METHOD FOR PRODUCING TRANSGENIC PLANT HAVING INCREASED CONTENT OF 20-HYDROXYECDYSONE USING INSECT-DERIVED GENE AND PLANT PRODUCED BY THE SAME
20200299720 ยท 2020-09-24
Inventors
- Key Zung Riu (Jeju-do, KR)
- Kyung Hwan Boo (Jeju-do, KR)
- Byung Nyun Chun (Gyeonggi-do, KR)
- Jung Kyu Suh (Gyeonggi-do, KR)
- Jiwon Kim (Jeju-do, KR)
Cpc classification
C12N15/8243
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
A method for producing a transgenic plant having increased content of 20-hydroxyecdysone according to an embodiment of the present invention may use insect-derived gene A method according to an embodiment of the present invention includes transforming a plant cell with a recombinant vector including at least one of a gene encoding short-chain dehydrogenase/reductase (SDR) protein and a gene encoding C-14 hydroxylase protein, a gene encoding C-25 hydroxylase protein, a gene encoding C-22 hydroxylase protein, a gene encoding C-2 hydroxylase protein, and a gene encoding C-20 hydroxylase protein derived from insect, and regenerating a plant from the transformed plant cell.
Claims
1. A method for producing a transgenic plant having increased content of 20-hydroxyecdysone compared to a wild type plant, the method comprising: transforming a plant cell with a recombinant vector comprising: at least one of a gene encoding short-chain dehydrogenase/reductase (SDR) protein and a gene encoding C-14 hydroxylase protein; a gene encoding C-25 hydroxylase protein; a gene encoding C-22 hydroxylase protein; a gene encoding C-2 hydroxylase protein; and a gene encoding C-20 hydroxylase protein derived from insect; and regenerating a plant from the transformed plant cell.
2. The method of claim 1, wherein the gene encoding SDR protein consists of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 7; the gene encoding C-14 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 8; the gene encoding C-25 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 9; the gene encoding C-22 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 10; the gene encoding C-2 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 11; and the gene encoding C-20 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 12.
3. A transgenic plant produced by the method of claim 1, the transgenic plant having increased content of 20-hydroxyecdysone compared to the wild type plant.
4. A transgenic seed of the transgenic plant according to claim 3.
5. A composition for increasing content of 20-hydroxyecdysone in plant, the composition comprising: at least one of short-chain dehydrogenase/reductase (SDR) gene which consists of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 7 and C-14 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 8; C-25 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 9; C-22 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 10; C-2 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 11; and C-20 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 12.
6. (canceled)
7. A method for producing a transgenic plant having increased insect resistance compared to a wild type plant, the method comprising: transforming a plant cell with a recombinant vector comprising: at least one of a gene encoding short-chain dehydrogenase/reductase (SDR) protein and a gene encoding C-14 hydroxylase protein; a gene encoding C-25 hydroxylase protein; a gene encoding C-22 hydroxylase protein; a gene encoding C-2 hydroxylase protein; and a gene encoding C-20 hydroxylase protein derived from insect; and regenerating a plant from the transformed plant cell.
8. A transgenic plant produced by the method of claim 7, the transgenic plant having increased insect resistance compared to the wild type plant.
9. A transgenic seed of the transgenic plant according to claim 8.
10. (canceled)
11. The method of claim 1, wherein the least one comprises the gene encoding short-chain dehydrogenase/reductase (SDR) protein.
12. The method of claim 1, wherein the least one comprises the gene encoding C-14 hydroxylase protein.
13. The method of claim 1, wherein the least one comprises both the gene encoding short-chain dehydrogenase/reductase (SDR) protein and the gene encoding C-14 hydroxylase protein.
14. The method of claim 12, wherein the gene encoding C-14 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 2; the gene encoding C-25 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 3; the gene encoding C-22 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 4; the gene encoding C-2 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 5; and the gene encoding C-20 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 6.
