Diagnosis and treatment of MERS-related renal disease
10782303 ยท 2020-09-22
Assignee
Inventors
- Man-Lung Yeung (Hong Kong, CN)
- Jasper Fuk-Woo Chan (Kowloon, CN)
- Johnson Yiu-Lam Lau (Newport Beach, CA, US)
- Kwok Yung Yuen (Pokfulam, HK)
Cpc classification
A61K31/7088
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
C12Q2600/112
CHEMISTRY; METALLURGY
G01N2800/52
PHYSICS
A61K31/713
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
C07K16/22
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
G01N2800/347
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
A61K31/7105
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
C07K16/22
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Methods for treating, diagnosing, and providing prognostic information for kidney disease related to MERS-CoV infection are described. Transcription and translation products (for example, mRNA or peptides) of FGF2, Smad7, and/or sequences upstream of FGF2 are useful as markers that indicate kidney disease and/or provide prognostic information related to the course of kidney disease related to MERS-CoV infection. Such kidney disease can be treated and/or mitigated by reducing the availability of FGF2, Smad7, and/or a sequence upstream from FGF2 by reducing and/or regulating transcription and by sequestering related peptides using a large molecule binding partner, such as an antibody. Sequences for useful siRNAs and antisense oligonucleotides are provided.
Claims
1. A method of preventing renal disease associated with MERS-CoV infection, comprising reducing bioavailability of FGF2 or Smad7 in an individual infected with MERS-CoV, wherein a reduction of bioavailability is achieved by at least one of reducing gene expression and reducing bioavailability of a product of gene expression.
2. The method of claim 1, further comprising a step of reducing expression a gene encoding for FGF2 or Smad7.
3. The method of claim 1, further comprising a step of administering a polynucleotide that interferes with transcription or translation of FGF2 or Smad7.
4. The method of claim 1, further comprising a step of administering a compound that interacts with a regulatory element that regulates transcription of FGF2 or Smad7.
5. The method of claim 1, further comprising a step of adminstering a compound that interacts with a regulatory pathway that regulates transcription of FGF2 or Smad7.
6. The method of claim 1, wherein bioavailability is reduced by administration of a binding partner with an affinity for a polypeptide corresponding to FGF2 or Smad7.
7. A method of treating renal disease associated with MERS-CoV infection, comprising reducing bioavailability of FGF2 or Smad7 in an individual infected with MERS-CoV, wherein a reduction of bioavailibility is achieved by at least one of reducing gene expression and reducing bioavailability of a product gene expression.
8. The method of claim 7, further comprising a step of reducing expression of a gene encoding FGF2 or Smad7.
9. The method of claim 7, further comprising a step of administering a polynucleotide that interferes with transcription or translation of FGF2 or Smad7.
10. The method of claim 7, further comprising a step of administering a compound that interacts with a regulatory element that regulates transcription of FGF2 or Smad7.
11. The method of claim 7, furhter comprising a step of administering a compound that interacts with a regulatory pathway that regulates transcription of FGF2 or Smad7.
12. The method of claim 7, wherein bioavailability is reeduced by administration of a binding partner with an affinity for FGF2 or Smad7.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DETAILED DESCRIPTION
(21) The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.
(22) The inventive subject matter provides apparatus, systems and methods in which methods and compositions are provided in which characterization the expression of FGF2, Smad7, and/or sequences upstream from FGF2 is utilized in the diagnosis and/or evaluation of the prognosis of MERS-related kidney disease, where overexpression is associated with renal and/or pulmonary disease. In other embodiments of the inventive concept inhibition of the expression and/or activity of FGF2 and/or Smad7 is(are) utilized for treatment and/or prevention of renal and/or pulmonary disease resulting from infection with MERs coronavirus.
