Antisense molecules and methods for treating pathologies

10781450 ยท 2020-09-22

Assignee

Inventors

Cpc classification

International classification

Abstract

An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 59.

Claims

1. A method for restoring an mRNA reading frame to induce dystrophin protein production in a patient with Duchenne muscular dystrophy (DMD) in need thereof who has a mutation of the DMD gene that is amenable to exon 45 skipping, comprising administering to the patient an antisense oligonucleotide of 22 bases in length, wherein the antisense oligonucleotide is 100% complementary to a target region of exon 45 of the human dystrophin pre-mRNA, wherein the target region is annealing site H45A(03+19), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide, and wherein the antisense oligonucleotide specifically hybridizes to the annealing site inducing exon 45 skipping, or a pharmaceutically acceptable salt thereof, thereby restoring the mRNA reading frame to induce dystrophin protein production in the patient.

2. The method of claim 1, wherein the antisense oligonucleotide or pharmaceutically acceptable salt thereof is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.

3. The method of claim 1, wherein the antisense oligonucleotide or pharmaceutically acceptable salt thereof is chemically linked to a polyethylene glycol chain.

4. A method for restoring an mRNA reading frame to induce dystrophin protein production in a patient with Duchenne muscular dystrophy (DMD) in need thereof who has a mutation of the DMD gene that is amenable to exon 45 skipping, comprising administering to the patient an antisense oligonucleotide of 22 bases in length, wherein the antisense oligonucleotide is 100% complementary to a target region of exon 45 of the human dystrophin pre-mRNA, wherein the target region is annealing site H45A(03+19), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide, and wherein the antisense oligonucleotide specifically hybridizes to the annealing site inducing exon 45 skipping, thereby restoring the mRNA reading frame to induce dystrophin protein production in the patient.

5. The method of claim 4, wherein the antisense oligonucleotide is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.

6. The method of claim 4, wherein the antisense oligonucleotide is chemically linked to a polyethylene glycol chain.

7. A method for restoring an mRNA reading frame to induce dystrophin protein production in a patient with Duchenne muscular dystrophy (DMD) in need thereof who has a mutation of the DMD gene that is amenable to exon 45 skipping, comprising administering to the patient a pharmaceutical composition comprising (i) an antisense oligonucleotide of 22 bases in length, wherein the antisense oligonucleotide is 100% complementary to a target region of exon 45 of the human dystrophin pre-mRNA, wherein the target region is annealing site H45A(03+19), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide, and wherein the antisense oligonucleotide specifically hybridizes to the annealing site inducing exon 45 skipping, or a pharmaceutically acceptable salt thereof, and (ii) a pharmaceutically acceptable carrier, thereby restoring the mRNA reading frame to induce dystrophin protein production in the patient.

8. The method of claim 7, wherein the antisense oligonucleotide or pharmaceutically acceptable salt thereof is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.

9. The method of claim 7, wherein the antisense oligonucleotide or pharmaceutically acceptable salt thereof is chemically linked to a polyethylene glycol chain.

10. A method for restoring an mRNA reading frame to induce dystrophin protein production in a patient with Duchenne muscular dystrophy (DMD) in need thereof who has a mutation of the DMD gene that is amenable to exon 45 skipping, comprising administering to the patient a pharmaceutical composition comprising (i) an antisense oligonucleotide of 22 bases in length, wherein the antisense oligonucleotide is 100% complementary to a target region of exon 45 of the human dystrophin pre-mRNA, wherein the target region is annealing site H45A(03+19), wherein the antisense oligonucleotide is a morpholino antisense oligonucleotide, and wherein the antisense oligonucleotide specifically hybridizes to the annealing site inducing exon 45 skipping, and (ii) a pharmaceutically acceptable carrier, thereby restoring the mRNA reading frame to induce dystrophin protein production in the patient.

11. The method of claim 10, wherein the antisense oligonucleotide is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.

12. The method of claim 10, wherein the antisense oligonucleotide is chemically linked to a polyethylene glycol chain.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. Schematic representation of motifs and domains involved in exon recognition, intron removal and the splicing process.

(2) FIG. 2. Diagrammatic representation of the concept of antisense oligonucleotide induced exon skipping to by-pass disease-causing mutations (not drawn to scale). The hatched box represents an exon carrying a mutation that prevents the translation of the rest of the mRNA into a protein. The solid black bar represents an antisense oligonucleotide that prevents inclusion of that exon in the mature mRNA.

(3) FIG. 3. Gel electrophoresis showing a cocktail of antisense molecules directed at exon 3 which induce strong and consistent exon skipping at a transfection concentration of 10 nanomolar in cultured normal human muscle cells.

(4) FIG. 4. Gel electrophoresis showing a cocktail of antisense molecules directed at exon 4 which induce strong and consistent exon skipping at a transfection concentration of 25 nanomolar in cultured normal human muscle cells.

(5) FIG. 5 Gel electrophoresis showing strong and efficient human exon 5 skipping using an antisense molecules [H5A(+35+65)] directed at an exon 5 internal domain, presumably an exon splicing enhancer. This preferred compound induces consistent exon skipping at a transfection concentration of 25 nanomolar in cultured human muscle cells.

(6) FIG. 6. Gel electrophoresis showing a cocktail of antisense molecules directed at exon 8 which induce strong and consistent exon skipping of both exon 8 and exon8/9 at a transfection concentration of 10 nanomolar in cultured normal human muscle cells.

(7) FIG. 7. Gel electrophoresis showing various cocktails and single antisense molecules which induce skipping of exon 10 and surrounding exons. A combination of [H10A(05+16)] and [H10A(+98+119)] or [H10A(05+16)] and [H10A(+130+149)] induces skipping of exon 10 and exons 912, whilst [H10A(05+16)] alone induces skipping of exons 914.

(8) FIG. 8. Gel electrophoresis showing exon 14 skipping using antisense molecule H14A(+31+61) directed at exon 14.

(9) FIG. 9. Gel electrophoresis showing exon 17 skipping using antisense molecule H17A(+10+35) directed at exon 17.

(10) FIG. 10. Gel electrophoresis showing two cocktails of antisense molecules directed at exon 26. The double cocktail of [H26A(07+19)] and [H26A(+24+50)] induces good skipping of exon 26, and the addition of a further antisense molecule to the cocktail does not affect the efficiency of skipping.

(11) FIG. 11. Gel electrophoresis showing a cocktail of antisense molecules directed at exon 36 which induce strong and consistent exon skipping at a transfection concentration of 25 nanomolar in cultured normal human muscle cells.

(12) FIG. 12. Gel electrophoresis showing strong and consistent exon 43 skipping to 25 nanomolar in cultured normal human muscle cells using antisense molecule H43A(+92+117).

(13) FIG. 13. Gel electrophoresis showing dose dependant exon 55 skipping using antisense molecule H44A(+65+90).

(14) FIG. 14. Gel electrophoresis showing strong and consistent exon 45 skipping using antisense molecule H45A(09+25).

(15) FIG. 15. Gel electrophoresis showing strong and consistent exon 46 skipping using antisense molecule H46A(+81+109).

(16) FIG. 16. Gel electrophoresis showing strong and consistent exon 47 skipping using antisense molecule H47A(+01+29).

(17) FIG. 17. Gel electrophoresis showing a cocktail of antisense molecules directed at exon 48 which induce strong and consistent exon skipping.

(18) FIG. 18. Gel electrophoresis showing strong and consistent exon 49 skipping using antisense molecule H49A(+45+70).

(19) FIG. 19. Gel electrophoresis showing strong and consistent exon 50 skipping using antisense molecule H50A(+48+74).

(20) FIG. 20. Gel electrophoresis showing strong and consistent exon 51 skipping using antisense molecule H51A(+66+95).

(21) FIG. 21. Gel electrophoresis showing strong and consistent exon 54 skipping using antisense molecule H54A(+67+97).

(22) FIG. 22. Gel electrophoresis showing antisense molecule H55A(10+20) induced dose dependant exon 55 skipping.

(23) FIG. 23. Gel electrophoresis showing strong and consistent exon 56 skipping using antisense molecule H56A(+92+121).

(24) FIG. 24. Gel electrophoresis showing antisense molecule H57A(10+20) induced dose dependant exon 57 skipping.

(25) FIG. 25. Gel electrophoresis showing exon 59 and exon 58/59 skipping using antisense molecule H59A(+96+120) directed at exon 59.

(26) FIG. 26. Gel electrophoresis showing two different cocktails which induce exon skipping of exon 60.

(27) FIG. 27. Gel electrophoresis showing exon 63 skipping using antisense molecule H63A(+20+49).

(28) FIG. 28. Gel electrophoresis showing exon 64 skipping using antisense molecule H64A(+34+62).

(29) FIG. 29. Gel electrophoresis showing a cocktail of antisense molecules directed at exon 66 which induce dose dependant exon skipping.

(30) FIG. 30. Gel electrophoresis showing exon 67 skipping using antisense molecule H67A(+17+47).

(31) FIG. 31. Gel electrophoresis showing a cocktail of antisense molecules directed at exon 68 which induce dose dependant exon skipping.

(32) FIG. 32. Gel electrophoresis showing a cocktail of antisense molecules which induce strong and consistent exon skipping of exons 69/70 at a transfection concentration of 25 nanomolar.

(33) FIG. 33. Gel electrophoresis showing various cocktails of antisense molecules which induce various levels of skipping in exon 50.

(34) FIG. 34. Gel electrophoresis showing a cocktail of three antisense molecules which induce efficient skipping of exons 50/51.

(35) FIG. 35. Graph of densitometry results showing various efficiencies of exon skipping. The antisense molecules tested were Exon 3 [H3A(+30+60) & H3A(+61+85)]; Exon 4 [H4D(+1411) & H4A(+11+40)]; Exon 14 [H14A(+32+61)]; Exon 17 [H17A(+10+35)]; Exon 26 [H26A(07+19), H26A(+24+50) & H26A(+68+92)]; Exon 36 [H36A(16+09) & H36A(+22+51)].

(36) FIG. 36. Graph of densitometry results showing various efficiencies of exon skipping. The antisense molecules tested were Exon 46 [H46A(+81+109)]; Exon 47 [H47A(+01+29)]; Exon 48 [H48A(+01+28) & H48A(+40+67)]; Exon 49 [H49A(+45+70)].

(37) FIG. 37. Gel electrophoresis showing exon 11 skipping using antisense molecule H11A(+50+79).

(38) FIG. 38. Gel electrophoresis showing exon 12 skipping using antisense molecule H12A(+30+57).

(39) FIG. 39. Gel electrophoresis showing exon 44 skipping using antisense molecule H44A(+59+85).

(40) FIG. 40. Gel electrophoresis showing exon 45 skipping using antisense molecule H45A(03+25).

(41) FIG. 41. Gel electrophoresis showing exon 51 skipping using antisense molecule H51A(+71+100).

(42) FIG. 42. Gel electrophoresis showing exon 52 skipping using antisense molecule H52A(+09+38).

(43) FIG. 43. Gel electrophoresis showing exon 53 skipping using antisense molecule H53A(+33+65).

(44) FIG. 44. Gel electrophoresis showing exon 46 skipping using antisense molecule H46A(+93+122).

(45) FIG. 45. Gel electrophoresis showing exon 46 skipping using antisense molecule (H46A(+93+2).

(46) FIG. 46A. Sequences of antisense molecules.

(47) FIG. 46B. Sequences of antisense molecules.

DETAILED DESCRIPTION

Brief Description of the Sequence Listings

(48) TABLE-US-00001 TABLE 1A Single antisense molecules SEQ ID Exon Sequence Exon 5 1 H5A(+35+65) AAA CCA AGA GUC AGU UUA UGA UUU CCA UCU A Exon 11 52 H11A(+50+79) CUG UUC CAA UCA GCU UAC UUC CCA AUU GUA Exon 12 2 H12A(+52+75) UCU UCU GUU UUU GUU AGC CAG UCA 53 H12A(+30+57) CAG UCA UUC AAC UCU UUC AGU UUC UGA U Exon 17 3 H17A(07+23) GUG GUG GUG ACA GCC UGU GAA AUC UGU GAG 4 H17A(+61+86) UGU UCC CUU GUG GUC ACC GUA GUU AC Exon 21 5 H21A(+86+114) CAC AAA GUC UGC AUC CAG GAA CAU GGG UC 6 H21A(+90+119) AAG GCC ACA AAG UCU GCA UCC AGG AAC AUG Exon 22 7 H22A(+125+146) CUG CAA UUC CCC GAG UCU CUG C Exon 24 8 H24A(+51+73) CAA GGG CAG GCC AUU CCU CCU UC Exon 43 9 H43A(+92+117) GAG AGC UUC CUG UAG CUU CAC CCU UU Exon 44 10 H44A(+65+90) UGU UCA GCU UCU GUU AGC CAC UGA 54 H44A(+59+85) CUG UUC AGC UUC UGU UAG CCA CUG AUU Exon 45 11 H45A (09+25) GCU GCC CAA UGC CAU CCU GGA GUU CCU GUA AGA U 55 H45A(03+25) GCU GCC CAA UGC CAU CCU GGA GUU CCU G 61 H45A(06+25) GCU GCC CAA UGC CAU CCU GGA GUU CCU GUA A 62 H45A(12+19) CAA UGC CAU CCU GGA GUU CCU GUA AGA UAC C Exon 46 12 H46A(+81+109) UCC AGG UUC AAG UGG GAU ACU AGC AAU GU 56 H46A(+93+122) GUU GCU GCU CUU UUC CAG GUU CAA GUG GGA Exon 47 13 H47A(+01+29) UGG CGC AGG GGC AAC UCU UCC ACC AGU AA Exon 49 14 H49A(+45+70) ACA AAU GCU GCC CUU UAG ACA AAA UC Exon 50 15 H50A(+48+74) GGC UGC UUU GCC CUC AGC UCU UGA AGU Exon 51 57 H51A(+71+100) GGU ACC UCC AAC AUC AAG GAA GAU GGC AUU Exon 52 58 H52A(+09+38) UCC AAC UGG GGA CGC CUC UGU UCC AAA UCC UGC Exon 53 59 H53A(+33+65) UUC AAC UGU UGC CUC CGG UUC UGA AGG UGU UCU Exon 54 16 H54A(+67+97) UGG UCU CAU CUG CAG AAU AAU CCC GGA GAA G Exon 55 17 H55A(10+20) CAG CCU CUC GCU CAC UCA CCC UGC AAA GGA Exon 56 18 H56A(+92+121) CCA AAC GUC UUU GUA ACA GGA CUG CAU 19 H56A(+112+141) CCA CUU GAA GUU CAU GUU AUC CAA ACG UCU Exon 57 20 H57A(10+20) AAC UGG CUU CCA AAU GGG ACC UGA AAA AGA Exon 58 21 H58A(+34+64) UUC GUA CAG UCU CAA GAG UAC UCA UGA UUA C 22 H58D(+1707) CAA UUA CCU CUG GGC UCC UGG UAG Exon 59 23 H59A(+96+120) CUA UUU UUC UCU GCC AGU CAG CGG A Exon 60 24 H60A(+33+62) CGA GCA AGG UCA UUG ACG UGG CUC ACG UUC Exon 61 25 H61A(+10+40) GGG CUU CAU GCA GCU GCC UGA CUC GGU CCU C Exon 62 26 H62A(23+52) UAG GGC ACU UUG UUU GGC GAG AUG GCU CUC Exon 63 27 H63A(+20+49) GAG CUC UGU CAU UUU GGG AUG GUC CCA GCA Exon 64 28 H64A(+34+62) CUG CAG UCU UCG GAG UUU CAU GGC AGU CC Exon 66 29 H66A(8+19) GAU CCU CCC UGU UCG UCC CCU AUU AUG Exon 67 30 H67A(+17+47) GCG CUG GUC ACA AAA UCC UGU UGA ACU UGC Exon 73 60 H73A(+02+26) CAU UGC UGU UUU CCA UUU CUG GUA G