15. The method of claim 13, wherein the gene encoding SDR protein consists of the nucleotide sequence of SEQ ID NO: 7; the gene encoding C-14 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 8; the gene encoding C-25 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 9; the gene encoding C-22 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 10; the gene encoding C-2 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 11; and the gene encoding C-20 hydroxylase protein consists of the nucleotide sequence of SEQ ID NO: 12.
16. The method of claim 1, wherein the plant is selected from the group consisting of tobacco, Arabidopsis thaliana, potato, eggplant, pepper, tomato, burdock, crown daisy, lettuce, balloon flower, spinach, chard, yam, celery, carrot, water parsley, parsley, Chinese cabbage, cabbage, Raphanus sativus for. raphnistroides MAK, watermelon, oriental melon, cucumber, zucchini, gourd, strawberry, soybean, mung bean, kidney bean, or sweet pea, rice, barley, wheat, rye, maze, sugar cane, oat, and onion.
17. The method of claim 1, wherein the plant is tobacco.
18. A recombinant vector comprising the composition of claim 5.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
BEST MODE(S) FOR CARRYING OUT THE INVENTION
[0026] In order to achieve the object of the present invention, the present invention provides a method for producing a transgenic plant having increased content of 20-hydroxyecdysone compared to a wild type plant including:
[0027] transforming a plant cell with a recombinant vector containing one or more genes encoding one or more proteins of SDR (short-chain dehydrogenase/reductase) protein and C-14 hydroxylase protein; a gene encoding C-25 hydroxylase protein; a gene encoding C-22 hydroxylase protein; a gene encoding C-2 hydroxylase protein; and a gene encoding C-20 hydroxylase protein derived from insect; and
[0028] regenerating a plant from the transformed plant cell.
[0029] The SDR, C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase and C-20 hydroxylase enzymes of the present invention are an enzyme which is related to the biosynthesis of 20-hydroxyecdysone using 7-dehydrocholesterol as a start material.
[0030] The enzyme related to the biosynthesis of 20-hydroxyecdysone according to the present invention may be an enzyme derived from an insect such as Bombyx mori, Drosophila melanogaster, Manduca sexta, Plutella xylostella, Musca domestica, Tribolium castaneum, Anopheles gambiae, Aedes aegypti, Cluex quinquefasciatus, Apis mellifera, or Acyrthosiphon pisum, and preferably an enzyme derived from Bombyx mori or Drosophila melanogaster, but it is not limited thereto.
[0031] In the biosynthetic pathway of 20-hydroxyecdysone, SDR and C-14 hydroxylase are an enzyme related to the conversion step from 7-dehydrocholesterol to ketodiol (2-, 22-, 25-trideoxyecdysone), and SDR and C-14 hydroxylase may act on the conversion step, either separately or together.
[0032] According to the production method of the present invention, the recombinant vector may contain a gene encoding SDR, a gene encoding C-25 hydroxylase, a gene encoding C-22 hydroxylase, a gene encoding C-2 hydroxylase and a gene encoding C-20 hydroxylase; a gene encoding C-14 hydroxylase, a gene encoding C-25 hydroxylase, a gene encoding C-22 hydroxylase, a gene encoding C-2 hydroxylase and a gene encoding C-20 hydroxylase; or a gene encoding SDR, a gene encoding C-14 hydroxylase, a gene encoding C-25 hydroxylase, a gene encoding C-22 hydroxylase, a gene encoding C-2 hydroxylase and a gene encoding C-20 hydroxylase, but it is not limited thereto.