(23) One should appreciate that the disclosed techniques provide many advantageous technical effects, including identification of a therapeutic modality that is effective in preventing illness and/or death due to apoptotic activity in kidney cells following MERS infection. Moreover, as the inventors observed similar mechanisms in lung cells, it is contemplated that lung damage due to MERS viruses may also be reduced or even eliminated.
(24) The following discussion provides many example embodiments of the inventive subject matter. Although each embodiment represents a single combination of inventive elements, the inventive subject matter is considered to include all possible combinations of the disclosed elements. Thus if one embodiment comprises elements A, B, and C, and a second embodiment comprises elements B and D, then the inventive subject matter is also considered to include other remaining combinations of A, B, C, or D, even if not explicitly disclosed.
(25) The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value with a range is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g. such as) provided with respect to certain embodiments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
(26) Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
(27) Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
(28) It should be apparent to those skilled in the art that many more modifications besides those already described are possible without departing from the inventive concepts herein. The inventive subject matter, therefore, is not to be restricted except in the spirit of the appended claims. Moreover, in interpreting both the specification and the claims, all terms should be interpreted in the broadest possible manner consistent with the context. In particular, the terms comprises and comprising should be interpreted as referring to elements, components, or steps in a non-exclusive manner, indicating that the referenced elements, components, or steps may be present, or utilized, or combined with other elements, components, or steps that are not expressly referenced. Where the specification claims refers to at least one of something selected from the group consisting of A, B, C . . . and N, the text should be interpreted as requiring only one element from the group, not A plus N, or B plus N, etc.
(29) One embodiment of the inventive concept includes methods useful in identifying diagnostic and/or therapeutic targets for renal and/or pulmonary disease due to MERS coronavirus infection. In such embodiments the transcription patterns of proteins in MERS-infected cells are characterized to identify proteins/peptides and/or families of proteins/peptides that can be used to predict, diagnose, mitigate, and/or prevent the kidney-damaging effects of MERS infection. In order to characterize host response to MERS-CoV infection, the transcriptomic profiles of polarized human bronchial epithelial Calu-3 cells infected with MERS-CoV can be compared to those of cells from the same cell line that are infected with severe acute respiratory syndrome coronavirus (SARS-CoV). Typical results of such studies are shown in
(30) Although detection of MERS-CoV RNA in the urine of infected patients has been reported, direct in vivo evidence of MERS-CoV infection of the kidneys has not previously been reported. One embodiment of the inventive concept is ex vivo human kidney culture model for characterization of the effects of infection with a virus (for example, a coronavirus). In some such embodiments the coronavirus is a MERS coronavirus. The inventors contemplate that other human organ cultures (for example, human lung cultures) can also serve as models for human infection with cornaviruses (for example, a SARS coronavirus strain and/or a MERS coronavirus strain). Embodiments of the inventive concept using human kidney culture demonstrate that kidney cells in such a culture can be readily infected by MERS-CoV. This is shown in the lower panel of
(31) More particularly,
(32) The upper panel
(33) The lower panels of
(34) Another embodiment of the inventive concept is the use of cultured cells derived from kidneys in characterization of genetic and protein/peptide markers associated with MERS-CoV infection and the prognosis of such an infection.
(35) Another embodiment of the inventive concept is the use of markers associated with apoptosis in the diagnosis and/or estimation of the prognosis of kidney disease in an individual with a MERS-CoV infection. Based on findings in transcriptomic and ex vivo studies, the inventors hypothesize that MERS-CoV induce renal failure through the induction of apoptosis, a major form of cell death. Presence of cellular proteins typical of apoptosis can be determined utilizing an immunological assay or staining method.