(49) TABLE-US-00002 TABLE 1B Cocktails of antisense molecules SEQ ID Exon Sequence Exon 3 cocktails 31 H3A(+30+60) UAG GAG GCG CCU CCC AUC CUG UAG GUC ACU G 32 H3A(+61+85) G CCC UGU CAG GCC UUC GAG GAG GUC Exon 4 cocktails 33 H4A(+11+40) UGU UCA GGG CAU GAA CUC UUG UGG AUC CUU 34 H4D(+1411) GUA CUA CUU ACA UUA UUG UUC UGC A Exon 8 cocktails 35 H8A(06+24) UAU CUG GAU AGG UGG UAU CAA CAU CUG UAA 36 H8A(+134+158) AUG UAA CUG AAA AUG UUC UUC UUU A Exon 10 cocktails 37 H10A(05+16) CAG GAG CUU CCA AAU GCU GCA 38 H10A(+98+119) UCC UCA GCA GAA AGA AGC CAC G Exon 26 cocktails 39 H26A(07+19) CCU CCU UUC UGG CAU AGA CCU UCC AC 40 H26A(+24+50) CUU ACA GUU UUC UCC AAA CCU CCC UUC 41 H26A(+68+92) UGU GUC AUC CAU UCG UGC AUC UCU G Exon 36 cocktails 42 H36A(16+09) CUG GUA UUC CUU AAU UGU ACA GAG A 43 H36A(+22+51) UGU GAU GUG GUC CAC AUU CUG GUC AAA AGU Exon 48 cocktails 44 H48A(+01+28) CUU GUU UCU CAG GUA AAG CUC UGG AAA C 45 H48A(+40+67) CAA GCU GCC CAA GGU CUU UUA UUU GAG C Exon 60 cocktails 46 H60A(+87+116) UCC AGA GUG CUG AGG UUA UAC GGU GAG AGC 47 H60A(+37+66) CUG GCG AGC AAG GUC CUU GAC GUG GCU CAC Exon 66 cocktails 48 H66A(02+28) CAG GAC ACG GAU CCU CCC UGU UCG UCC CCU 49 H66D(+1317) UAA UAU ACA CGA CUU ACA UCU GUA CUU GUC Exon 68 cocktails 50 H68A(+48+72) CAC CAU GGA CUG GGG UUC CAG UCU C 51 H68D(+2303) UAC CUG AAU CCA AUG AUU GGA CAC UC

General

(50) Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in the specification, individually or collectively and any and all combinations or any two or more of the steps or features.

(51) The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally equivalent products, compositions and methods are clearly within the scope of the invention as described herein.

(52) Sequence identity numbers (SEQ ID NO:) containing nucleotide and amino acid sequence information included in this specification are collected at the end of the description and have been prepared using the programme PatentIn Version 3.0. Each nucleotide or amino acid sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (e.g. <210>1, <210>2, etc.). The length, type of sequence and source organism for each nucleotide or amino acid sequence are indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide and amino acid sequences referred to in the specification are defined by the information provided in numeric indicator field <400> followed by the sequence identifier (e.g. <400>1, <400>2, etc.).

(53) An antisense molecule nomenclature system was proposed and published to distinguish between the different antisense molecules (see Mann et al., (2002) J Gen Med 4, 644-654). This nomenclature became especially relevant when testing several slightly different antisense molecules, all directed at the same target region, as shown below:
H # A/D(x:y).

(54) The first letter designates the species (e.g. H: human, M: murine, C: canine) # designates target dystrophin exon number.

(55) A/D indicates acceptor or donor splice site at the beginning and end of the exon, respectively.

(56) (x y) represents the annealing coordinates where or + indicate intronic or exonic sequences respectively. As an example, A(6+18) would indicate the last 6 bases of the intron preceding the target exon and the first 18 bases of the target exon. The closest splice site would be the acceptor so these coordinates would be preceded with an A. Describing annealing coordinates at the donor splice site could be D(+218) where the last 2 exonic bases and the first 18 intronic bases correspond to the annealing site of the antisense molecule. Entirely exonic annealing coordinates that would be represented by A(+65+85), that is the site between the 65.sup.th and 85.sup.th nucleotide from the start of that exon.

(57) The entire disclosures of all publications (including patents, patent applications, journal articles, laboratory manuals, books, or other documents) cited herein are hereby incorporated by reference. No admission is made that any of the references constitute prior art or are part of the common general knowledge of those working in the field to which this invention relates.

(58) As used herein the term derived and derived from shall be taken to indicate that a specific integer may be obtained from a particular source albeit not necessarily directly from that source.

(59) Throughout this specification, unless the context requires otherwise, the word comprise, or variations such as comprises or comprising, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

(60) Other definitions for selected terms used herein may be found within the detailed description of the invention and apply throughout. Unless otherwise defined, all other scientific and technical terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which the invention belongs.

DESCRIPTION OF THE PREFERRED EMBODIMENT

(61) When antisense molecule(s) are targeted to nucleotide sequences involved in splicing in exons within pre-mRNA sequences, normal splicing of the exon may be inhibited, causing the splicing machinery to by-pass the entire mutated exon from the mature mRNA. The concept of antisense oligonucleotide induced exon skipping is shown in FIG. 2.

(62) In many genes, deletion of an entire exon would lead to the production of a non-functional protein through the loss of important functional domains or the disruption of the reading frame. However, in some proteins it is possible to shorten the protein by deleting one or more exons from within the protein, without disrupting the reading frame and without seriously altering the biological activity of the protein. Typically, such proteins have a structural role and or possess functional domains at their ends. The present invention describes antisense molecules capable of binding to specified dystrophin pre-mRNA targets and re-directing processing of that gene.

(63) A preferred aim of a therapy based on antisense molecules is to get maximum exon skipping by providing the lowest possible concentration of the antisense molecule. Generally, an antisense molecule may cause strong, robust exon skipping; weak, sporadic exon skipping or no exon skipping at all. It is preferable to develop antisense molecules (alone or in combination) which can deliver strong, robust consistent exon skipping at a low therapeutic dose.

(64) Antisense Molecules

(65) According to a first aspect of the invention, there is provided antisense molecules capable of binding to a selected target to induce exon skipping. To induce exon skipping in exons of the Dystrophin gene transcript, the antisense molecules are preferably selected from the group of compounds shown in Table 1A.

(66) There is also provided a combination or cocktail of two or more antisense oligonucleotides capable of binding to a selected target to induce exon skipping. To induce exon skipping in exons of the Dystrophin gene transcript, the antisense molecules in a cocktail are preferably selected from the group of compounds shown in Table 1B.

(67) Designing antisense molecules to completely mask consensus splice sites may not necessarily generate any skipping of the targeted exon. Furthermore, the inventors have discovered that size or length of the antisense oligonucleotide itself is not always a primary factor when designing antisense molecules. With some targets such as exon 19, antisense oligonucleotides as short as 12 bases were able to induce exon skipping, albeit not as efficiently as longer (2031 bases) oligonucleotides. In some other targets, such as murine dystrophin exon 23, antisense oligonucleotides only 17 residues long were able to induce more efficient skipping than another overlapping compound of 25 nucleotides. However, in the present invention it has been generally found that longer antisense molecules are often more effective at inducing exon skipping than shorter molecules. Thus preferably, the antisense molecules of the present invention are between 24 and 30 nucleic acids in length, preferably about 28 nucleotides in length. For example, it has previously been found that an antisense oligonucleotide of 20 bases (H16A(07+13)) was ineffective at inducing exon skipping of exon 16, but an oligonucleotide of 31 bases (H16A(06+25)), which completely encompassed the shorter oligonucleotide, was effective at inducing skipping (Harding et al (2007) Mol Ther 15:157-166).

(68) The inventors have also discovered that there does not appear to be any standard motif that can be blocked or masked by antisense molecules to redirect splicing. In some exons, such as mouse dystrophin exon 23, the donor splice site was the most amenable to target to re-direct skipping of that exon. It should be noted that designing and testing a series of exon 23 specific antisense molecules to anneal to overlapping regions of the donor splice site showed considerable variation in the efficacy of induced exon skipping. As reported in Mann et al., (2002) there was a significant variation in the efficiency of bypassing the nonsense mutation depending upon antisense oligonucleotide annealing (Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J Gen Med 4: 644-654). Targeting the acceptor site of exon 23 or several internal domains was not found to induce any consistent exon 23 skipping.

(69) In other exons targeted for removal, masking the donor splice site did not induce any exon skipping. However, by directing antisense molecules to the acceptor splice site (human exon 8 as discussed below), strong and sustained exon skipping was induced. It should be noted that removal of human exon 8 was tightly linked with the co-removal of exon 9. There is no strong sequence homology between the exon 8 antisense oligonucleotides and corresponding regions of exon 9 so it does not appear to be a matter of cross reaction. Rather, the splicing of these two exons is generally linked. This is not an isolated instance, as the same effect is observed in canine cells where targeting exon 8 for removal also resulted in the skipping of exon 9. Targeting exon 23 for removal in the mouse dystrophin pre-mRNA also results in the frequent removal of exon 22 as well. This effect occurs in a dose dependent manner and also indicates close coordinated processing of 2 adjacent exons.

(70) In other targeted exons, antisense molecules directed at the donor or acceptor splice sites did not induce exon skipping or induce poor skipping, while annealing antisense molecules to intra-exonic regions (i.e. exon splicing enhancers within human dystrophin exon 4) was most efficient at inducing exon skipping. Some exons, both mouse and human exon 19 for example, are readily skipped by targeting antisense molecules to a variety of motifs. That is, targeted exon skipping is induced after using antisense oligonucleotides to mask donor and acceptor splice sites or exon splicing enhancers.

(71) It is also not possible to predict which cocktails of antisense molecules will induce exon skipping. For example, the combination of two antisense molecules which, on their own, are very good at inducing skipping of a given exon may not cause skipping of an exon when combined in a cocktail. For example, each of H50A(+02+30) and H50A(+66+95) on their own induce good skipping of exon 50 and 51. However, in combination as a cocktail, they only induced poor skipping of the two exons. Likewise, the combination of H50A(+02+30) and H51A(+66+90) or H50A(+02+30) and H51A(+61+90) did not cause efficient skipping of exons 50 and 51, even though the individual antisense molecules were effective. Yet the introduction of a third antisense molecule ([H51D(+1607)] which by itself did not cause skipping), created a three element cocktail ([H50A(+02+30)], H51A(+66+90) and [H51D(+1607)]) that was able to cause skipping of exons 50 and 51 down to 1 nM.

(72) Alternatively, the combination of two or three antisense molecules which are ineffective or only moderately effective on their own may cause excellent skipping when combined. For example, individually H26A(07+19) [SEQ ID NO: 39], H26A(+24+50) [SEQ ID NO: 40] and H26A(+68+92) [SEQ ID NO: 41] cause inefficient skipping of exon 26, and also induce multiple exon skipping (2629 or 2730). However, when the three exons are combined as a cocktail, highly efficient skipping of exon 26 occurs.

(73) From the above examples and discussion, it is clear that there is no way to accurately predict whether a combination will work or not.

(74) Antisense molecules may cause skipping of exons in a dose dependant or non-dose dependant manner. By dose dependant, it is meant that a larger amount of the antisense molecule induces better skipping of the exon, whereas non-dose dependant antisense molecules are able to induce skipping even at very low doses. For example, from FIG. 15 it can be seen that H46A(+81+109) [SEQ ID NO: 12] gives equally good skipping of exon 46 regardless of the amount of antisense molecule present (from 600 nM to 25 nM). In contrast, H57A(10+20) [SEQ ID NO: 20] (FIG. 24) induces strong skipping of exon 57 at 100 nM, but reduced skipping at 50 nM and an even greater reduction in skipping at 25 nM.

(75) It is preferable to select antisense molecules that induce skipping in a dose independent manner, as these molecules may be administered at very low concentrations and still give a therapeutic effect. However, it is also acceptable to select as preferred molecules those antisense molecules that induce skipping in a dose dependant manner, particularly if those molecules induce good or excellent skipping at low concentrations. Preferably, the antisense molecules of the present invention are able to induce good or excellent exon skipping at concentrations of less than 500 nM, preferably less than 200 nM and more preferably as low as 100 nM, 50 nM or even 25 nM. Most preferably, the oligonucleotide molecules of the present invention are able to induce skipping at levels of greater that 30% at a concentration of 100 nM.

(76) To identify and select antisense oligonucleotides suitable for use in the modulation of exon skipping, a nucleic acid sequence whose function is to be modulated must first be identified. This may be, for example, a gene (or mRNA transcribed form the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. Within the context of the present invention, preferred target site(s) are those involved in mRNA splicing (i.e. splice donor sites, splice acceptor sites, or exonic splicing enhancer elements). Splicing branch points and exon recognition sequences or splice enhancers are also potential target sites for modulation of mRNA splicing.

(77) Preferably, the present invention aims to provide antisense molecules capable of binding to a selected target in the dystrophin pre-mRNA to induce efficient and consistent exon skipping. Duchenne muscular dystrophy arises from mutations that preclude the synthesis of a functional dystrophin gene product. These Duchenne muscular dystrophy gene defects are typically nonsense mutations or genomic rearrangements such as deletions, duplications or micro-deletions or insertions that disrupt the reading frame. As the human dystrophin gene is a large and complex gene (with 79 exons being spliced together to generate a mature mRNA with an open reading frame of approximately 11,000 bases), there are many positions where these mutations can occur. Consequently, a comprehensive antisense oligonucleotide based therapy to address many of the different disease-causing mutations in the dystrophin gene will require that many exons can be targeted for removal during the splicing process.

(78) Within the context of the present invention, preferred target site(s) are those involved in mRNA splicing (i.e. splice donor sites, splice acceptor sites or exonic splicing enhancer elements). Splicing branch points and exon recognition sequences or splice enhancers are also potential target sites for modulation of mRNA splicing.

(79) The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, specifically hybridisable and complementary are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense molecule need not be 100% complementary to that of its target sequence to be specifically hybridisable. An antisense molecule is specifically hybridisable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.

(80) While the above method may be used to select antisense molecules capable of deleting any exon from within a protein that is capable of being shortened without affecting its biological function, the exon deletion should not lead to a reading frame shift in the shortened transcribed mRNA. Thus, if in a linear sequence of three exons the end of the first exon encodes two of three nucleotides in a codon and the next exon is deleted then the third exon in the linear sequence must start with a single nucleotide that is capable of completing the nucleotide triplet for a codon. If the third exon does not commence with a single nucleotide there will be a reading frame shift that would lead to the generation of a truncated or a non-functional protein.

(81) It will be appreciated that the codon arrangements at the end of exons in structural proteins may not always break at the end of a codon. Consequently, there may be a need to delete more than one exon from the pre-mRNA to ensure in-frame reading of the mRNA. In such circumstances, a plurality of antisense oligonucleotides may need to be selected by the method of the invention, wherein each is directed to a different region responsible for inducing splicing in the exons that are to be deleted.

(82) The length of an antisense molecule may vary so long as it is capable of binding selectively to the intended location within the pre-mRNA molecule. The length of such sequences can be determined in accordance with selection procedures described herein. Generally, the antisense molecule will be from about 10 nucleotides in length up to about 50 nucleotides in length. However, it will be appreciated that any length of nucleotides within this range may be used in the method. Preferably, the length of the antisense molecule is between 17 to 30 nucleotides in length. Surprisingly, it has been found that longer antisense molecules are often more effective at inducing exon skipping. Thus, most preferably the antisense molecule is between 24 and 30 nucleotides in length.