[0033] The gene encoding SR protein according to the present invention may consist of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 7; the gene encoding C-14 hydroxylase protein may consist of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 8; the gene encoding C-25 hydroxylase protein may consist of the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 9; the gene encoding C-22 hydroxylase protein may consist of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 10; the gene encoding C-2 hydroxylase protein may consist of the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 11; and the gene encoding C-20 hydroxylase protein may consist of the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 12, but it is not limited thereto. Further, homologues of those nucleotide sequences are also within the scope of the present invention. Specifically, the gene encoding SDR, C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase and C-20 hydroxylase proteins may include a nucleotide sequence which has preferably at least 70%, more preferably at least 80%, still more preferably at least 90%, and most preferably at least 95% sequence homology with the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 7; SEQ ID NO: 2 or SEQ ID NO: 8; SEQ ID NO: 3 or SEQ ID NO: 9; SEQ ID NO: 4 or SEQ ID NO: 10; SEQ ID NO: 5 or SEQ ID NO: 11; and SEQ ID NO: 6 or SEQ ID NO: 12. The sequence homology % for a certain polynucleotide is identified by comparing a comparative region with two sequences that are optimally aligned. In this regard, a part of the polynucleotide in comparative region may include an addition or a deletion (i.e., a gap) compared to a reference sequence (without any addition or deletion) relative to the optimized alignment of the two sequences.
[0034] The nucleotide sequences of SEQ ID NO: 1 to 6 of the present invention are genes that are derived from Bombyx mori while the nucleotide sequences of SEQ ID NO: 7 to 12 of the present invention are genes that are derived from Drosophila melanogaster, in which the nucleotide sequences of SEQ ID NO: 1 to 12 are sequences that are optimized for plant codon. The plant may be a maze, but it is not limited thereto.
[0035] As described herein, the expression optimized for codon means a modification of codon of a polynucleotide encoding a protein with a codon that is used first than others in a specific organism such that the coded protein can be more efficiently expressed in the organism. Because most amino acids are described by several codons that are referred to as synonym or synonymous codon, genetic codes have degeneracy. However, codon usage by a specific organism is not random, and it is rather biased to specific codon triplets. Such codon usage bias may be even higher in relation with a certain gene, a gene with common function or ancestor origin, protein expressed at high level vs. proteins with low copy number, or a group protein coding region of a genome of an organism.
[0036] The term recombinant indicates a cell which replicates a heterogeneous nucleotide or expresses said nucleotide, or a peptide, a heterogeneous peptide, or a protein encoded by a heterogeneous nucleotide. Recombinant cell can express a gene or a gene fragment in the form of a sense or antisense, which are not found in natural state of cell. In addition, a recombinant cell can express a gene that is found in natural state, provided that said gene is modified and re-introduced into the cell by an artificial means.
[0037] According to the present invention, the gene sequence encoding SDR, C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase and C-20 hydroxylase protein may be inserted to a recombinant expression vector. The expression recombinant expression vector means a bacteria plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In general, as long as it can be replicated and stabilized in a host, any plasmid or vector can be used. Important characteristic of the expression vector is that it has a replication origin, a promoter, a marker gene, and a translation control element.
[0038] The recombinant vector of the present invention may be a recombinant vector which separately contains a gene encoding insect-derived SDR, a gene encoding insect-derived C-14 hydroxylase, a gene encoding insect-derived C-25 hydroxylase, a gene encoding insect-derived C-22 hydroxylase, a gene encoding insect-derived C-2 hydroxylase, and a gene encoding insect-derived C-20 hydroxylase protein, or a single recombinant vector which contains all of those genes. Preferably, it is a recombinant vector which separately contains each of those genes, but it is not limited thereto.
[0039] In the present invention, the expression vector containing the gene sequence encoding SDR, C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase and C-20 hydroxylase proteins and a suitable signal for regulating transcription/translation can be constructed by a method which is well known to a person in the art. Examples of such method include an in vitro recombination DNA technique, a DNA synthesis technique, and an in vivo recombination technique. The DNA sequence may be effectively linked to a suitable promoter in the expression vector in order to induce synthesis of mRNA. Furthermore, the expression vector may contain, as a site for translation initiation, a ribosome binding site and a transcription terminator.
