane fractionation in a density gradient. Lyn-.sup.cGMPSp/SponGee expression was restricted to the low density fractions 3-4, concomitant with the lipid raft marker Caveolin. In contrast, .sup.cGMPSp/SponGee -Kras was enriched in the high density fractions 7 to 9 together with custom-character-Adaptin, a marker of the non-raft component of the membrane. To assess whether the compartmentalized variants of .sup.cGMPSp/SponGee affect differentially cGMP- dependent cellular responses, the response of retinal ganglion cell growth cones expressing either Lyn-.sup.cGMPSp/SponGee or .sup.cGMPSp/SponGee-Kras to the axon guidance molecules slit-1 and ephrinA5, a process requiring cGMP, was analyzed. In untransfected axons, slit-1 and ephrin-A5 induced the collapse of the growth cone. The expression of .sup.cGMPSp/SponGee in the cytosol abolished the collapse response induced by both cues, confirming the requirement of cGMP signaling in this process. Similarly, slit1 and ephrinA5 failed to induce growth collapse in Lyn-.sup.cGMPSp/SponGee-expressing axons. In contrast, .sup.cGMPSp/SponGee-Kras-expressing axons were indistinguishable from controls, demonstrating that the blockade of cGMP signaling by .sup.cGMPSp/SponGee in but not outside lipid rafts is sufficient to prevent slit1- and ephrinA5-induced growth cone collapse. Thus, targeting .sup.cGMPSp/SponGee to distinct compartments enables the control of cGMP and its downstream signaling with subcellular resolution. To investigate the limits of cGMP buffering by .sup.cGMPSp/SponGee, cells coexpressing .sup.cGMPSp/SponGee and .sup.ThPDE5.sup.VV were exposed to longer Spermine-NONOate stimulation (two-minute pulse, or sustained exposure). Expressing SponGee was sufficient to reduce both the amplitude and delay of the FRET:CFP elevation induced by a two-minute exposure to Spermine-NONOate (FIG. 4A-C). In contrast, the cGMP elevation detected by .sup.ThPDE5.sup.VV during a sustained Spermine-NONOate stimulation was delayed, but the peak amplitude was not affected (FIG. 4D-F), suggesting that massive and prolonged increase in cGMP concentration leads to the saturation of .sup.cGMPSp/SponGee cGMP binding sites in contrast to the resting concentration in this second messenger.

[0101] The chronic scavenging of cGMP might affect cell survival because of the role of this second messenger in many signaling pathways and cellular processes. However, the morphology of .sup.cGMPSp/SponGee expressing cells did not differ from their control suggesting that cell death was not affected (FIG. 5). Caspase 3 was not activated in expressing .sup.cGMPSp/SponGee -expressing HEK293 cells confirming that buffering cGMP with .sup.cGMPSp/SponGee does not affect cell survival (FIG. 5).

[0102] To evaluate the specificity of .sup.cGMPSp/SponGee for cGMP over the closely related cAMP, FRET experiments were conducted using a cAMP bio sensor, H147. In many systems, cAMP and cGMP signaling influence each other, with the concentration of both cyclic nucleotides changing in opposite directions. To minimize the influence of cGMP scavenging by .sup.cGMPSp/SponGee on cAMP measurements, the cAMP buffering activity of .sup.cGMPSp/SponGee was evaluated in cells with pharmacologically-reduced and stabilized cGMP concentration. RFP- or .sup.cGMPSp/SponGee-expressing cells were maintained with reduced cGMP-signaling using the soluble guanylyl cyclase inhibitor ODQ, and later exposed to a 20 seconds pulse of the adenylyl cyclase activator Fsk. .sup.cGMPSp/SponGee did not reduce the amplitude or induce a delay in the elevation of cAMP concentration (FIG. 6A-C). Whether high intracellular concentrations of cAMP can bind and saturate the cGMP-binding domains of .sup.cGMPSp/SponGee, reducing its ability to act as a cGMP-specific scavenger, was evaluated. The buffering of NO-induced cGMP elevation by .sup.cGMPSp/SponGee was not affected after Fsk-induced elevation of cAMP concentrations (FIG. 6D-F), showing that cellular cAMP does not bind .sup.cGMPSp/SponGee, even at high concentrations. These observations demonstrate that .sup.cGMPSp/SponGee does not buffer intracellular cAMP and highlights its specificity for cGMP.