(83) In order to determine which exons can be connected in a dystrophin gene, reference should be made to an exon boundary map. Connection of one exon with another is based on the exons possessing the same number at the 3 border as is present at the 5 border of the exon to which it is being connected. Therefore, if exon 7 were deleted, exon 6 must connect to either exons 12 or 18 to maintain the reading frame. Thus, antisense oligonucleotides would need to be selected which redirected splicing for exons 7 to 11 in the first instance or exons 7 to 17 in the second instance. Another and somewhat simpler approach to restore the reading frame around an exon 7 deletion would be to remove the two flanking exons. Induction of exons 6 and 8 skipping should result in an in-frame transcript with the splicing of exons 5 to 9. In practise however, targeting exon 8 for removal from the pre-mRNA results in the co-removal of exon 9 so the resultant transcript would have exon 5 joined to exon 10. The inclusion or exclusion of exon 9 does not alter the reading frame.

(84) Once the antisense molecules to be tested have been identified, they are prepared according to standard techniques known in the art. The most common method for producing antisense molecules is the methylation of the 2 hydroxyribose position and the incorporation of a phosphorothioate backbone.

(85) This produces molecules that superficially resemble RNA but that are much more resistant to nuclease degradation.

(86) To avoid degradation of pre-mRNA during duplex formation with the antisense molecules, the antisense molecules used in the method may be adapted to minimise or prevent cleavage by endogenous RNase H. This property is highly preferred, as the presence of unmethylated RNA oligonucleotides in an intracellularly environment or in contact with crude extracts that contain RNase H will lead to degradation of the pre-mRNA: antisense oligonucleotide duplexes. Any form of modified antisense molecules that are capable of by-passing or not inducing such degradation may be used in the present method. The nuclease resistance may be achieved by modifying the antisense molecules of the invention so that it comprises partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups including carboxylic acid groups, ester groups, and alcohol groups.

(87) An example of antisense molecules which, when duplexed with RNA, are not cleaved by cellular RNase H are 2-O-methyl derivatives. 2-O-methyl-oligoribonucleotides are very stable in a cellular environment and in animal tissues, and their duplexes with RNA have higher Tm values than their ribo- or deoxyribo-counterparts. Alternatively, the nuclease resistant antisense molecules of the invention may have at least one of the last 3-terminus nucleotides fluoridated. Still alternatively, the nuclease resistant antisense molecules of the invention have phosphorothioate bonds linking between at least two of the last 3-terminus nucleotide bases, preferably having phosphorothioate bonds linking between the last four 3-terminal nucleotide bases.

(88) Antisense molecules that do not activate RNase H can be made in accordance with known techniques (see, e.g., U.S. Pat. No. 5,149,797). Such antisense molecules, which may be deoxyribonucleotide or ribonucleotide sequences, simply contain any structural modification which sterically hinders or prevents binding of RNase H to a duplex molecule containing the oligonucleotide as one member thereof, which structural modification does not substantially hinder or disrupt duplex formation. Because the portions of the oligonucleotide involved in duplex formation are substantially different from those portions involved in RNase H binding thereto, numerous antisense molecules that do not activate RNase H are available. For example, such antisense molecules may be oligonucleotides wherein at least one, or all, of the inter-nucleotide bridging phosphate residues are modified phosphates, such as methyl phosphonates, methyl phosphorothioates, phosphoromorpholidates, phosphoropiperazidates and phosphoramidates. For example, every other one of the internucleotide bridging phosphate residues may be modified as described. In another non-limiting example, such antisense molecules are molecules wherein at least one, or all, of the nucleotides contain a 2 lower alkyl moiety (e.g., C.sub.1-C.sub.4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described.

(89) While antisense oligonucleotides are a preferred form of the antisense molecules, the present invention comprehends other oligomeric antisense molecules, including but not limited to oligonucleotide mimetics such as are described below.

(90) Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural inter-nucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their inter-nucleoside backbone can also be considered to be oligonucleosides.

(91) In other preferred oligonucleotide mimetics, both the sugar and the inter-nucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleo-bases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

(92) Modified oligonucleotides may also contain one or more substituted sugar moieties. Oligonucleotides may also include nucleobase (often referred to in the art simply as base) modifications or substitutions. Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 C. and are presently preferred base substitutions, even more particularly when combined with 2-O-methoxyethyl sugar modifications.

(93) Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

(94) It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes antisense compounds that are chimeric compounds. Chimeric antisense compounds or chimeras, in the context of this invention, are antisense molecules, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the increased resistance to nuclease degradation, increased cellular uptake, and an additional region for increased binding affinity for the target nucleic acid.

(95) Methods of Manufacturing Antisense Molecules

(96) The antisense molecules used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). One method for synthesising oligonucleotides on a modified solid support is described in U.S. Pat. No. 4,458,066.

(97) Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. In one such automated embodiment, diethyl-phosphoramidites are used as starting materials and may be synthesized as described by Beaucage, et al., (1981) Tetrahedron Letters, 22:1859-1862.

(98) The antisense molecules of the invention are synthesised in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules. The molecules of the invention may also be mixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.

(99) Therapeutic Agents

(100) The present invention also can be used as a prophylactic or therapeutic, which may be utilised for the purpose of treatment of a genetic disease.

(101) Accordingly, in one embodiment the present invention provides antisense molecules that bind to a selected target in the dystrophin pre-mRNA to induce efficient and consistent exon skipping described herein in a therapeutically effective amount admixed with a pharmaceutically acceptable carrier, diluent, or excipient.

(102) The phrase pharmaceutically acceptable refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similarly untoward reaction, such as gastric upset and the like, when administered to a patient. The term carrier refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa., (1990).

(103) In a more specific form of the invention there are provided pharmaceutical compositions comprising therapeutically effective amounts of an antisense molecule together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers. Such compositions include diluents of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. Hylauronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives. See, e.g., Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, Pa. 18042) pages 1435-1712 that are herein incorporated by reference. The compositions may be prepared in liquid form, or may be in dried powder, such as lyophilised form.

(104) It will be appreciated that pharmaceutical compositions provided according to the present invention may be administered by any means known in the art. Preferably, the pharmaceutical compositions for administration are administered by injection, orally, or by the pulmonary, or nasal route. The antisense molecules are more preferably delivered by intravenous, intra-arterial, intraperitoneal, intramuscular, or subcutaneous routes of administration.

(105) Antisense Molecule Based Therapy

(106) Also addressed by the present invention is the use of antisense molecules of the present invention, for manufacture of a medicament for modulation of a genetic disease.

(107) The delivery of a therapeutically useful amount of antisense molecules may be achieved by methods previously published. For example, intracellular delivery of the antisense molecule may be via a composition comprising an admixture of the antisense molecule and an effective amount of a block copolymer. An example of this method is described in US patent application US 20040248833.

(108) Other methods of delivery of antisense molecules to the nucleus are described in Mann C J et al., (2001) [Antisense-induced exon skipping and the synthesis of dystrophin in the mdx mouse. Proc., Natl. Acad. Science, 98(1) 42-47] and in Gebski et al., (2003). Human Molecular Genetics, 12(15): 1801-1811.

(109) A method for introducing a nucleic acid molecule into a cell by way of an expression vector either as naked DNA or complexed to lipid carriers, is described in U.S. Pat. No. 6,806,084.

(110) It may be desirable to deliver the antisense molecule in a colloidal dispersion system. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes or liposome formulations.

(111) Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. These formulations may have net cationic, anionic or neutral charge characteristics and are useful characteristics with in vitro, in vivo and ex vivo delivery methods. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0.PHI.m can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. RNA and DNA can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci., 6:77, 1981).

(112) In order for a liposome to be an efficient gene transfer vehicle, the following characteristics should be present: (1) encapsulation of the antisense molecule of interest at high efficiency while not compromising their biological activity; (2) preferential and substantial binding to a target cell in comparison to non-target cells; (3) delivery of the aqueous contents of the vesicle to the target cell cytoplasm at high efficiency; and (4) accurate and effective expression of genetic information (Mannino, et al., Biotechniques, 6:682, 1988).

(113) The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.

(114) Alternatively, the antisense construct may be combined with other pharmaceutically acceptable carriers or diluents to produce a pharmaceutical composition. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration.

(115) The routes of administration described are intended only as a guide since a skilled practitioner will be able to determine readily the optimum route of administration and any dosage for any particular animal and condition.

(116) The antisense molecules of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such pro-drugs, and other bioequivalents.

(117) The term pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

(118) For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, (including by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2-O-methoxyethyl modification are believed to be particularly useful for oral administration.

(119) The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

(120) Kits of the Invention

(121) The invention also provides kits for treatment of a patient with a genetic disease which kit comprises at least an antisense molecule, packaged in a suitable container, together with instructions for its use.

(122) In a preferred embodiment, the kits will contain at least one antisense molecule as shown in Table 1A, or a cocktail of antisense molecules as shown in Table 1B. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.

(123) The contents of the kit can be lyophilized and the kit can additionally contain a suitable solvent for reconstitution of the lyophilized components. Individual components of the kit would be packaged in separate containers and, associated with such containers, can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.

(124) When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution, for example a sterile aqueous solution. For in vivo use, the expression construct may be formulated into a pharmaceutically acceptable syringeable composition. In this case the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an affected area of the animal, such as the lungs, injected into an animal, or even applied to and mixed with the other components of the kit.

(125) The components of the kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means. Irrespective of the number or type of containers, the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of an animal. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.

(126) Those of ordinary skill in the field should appreciate that applications of the above method has wide application for identifying antisense molecules suitable for use in the treatment of many other diseases.

Examples

(127) The following Examples serve to more fully describe the manner of using the above-described invention, as well as to set forth the best modes contemplated for carrying out various aspects of the invention. It is understood that these

(128) Examples in no way serve to limit the true scope of this invention, but rather are presented for illustrative purposes. The references cited herein are expressly incorporated by reference.

(129) Methods of molecular cloning, immunology and protein chemistry, which are not explicitly described in the following examples, are reported in the literature and are known by those skilled in the art. General texts that described conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art, included, for example: Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Glover ed., DNA Cloning: A Practical Approach, Volumes I and II, MRL Press, Ltd., Oxford, U.K. (1985); and Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K. Current Protocols in Molecular Biology. Greene Publishing Associates/Wiley Intersciences, New York (2002).

(130) Determining Induced Exon Skipping in Human Muscle Cells

(131) Attempts by the inventors to develop a rational approach in antisense molecules design were not completely successful as there did not appear to be a consistent trend that could be applied to all exons. As such, the identification of the most effective and therefore most therapeutic antisense molecules compounds has been the result of empirical studies.

(132) These empirical studies involved the use of computer programs to identify motifs potentially involved in the splicing process. Other computer programs were also used to identify regions of the pre-mRNA which may not have had extensive secondary structure and therefore potential sites for annealing of antisense molecules. Neither of these approaches proved completely reliable in designing antisense oligonucleotides for reliable and efficient induction of exon skipping.

(133) Annealing sites on the human dystrophin pre-mRNA were selected for examination, initially based upon known or predicted motifs or regions involved in splicing. 2OMe antisense oligonucleotides were designed to be complementary to the target sequences under investigation and were synthesised on an Expedite 8909 Nucleic Acid Synthesiser. Upon completion of synthesis, the oligonucleotides were cleaved from the support column and de-protected in ammonium hydroxide before being desalted. The quality of the oligonucleotide synthesis was monitored by the intensity of the trityl signals upon each deprotection step during the synthesis as detected in the synthesis log. The concentration of the antisense oligonucleotide was estimated by measuring the absorbance of a diluted aliquot at 260 nm.

(134) Specified amounts of the antisense molecules were then tested for their ability to induce exon skipping in an in vitro assay, as described below.

(135) Briefly, normal primary myoblast cultures were prepared from human muscle biopsies obtained after informed consent. The cells were propagated and allowed to differentiate into myotubes using standard culturing techniques. The cells were then transfected with the antisense oligonucleotides by delivery of the oligonucleotides to the cells as cationic lipoplexes, mixtures of antisense molecules or cationic liposome preparations.

(136) The cells were then allowed to grow for another 24 hours, after which total RNA was extracted and molecular analysis commenced. Reverse transcriptase amplification (RT-PCR) was undertaken to study the targeted regions of the dystrophin pre-mRNA or induced exonic re-arrangements.

(137) For example, in the testing of an antisense molecule for inducing exon 19 skipping the RT-PCR test scanned several exons to detect involvement of any adjacent exons. For example, when inducing skipping of exon 19, RT-PCR was carried out with primers that amplified across exons 17 and 21. Amplifications of even larger products in this area (i.e. exons 13-26) were also carried out to ensure that there was minimal amplification bias for the shorter induced skipped transcript. Shorter or exon skipped products tend to be amplified more efficiently and may bias the estimated of the normal and induced transcript.

(138) The sizes of the amplification reaction products were estimated on an agarose gel and compared against appropriate size standards. The final confirmation of identity of these products was carried out by direct DNA sequencing to establish that the correct or expected exon junctions have been maintained.

(139) Once efficient exon skipping had been induced with one antisense molecule, subsequent overlapping antisense molecules may be synthesized and then evaluated in the assay as described above. Our definition of an efficient antisense molecule is one that induces strong and sustained exon skipping at transfection concentrations in the order of 300 nM or less. Most preferably, the oligonucleotide molecules of the present invention are able to induce skipping at levels of greater that 30% at a concentration of 100 nM.

(140) Densitometry Methods

(141) Densitometry analysis of the results of the exon skipping procedures was carried out, in order to determine which antisense molecules achieved the desired efficiency. Amplification products were fractionated on 2% agarose gels, stained with ethidium bromide and the images captured by a Chemi-Smart 3000 gel documentation system (Vilber Lourmat, Marne La Vallee). The bands were then analyzed using gel documentation system (Bio-Profil, Bio-1 D version 11.9, Vilber Lourmat, Marne La Vallee), according to the manufacturer's instructions.

(142) Densitometry was carried out on the following antisense molecules:

(143) FIG. 35

(144) Exon 3 H3A(+30+60) & H3A(+61+85)

(145) Exon 4 H4D(+1411) & H4A(+11+40)

(146) Exon 14 H14A(+32+61)

(147) Exon 17 H17A(+10+35)

(148) Exon 26 H26A(07+19), H26A(+24+50) & H26A(+68+92)

(149) Exon 36 H36A(16+09) & H36A(+22+51)

(150) FIG. 36

(151) Exon 46 H46A(+81+109)

(152) Exon 47 H47A(+01+29)

(153) Exon 48 H48A(+01+28) & H48A(+40+67)

(154) Exon 49 H49A(+45+70)

(155) Antisense Oligonucleotides Directed at Exon 17

(156) Antisense oligonucleotides directed at exon 17 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(157) From Table 2 below, it can be seen that the effect of antisense molecules directed at the same site (the exon 17 acceptor splice site) can be very different, even though the binding location of the two antisense molecules are overlapping.

(158) H17A(07+23) [SEQ ID NO:3], which anneals to the last 7 bases of intron 16 and the first 23 bases of exon 17, induces exon 17 skipping when delivered into the cell at a concentration of 25 nM. In contrast, the antisense molecule H17A(12+18), which anneals to the last 12 bases of intron 16 and the first 18 bases of exon 17, and thus overlaps the location of binding of H17A(07+23), was not able to induce exon skipping at all. Furthermore, H17A(07+16), which anneals to the last 7 bases of intron 16 and the first 16 bases of exon 17 caused skipping of both exon 17 and 18 at 200 nM. Antisense molecule H17A(+61+86) [SEQ ID NO:4], which binds in an intra-exonic splicing enhancer motif of exon 17, is also able to induce good skipping. It can be seen that the ability of antisense molecules to induce exon skipping cannot be predicted simply from their binding location and must be determined through rigorous testing.