[0040] A preferred example of the recombinant vector of the present invention is Ti-plasmid vector which can transfer a part of itself, i.e., so called T-region, to a plant cell when the vector is present in an appropriate host such as Agrobacterium tumefaciens. Other types of Ti-plasmid vector (see, EP 0 116 718 B1) are currently used for transferring a hybrid DNA sequence to protoplasts that can produce a new plant by appropriately inserting a plant cell or hybrid DNA to a genome of a plant. Especially preferred form of Ti-plasmid vector is a so-called binary vector which has been disclosed in EP 0 120 516 B1 and U.S. Pat. No. 4,940,838. Other vector that can be used for introducing the DNA of the present invention to a host plant can be selected from a double-stranded plant virus (e.g., CaMV), a single-stranded plant virus, and a viral vector which can be originated from Gemini virus, etc., for example a non-complete plant viral vector. Use of said vector can be advantageous especially when a plant host cannot be easily transformed.
[0041] The expression vector may preferably contain one or more selective marker. Said selective marker is a nucleotide sequence having a property of allowing vector selection by a common chemical method. Every gene that can be used for identifying transformed cells from non-transformed cell can be a selective marker. Examples thereof include a gene resistant to herbicide such as glyphosate and phosphinothricin, and a gene resistant to antibiotics such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol, but it is not limited thereto.
[0042] For the recombinant vector of the present invention, the promoter can be any one of CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but not limited thereto. The term promoter means a DNA molecule to which RNA polymerase binds in order to initiate its transcription, and it corresponds to a DNA region upstream of a structural gene. The term plant promoter indicates a promoter which can initiate transcription in a plant cell. The term constitutive promoter indicates a promoter which is active in most of environmental conditions and development states or cell differentiation states. Since a transformant can be selected with various mechanisms at various stages, a constitutive promoter can be preferable for the present invention. Therefore, a possibility for choosing a constitutive promoter is not limited herein.
[0043] For the recombinant vector of the present invention, any conventional terminator can be used. Examples thereof include nopaline synthase (NOS), rice -amylase RAmy 1 A terminator, phaseolin terminator, and a terminator for optopine gene of Agrobacterium tumefaciens, etc., but are not limited thereto. Regarding the necessity of terminator, it is generally known that such region can increase a reliability and an efficiency of transcription in plant cells. Therefore, the use of terminator is highly preferable in view of the contexts of the present invention.
[0044] Plant transformation means any method by which DNA is delivered to a plant. Such transformation method does not necessarily need a period for regeneration and/or tissue culture. Transformation of plant species is now quite common not only for dicot plants but also for monocot plants. In principle, any transformation method can be used for introducing a hybrid DNA of the present invention to appropriate progenitor cells. The method can be appropriately selected from a calcium/polyethylene glycol method for protoplasts (Krens, F. A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), an electroporation method for protoplasts (Shillito R. D. et al., 1985 Bio/Technol. 3, 1099-1102), a microscopic injection method for plant components (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), a (DNA or RNA-coated) particle bombardment method for various plant components (Klein T. M. et al., 1987, Nature 327, 70), or a (non-complete) viral infection method in Agrobacterium tumefaciens mediated gene transfer by plant invasion or transformation of fully ripened pollen or microspore (EP 0 301 316), etc.
[0045] The method for producing a transgenic plant having increased content of 20-hydroxyecdysone of the present invention includes transforming a plant cell with the recombinant vector of the present invention, and the transformation may be mediated by Agrobacterium tumefiaciens, for example. Further, the method of the present invention includes regenerating a transgenic plant from the transformed plant cell. As for the method for regenerating a transgenic plant from a transformed plant cell, a method well known in the pertinent art can be used.
[0046] The transformed plant cell needs to be regenerated into a whole plant. Techniques for regeneration into a mature plant by culture of callus or protoplast are well known in the pertinent art for various species.
[0047] The present invention further provides a transgenic plant produced by the above method which has increased content of 20-hydroxyecdysone compared to a wild type plant, and a seed thereof.