(36) As shown above, transcriptomic data indicates that the biological pathways related to renal necrosis/cell death are severely perturbed in MERS-CoV-infected cells (see
(37) More particularly,
(38) In some embodiments of the inventive concept of reduction of the expression and/or functionality of proteins identified by the transcriptomic approach is utilized as a therapeutic modality in the treatment of MERS infection. The identification of Smad7 and FGF2 as mediators of MERS-CoV pathogenesis indicates that either or both can serve as therapeutic targets. It is notable that Smad7 is located upstream of FGF2, and in some embodiments sequences upstream of FGF2 are utilized as therapeutic targets. Similarly, indications of over-expression of Smad7 and/or FGF2 can serve as diagnostic and/or prognostic indicators of the presence and/or extent of renal and/or pulmonary disease associated with MERS-CoV infection. The inventors have found that compromising Smad7 and expression can subvert MERS virus-induced damage. In one embodiment expression of such apoptosis associated proteins can be reduced using siRNA. Typical results in HK2 cells show that reduction of expression can be accomplished using siRNAs against such markers (e.g. siSmad7-1 (SEQ ID NO. XXX) and siSmad7-2 (SEQ ID NO. YYY)). In such studies the expression of Smad7 was typically reduced by 75% and 40% (p<0.05) at protein (
(39)
(40) In some embodiments of the inventive concept, modification of the expression of FGF2, Smad7, and/or sequences upstream from FGF2 can be used to prevent, reduce, or eliminate kidney and/or lung damage resulting from MERS-CoV infection, for example by reducing MERS-CoV induced apoptosis. The impact of modifying Smad7 expression on MERS-CoV-induced apoptosis can be determined by characterizing expression of activity of an apoptosis marker, such as caspase-3. For example, as shown in the left panel of
(41) In other embodiments, small molecules that can impact expression and/or activity of Smad7 and/or FGF2 (such as tyrphostin AG1296 and/or NSC37204) can be utilized to prevent, reduce, and/or eliminate apoptosis-inducing effects of MERS-CoV infection. The left panel of
(42) In still other embodiments a large molecule inhibitor and/or sequestering agent (for example a specific antibody or aptamer) directed to FGF2, Smad7, or a molecule expressed upstream from FGF2 can be used to prevent, reduce, and/or eliminate damage to kidney or lung tissue associated with MERS-CoV infection. As shown in the right panel of
(43) Overall, in some embodiments of the inventive concept apoptic events in kidney and/or lung tissue resulting from MERS-CoV infection can be prevented, reduced, and/or eliminated by reducing the expression or functionality of FGF2, Smad7, and or products expressed upstream from FGF2. Such reduction in expression of activity can be accomplished by genetic means (e.g. use of siRNA, antisense, and/or other oligonucleotides), small molecules (e.g. low molecular weight inhibitory compounds), and/or sequestration and/or inhibition by large molecules (such as antibodies). The effectiveness of different approaches to reduction in active FGF2, Smad7, and sequences upstream of FGF2, where such approaches are directed at different levels of achieving such activity, is indicative of this being a general phenomena that is not limited to a specific class of molecules and/or mechanism of action.