(159) TABLE-US-00003 TABLE 2 Antisense molecule sequences tested to determine if they induce exon 17 skipping Antisense SEQ Oligonucleotide Ability to ID name Sequence induce skipping 459 H17A(12 +18) GGU GAC AGC CUG UGA AAU CUG UGA GAA GUA No Skipping 3 H17A(07+23) GUG GUG GUG ACA GCC UGU GAA AUC UGU GAG Skipping at 25 nM 460 H17A(07+16) UGA CAG CCU GUG AAA UCU GUG AG Skipping ex 17 +18 at 200 nM 461 H17A(+10 +35) AGU GAU GGC UGA GUG GUG GUG ACA GC Skipping at 50 nM 462 H17A(+31+50) ACA GUU GUC UGU GUU AGU GA inconsistent skipping 4 H17A(+61 +86) UGU UCC CUU GUG GUC ACC GUA GUU AC Skipping at 50 nM 463 H17A(+144+163) CAG AAU CCA CAG UAA UCU GC skipping at 300 nM

(160) This data shows that some particular antisense molecules induce efficient exon skipping while another antisense molecule, which targets a near-by or overlapping region, can be much less efficient. Titration studies show one molecule is able to induce targeted exon skipping at 20-25 nM while a less efficient antisense molecule might only induced exon skipping at concentrations of 300 nM and above. Therefore, we have shown that targeting of the antisense molecules to motifs involved in the splicing process plays a crucial role in the overall efficacy of that compound.

(161) Efficacy refers to the ability to induce consistent skipping of a target exon. However, sometimes skipping of the target exons is consistently associated with a flanking exon. That is, we have found that the splicing of some exons is tightly linked. For example, in targeting exon 23 in the mouse model of muscular dystrophy with antisense molecules directed at the donor site of that exon, dystrophin transcripts missing exons 22 and 23 are frequently detected. As another example, when using an antisense molecule directed to exon 8 of the human dystrophin gene, many induced transcripts are missing both exons 8 and 9.

(162) Antisense Oligonucleotides Directed at Exon 2

(163) Antisense oligonucleotides directed at exon 2 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(164) TABLE-US-00004 TABLE 3 Antisense molecule sequences tested to determine if they induce exon 2 skipping Antisense Ability to SEQ Oligonucleotide induce ID name Sequence skipping 75 H2A(14+10) UCU CUU UCA UCU AAA AUG CAA AAU No Skipping 76 H2A(1+23) CUU UUG AAC AUC UUC UCU UUC AUC No Skipping 77 H2A(+7+38) UUU UGU GAA UGU UUU CUU UUG AAC AUC UUC UC No Skipping 78 H2A(+16+39) AUU UUG UGA AUG UUU UCU UUU GAA No Skipping 79 H2A(+30+60) UAG AAA AUU GUG CAU UUA CCC AUU UUG UGA A No Skipping 80 H2D(+1911) ACC AUU CUU ACC UUA GAA AAU UGU GCA UUU No Skipping 81 H2D(+0321) AAA GUA ACA AAC CAU UCU UAC CUU No Skipping
Antisense Oligonucleotides Directed at Exon 3

(165) Antisense oligonucleotides directed at exon 3 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(166) Each used alone, antisense molecules H3A(+30+60) [SEQ ID NO: 31] and H3A(+61+85) [SEQ ID NO: 32] induce exon 3 skipping. However, in combination, the two molecules are even more effective at inducing skipping (FIG. 3), and are also able to induce skipping of exons 4 and 5 at 300 nM and 600 nM, a result not seen or predicted by the results of the use of each antisense molecule alone. Additional products above the induced transcript missing exon 3 arise from amplification from carry-over outer primers from the RT-PCR as well as heteroduplex formation.

(167) TABLE-US-00005 TABLE 4 Antisense molecule sequences tested to determine if they induce exon 3 skipping Antisense SEQ Oligonucleotide Ability to induce ID name Sequence skipping 82 H3A(+14+38) AGG UCA CUG AAG AGG UUC UCA AUA U Moderate skipping to 10 nM 83 H3A(+20+40) GUA GGU CAC UGA AGA GGU UCU Strong skipping to 50 nM 84 H3A(+25+60) AGG AGG CGU CUC CCA UCC UGU AGG UCA CUG AAG weak skipping AG 85 H3A(+45+65) AGG UCU AGG AGG CGC CUC CCA No skipping 86 H3A(+48+73) CUU CGA GGA GGU CUA GGA GGC GCC UC No Skipping 32 H3A(+61+85) GCC CUG UCA GGC CUU CGA GGA GGU C Skipping to 300 nM 87 H3D(+1708) uca cau acA GUU UUU GCC CUG UCA G No skipping 88 H3D(+1902) UAC AGU UUU UGC CCU GUC AGG No skipping 89 H3D(+1410) AAG UCA CAU ACA GUU UUU GCC CUG No skipping 90 H3D(+1207) UCA CAU ACA GUU UUU GCC C No skipping Cocktails for exon 3 31 & H3A(+30+60) UAG GAG GCG CCU CCC AUC CUG UAG GUC ACU G Excellent skipping to 32 H3A(+61+85) G CCC UGU CAG GCC UUC GAG GAG GUC 100 nM, skipping to 10 nM. Also taking out 4&5 to 300 nM 32 & H3A(+61+85) G CCC UGU CAG GCC UUC GAG GAG GUC Very strong skipping to 464 H3A(+30+54) GCG CCU CCC AUC CUG UAG GUC ACU G 50 nM 32 & H3A(+61+85) G CCC UGU CAG GCC UUC GAG GAG GUC Very strong skipping to 84 H3A(+25+60) AGG AGG CGU CUC CCA UCC UGU AGG UCA CUG AAG 50 nM AG
Antisense Oligonucleotides Directed at Exon 4

(168) Antisense oligonucleotides directed at exon 4 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. FIG. 4 shows skipping of exon 4 using a cocktail of H4A(+11+40) [SEQ ID NO: 33] and H4D(+1411) [SEQ ID NO: 34].

(169) TABLE-US-00006 TABLE 5 Antisense molecule sequences tested to determine if they induce exon 4 skipping Antisense SEQ Oligonucleotide ID name Sequence Ability to induce skipping 91 H4A(08+17) GAU CCU UUU UCU UUU GGC UGA GAA C Weak skipping down to 10 nM 92 H4A(+36+60) CCG CAG UGC CUU GUU GAC AUU GUU C Good skipping to 10 nM 93 H4D(+1411) GUA CUA CUU ACA UUA UUG UUC UGC A Very poor skipping to 10 nM Exon 4 Cocktails 33 & H4A(+11+40) UGU UCA GGG CAU GAA CUC UUG UGG AUC CUU Excellent skipping(100% to 34 H4D(+1411) GUA CUA CUU ACA UUA UUG UUC UGC A 100 nM) and good skipping down to 5 nM
Antisense Oligonucleotides Directed at Exon 5

(170) Antisense oligonucleotides directed at exon 5 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. H5D(+2605) would be regarded as a non-preferred antisense molecule as it failed to induce even low level skipping of exon 5. However, H5A(+35+65) [SEQ ID NO: 1], which presumably targets an exonic splicing enhancer was evaluated, found to be highly efficient at inducing skipping of that target exon, as shown in FIG. 5 and is regarded as the preferred compound for induced exon 5 skipping.

(171) TABLE-US-00007 TABLE 6 Antisense molecule sequences tested to determine if they induce exon 5 skipping Antisense Ability to Oligonucleotide induce SEQ ID name Sequence skipping 1 H5A(+35+65) AAA CCA AGA GUC Great AGU UUA UGA UUU skipping CCA UCU A to 10 nM 94 H5D(+2605) CUU ACC UGC CAG No skipping UGG AGG AUU AUA UUC CAA A
Antisense Oligonucleotides Directed at Exon 6

(172) Antisense oligonucleotides directed at exon 6 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(173) TABLE-US-00008 TABLE7 Antisensemoleculesequencestestedtodetermineiftheyinduceexon6 skipping SEQ Antisense Abilitytoinduce ID Oligonucleotidename Sequence skipping 95 H6A(09+17) UUCAUUACAUUUUUGACCUACAUGUG faintto600nM 96 H6A(+32+57) CUUUUCACUGUUGGUUUGUUGCAAUC skippingat25nM 97 KH96A(+66+94) AAUUACGAGUUGAUUGUCGGACCCAGCUC skippingat25nM 98 H6A(+69+96) AUAAUUACGAGUUGAUUGUCGGACCCAG skippingto100nM 99 H6A(+98+123) GGUGAAGUUGAUUACAUUAACCUGUG Noskipping 100 H6D(+1806) UCUUACCUAUGACUAUGGAUGAGA Noskipping 101 H6D(+0715) CAGUAAUCUUCUUACCUAUGAC Noskipping 102 H6D(+0716) UCAGUAAUCUUCUUACCUAUGAC Noskipping 103 H6D(+0420) UGUCUCAGUAAUCUUCUUACCUAU Noskipping
Antisense Oligonucleotides Directed at Exon 7

(174) Antisense oligonucleotides directed at exon 7 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(175) TABLE-US-00009 TABLE8 Antisensemoleculesequencestestedtodetermineiftheyinduceexon7 skipping SEQ Antisense Abilitytoinduce ID Oligonucleotidename Sequence skipping 104 H7A(07+15) UCAAAUAGGUCUGGCCUAAAAC noskipping 105 H7A(03+18) CCAGUCAAAUAGGUCUGGCCUA noskipping 106 H7A(+41+63) UGUUCCAGUCGUUGUGUGGCUGA skipping50nM 73 H7A(+41+67) UGCAUGUUCCAGUCGUUGUGUGGCUGA skipping25nM 107 H7A(+47+74) UGUUGAAUGCAUGUUCCAGUCGUUGUGU skippking25nMbutweak 72 H7A(+49+71) UGAAUGCAUGUUCCAGUCGUUGU goodskippingto25nM
Antisense Oligonucleotides Directed at Exon 8

(176) Antisense oligonucleotides directed at exon 8 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 6.

(177) TABLE-US-00010 TABLE9 Antisensemoleculesequencestestedtodetermineiftheyinduceexon8 skipping Antisense SEQ Oligonucleotide ID name Sequence Abilitytoinduceskipping 108 H8A(10+20) UGGAUAGGUGGUAUCAACAUCUGUAAGCAC Veryweakskippingof8+9to 10nM 109 H8A(07+15) GAUAGGUGGUAUCAACAUCUGU Very,veryweakskippingof8+9 to10nM 35 H8A(06+24) UAUCUGGAUAGGUGGUAUCAACAUCUGUAA Weakskippingof8+9to10nM 110 H8A(04+18) GAUAGGUGGUAUCAACAUCUGU worksstronglyto40nM 71 H8A(+42+66) AAACUUGGAAGAGUGAUGUGAUGUA goodskippingof8+9to10nM 70 H8A(+57+83) GCUCACUUGUUGAGGCAAAACUUGGAA goodskippingof8+9athigh conc,downto10nM 111 H8A(+96+120) GCCUUGGCAACAUUUCCACUUCCUG Weakskippingof8+9to300nM 36 H8A(+134+158) AUGUAACUGAAAAUGUUCUUCUUUA Weakskippingof8+9to100nM 112 H8D(+1312) UACACACUUUACCUGUUGAGAAUAG Weakskippingof8+9to50nM Exon8 Cocktails 35& H8A(06+24) UAUCUGGAUAGGUGGUAUCAACAUCUGUAA Goodskippingto10nM(8+9)but 36 H8A(+134+158) AUGUAACUGAAAAUGUUCUUCUUUA also8onitsown 35& H8A(06+24) UAUCUGGAUAGGUGGUAUCAACAUCUGUAA Goodskippingto10nM(8+9)but 112 H8D(+1312) UACACACUUUACCUGUUGAGAAUAG also8onitsown 35& H8A(06+24) UAUCUGGAUAGGUGGUAUCAACAUCUGUAA Goodskippingto10nM(8+9)but 70 H8A(+57+83) GCUCACUUGUUGAGGCAAAACUUGGAA also8onitsown 35& H8A(06+24) UAUCUGGAUAGGUGGUAUCAACAUCUGUAA Goodskippingto10nM(8+9)but 111 H8A(+96+120) GCCUUGGCAACAUUUCCACUUCCUG also8onitsown
Antisense Oligonucleotides Directed at Exon 9

(178) Antisense oligonucleotides directed at exon 9 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(179) TABLE-US-00011 TABLE10 Antisensemoleculesequencestestedtodetermine iftheyinduceexon9skipping Antisense Ability SEQ Oligonucleotide toinduce ID name Sequence skipping 113 H9A(+154+184) AGCAGCCUGUGUGUA working GGCAUAGCUCUUGAAU strongly to100nM 114 H9D(+2604) AGACCUGUGAAGGAA working AUGGGCUCCGUGUAG strongly to200nM
Antisense Oligonucleotides Directed at Exon 10

(180) Antisense oligonucleotides directed at exon 10 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 7 for examples of a single antisense oligonucleotide molecule and cocktails which induce skipping of exon 10 and surrounding exons. Single antisense oligonucleotide molecule H10A(05+16) [SEQ ID NO: 37] was able to induce skipping of exons 9-14, whilst the combination with H10A(+98+119) [SEQ ID NO: 38] was able to induce skipping of exon 10 alone and exons 9-12 (and some skipping of exons 10-12). The combination of H10A(05+16) and H10A(+130+149) was able to induce skipping of exon 10 and exons 9-12.

(181) TABLE-US-00012 TABLE11 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 10skipping SEQ Antisense ID Oligonucleotidename Sequence Abilitytoinduceskipping 115 H10A(09+16) CAGGAGCUUCCAAAUGCUGCACAAU noskipping 116 H10A(+08+27) UGACUUGUCUUCAGGAGCUU noskipping 117 H10A(+21+42) CAAUGAACUGCCAAAUGACUUG Skippingat100nM 118 H10A(+27+51) ACUCUCCAUCAAUGAACUGCCAAAU NoSkipping 119 H10A(+55+79) CUGUUUGAUAACGGUCCAGGUUUAC NoSkipping 120 H10A(+80+103) GCCACGAUAAUACUUCUUCUAAAG NoSkipping 121 H10D(+1609) UUAGUUUACCUCAUGAGUAUGAAAC NoSkipping CocktailsExon10 37& H10A(05+16) CAGGAGCUUCCAAAUGCUGCA Strongskippingat200nM 38 H10A(+98+119) UCCUCAGCAGAAAGAAGCCACG 37& H10A(05+16) CAGGAGCUUCCAAAUGCUGCA Skippingat200nM 122 H10A(+130+149) UUAGAAAUCUCUCCUUGUGC
Antisense Oligonucleotides Directed at Exon 11

(182) Antisense oligonucleotides directed at exon 11 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 37.

(183) TABLE-US-00013 TABLE12 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 11skipping Antisense SEQ Oligonucleotide ID name Sequence Abilitytoinduceskipping 123 H11A(07+13) CCAUCAUGUACCCCUGACAA Skippingat300nM 124 H11A+(+134+157) CCCUGAGGCAUUCCCAUCUUGAAU Skippingat100nM 125 H11A(+20+45) AUUACCAACCCGGCCCUGAUGGGCUG skippingto25nM 126 H11A(+46+75) UCCAAUCAGCUUACUUCCCAAUUGUAGAAU Strongskippingto25nM hintat2.5nM 127 H11A(+50+75) UCCAAUCAGCUUACUUCCCAAUUGUA Strongskippingto10nM faintat2.5nM 52 H11A(+50+79) CUGUUCCAAUCAGCUUACUUCCCAAUUGUA Strongskippingto5nM faintat2.5nM 128 H11A(+80+105) AGUUUCUUCAUCUUCUGAUAAUUUUC Faintskippingto25nM 129 H11A(+106+135) AUUUAGGAGAUUCAUCUGCUCUUGUACUUC Strongskippingto25nM (20%) 130 H11A(+110+135) AUUUAGGAGAUUCAUCUGCUCUUGUA Strongskippingto25nM (20%) 131 H11A(+110+139) UUGAAUUUAGGAGAUUCAUCUGCUCUUGUA Strongskippingto25nM (20%)
Antisense Oligonucleotides Directed at Exon 12

(184) Antisense oligonucleotides directed at exon 12 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 38.