[0048] According to one embodiment of the present invention, the plant can be a dicot plant such as tobacco, Arabidopsis thaliana, potato, eggplant, pepper, tomato, burdock, crown daisy, lettuce, balloon flower, spinach, chard, yam, celery, carrot, water parsley, parsley, Chinese cabbage, cabbage, Raphanus sativus for. raphnistroides MAK, watermelon, oriental melon, cucumber, zucchini, gourd, strawberry, soybean, mung bean, kidney bean, or sweet pea or a monocot plant such as rice, barley, wheat, rye, maze, sugar cane, oat, or onion. Preferably, it is a dicot plant. More preferably, it is tobacco, but it is not limited thereto.
[0049] The present invention further provides a composition for increasing content of 20-hydroxyecdysone in plant which includes, as an effective component, one or more genes of insect-derived SDR gene which consists of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 7 and C-14 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 8; C-25 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 9; C-22 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 10; C-2 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 11; and C-20 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 12. As one or more genes of insect-derived SDR gene and C-14 hydroxylase gene; C-25 hydroxylase gene; C-22 hydroxylase gene; C-2 hydroxylase gene; and C-20 hydroxylase gene are contained as an effective component in the composition of the present invention and those genes are used for transformation of a plant, it becomes possible to increase the content of 20-hydroxyecdysone in plant.
[0050] The present invention further provides a method for increasing content of 20-hydroxyecdysone in plant including transforming a plant cell with a recombinant vector containing one or more genes encoding one or more proteins of SDR (short-chain dehydrogenase/reductase) protein and C-14 hydroxylase protein; a gene encoding C-25 hydroxylase protein; a gene encoding C-22 hydroxylase protein; a gene encoding C-2 hydroxylase protein; and a gene encoding C-20 hydroxylase protein derived from insect to overexpress the genes.
[0051] The scope of the nucleotide sequence of the present invention which encodes SDR, C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase, and C-20 hydroxylase proteins is as described in the above.
[0052] The present invention further provides a method for producing a transgenic plant having increased insect resistance compared to a wild type plant including:
[0053] transforming a plant cell with a recombinant vector containing one or more genes encoding one or more proteins of SDR (short-chain dehydrogenase/reductase) protein and C-14 hydroxylase protein; a gene encoding C-25 hydroxylase protein; a gene encoding C-22 hydroxylase protein; a gene encoding C-2 hydroxylase protein; and a gene encoding C-20 hydroxylase protein derived from insect; and
[0054] regenerating a plant from the transformed plant cell.
[0055] As described herein, the expression insect resistance includes the resistance and tolerance which is exhibited by a plant against harmful insects, and it includes inhibited preference of harmful insect for host plant, inhibited growth activity of a host against harmful insect, and tolerance not allowing any influence by harmful insects based on strong compensation property or recovery property.
[0056] The plant transformed with the recombinant vector of the present invention, which contains a gene encoding one or more proteins of insect-derived SDR protein and C-14 hydroxylase protein; C-25 hydroxylase protein; C-22 hydroxylase protein; C-2 hydroxylase protein; and C-20 hydroxylase protein, has increased content of 20-hydroxyecdysone. Since 20-hydroxyecdysone is known to exhibit an antifeedant effect, avoidance, and insecticidal activity against some harmful insects, the plant transformed with the recombinant vector of the present invention may exhibit enhanced insect resistance due to the influence exhibited by increased 20-hydroxyecdysone.
[0057] The present invention further provides a transgenic plant produced by the aforementioned method which has increased insect resistance compared to a wild type plant, and a transgenic seed of the plant.
[0058] The plant of the present invention is as described in the above.
[0059] The present invention further provides a composition for enhancing insect resistance of a plant which includes, as an effective component, one or more genes of SDR (short-chain dehydrogenase/reductase) gene which consists of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 7 and C-14 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 8; C-25 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 9; C-22 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 10; C-2 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 11; and C-20 hydroxylase gene which consists of the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 12.