(44) In another embodiment of the inventive concept, reduction of FGF2 and/or Smad7 expression or functionality can be utilized to reduce replication and/or spread of MERS-CoV virus. It should be appreciated that, in addition to resulting in the immediate problem of kidney and/or lung damage, MERS-CoV promotion of apoptosis in infected cells can serve to spread virus progeny to neighboring cells. In some embodiments of the inventive concept disruption of the apoptosis process induced by MERS-CoV infection (as detailed above) can also serve to interrupt the highly lytic MERS-CoV replication cycle, thereby reducing or halting the spread of the virus to adjacent, uninfected cells. For example, treatment of HK2 and Calu-3 cells with an anti-Smad7 oligonucleotide (such as GTCGCCCCTTCTCCCCGCAG (SEQ ID NO. 9)) before challenging with MERS-CoV provides a dose-dependent reduction in apoptosis. An MTT assay shows that anti-Smad7 oligo protected 50% of cells from MERS-CoV-induced apoptosis at a concentration of 0.432 g/ml and 0.965 g/ml in HK2 and Calu-3 cells, respectively (see
(45) Correlation between such in vitro studies and actual MERS infection have been confirmed using a non-human primate animal model that recapitulates the severe and sometimes lethal respiratory symptoms with disseminated extra-pulmonary infection seen in MERS-infected patients and closely resembles the clinical profile of human patients. In a typical study a group of 6 common marmosets was challenged with MERS-CoV. All MERS-CoV-inoculated common marmosets developed acute respiratory distress syndrome (ARDS), with one death due to severe illness. MER-CoV infection was confirmed by the detection of viral RNA and antigen in all lung samples collected from MERS-CoV-inoculated common marmosets (
(46) In more detail,
(47)
(48) Notably, in such studies viral RNA and antigen were also detected in 4 of 6 kidney samples (
(49) As noted above, in some embodiments of the inventive concept characterization of Smad7 and/or FGF2 expression can be utilized to diagnose renal disease associated with MERS-CoV infection. In such an embodiment expression can be characterized in terms of nucleotide expression and/or protein expression. Nucleotide expression (e.g. mRNA expression) of Smad7 and/or FGF2 can be performed by any suitable technique, including RT-PCR, real time RT-PCR, and direct hybridization. Protein expression (e.g. detection of intra- or extra-cellular Smad7 and/or FGF2) can be performed by any suitable method, including immunological assays (such as EIA, RIA, and/or FIA), immunofluorescent staining, FACS, and so on. Such protein expression techniques can be applied to any suitable sample, such as whole blood, plasma, serum, saliva, lacrimal fluid, synovial fluid, mucus, interstitial fluids, and/or tissue samples. Results of such nucleotide and/or protein expression studies can be quantitative or non-quantitative, and in some embodiments can be performed on an automated system.
(50) In other embodiments of the inventive concept characterization of Smad7 and/or FGF2 expression is utilized in a prognostic fashion to characterize a stage of renal disease associated with MERS-CoV infection or to provide a clinician with insight into the probable course of such disease. In such an embodiment expression can be characterized in terms of nucleotide expression and/or protein expression. Nucleotide expression (e.g. mRNA expression) of Smad7 and/or FGF2 can be performed by any suitable technique, including RT-PCR, real time RT-PCR, and direct hybridization. Protein expression (e.g. detection of intra- or extra-cellular Smad7 and/or FGF2) can be performed by any suitable method, including immunological assays (such as EIA, RIA, and/or FIA), immunofluorescent staining, FACS, and so on. S Such protein expression techniques can be applied to any suitable sample, such as whole blood, plasma, serum, saliva, lacrimal fluid, synovial fluid, mucus, interstitial fluids, and/or tissue samples Results of such nucleotide and/or protein expression studies can be quantitative or non-quantitative, and in some embodiments can be performed on an automated system.
(51) In another embodiment of the inventive concept, methods and compositions that reduce the expression and/or the effective expression of FGF2, Smad7, and/or sequences that are upstream of FGF2 are used to reduce or eliminate renal failure resulting from MERS-CoV infection. In some embodiments this reduction in expression is accomplished at the transcription level, for example by treatment with siRNA, RNAi, and antisense polynucleotides that interfere with effective transcription and/or translation of FGF2, Smad7, and/or a sequence upstream from FGF2. In other embodiments of the inventive concept peptides, proteins, and/or small (i.e. less than about 500 D) molecule that interact with regulatory regions associated with FGF2, Smad7, and/or sequences upstream from FGD2 are used to inhibit or reduce transcription of these sequences.
(52) In still further contemplated aspects of the inventive subject matter, the inventors also contemplate that drugs that inhibit or reduce apoptosis can be used (alone or in combination with the treatment modalities presented herein) to reduce or abrogate lung and/or kidney cell damage for MERS infected cells. For example, contemplated drugs include Kaletra (a combination of lopinavir/ritonavir) or other drugs with anti-apoptotic effects including antioxidants, cell cycle inhibitors, BAX inhibitors, caspase-3 inhibitors, PARP inhibitors, or GSK3 inhibitors.