(185) TABLE-US-00014 TABLE13 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 12skipping SEQ Antisense ID Oligonucleotidename Sequence Abilitytoinduceskipping 132 H12D(+0616) CAUAAGAUACACCUACCUUAUG NoSkipping 2 H12A(+52+75) UCUUCUGUUUUUGUUAGCCAGUCA Strongskipping 53 H12A(+30+57) CAGUCAUUCAACUCUUUCAGUUUCUGAU Strongskippingto10nM faintat2.5nM 133 H12A(+60+87) UUCCUUGUUCUUUCUUCUGUUUUUGUUA Strongskippingto25nM faintat5nM 134 H12A(+90+117) AGAUCAGGUCCAAGAGGCUCUUCCUCCA Strongskippingto25nM (30%) 135 H12A(+120+147) UGUUGUUGUACUUGGCGUUUUAGGUCUU Strongskippingto25nM (30%)
Antisense Oligonucleotides Directed at Exon 13

(186) Antisense oligonucleotides directed at exon 13 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(187) TABLE-US-00015 TABLE14 Antisensemoleculesequencestestedtodetermine iftheyinduceexon13skipping Antisense Ability SEQ Oligonucleotide toinduce ID name Sequence skipping 136 H13A(12+12) UUCUUGAAGCACCUG NoSkipping AAAGAUAAA
Antisense Oligonucleotides Directed at Exon 14

(188) Antisense oligonucleotides directed at exon 14 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 8.

(189) TABLE-US-00016 TABLE15 Antisensemoleculesequencestestedtodetermine iftheyinduceexon14skipping Antisense Abilityto SEQ Oligonucleotide induce ID name Sequence skipping 137 H14A(+45+73) GAAGGAUGUCUUGUA Skipping AAAGAACCCAGCGG at25nM
Antisense Oligonucleotides Directed at Exon 16

(190) Antisense oligonucleotides directed at exon 16 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(191) TABLE-US-00017 TABLE16 Antisensemoleculesequencestestedtodetermine iftheyinduceexon16skipping Antisense Abilityto SEQ Oligonucleotide induce ID name Sequence skipping 138 H16A(07+19) CUAGAUCCGCUUUUA Noskipping AAACCUGUUAA 139 H16A(+09+31) GCUUUUUCUUUUCUA Noskipping GAUCCGCU 140 H16D(+1807) CACUAACCUGUGCUG Noskipping UACUCUUUUC
Antisense Oligonucleotides Directed at Exon 17

(192) Antisense oligonucleotides directed at exon 17 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(193) TABLE-US-00018 TABLE64 Antisensemoleculesequencestestedtodetermine iftheyinduceexon17skipping Antisense Ability SEQ Oligonucleotide toinduce ID name Sequence skipping 141 H17A(+48+78) UGUGGUCACCGUAGU No UACUGUUUCCAUUCAA skipping 142 H17A(+55+85) GUUCCCUUGUGGUCA Skipping CCGUAGUUACUGUUUC to100nM
Antisense Oligonucleotides Directed at Exon 18

(194) Antisense oligonucleotides directed at exon 18 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 9.

(195) TABLE-US-00019 TABLE17 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 18skipping Antisense SEQ Oligonucleotide ID name Sequence Abilitytoinduceskipping 143 H18A(09+11) CAACAUCCUUCCUAAGACUG Noskipping 144 H18A(+24+43) GCGAGUAAUCCAGCUGUGAA Inconsistentskippingofboth exon17+18 145 H18A(+41+70) UUCAGGACUCUGCAACAGAGCUUCUGA Skippingexons17+18 GCG 300nM 146 H18A(+83+108) UUGUCUGUGAAGUUGCCUUCCUUCCG Skippingexons17+18 300nM 147 H18D(+0416) UUAAUGCAUAACCUACAUUG Noskipping
Antisense Oligonucleotides Directed at Exon 19

(196) Antisense oligonucleotides directed at exon 19 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(197) TABLE-US-00020 TABLE18 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 19skipping Antisense SEQ Oligonucleotide Abilitytoinduce ID name Sequence skipping 148 H19A(+19+48) GGCAUCUUGCAGUUUUCUGAACUUCUC skippingto25nM AGC 149 H19A(+27+54) UCUGCUGGCAUCUUGCAGUUUUCUGAAC skippingto25nM 150 H19D(+317) UCAACUCGUGUAAUUACCGU skipping
Antisense Oligonucleotides Directed at Exon 20

(198) Antisense oligonucleotides directed at exon 20 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(199) TABLE-US-00021 TABLE19 Antisensemoleculesequencestestedtodetermine iftheyinduceexon20skipping Antisense Abilityto SEQ Oligonucleotide induce ID name Sequence skipping 151 H20A(+23+47) GUUCAGUUGUUC faintshadow UGAGGCUUGUUUG at600nM 152 H20A(+140+164) AGUAGUUGUCAU noskipping CUGCUCCAAUUGU
Antisense Oligonucleotides Directed at Exon 23

(200) Antisense oligonucleotides directed at exon 23 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. Antisense oligonucleotides directed at exon 23 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. H23(+69+98)-SNP contains a single nucleotide polymorphism (SNP) that has been previously documented.

(201) TABLE-US-00022 TABLE65 Antisensemoleculesequencestestedtodetermine iftheyinduceexon23skipping Antisense Abilityto Oligonucleotide induce SEQID name Sequence skipping 153 H23(+69+98)-SNP CGGCUAAUUUCA skippingto GAGGGCGCUUUC 25nM UUUGAC
Antisense Oligonucleotides Directed at Exon 24

(202) Antisense oligonucleotides directed at exon 24 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(203) TABLE-US-00023 TABLE20 Antisensemoleculesequencestestedto determineiftheyinduceexon24skipping. Antisense SEQ Oligonucleotide Abilitytoinduce ID name Sequence skipping 8 H24A(+51+73) CAAGGGCAG Strongskipping GCCAUUCCU to25nM CCUUC
Antisense Oligonucleotides Directed at Exon 25

(204) Antisense oligonucleotides directed at exon 25 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. Oligonucleotide H25A(+95+119)-DupA is a patient specific antisense molecule.

(205) TABLE-US-00024 TABLE21 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 25skipping. SEQ Antisense ID Oligonucleotidename Sequence Abilitytoinduceskipping 154 H25A(+10+33) UGGGCUGAAUUGUCUGAAUAUCAC strongat25nMbutdidnot reducethefulllength product 155 H25D(+0614) GAGAUUGUCUAUACCUGUUG verystrongat25nM 156 H25A(+10+38) AGACUGGGCUGAAUUGUCUGAAUAUCA Strongskippingat5nMfaint CU 2.5nM 157 H25A(+95+119)-DupA* UUGAGUUCUGUUCUCAAGUCUCGAAG Strongskippingat25nM faint5nM(patientspecific) 158 H25D(+1314) GAGAUUGUCUAUACCUGUUGGCACAUG Strongskippingat10nM
Antisense Oligonucleotides Directed at Exon 26

(206) Antisense oligonucleotides directed at exon 26 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 10.

(207) TABLE-US-00025 TABLE22 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 26skipping. Antisense Abilitytoinduce SEQ Oligonucleotidename Sequence skipping 159 H26A(16+09) GGCAUAGACCUUCCACAAAACAAAC Faintskipping600nM &300nM 160 H26A(7+23) AAGGCCUCCUUUCUGGCAUAGACCUUC Faintat600,300nM, CAC multipleexons26-29or 27-30 161 H26A(03+27) CUUCAAGGCCUCCUUUCUGGCAUAGAC Faintat600,300nM, CUU multipleexons26-29or 27-30 162 H26A(+5+35) AACCUCCCUUCAAGGCCUCCUUUCUGG Noskipping CAU 40 H26A(+24+50) CUUACAGUUUUCUCCAAACCUCCCUUC Faintat600,300nM, multipleexons26-29or 27-30 163 H26D(+0619) UUUCUUUUUUUUUUUUUACCUUCAU Faintat600,multiple exons26-29or27-30 164 H26D(+2104) UUACCUUCAUCUCUUCAACUGCUUU multipleexons26-29or 27-30 165 H26D(+1010) UUUUUUUUACCUUCAUCUCU Notskipping26other bands Exon26cocktails 39, H26A(07+19) CCUCCUUUCUGGCAUAGACCUUCCAC strongskippingdownto 40& H26A(+24+50) CUUACAGUUUUCUCCAAACCUCCCUUC 25nM 41 H26A(+68+92) UGUGUCAUCCAUUCGUGCAUCUCUG
Antisense Oligonucleotides Directed at Exon 31

(208) Antisense oligonucleotides directed at exon 31 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(209) TABLE-US-00026 TABLE23 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 31skipping SEQ Antisense Abilitytoinduce ID Oligonucleotidename Sequence skipping 166 H31D(+1218) UUCUGAAAUUUCAUAUACCUGUGCAACAUC skippingto100nM 167 H31D(+0822) UAGUUUCUGAAAUAACAUAUACCUGUGCAA skippingto100nM 168 H31D(+0624) CUUAGUUUCUGAAAUAACAUAUACCUGUGC skippingto100nM 169 H31D(+0222) UAGUUUCUGAAAUAACAUAUACCU skippingto100nM 170 H31D(+0125) CCUUAGUUUCUGAAAUAACAUAUACC strongskippingat 300nM
Antisense Oligonucleotides Directed at Exon 32

(210) Antisense oligonucleotides directed at exon 32 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(211) TABLE-US-00027 TABLE24 Antisensemoleculesequencestestedto determineiftheyinduceexon32skipping Antisense SEQ Oligonucleotide Abilitytoinduce ID name Sequence skipping 171 H32A(+49+78) ACUUUCUUG skippingto100nM UAGACGCUG CUCAAAAUU GGC
Antisense Oligonucleotides Directed at Exon 34

(212) Antisense oligonucleotides directed at exon 34 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(213) TABLE-US-00028 TABLE25 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 34skipping Antisense Abilitytoinduce SEQID Oligonucleotidename Sequence skipping 172 H34A(+36+59) UUUCGCAUCUUACGGGACAAUUUC skippingto200nM 173 H34A(+41+70) CAUUCAUUUCCUUUCGCAUCUUACGGGACA skippingto200nM 174 H34A(+43+72) GACAUUCAUUUCCUUUCGCAUCUUACGGGA skippingto100nM 175 H34A(+51+83) UCUGUCAAGACAUUCAUUUCCUUUCGCAUC skippingto200nM 176 H34A(+91+120) UGAUCUCUUUGUCAAUUCCAUAUCUGUAGC skippingto100nM 177 H34A(+92+121) CUGAUCUCUUUGUCAAUUCCAUAUCUGUGG skippingto100nM 178 H34A(+95+120) UGAUCUCUUUGUCAAUUCCAUAUCUG Faintto25nM 179 H34A(+95+124) CUGCUGAUCUCUUUGUCAAUUCCAUAUCUG skippingto100nM
Antisense Oligonucleotides Directed at Exon 35

(214) Antisense oligonucleotides directed at exon 35 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(215) TABLE-US-00029 TABLE26 Antisensemoleculesequencestestedto determineiftheyinduceexon35skipping Antisense SEQ Oligonucleotide Abilitytoinduce ID name Sequence skipping 180 H35A(+14+43) UCUUCAGGU skippingto100nM GCACCUUCU GUUUCUCAA UCU 181 H35A(+24+53) UCUGUGAUA skippingto100nM CUCUUCAGG UGCACCUUC UGU
Antisense Oligonucleotides Directed at Exon 36

(216) Antisense oligonucleotides directed at exon 36 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 11.

(217) TABLE-US-00030 TABLE27 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 36skipping SEQ Antisense Abilitytoinduce ID Oligonucleotidename Sequence skipping 42 H36A(16+09) CUGGUAUUCCUUAAUUGUACAGAGA noskipping 182 H36A(01+19) CCAUGUGUUUCUGGUAUUCC veryfaintskipping300nM 183 H36A(+10+39) CACAUUCUGGUCAAAAGUUUCCAUGUGUUU Skippingto25nM 43 H36A(+22+51) UGUGAUGUGGUCCACAUUCUGGUCAAAAGU Skippingat100nM 184 H36A(+27+51) UGUGAUGUGGUCCACAUUCUGGUCA Skippingat100nM 185 H36A(+27+56) CACUUUGUGAUGUGGUCCACAUUCUGGUCA Skippingat300nM 186 H36A(+32+61) UGAUCCACUUUGUGAUGUGGUCCACAUUCU Skippingto25nM 187 H36A(+59+78) AAGUGUGUCAGCCUGAAUGA veryweakskipping 188 H36A(+65+94) UCUCUGAUUCAUCCAAAAGUGUGUCAGCCU 100%skippingat600nM, skipopingto25nM 189 H36A(+80+109) GCUGGGGUUUCUUUUUCUCUGAUUCAUCCA 100%skippingat600nM, skipopingto25nM 190 H36D(+1510) UAUUUGCUACCUUAAGCACGUCUUC veryweakskipping Exon36cocktails 42& H36A(16+09) CUGGUAUUCCUUAAUUGUACAGAGA goodskippingdownto 43 H36A(+22+51) UGUGAUGUGGUCCACAUUCUGGUCAAAAGU 25nM
Antisense Oligonucleotides Directed at Exon 38

(218) Antisense oligonucleotides directed at exon 38 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(219) TABLE-US-00031 TABLE28 Antisensemoleculesequencestestedto determineiftheyinduceexon38skipping Antisense SEQ Oligonucleotide Abilitytoinduce ID name Sequence skipping 191 H38A(2101) CUAAAAAAA skippingto25nM AAGAUAGUG CUA 192 H38A(12+14) AAAGGAAUG skippingto25nM GAGGCCUAA AAAAAAAG 193 H38D(+1411) AACCAAUUU skippingto25nM ACCAUAUCU UUAUUGA
Antisense Oligonucleotides Directed at Exon 39

(220) Antisense oligonucleotides directed at exon 39 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(221) TABLE-US-00032 TABLE29 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 39skipping SEQ Antisense Abilitytoinduce ID Oligonucleotidename Sequence skipping 194 H39A(07+23) ACAGUACCAUCAUUGUCUUCAUUCUGAUC skippingto600nM 195 H39A(07+23) ACAGUACCCUCAUUGUCUUCAUUCUGAUC skippingto600nM 196 H39A(+58+87) CUCUCGCUUUCUCUCAUCUGUGAUUCUUUG skippingto100nM 197 H39A(+60+89) UCCUCUCGCUUUCUCUCAUCUGUGAUUCUU skippingto100nM 198 H39A(+102+126) UAUGUUUUGUCUGUAACAGCUGCUG skippingto600nM
Antisense Oligonucleotides Directed at Exon 41

(222) Antisense oligonucleotides directed at exon 41 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(223) TABLE-US-00033 TABLE30 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 41skipping SEQ Antisense Abilitytoinduce ID Oligonucleotidename Sequence skipping 199 H41A(15+5) AUUUCCUAUUGAGCAAAACC Skippingdownto200nM 200 H41A(+66+90) CAUUGCGGCCCCAUCCUCAGACAAG Skippingdownto100nM 201 H41A(+92+120) GCUGAGCUGGAUCUGAGUUGGCUCCAC Skippingdownto10nM UG 202 H41A(+143+171) GUUGAGUCUUCGAAACUGAGCAAAUUUGC Novisibleskipping 203 H41D(+515) CCAGUAACAACUCACAAUUU Skippingdownto200nM
Antisense Oligonucleotides Directed at Exon 42

(224) Antisense oligonucleotides directed at exon 42 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(225) TABLE-US-00034 TABLE31 Antisensemoleculesequencestestedto determineiftheyinduceexon20skipping Antisense Oligonucleotide SEQ name Abilitytoinduce ID Exon42 Sequence skipping 204 H42D(+1802) ACCUUCAGA strongskipping GACUCCUCU UGC
Antisense Oligonucleotides Directed at Exon 43

(226) Antisense oligonucleotides directed at exon 43 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 12.