[0060] Hereinbelow, the present invention is explained in greater detail in view of the Examples. However, it is evident that the following Examples are given only for exemplification of the present invention and by no means the present invention is limited to the following Examples.
Examples
Materials and Methods
[0061] 1. 20-Hydroxyecdysone Biosynthesis Gene from Insect
[0062] For having 20-hydroxyecdysone (hereinbelow, 20E) biosynthesis gene from an insect, information of 6 kinds of gene was collected from Bombyx mori (silkworm moth) and Drosophila melanogaster (fruit fly) based on the 20E biosynthetic pathway in insect given by KEGG (http://www.kegg.jp/) (
[0063] To have easier expression in plant, the nucleotide sequence of the 6 kinds of gene related to the insect 20E biosynthesis, which are derived from Bombyx mori or Drosophila melanogaster, were codon-optimized based on the codon usage in maze. The 6 kinds of gene were synthesized based on the codon-optimized nucleotide sequence.
2. Construction of Plant Expression Vector and Agrobacterium Transformation
[0064] Among the 6 kinds of gene synthesized above, each of the 5 kinds derived from Bombyx mori (i.e., C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase and C-20 hydroxylase) and the 6 kinds derived from Drosophila melanogaster (SDR, C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase and C-20 hydroxylase) was inserted to a plant expression vector (pB7WG2D) by using Gateway system. Expression of the each gene was carried out such that it is regulated by 35S promoter, and, as a selection marker, bar, i.e., an herbicide gene, was used (
3. Induction of Transient Expression of Insect 20E Biosynthesis Gene in Plant
[0065] The transformed Agrobacterium was inoculated to liquid LB medium (5 mL) containing 100 g/ml rifampicin and 50 g/ml spectinomycin, and then subjected to overnight suspension culture at 28 C. under shaking rate of 200 rpm. The suspension culture (1 mL) was inoculated again to liquid LB medium (25 mL) containing 100 g/ml rifampicin, 50 g/ml spectinomycin, and 200 M acetosyringone followed by suspension culture at 28 C. under shaking rate of 200 rpm until OD.sub.600 is 1.0. After measuring the OD.sub.600 value, the culture was centrifuged for 10 minutes at 3000 rpm to remove the supernatant. The cell pellet was suspended in 10 mM MES buffer (10 mM MgCl.sub.2, 10 mM MES (pH 5.5)). After centrifuging again the suspension for 10 minutes at 3,000 rpm, the supernatant was removed and the cell pellet was re-suspended in 10 mM MES to have final OD.sub.600 value of 3.0. Then, after adding acetosyringone to final concentration of 200 M, the mixture was kept overnight at room temperature.
[0066] After adding each Agrobacterium solution in the same amount, agroinfiltration was carried out. Briefly, it was carried out in a mode in which Agrobacterium solution is filled in a 1 ml syringe (without needle) and injected to a backside of the tobacco (Nicotiana benthamiana) leaf. Tobacco obtained after agroinfiltration was allowed to grow for 7 days at 27 C., and only the leaf for which the agroinfiltration has been carried out was harvested and used for the analysis.
4. Analysis of Gene Expression and Biosynthesis of 20-Hydroxyecdysone (20E)
[0067] Presence or absence of the expression of the gene 20E biosynthesis gene which has been introduced as described in the above was determined by RT-PCR (reverse transcription polymerase chain reaction). RT-PCR was carried out by using, as a template, total RNA (100 ng) extracted from the tobacco leaf after agroinfiltration, and primers for amplifying the introduced 20E biosynthesis gene (Table 1). Conditions of RT-PCR are as follows: 50 C., 30 minutes.fwdarw.95 C., 5 minutes.fwdarw.[95 C., 30 seconds.fwdarw.55 C., 30 seconds.fwdarw.72 C., 1 minute and 30 seconds] (30 cycles).fwdarw.72 C., 10 minutes.