[0103] To evaluate the ability of .sup.cGMPSp/SponGee to interfere with physiological processes in vivo and thus to assess its potential as a tool to investigate cellular function in an intact organism, .sup.cGMPSp/SponGee was electroporated in utero in the brain lateral ventricles of E14.5 mouse embryos. The migration of electroporated cortical neurons was analyzed at E18.5 and P10. In E18.5 control eGFP and mRFP co-electroporated animals, neurons display an archetypical migration with the majority of transfected cells accumulating in the cortical plate near the marginal zone (FIG. 7A,B). In contrast, neurons co-electroporated with .sup.cGMPSp/SponGee and GFP exhibit a delayed migration, with neurons scattered throughout the cortical plate, including the intermediate zone (FIG. 7A). In addition, several electroporated cells failed to stall at the cortical plate, overshooting the terminal zone observed in mRFP-electroporated controls (FIG. 7B). Heterotopias were found in 7 out of 9 .sup.cGMPSp/SponGee-electroporated animals, whereas 2 out of 10 mRFP-expressing embryos exhibited neurons overshooting the cortical plate (P=0.000037, custom-character test). Misplaced .sup.cGMPSp/SponGee-expressing neurons were still found at P10 with heterotopias in 71% of the pups (5 out of 7) as compared to 20% control animals (1 out of 5, P=0.000024, custom-character test) (FIG. 7C,D). This demonstrates that cGMP buffering by .sup.cGMPSp/SponGee is sufficient to alter the physiological cGMP modulation required for the appropriate neuronal migration in vivo.

[0104] To achieve specific activation of its plethoric downstream targets, cGMP signals are confined to specific subcellular compartments . Since genetic encoding confers the ability to restrict the expression of the constructs to a specific organelle using targeting sequences, the functionality of .sup.cGMPSp/SponGee was assessed in this scenario. We targeted the cGMP buffer to the membrane, further restricting its expression to the lipid raft microdomains by the N-terminal fusion of a tandem of palmitoylation-myristoylation targeting peptides from Lyn Kinase (Lyn-.sup.cGMPSp/SponGee), or excluding it from the lipid raft domain by the C-terminal fusion of a CaaX-polylysine motif derived from K-Ras (.sup.cGMPSp/SponGee-Kras) (FIG. 8A). Lyn-.sup.cGMPSp/SponGee and .sup.cGmPSp/SponGee-Kras expression was restricted to the membrane, in contrast to the untargeted .sup.cGMPSp/SponGee (FIG. 8B). We analyzed the localization of Lyn-.sup.cGMPSp/SponGee and .sup.cGMPSp/SponGee-Kras in distinct membrane compartments using membrane fractionation in a density gradient. Lyn-.sup.cGMPSp/SponGee expression was restricted to low-density fractions, concomitant with the lipid raft marker Caveolin. In contrast, .sup.cGMPSp/SponGee-Kras was enriched in the high-density fractions together with custom-character-Adaptin, a marker of the non-raft component of the membrane (FIG. 8C,D). To assess whether compartmentalization of .sup.cGMPSp/SponGee differentially affects cGMP-dependent cellular responses, the behavior of retinal ganglion cell growth cones expressing either Lyn-.sup.cGMPSp/SponGee or .sup.cGMPSp/SponGee-Kras when exposed to the axon guidance molecules slit1 and ephrinA5 were analyzed. Slit1- and ephrinA5-dependent repulsion of axonal growth cones require cGMP signaling. In control conditions, including untransfected axons and mRFP-electroporated axons, slit1 and ephrinA5 induced the collapse of the growth cone (FIG. 8E,F). .sup.cGMPSp/SponGee expression in the cytosol abolished the collapse response induced by both cues, confirming the requirement of cGMP signaling in this process. Similarly, slit1 and ephrinA5 failed to induce growth cone collapse in Lyn-.sup.cGMPSp/SponGee-expressing axons. In contrast, .sup.cGMPSp/SponGee-Kras-expressing axons were indistinguishable from controls (FIG. 8E,F), demonstrating that the blockade of cGMP signaling by .sup.cGMPSp/SponGee in but not outside lipid rafts is sufficient to prevent slit 1- and ephrinA5-induced growth cone collapse. Thus, targeting .sup.cGMPSp/SponGee to distinct compartments enables the control of cGMP and its downstream signaling with subcellular resolution. In conclusion, the polypeptide of the invention functions as a cGMP scavenger able to interfere with physiological functions that rely on this second messenger. The polypeptide of the invention, can therefore alter cGMP responses in a cell-specific manner and with subcellular resolution, opening new fields for the precise study of signaling cascades and paving the way for therapeutic implementation.