(227) TABLE-US-00035 TABLE32 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 20skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon43 Sequence skipping 205 H43A(+83+110) UCCUGUAGCUUCACCCUUUCCACAGGCG Noskipping 9 H43A(+92+117) GAGAGCUUCCUGUAGCUUCACCCUUU Skippingat10nM 206 H43A(+101+130) AAUCAGCUGGGAGAGAGCUUCCUGUAGCU Noskipping 207 H43D(+0812) UGUGUUACCUACCCUUGUCG Skippingdownto200nM 208 H43A(09+18) UAGACUAUCUUUUAUAUUCUGUAAUAU Faintskippingto25nM 209 H43A(+89+117) GAGAGCUUCCUGUAGCUUCACCCUUUCCA Strongskippingat25nM faint2.5nM 210 H43A(+81+111) UUCCUGUAGCUUCACCCUUUCCACAGGCGUU Strongskippingat50nM faint2.5nM 211 H43A(+92+114) AGCUUCCUGUAGCUUCACCCUUU Faintskippingto2.5nM 74 H43A(+92+120) GGAGAGAGCUUCCUGUAGCUUCACCCUUU Strongskippingat10nM faint5nM 212 H43A(+95+117) GAGAGCUUCCUGUAGCUUCACCC Strongskippingat25nM faint10nM
Antisense Oligonucleotides Directed at Exon 44

(228) Antisense oligonucleotides directed at exon 44 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 13 and FIG. 39.

(229) TABLE-US-00036 TABLE33 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 44skipping Antisense Oligonucleotidename Abilitytoinduce SEQ Exon44 Sequence skipping 213 H44A(13+13) UCUGUCAAAUCGCCUGCAGGUAAAAG 214 H44A(06+24) UUCUCAACAGAUCUGUCAAAUCGCCUGCAG Noskipping 215 H44A(+44+68) GCCACUGAUUAAAUAUCUUUAUAUC Skippingat100nM 216 H44A(+46+75) UCUGUUAGCCACUGAUUAAAUAUCUUUAUA Skippingat50nM 217 H44A(+61+84) UGUUCAGCUUCUGUUAGCCACUGA Skippingat100nM 218 H44A(+61+91) GAGAAACUGUUCAGCUUCUGUUAGCCACUGA Skippingat25nM 10 H44A(+65+90) UGUUCAGCUUCUGUUAGCCACUGA Skippingat10nM 219 H44A(+68+98) UCUUUCUGAGAAACUGUUCAGCUUCUGUUAG weakat50nM 220 H44A(09+17) CAGAUCUGUCAAAUCGCCUGCAGGUA Faintskippingto10nM 68 H44A(06+20) CAACAGAUCUGUCAAAUCGCCUGCAG Faintskippingto2.5nM 221 H44A(+56+88) AAACUGUUCAGCUUCUGUUAGCCACUGAUU Strongskippingat5nM AAA faint2.5nM 54 H44A(+59+85) CUGUUCAGCUUCUGUUAGCCACUGAUU Strongskippingat5nM 222 H44A(+59+89) GAAACUGUUCAGCUUCUGUUAGCCACUGAUU Faintskippingto10nM 223 H44A(+61+88) AAACUGUUCAGCUUCUGUUAGCCACUGA Faintskippingto25nM 224 H44A(+65+92) UGAGAAACUGUUCAGCUUCUGUUAGCCA Faintskippingto25nM 225 H44A(+64+95) UUCUGAGAAACUGUUCAGCUUCUGUUAGCCAC Faintskippingto25nM 226 H44A(+70+95) UUCUGAGAAACUGUUCAGCUUCUGUU Faintskippingto50nM
Antisense Oligonucleotides Directed at Exon 45

(230) Antisense oligonucleotides directed at exon 45 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 14 and FIG. 40.

(231) TABLE-US-00037 TABLE34 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 45skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon45 Sequence skipping 227 H45A(14+25) GCUGCCCAAUGCCAUCCUGGAGUUCCUGUA Generatesmultiplebands AG 228 H45A(10+20) CCAAUGCCAUCCUGGAGUUCCUGUAAGAUA Skippingat10nM 229 H45A(09+30) UUGCCGCUGCCCAAUGCCAUCCUGGAGUUC NoSkipping CUGUAAGAU 11 H45A(09+25) GCUGCCCAAUGCCAUCCUGGAGUUCCUGUA Skippingat10nM(100% AGAU skippingat25nM) 230 H45A(08+19) CAAUGCCAUCCUGGAGUUCCUGUAAGA Skippingat50nM 231 HM45A(07+25) GCUGCCCAAUGCCAUCCUGGAGUUCCUGUA Skippingat25nM AG 232 H45A(+09+34) CAGUUUGCCGCUGCCCAAUGCCAUCC NoSkipping 233 H45A(+41+64) CUUCCCCAGUUGCAUUCAAUGUUC NoSkipping 234 H45A(+76+98) CUGGCAUCUGUUUUUGAGGAUUG NoSkipping 235 H45D(+0218) UUAGAUCUGUCGCCCUACCU NoSkipping 236 H45A(14+25) GCUGCCCAAUGCCAUCCUGGAGUUCCUGUA AGAUACCAA 237 H45A(12+22) GCCCAAUGCCAUCCUGGAGUUCCUGUAAGA Strongskippingat5nM UACC faint2.5nM 238 H45A(12+13) CAUCCUGGAGUUCCUGUAAGAUACC Noskipping 66 H45A(12+16) UGCCAUCCUGGAGUUCCUGUAAGAUACC Strongskippingat25nM faint5nM 65 H45A(09+16) UGCCAUCCUGGAGUUCCUGUAAGAU skippingto10nM 64 H45A(09+19) CAAUGCCAUCCUGGAGUUCCUGUAAGAU Strongskippingat25nM faint2.5nM 239 H45A(09+22) GCCCAAUGCCAUCCUGGAGUUCCUGUAAGAU Strongskippingat10nM faint5nM 240 H45A(09+30) UUGCCGCUGCCCAAUGCCAUCCUGGAGUUC Strongskippingat5nM CUGUAAGAU faint2.5nM 241 HM45A(07+25) GCUGCCCAAUGCCAUCCUGGAGUUCCUGUA Strongskippingat2.5nM AG 242 H45A(06+22) GCCCAAUGCCAUCCUGGAGUUCCUGUAA Strongskippingat5nM faint2.5nM 243 H45A(06+28) GCCGCUGCCCAAUGCCAUCCUGGAGUUCCU Strongskippingat2.5nM GUAA 63 H45A(03+19) CAAUGCCAUCCUGGAGUUCCUG Strongskippingat5nM faint2.5nM 244 H45A(03+22) GCCCAAUGCCAUCCUGGAGUUCCUG Strongskippingat10nM faint2.5nM 55 H45A(03+25) GCUGCCCAAUGCCAUCCUGGAGUUCCUG Strongskippingat2.5nM 245 H45A(03+28) GCCGCUGCCCAAUGCCAUCCUGGAGUUCCUG Strongskippingat10nM faint2.5nM 246 H45D(+1019) AUUAGAUCUGUCGCCCUACCUCUUUUUUC Noskipping 247 H45D(+1611) UGUCGCCCUACCUCUUUUUUCUGUCUG Noskipping 61 H45A(06+25) GCUGCCCAAUGCCAUCCUGGAGUUCCUGUAA strongskippingat2.5nM 62 H45A(12+19) CAAUGCCAUCCUGGAGUUCCUGUAAGAUACC strongskippingat25nM
Antisense Oligonucleotides Directed at Exon 46

(232) Antisense oligonucleotides directed at exon 46 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 15 and FIG. 44.

(233) TABLE-US-00038 TABLE35 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 46skipping Antisense Oligonucleotidename Abilitytoinduce SEQ Exon46 Sequence skipping 248 H46A(05+19) AUUCUUUUGUUCUUCUAGCCUGGA Noskipping 249 H46A(+16+42) UCUCUUUGAAAUUCUGACAAGAUAUUC skippingto25nM,other bands 250 H46A(+27+44) UUAAAUCUCUUUGAAAUUCU Noskipping 251 H46A(+35+60) AAAACAAAUUCAUUUAAAUCUCUUUG veryfaintskippingto50nM 252 H46A(+56+77) CUGCUUCCUCCAACCAUAAAAC Noskipping 253 H46A(+63+87) GCAAUGUUAUCUGCUUCCUCCAACC Noskipping 12 H46A(+81+109) UCCAGGUUCAAGUGGGAUACUAGCAAUGU strongskippingat25nM 254 H46A(+83+103) UUCAAGUGGGAUACUAGCAAU skippingat25nM 255 H46A(+90+109) UCCAGGUUCAAGUGGGAUAC noskipping 256 H46A(+91+118) CUGCUCUUUUCCAGGUUCAAGUGGGAUA strongskippingat25nM 257 H46A(+95+122) GUUGCUGCUCUUUUCCAGGUUCAAGUGG strongskippingat25nM 258 H46A(+101+128) CUUUUAGUUGCUGCUCUUUUCCAGGUUC strongskippingat25nM 259 H46A(+113+136) AAGCUUUUCUUUUAGUUGCUGCUC skippingat100nM 260 H46A(+115+134) GCUUUUCUUUUAGUUGCUGC skippingat100nM 261 H46A(+116+145) GACUUGCUCAAGCUUUUCUUUUAGUUGCUG strongskippingat25nM 262 H46D(+0218) UUCAGAAAAUAAAAUUACCU noskipping 56 H46A(+93+122) GUUGCUGCUCUUUUCCAGGUUCAAGUGGGA 100%skippingat25nM strongat5nM 263 H46A(+95+124) UAGUUGCUGCUCUUUUCCAGGUUCAAGUGG 100%skippingat25nM
Antisense Oligonucleotide Cocktails Directed at Exons 44 to 46

(234) Antisense oligonucleotide cocktails directed at exons 44 to 46 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(235) TABLE-US-00039 TABLE36 Antisensemoleculesequencecocktailsthatinduceexon44to45skipping SEQ AntisenseOligonucleotide Abilityto ID name Sequence induceskipping Cocktailsforskipping44+ 45 10& H44A(+65+90) AGAAACUGUUCAGCUUCUGUUAGCCA Skippingat25nM 228 H45A(10+20) CCAAUGCCAUCCUGGAGUUCCUGUAAGAUA Cocktailsforskippingexons 45and46 228& H45A(10+20) CCAAUGCCAUCCUGGAGUUCCUGUAAGAUA Skippingat25nM 256 H46A(+91+118) CUGCUCUUUUCCAGGUUCAGGUGGGAUA 228& H45A(10+20) CCAAUGCCAUCCUGGAGUUCCUGUAAGAUA Skippingat25nM 264 H46A(+107+137) CAAGCUUUUCUUUUAGUUGCUGCUCUUUUCC Cocktailforskippingexon 44/45/46 228, H45A(10+20) CCAAUGCCAUCCUGGAGUUCCUGUAAGAUA Skippingat25nM 10& H44A(+65+90) AGAAACUGUUCAGCUUCUGUUAGCCA 256 H46A(+91+118) CUGCUCUUUUCCAGGUUCAGGUGGGAUA
Antisense Oligonucleotides Directed at Exon 47

(236) Antisense oligonucleotides directed at exon 47 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 16.

(237) TABLE-US-00040 TABLE37 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 47skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon47 Sequence skipping 265 H47A(07+19) GCAACUCUUCCACCAGUAACUGAAAC Skippingat100nM 13 H47A(+01+29) UGGCGCAGGGGCAACUCUUCCACCAGUAA strongskippingat25nM 266 H47A(+44+70) GCACGGGUCCUCCAGUUUCAUUUAAUU Skippingat600nM 267 H47A(+68+92) GGGCUUAUGGGAGCACUUACAAGCA Noskipping 268 H47A(+73+103) CUUGCUCUUCUGGGCUUAUGGGAGCACUUAC Noskipping 269 H47A(+76+103) CUUGCUCUUCUGGGCUUAUGGGAGCACU Faintskippingat200nM, fulllengthproductnot reduced 270 H47D(+1710) AAUGUCUAACCUUUAUCCACUGGAGAU Noskipping
Antisense Oligonucleotides Directed at Exon 48

(238) Antisense oligonucleotides directed at exon 48 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 17.

(239) TABLE-US-00041 TABLE38 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 48skipping SEQ AntisenseOligonucleotide Abilitytoinduce ID name Sequence skipping Exon48 271 H48A(09+21) CUCAGGUAAAGCUCUGGAAACCUGAAAGGA Noskipping 272 H48A(08+19) CAGGUAAAGCUCUGGAAACCUGAAAGG Noskipping 273 H48A(07+23) UUCUCAGGUAAAGCUCUGGAAACCUGAAAG Skippingat600,300nM 274 H48A(05+25) GUUUCUCAGGUAAAGCUCUGGAAACCUGAA Noskipping 44 H48A(+01+28) CUUGUUUCUCAGGUAAAGCUCUGGAAAC faintto50nM 275 H48A(+07+33) UUCUCCUUGUUUCUCAGGUAAAGCUCU faintto50nM 45 H48A(+40+67) CAAGCUGCCCAAGGUCUUUUAUUUGAGC Noskipping(sporadic) 276 H48A(+75+100) UUAACUGCUCUUCAAGGUCUUCAAGC faintto1000nM 277 H48A(+96+122) GAUAACCACAGCAGCAGAUGAUUUAAC Noskipping 278 H48D(+1710) AGUUCCCUACCUGAACGUCAAAUGGUC Noskipping 279 H48D(+1609) GUUCCCUACCUGAACGUCAAAUGGU Noskipping Cocktail48 44& H48A(+01+28) CUUGUUUCUCAGGUAAAGCUCUGGAAAC Strongskippingat25nM 45 H48A(+40+67) CAAGCUGCCCAAGGUCUUUUAUUUGAGC
Antisense Oligonucleotides Directed at Exon 49

(240) Antisense oligonucleotides directed at exon 49 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 18.

(241) TABLE-US-00042 TABLE39 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 49skipping AntisenseOligonucleotide SEQ name Abilitytoinduce ID Exon49 Sequence skipping 280 H49A(07+19) GAACUGCUAUUUCAGUUUCCUGGGGA Skippingto100nM 281 H49A(+22+47) AUCUCUUCCACAUCCGGUUGUUUAGC Skippingto25nM 14 H49A(+45+70) ACAAAUGCUGCCCUUUAGACAAAAUC Skippingto25nM 282 H49D(+1808) UUCAUUACCUUCACUGGCUGAGUGGC Skippingto100nM
Antisense Oligonucleotides Directed at Exon 50

(242) Antisense oligonucleotides directed at exon 50 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIGS. 19 and 33.