TABLE-US-00001 TABLE1 RT-PCRPrimerInformation Nucleotidesequence(5.fwdarw.3) Genename (SEQIDNO) B.moriC-14 F CACCATGAGTTCGCTCATCATTGTG hydroxylase (SEQIDNO:13) R TCACTTCCGAGGTATCAAATGCATC (SEQIDNO:14) B.moriC-25 F CACCATGGACCTTTATTTTATTTGGCTG hydroxylase (SEQIDNO:15) R TCAAATTGGCTCGCAGTAGTACTTC (SEQIDNO:16) B.moriC-22 F CACCATGTTCGTTAGGCTCACCGTT hydroxylase (SEQIDNO:17) R TCAGGAACTTCTTGGGATGAAGTTG (SEQIDNO:18) B.moriC-2 F CACCATGCATCGCTTCCCGTCTATGTC hydroxylase (SEQIDNO:19) R TCACTTAGAAATGCTGCGCGGTAG (SEQIDNO:20) B.moriC-20 F CACCATGTCTCTCCCGGGAGTTTTCC hydroxylase (SEQIDNO:21) R TCACCACTCGACAAGACGCAAGG (SEQIDNO:22) D.melanogaster F CACCATGAGCGGCAGTCAACTTCTC SDR (SEQIDNO:23) R TCAAATCTTCTCCTGTCTATTCG (SEQIDNO:24) D.melanogaster F CACCATGCTGGCTGCTCTGATCTAC C-14hydroxylase (SEQIDNO:25) R TCATAGTGGTCCGATCTTCTC (SEQIDNO:26) D.melanogaster F CACCATGTCAGCGGACATAGTCGA C-25hydroxylase (SEQIDNO:27) R TCAGTCCTGAACCACAGCTCC (SEQIDNO:28) D.melanogaster F CACCATGTTGACCAAGCTGCTAAAG C-22hydroxylase (SEQIDNO:29) R TCACTCGCGACGGAGGCGCAG (SEQIDNO:30) D.melanogaster F CACCATGACCGAGAAGAGGGAGAG C-2hydroxylase (SEQIDNO:31) R TCACTCTGTCCGTGGCCGGAG (SEQIDNO:32) D.melanogaster F CACCATGGCCGTGATACTGTTGCTC C-20hydroxylase (SEQIDNO:33) R TCAGAAAACGCGATCGCTGAG (SEQIDNO:34)
[0068] Furthermore, 20E biosynthesis was determined based on 20E content which is obtained by HPLC (high performance liquid chromatography) analysis. A methanol extract of tobacco leaf after agroinfiltration was prepared for HPLC analysis, and, after removing lipid component by hexane phase partition, it was used for the analysis. Briefly, the harvested tobacco leaf sample was ground, and, to 100 mg of the ground sample, methanol (1 ml) was added and mixed therein. After allowing the mixture to stand for 1 hour at 55 C., it was centrifuged for 10 minutes at 5,000 rpm and only the supernatant was collected. The extraction process was repeated 3 times, and, to the collected methanol extract, distilled water (0.75 ml) and hexane (4 ml) were added to induce phase separation, and then only the methanol supernatant was separated. After drying for 55 C. until the separated methanol layer is completely dry, methanol was added in a specific amount compared to the initial sample amount for dissolution. The solution was then centrifuged for 10 minutes at 12,000 rpm, and then only the supernatant was collected and used for analysis. HPLC Conditions for determination of 20E content are as shown in the following Table 2, and determination of the detected 20E compound was carried out by UPLC-MS/MS (ultra performance liquid chromatography-tandem mass spectrometry), in which UPLC-MS/MS conditions are as shown in the following Table 3.