(243) TABLE-US-00043 TABLE40 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 50skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon50 Sequence skipping 283 H50A(07+20) CUCAGAUCUUCUAACUUCCUCUUUAAC Faintskipping25nM 284 H50A(02+27) CUCAGAGCUCAGAUCUUCUAACUUCCUCU faintskipping100nM 285 H50A(+10+36) CGCCUUCCACUCAGAGCUCAGAUCUUC skippingfaintlyto25 286 H50A(+35+61) UCAGCUCUUGAAGUAAACGGUUUACCG strongskippingto25nM 287 H50A(+42+68) UUUGCCCUCAGCUCUUGAAGUAAACGG reasonableskippingto25nM 15 H50A(+48+74) GGCUGCUUUGCCCUCAGCUCUUGAAGU strongskippingat25nM 288 H50A(+63+88) CAGGAGCUAGGUCAGGCUGCUUUGCC strongskippingto25nM 289 H50A(+81+105) UCCAAUAGUGGUCAGUCCAGGAGCU 290 H50D(0127) AAAGAGAAUGGGAUCCAGUAUACUUAC faintskipping100nM 291 H50D(1541) AAAUAGCUAGAGCCAAAGAGAAUGGGA Noskipping 292 H50A(+42+74) GGCUGCUUUGCCCUCAGCUCUUGAAGUAAA Strongskippingto10nM CGG faintat5nM 293 H50A(+46+75) AGGCUGCUUUGCCCUCAGCUCUUGAAGUAA Strongskippingto25nM faintat10nM 294 H50A(+48+78) GUCAGGCUGCUUUGCCCUCAGCUCUUGAAGU Strongskippingto10nM faintat2.5nM 295 H50A(+51+80) AGGUCAGGCUGCUUUGCCCUCAGCUCUUGA Strongskippingto25nM faintat2.5nM 296 Hint49(7246) AAGAUAAUUCAUGAACAUCUUAAUCCA Noskipping
Antisense Oligonucleotides Directed at Exon 51

(244) Antisense oligonucleotides directed at exon 51 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 20 and FIG. 41.

(245) TABLE-US-00044 TABLE41 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 51skipping AntisenseOligonucleotide SEQ name Abilitytoinduce ID Exon51 Sequence skipping 297 H51A(2910) UUUGGGUUUUUGCAAAAAGG Noskipping 298 H51A(2201) CUAAAAUAUUUUGGGUUUUUGC Noskipping 299 H51A(14+10) UGAGUAGGAGCUAAAAUAUUUUGG Noskipping 300 H51(+26+52) GUUUCCUUAGUAACCACAGGUUGUGUC veryfaintskippingto 25nM 301 H51A(+40+67) AGUUUGGAGAUGGCAGUUUCCUUAGUAA skippingto25nM alsoskips50or52a well 302 H51A(+66+77) UGGCAUUUCUAG Noskipping 303 H51A(+66+80) AGAUGGCAUUUCUAG Noskipping 304 H51A(+66+83) GGAAGAUGGCAUUUCUAG Noskipping 305 H51A(+78+95) CUCCAACAUCAAGGAAGA Noskipping 306 H51A(+81+95) CUCCAACAUCAAGGA Noskipping 307 H51A(+84+95) CUCCAACAUCAA Noskipping 308 H51A(+90+116) GAAAUCUGCCAGAGCAGGUACCUCCAA Noskipping 309 H51A(+53+79) GAUGGCAUUUCUAGUUUGGAGAUGGCA Strongskippingto25nM 310 H51A(+57+85) AAGGAAGAUGGCAUUUCUAGUUUGGAGAU Strongskippingto25nM faintat2.5nM 69 H51A(+71+100) GGUACCUCCAACAUCAAGGAAGAUGGCAUU Strongskippingto5nM 311 H51A(+76+104) AGCAGGUACCUCCAACAUCAAGGAAGAUG Strongskippingto25nM
Antisense Oligonucleotides Directed at Exon 52

(246) Antisense oligonucleotides directed at exon 52 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 42.

(247) TABLE-US-00045 TABLE42 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 52skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon52 Sequence skipping 312 H52A(12+13) CCUGCAUUGUUGCCUGUAAGAACAA Noskipping 313 H52A(10+10) GCAUUGUUGCCUGUAAGAAC Noskipping 314 H52A(+07+33) GGGACGCCUCUGUUCCAAAUCCUGCAU skippping50nM 315 H52A(+17+46) GUUCUUCCAACUGGGGACGCCUCUGUUCCA skippping25nM 316 H52A(+17+37) ACUGGGGACGCCUCUGUUCCA skippping25nM 317 H52A(+67+94) CCUCUUGAUUGCUGGUCUUGUUUUUCAA veyveryfaintskippingto 25nM 318 Hint51(4014) UACCCCUUAGUAUCAGGGUUCUUCAGC Noskipping(SNPCorT) 58 H52A(+09+38) AACUGGGGACGCCUCUGUUCCAAAUCCUGC Strongskippingto2.5nM 319 H52A(+09+41) UCCAACUGGGGACGCCUCUGUUCCAAAUCC Strongskippingto5nM UGC faintat5nM 320 H52A(+15+44) UCUUCCAACUGGGGACGCCUCUGUUCCAAA Strongskippingto10nM faintat5nM
Antisense Oligonucleotides Directed at Exon 53

(248) Antisense oligonucleotides directed at exon 53 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 43.

(249) TABLE-US-00046 TABLE 43 Antisense molecule sequences tested to determine if they induce exon 53 skipping Antisense SEQ Oligonucleotide name Ability to induce ID Exon 53 Sequence skipping 321 H53A(4926) AUA GUA GUA AAU GCU AGU CUG GAG No skipping 322 H53A(3813) GAA AAA UAA AUA UAU AGU AGU AAA UG No skipping 323 H53A(3206) AUA AAA GGA AAA AUA AAU AUA UAG UAG No skipping 324 H53A(15+15) UCU GAA UUC UUU CAA CUA GAA UAA AAG GAA No skipping 325 H53A(+39+65) CAA CUG UUG CCU CCG GUU CUG AAG GUG skippping 50 nM 326 H53A(+39+67) UUC AAC UGU UGC CUC CGG UUC UGA AGG UG skippping 100 nM 327 H39A(+39+69)SNP CGU UCA ACU GUU GCC UCC GGU UCU GAA GGU G skipping to 25 nM 328 H53A(+40+70) UCA UUC AAC UGU UGC CUC CGG UUC UGA AGG U skippping 50 nM 329 H53A(+41+69) CAU UCA ACU GUU GCC UCC GGU UCU GAA GG skippping 50 nM 330 H53A(+43+69) CAU UCA ACU GUU GCC UCC GGU UCU GAA skippping 50 nM 331 H53A(+69+98) CAG CCA UUG UGU UGA AUC CUU UAA CAU UUC Skipping at 50 nM 332 Hint52(4723) UAU AUA GUA GUA AAU GCU AGU CUG G No skipping 67 H53A(+27+56) CCU CCG GUU CUG AAG GUG UUC UUG UAC UUC strong skipping to 25 nM faint at 5 nM 333 H53A(+27+59) UUG CCU CCG GUU CUG AAG GUG UUC UUG UAC strong skipping to 10 nM UUC faint at 5 nM 334 H53A(+30+59) UUG CCU CCG GUU CUG AAG GUG UUC UUG UAC 335 H53A(+30+64) AAC UGU UGC CUC CGG UUC UGA AGG UGU UCU strong skipping to 25 nM UGU AC faint at 10 nM 336 H53A(+30+69) CAU UCA ACU GUU GCC UCC GGU UCU GAA GGU strong skipping to 25 nM GUU CUU GUA C faint at 5 nM 337 H53A(+33+63) ACU GUU GCC UCC GGU UCU GAA GGU GUU CUU G strong skipping to 25 nM faint at 5 nM 338 H53A(+33+67) UUC AAC UGU UGC CUC CGG UUC UGA AGG UGU strong skipping to 50 nM UCU UG faint at 5 nM 59 H53A(+33+65) CAA CUG UUG CCU CCG GUU CUG AAG GUG UUC strong skipping to 25 nM UUG faint at 2.5 nM 339 H53A(+35+67) UUC AAC UGU UGC CUC CGG UUC UGA AGG UGU strong skipping to 25 nM UCU 340 H53A(+37+67) UUC AAC UGU UGC CUC CGG UUC UGA AGG UGU U strong skipping to 25 nM 341 H53A(+36+70) UCA UUC AAC UGU UGC CUC CGG UUC UGA AGG reasonable sipping to 5 nM UGU UC 342 H53A(+39+71) UUC AUU CAA CUG UUG CCU CCG GUU CUG AAG strong skipping to 25 nM GUG 343 H53A(+42+71) UUC AUU CAA CUG UUG CCU CCG GUU CUG AAG strong skipping to 100 nM faint at 5 nM
Antisense Oligonucleotides Directed at Exon 54

(250) Antisense oligonucleotides directed at exon 54 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 21.

(251) TABLE-US-00047 TABLE44 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 54skipping SEQ Antisense Abilitytoinduce ID Oligonucleotidename Sequence skipping Exon54 344 H54A(+13+34) UUGUCUGCCACUGGCGGAGGUC Skippingat300nM bringsout55+ 54 345 H54A(+60+90) AUCUGCAGAAUAAUCCCGGAGAAGUUUCAG Skippingat25nM 346 H54A(+67+89) UCUGCAGAAUAAUCCCGGAGAAG Weakskippingto40nM- both54+ 55 16 H54A(+67+97) UGGUCUCAUCUGCAGAAUAAUCCCGGAGAAG Skippingat10nM 347 H54A(+77+106) GGACUUUUCUGGUAUCAUCUGCAGAAUAAU Skipping50nM CocktailforExons 54+ 55 16& H54A(+67+97) UGGUCUCAUCUGCAGAAUAAUCCCGGAGAAG Specificfor54&55 348 H55A(10+14) CUCGCUCACUCACCCUGCAAAGGA Skippingat10nM Noadditionalbands
Antisense Oligonucleotides Directed at Exon 55

(252) Antisense oligonucleotides directed at exon 55 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 22.

(253) TABLE-US-00048 TABLE45 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 55skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon55 Sequence skipping 348 H55A(10+14) CUCGCUCACUCACCCUGCAAAGGA NoSkipping 17 H55A(10+20) CAGCCUCUCGCUCACUCACCCUGCAAAGGA Skippingat10nM 349 H55A(+39+61) CAGGGGGAACUGUUGCAGUAAUC NoSkipping 350 H55A(+41+71) UCUUUUACUCCCUUGGAGUCUUCUAGGAGCC NoSkipping 351 H55A(+73+93) UCUGUAAGCCAGGCAAGAAAC NoSkipping 352 H55A(+107+137) CCUUACGGGUAGCAUCCUGAUGGACAUUGGC NoSkipping 353 H55A(+112+136) CUUACGGGUAGCAUCCUGUAGGACA veryweakskippingat100nM 354 H55A(+132+161) CCUUGGAGUCUUCUAGGAGCCUUUCCUUAC Skippingat200nM 355 H55A(+141+160) CUUGGAGUCUUCUAGGAGCC Skippingat100nM 356 H55A(+143+171) CUCUUUUACUCCCUUGGAGUCUUCUAGGAG Noskipping 357 H55D(+1109) CCUGACUUACUUGCCAUUGU Noskipping
Antisense Oligonucleotides Directed at Exon 56

(254) Antisense oligonucleotides directed at exon 56 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 23.

(255) TABLE-US-00049 TABLE46 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 56skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon56 Sequence skipping 358 H56A(06+23) GCUUCAAUUUCACCUUGGAGGUCCUACAG Skippingat25nM 359 H56A(06+15) UUCACCUUGGAGGUCCUACAG NoSkipping 360 H56A(+23+44) GUUGUGAUAAACAUCUGUGUGA Noskipping 361 H56A(+56+81) CCAGGGAUCUCAGGAUUUUUUGGCUG Noskipping 362 H56A(+67+91) CGGAACCUUCCAGGGAUCUCAGGAU Skippingat200nM 18 H56A(+92+121) CCAAACGUCUUUGUAACAGGACUGCAU skippingat25nM 363 H56A(+102+126) GUUAUCCAAACGUCUUUGUAACAGG skippingat100nM 364 H56A(+102+131) UUCAUGUUAUCCAAACGUCUUUGUAACAGG skippingat25nM 19 H56A(+112+141) CCACUUGAAGUUCAUGUUAUCCAAACGUCU skippingat25nM 365 H56A(+117+146) UCACUCCACUUGAAGUUCAUGUUAUCCAAA skippingweaklyat25nM 366 H56A(+121+143) CUCCACUUGAAGUUCAUGUUAUC NoSkipping 367 H56D(+1110) CUUUUCCUACCAAAUGUUGAG Skippingat600nM
Antisense Oligonucleotides Directed at Exon 57

(256) Antisense oligonucleotides directed at exon 57 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 24.

(257) TABLE-US-00050 TABLE47 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 57skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon57 Sequence skipping 368 H57A(15+18) CUGGCUUCCAAAUGGGACCUGAAAAAGAACAGC NoSkipping 369 H57A(12+18) CUGGCUUCCAAAUGGGACCUGAAAAAGAAC Skippingat50nM 20 H57A(10+20) AACUGGCUUCCAAAUGGGACCUGAAAAAGA Skippingat300nM 370 H57A(06+24) UCAGAACUGGCUUCCAAAUGGGACCUGAAA Skippingat300nM 371 H57A(+21+44) GGUGCAGACGCUUCCACUGGUCAG NoSkipping 372 H57A(+47+77) GCUGUAGCCACACCAGAAGUUCCUGCAGAGA NoSkipping 373 H57A(+79+103) CUGCCGGCUUAAUUCAUCAUCUUUC NoSkipping 374 H57A(+105+131) CUGCUGGAAAGUCGCCUCCAAUAGGUG NoSkipping
Antisense Oligonucleotides Directed at Exon 59

(258) Antisense oligonucleotides directed at exon 59 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 25.

(259) TABLE-US-00051 TABLE48 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 59skipping Antisense SEQ Oligonucleotidename Abilitytoinduce ID Exon59 Sequence skipping 375 H59A(06+16) UCCUCAGGAGGCAGCUCUAAAU Noskipping 376 H59A(+31+61) UCCUCGCCUGCUUUCGUAGAAGCCGAGUGA Noskipping 377 H59A(+66+91) AGGUUCAAUUUUUCCCACUCAGUAUU NoSkipping 23 H59A(+96+120) CUAUUUUUCUCUGCCAGUCAGCGGA Skippingat100nM 378 H59A(+96+125) CUCAUCUAUUUUUCUCUGCCAGUCAGCGGA Noskipping 379 H59A(+101+132) CAGGGUCUCAUCUAUUUUUCUCUGCCAGUCA Noskipping 380 H59A(+141+165) CAUCCGUGGCCUCUUGAAGUUCCUG Skippingexon 58&59at200nM 381 H59A(+151+175) AGGUCCAGCUCAUCCGUGGCCUCUU Skippingat300nM 382 H59A(+161+185) GCGCAGCUUGAGGUCCAGCUCAUCC weakskippingat 200nM 383 H59A(+161+190) GCUUGGCGCAGCUUGAGGUCCAGCUCAUCC Skippingat100nM 384 H59A(+171+197) CACCUCAGCUUGGCGCAGCUUGAGGUC Noskipping 385 H59A(+181+205) CCCUUGAUCACCUCAGCUUGGCGCA NoSkipping 386 H59A(+200+220) ACGGGCUGCCAGGAUCCCUUG NoSkipping 387 H59A(+221+245) GAGAGAGUCAAUGAGGAGAUCGCCC NoSkipping 388 H59A(+92+125) CUCAUCUAUUUUUCUCUGCCAGUCAGCGGAGUGC
Antisense Oligonucleotides Directed at Exon 60

(260) Antisense oligonucleotides directed at exon 60 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 26.

(261) TABLE-US-00052 TABLE49 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 60skipping SEQ Antisense Abilitytoinduce ID Oligonucleotidename Sequence skipping Exon60 389 H60A(10+20) GCAAUUUCUCCUCGAAGUGCCUGUGUGCAA noskipping 390 H60A(8+19) CAAUUUCUCCUCGAAGUGCCUGUGUGC noskipping 391 H60A(+29+58) CAAGGUCAUUGACGUGGCUCACGUUCUCUU skippingto50nM 24 H60A(+33+62) CGAGCAAGGUCAUUGACGUGGCUCACGUUC strongskippingto50nM 47 H60A(+37+66) CUGGCGAGCAAGGUCCUUGACGUGGCUCAC goodskippingat100nM 392 H60A(+37+66) CUGGCGAGCAAGGUCAUUGACGUGGCUCAC SNP 393 H60A(+39+66) CUGGCGAGCAAGGUCCUUGACGUGGCUC goodskippingat100nM 394 H60A(+43+73) UGGUAAGCUGGCGAGCAAGGUCCUUGACGUG weakskippingat100nM 395 H60A(+51+75) AGUGGUAAGCUGGCGUGCAAGGUCA weakskippingat100nM 396 H60A(+72+102) UUAUACGGUGAGAGCUGAAUGCCCAAAGUG noskipping 397 H60A(+75+105) GAGGUUAUACGGUGAGAGCUGAAUGCCCAAA noskipping 398 H60A(+80+109) UGCUGAGGUUAUACGGUGAGAGCUGAA goodskippingat100nM 46 H60A(+87+116) UCCAGAGUGCUGAGGUUAUACGGUGAGAGC weakskippingat100nM 399 H60D(+255) CUUUCCUGCAGAAGCUUCCAUCUGGUGUUC weakskippingat600nM Exon60cocktails 390 H60A(8+19) CAAUUUCUCCUCGAAGUGCCUGUGUGC weakskippingat10nM 392 H60A(+37+66) CUGGCGAGCAAGGUCCUUGACGUGGCUCAC 46& H60A(+87+116) UCCAGAGUGCUGAGGUUAUACGGUGAGAGC skippingat10nM 47 H60A(+37+66) CUGGCGAGCAAGGUCCUUGACGUGGCUCAC 389 H60A(10+20) GCAAUUUCUCCUCGAAGUGCCUGUGUGCAA skippingat10nM 394 H60A(+43+73) UGGUAAGCUGGCGAGCAAGGUCCUUGACGUG 393 H60A(+39+66) CUGGCGAGCAAGGUCCUUGACGUGGCUC skippingat10nM 389 H60A(10+20) GCAAUUUCUCCUCGAAGUGCCUGUGUGCAA
Antisense Oligonucleotides Directed at Exon 61

(262) Antisense oligonucleotides directed at exon 61 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(263) TABLE-US-00053 TABLE50 Antisensemoleculesequencestestedtodetermineiftheyinduceexon 61skipping AntisenseOligonucleotide SEQ name Abilitytoinduce ID Exon61 Sequence skipping 400 H61A(7+19) CUCGGUCCUCGACGGCCACCUGGGAG noskipping 401 H61A(+05+34) CAUGCAGCUGCCUGACUCGGUCCUCGCCGG skippingto50nM 25 H61A(+10+40) GGGCUUCAUGCAGCUGCCUGACUCGGUCCUC Skippingat100nM 402 H61A(+16+40) GGGCUUCAUGCAGCUGCCUGACUCG noskipping 403 H61A(+16+45) CCUGUGGGCUUCAUGCAGCUGCCUGACUCG skippingto50nM 404 H61A(+42+67) GCUGAGAUGCUGGACCAAAGUCCCUG noskipping 405 H61D(+1016) GCUGAAAAUGACUUACUGGAAAGAAA noskipping
Antisense Oligonucleotides Directed at Exon 62

(264) Antisense oligonucleotides directed at exon 62 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(265) TABLE-US-00054 TABLE 51 Antisense molecule sequences tested to determine if they induce exon 62 skipping Antisense Oligonucleotide SEQ name Ability to induce ID Exon 62 Sequence skipping 406 H62A(15+15) GAC CCU GGA CAG ACG CUG AAA AGA AGG GAG No skipping 407 H62A(10+20) CCA GGG ACC CUG GAC AGA CGC UGA AAA GAA No skipping 408 H62A(05+15) GAC CCU GGA CAG ACG CUG AA Faint to 25 nM 409 H62A(3+25) CUC UCC CAG GGA CCC UGG ACA GAC GCU G No skipping 410 H62A(+01+30) UGG CUC UCU CCC AGG GAC CCU GGA CAG ACG almost 100% skipping to 300 nM 411 H62A(+8+34) GAG AUG GCU CUC UCC CAG GGA CCC UGG Skipping at 300 nM 412 H62A(+13+43) UUG UUU GGU GAG AUG GCU CUC UCC CAG GGA C Faint to 25 nM 26 H62A(23+52) UAG GGC ACU UUG UUU GGC GAG AUG GCU CUC Skipping at 100 nM 413 H62D(+1703) UAC UUG AUA UAG UAG GGC AC Faint to 100 nM 414 H62D(+255) CUU ACU UGA UAU AGU AGG GCA CUU UGU UUG No skipping
Antisense Oligonucleotides Directed at Exon 63

(266) Antisense oligonucleotides directed at exon 63 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 27.

(267) TABLE-US-00055 TABLE 52 Antisense molecule sequences tested to determine if they induce exon 63 skipping Antisense SEQ Oligonucleotide name Ability to induce ID Exon 63 Sequence skipping 415 H63A(14+11) GAG UCU CGU GGC UAA AAC ACA AAA C No visible skipping 416 H63A(+11+35) UGG GAU GGU CCC AGC AAG UUG UUU G Possible skipping at 600 nM 27 H63A(+20+49) GAG CUC UGU CAU UUU GGG AUG GUC CCA GCA Skipping to 100 nM 417 H63A(+33+57) GAC UGG UAG AGC UCU GUC AUU UUG G No visible skipping 418 H63A(+40+62) CUA AAG ACU GGU AGA GCU CUG UC No Skipping 419 H63D(+817) CAU GGC CAU GUC CUU ACC UAA AGA C No visible skipping
Antisense Oligonucleotides Directed at Exon 64

(268) Antisense oligonucleotides directed at exon 64 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 28.

(269) TABLE-US-00056 TABLE 53 Antisense molecule sequences tested to determine if they induce exon 64 skipping Antisense Oligonucleotide SEQ name Ability to induce ID Exon 64 Sequence skipping 420 H64A(3+27) CUG AGA AUC UGA CAU UAU UCA GGU CAG CUG No skipping 28 H64A(+34+62) CUG CAG UCU UCG GAG UUU CAU GGC AGU CC Skipping at 50 nM 421 H64A(+43+72) AAA GGG CCU UCU GCA GUC UUC GGA GUU UCA Skipping at 50 nM 422 H64A(+47+74) GCA AAG GGC CUU CUG CAG UCU UCG GAG Skipping at 200 nM 423 H64D(+1510) CAA UAC UUA CAG CAA AGG GCC UUC U No skipping
Antisense Oligonucleotides Directed at Exon 65

(270) Antisense oligonucleotides directed at exon 65 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(271) TABLE-US-00057 TABLE 54 Antisense molecule sequences tested to determine if they induce exon 65 skipping Antisense Oligonucleotide Ability to SEQ name induce ID Exon 65 Sequence skipping 424 H65A(+123+148) UUG ACC AAA UUG UUG No skipping UGC UCU UGC UC
Antisense Oligonucleotides Directed at Exon 66

(272) Antisense oligonucleotides directed at exon 66 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 29.

(273) TABLE-US-00058 TABLE 55 Antisense molecule sequences tested to determine if they induce exon 66 skipping SEQ Antisense Oligonucleotide Ability to induce ID name Sequence skipping Exon 66 29 H66A(8+19) GAU CCU CCC UGU UCG UCC CCU AUU AUG Skipping at 100 nM 48 H66A(02+28) CAG GAC ACG GAU CCU CCC UGU UCG UCC CCU No skipping 49 H66D(+1317) UAA UAU ACA CGA CUU ACA UCU GUA CUU GUC No skipping Exon 66 cocktails 48 & H66A(02+28) CAG GAC ACG GAU CCU CCC UGU UCG UCC CCU skipping at 25 nM 49 H66D(+1317) UAA UAU ACA CGA CUU ACA UCU GUA CUU GUC
Antisense Oligonucleotides Directed at Exon 67

(274) Antisense oligonucleotides directed at exon 67 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 30.

(275) TABLE-US-00059 TABLE 56 Antisense molecule sequences tested to determine if they induce exon 67 skipping Antisense SEQ Oligonucleotide name Ability to induce ID Exon 67 Sequence skipping 30 H67A(+17+47) GCG CUG GUC ACA AAA UCC UGU UGA ACU UGC strong skipping at 25 nM 425 H67A(+120+147) AGC UCC GGA CAC UUG GCU CAA UGU UAC U No skipping 426 H67A(+125+149) GCA GCU CCG GAC ACU UGG CUC AAU G Skipping at 600 nM 427 H67D(+2208) UAA CUU ACA AAU UGG AAG CAG CUC CGG ACA No skipping
Antisense Oligonucleotides Directed at Exon 68

(276) Antisense oligonucleotides directed at exon 68 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 31.

(277) TABLE-US-00060 TABLE 57 Antisense molecule sequences tested to determine if they induce exon 68 skipping SEQ Antisense Oligonucleotide Ability to induce ID name Sequence skipping Exon 68 428 H68A(4+21) GAU CUC UGG CUU AUU AUU AGC CUG C Skipping at 100 nM 429 H68A(+22+48) CAU CCA GUC UAG GAA GAG GGC CGC UUC Skipping at 200 nM 50 H68A(+48+72) CAC CAU GGA CUG GGG UUC CAG UCU C Skipping at 200 nM 430 H68A(+74+103) CAG CAG CCA CUC UGU GCA GGA CGG GCA GCC No skipping 51 H68D(+2303) UAC CUG AAU CCA AUG AUU GGA CAC UC No skipping Exon 68 cocktails 50 & H68A(+48+72) CAC CAU GGA CUG GGG UUC CAG UCU C skipping at 10 nM 51 H68D(+2303) UAC CUG AAU CCA AUG AUU GGA CAC UC
Antisense Oligonucleotides Directed at Exon 69

(278) Antisense oligonucleotides directed at exon 69 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above. See FIG. 32 which shows a cocktail of H69A(+32+60) and H70A(06+18) to remove both exons 69 and 70.

(279) TABLE-US-00061 TABLE 58 Antisense molecule sequences tested to determine if they induce exon 69 skipping Antisense SEQ Oligonucleotide name Ability to induce ID Exon 69 Sequence skipping 431 H69A(12+19) GUG CUU UAG ACU CCU GUA CCU GAU AAA GAG C No skipping 432 H69A(+09 +39) UGG CAG AUG UCA UAA UUA AAG UGC UUU AGAC Skipping 68-71 at 200 nM 433 H69A(+29 +57) CCA GAA AAA AAG CAG CUU UGG CAG AUG UC Skipping 68-71 at 200 nM also 68 +69 & 69 +70 434 H69A(+51+74) GGC CUU UUG CAA CUC GAC CAG AAA Skipping 68-71 435 H69A(+51 +80) UUU UAU GGC CUU UUG CAA CUC GAC CAG AAA ~90% Skipping of 68-71 at 200 nM 436 H69D(+0816) CUG GCG UCA AAC UUA CCG GAG UGC no skipping
Antisense Oligonucleotides Directed at Exon 70

(280) Antisense oligonucleotides directed at exon 70 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(281) TABLE-US-00062 TABLE 59 Antisense molecule sequences tested to determine if they induce exon 70 skipping Antisense Oligonucleotide SEQ name Ability to induce ID Exon 70 Sequence skipping 437 H70A(09+15) UUC UCC UGA UGU AGU CUA AAA GGG no skipping 438 H70A(07 +23) CGA ACA UCU UCU CCU GAU GUA GUC UAA AAG No skipping 439 H70A(+16 +40) GUA CCU UGG CAA AGU CUC GAA CAU C No skipping 440 H70A(+25 +48) GUU UUU UAG UAC CUU GGC AAA GUC No Skipping 441 H70A(+32+60) GGU UCG AAA UUU GUU UUU UAG UAC CUU GG No skipping 442 H70A(+64 +93) GCC CAU UCG GGG AUG CUU CGC AAA AUA CCU No skipping
Antisense Oligonucleotides Directed at Exon 71

(282) Antisense oligonucleotides directed at exon 71 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(283) TABLE-US-00063 TABLE 60 Antisense molecule sequences tested to determine if they induce exon 71 skipping SEQ Antisense Oligonucleotide name Ability to induce ID Exon 71 Sequence skipping 443 H71A(08+16) GAU CAG AGU AAC GGG ACU GCA AAA 444 H71A(+07+30) ACU GGC CAG AAG UUG AUC AGA GUA weak skipping at 100 nM 445 H71A(+16+39) GCA GAA UCU ACU GGC CAG AAG UUG skipping at 100 nM 446 H71D(+1905) CUC ACG CAG AAU CUA CUG GCC AGA
Antisense Oligonucleotides Directed at Exon 72

(284) Antisense oligonucleotides directed at exon 72 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(285) TABLE-US-00064 TABLE 61 Antisense molecule sequences tested to determine if they induce exon 72 skipping Antisense SEQ Oligonucleotide name Ability to induce ID Exon 72 Sequence skipping 447 H72A(8+22) AAG CUG AGG GGA CGA GGC AGG CCU AUA AGG faint skipping at 600 nM 448 H72A(+02+28) GUG UGA AAG CUG AGG GGA CGA GGC AGG no skipping 449 H72D(+1410) AGU CUC AUA CCU GCU AGC AUA AUG no skipping
Antisense Oligonucleotides Directed at Exon 73

(286) Antisense oligonucleotides directed at exon 73 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(287) TABLE-US-00065 TABLE 62 Antisense molecule sequences tested to determine if they induce exon 73 skipping Antisense Oligonucleotide SEQ name Ability to induce ID Exon 73 Sequence skipping 450 H73A(+24+49) AUG CUA UCA UUU AGA UAA GAU CCA U weak skipping 451 H73A(16+10) UUC UGC UAG CCU GAU AAA AAA CGU AA Faint to 25 nM 60 H73A(+02+26) CAU UGC UGU UUU CCA UUU CUG GUA G Strong to 25 nM 452 H73D(+2302) ACA UGC UCU CAU UAG GAG AGA UGC U Skipping to 25 nM 453 HM73A(+19+44) UAU CAU UUA GAU AAG AUC CAU UGC UG Faint skipping to 25 nM
Antisense Oligonucleotides Directed at Exon 74

(288) Antisense oligonucleotides directed at exon 74 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(289) TABLE-US-00066 TABLE 66 Antisense molecule sequences tested to determine if they induce exon 74 skipping SEQ Antisense Ability to induce ID Oligonucleotide name Sequence skipping 454 HM74A(+20+46) GUU CAA ACU UUG GCA GUA AUG CUG GAU skipping 25 nM 455 HM74A(+50+77) GAC UAC GAG GCU GGC UCA GGG GGG AGU C 100% skipping at 25 nM 456 HM74A(+96+122) GCU CCC CUC UUU CCU CAC UCU CUA AGG skipping 25 nM
Antisense Oligonucleotides Directed at Exon 76

(290) Antisense oligonucleotides directed at exon 76 were prepared and tested for their ability to induce exon skipping in human muscle cells using similar methods as described above.

(291) TABLE-US-00067 TABLE 63 Antisense molecule sequences tested to determine if they induce exon 76 skipping Antisense Oligonucleotide SEQ name Ability to induce ID Exon 76 Sequence skipping 457 H76A(02+25) CAU UCA CUU UGG CCU CUG CCU GGG GCU no detectable skipping 458 H76A(+80+106) GAC UGC CAA CCA CUC GGA GCA GCA UAG no detectable skipping

(292) Modifications of the above-described modes of carrying out the various embodiments of this invention will be apparent to those skilled in the art based on the above teachings related to the disclosed invention. The above embodiments of the invention are merely exemplary and should not be construed to be in any way limiting.