TABLE-US-00002 TABLE 2 HPLC Conditions for determination of 20E content Parameter Conditions Apparatus Shimadzu HPLC system DGU-20A LC-20AD SIL-20A CTO-20A SPD-M20A CBM-20A Column Shim-pack GIS ODS column (250 4.6 mM ID, 5 m) Mobile phase 11% Isopropanol + 0.1% TFA Flow rate 1 ml/minute Wavelength for detection 242 nm Wavelength for scanning 190 to 800 nm Injection amount 20 l Column temperature 40 C. Running time 60 minutes
TABLE-US-00003 TABLE 3 UPLC-MS/MS Conditions for determination of 20E compound Parameter Conditions Apparatus UHPLC-MS/MS system Agilent 1290 Infinity UHPLC AB Sciex QTrap 6500 MS/MS Column SeQuant ZIC-cHILIC (100 2.1 mM ID, 3 m, 100 ) Mobile phase A: MeOH (5 mM ammonium acetate, 0.1% formic acid) B: Water (5 mM ammonium acetate, 0.1% formic acid) * A:B = 85:15 Flow rate 130 l/minute Injection amount 5 l Running time 5 minutes
Example 1. Analysis of Expression of Insect-Derived Gene Related to 20E Biosynthesis which has been Introduced to Plant
[0069] From the tobacco leaf obtained after agroinfiltration by using Agrobacterium which has been transduced with a plant expression vector containing each of the 5 kinds of 20E biosynthesis gene derived from Bombyx mori (C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase and C-20 hydroxylase) or 6 kinds of 20E biosynthesis gene derived from Drosophila melanogaster (SDR, C-14 hydroxylase, C-25 hydroxylase, C-22 hydroxylase, C-2 hydroxylase and C-20 hydroxylase), presence or absence of the expression of each gene was determined by RT-PCR. As a result, it was found that all of the 5 kinds of gene related to 20E biosynthesis gene are expressed in a tobacco leaf sample in which expression of gene derived from Bombyx mori has been induced by agroinfiltration (
[0070] Furthermore, as a result of analyzing the 20E content in wild type tobacco leaf and tobacco leaf in which expression of insect-derived gene has been induced, it was found that, compared to the wild type (WT), the 20E content has increased by about 7 times or 4.5 times in the tobacco (IS) in which expression of gene derived from Bombyx mori or Drosophila melanogaster has been induced (
Example 2. Analysis of Change in 20E Content with or without Addition of 20E Biosynthesis Precursor Derived from Insect
[0071] As a method for increasing 20E content, a method of adding a precursor is generally known. As such, to the tobacco leaf for which expression of the insect-derived gene related to 20E biosynthesis of the present invention has been introduced, a precursor of biosynthesis of 20E (7-dehydrocholesterol, 7DHC) was added, and a change in 20E content was analyzed accordingly. To a tobacco leaf obtained 2 days after inducing the expression of insect-derived gene, 10 mM MES buffer solution containing 7 DHC at a concentration of 60 ppm was added by infiltration, which has been carried out in the same manner as the agroinfiltration.
[0072] As a result, it was found that, when only the gene related to 20E biosynthesis derived from Bombyx mori or Drosophila melanogaster is expressed (i.e., IS), content of 20E has increased by about 3 times and 9 times, respectively, compared to the wild type (WT). When the precursor 7DHC is added during the expression of the insect-derived gene related to 20E biosynthesis (i.e., IS+7DHC), content of 20E has increased a bit more compared to the case in which the precursor has not been added (i.e., IS) (
Example 3. Analysis of Content of 20E and Determination of 20E Compound
[0073] Analysis of content of 20E and determination of 20E compound from an extract of tobacco leaf, which has been induced to have expression of 5 kinds or 6 kinds of 20E biosynthesis gene derived from Bombyx mori or Drosophila melanogaster, were carried out by HPLC and UPLC-MS/MS.
[0074] As a result of HPLC, from the tobacco leaf sample induced to have expression of the gene derived from Bombyx mori (
[0075] As a result of UPLC-MS/MS, it was found that the molecular weight of 20E standard is 480 Da and fragments with a size of 444, 370, or 164 Da are generated by fragmentation of the molecule, and, since the 20E-like peak of the tobacco extract also exhibits the same fragmentation pattern as the standard, it was recognized as 20E (