(53) In other embodiments of the inventive concept, renal disease associated with MERS-CoV infection can be reduced or eliminated by effectively reducing the expression of FGF2, Smad7, and or a sequence upstream of FGF2 by reducing the availability of the proteins associated with these sequences. In such embodiments a binding partner with an affinity for FGF2, Smad7, or a protein product of a sequence upstream of Smad7 can be utilized to complex with, inactivate, and/or reduce the functionality of such proteins. Suitable binding partners include natural and/or synthetic antibodies, polyclonal antibodies, monoclonal antibodies, humanized antibodies, antibody fragments, single chain antibodies, and/or aptamers.
(54) In other embodiments of the inventive concept, renal disease associated with MERS-CoV infection can be mitigated using compounds that interact with regulatory pathways associated with FGF2, Smad7, and/or sequences located upstream of FGF2. For example, proteins, peptides, and/or small molecules that block or interfere with the activity of receptors for FGF2 protein and/or Smad7 protein and subsequently result in down regulation of transcription of the related gene(s) can be used.
(55) In contemplating such treatment modalities, it should be appreciated that there are a variety of ways in which such compounds can be administered. The compositions according to the inventive subject matter may be administered using various routes, including orally, parenterally, by inhalation, topically, rectally, nasally, or via an implanted reservoir, wherein the term parenteral as used herein includes subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrathecal, intrahepatic, intralesional, and intracranial administration (typically injection or infusion). Preferably, the compositions are administered orally, intraperitoneally, or intravenously.
(56) For example, sterile injectable forms of contemplated compounds may be aqueous solutions or oleaginous suspensions. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. A sterile injectable preparation can also be prepared as a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among other acceptable vehicles and solvents, especially contemplated liquids include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils may be employed as a co-solvent or suspending medium (e.g., natural or synthetic mono- or diglycerides). Fatty acids may also be used, and suitable fatty acids include oleic acid and its glyceride derivatives, olive oil, castor oil, especially in their polyoxyethylated versions. Such oil solutions or suspensions may further contain a long-chain alcohol diluent or dispersant.
(57) In another example, contemplated compounds may be orally administered in any orally acceptable dosage form, including capsules, tablets, aqueous suspensions, or solutions. In the case of tablets for oral use, all pharmaceutically acceptable carriers (e.g., lactose, corn starch, etc) are deemed suitable. Similarly, various lubricating agents may be added (e.g., magnesium stearate). For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents may also be added.
(58) Pharmaceutical compositions of the inventive concept can also be administered topically, especially when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, the lower intestinal tract, or areas exposed during surgical intervention. There are numerous topical formulations known in the art, and all of such formulations are deemed suitable for use herein.
(59) For topical applications, contemplated compositions may be formulated in a suitable ointment, cream, gel, and/or suspension containing the active component suspended or dissolved in one or more carriers. Carriers for topical administration of the compounds of this invention include mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compound, emulsifying wax and water. Alternatively, the pharmaceutical compositions can be formulated in a suitable lotion or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
(60) Pharmaceutical compositions according to the inventive subject matter can also be administered by nasal aerosol or particulate inhalation. Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as dry powders or as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other conventional solubilizing or dispersing agents.
(61) With respect to the amount of contemplated compounds in the composition, it should be recognized that the particular quantity will typically depend on the specific formulation, active ingredient, and desired purpose. Therefore, it should be recognized that the amount of contemplated compounds will vary significantly. However, it is generally preferred that the compounds are present in a minimum amount effective to deliver a therapeutic effect and/or to be visualized in vitro and/or in vivo.
(62) Thus, in most preferred embodiments, contemplated compounds will be present in an amount of between about 0.1 ng/ml to about 100 mg/ml, more typically in an amount of between about 10 ng/ml to about 100 mg/ml, and most typically between about 1 g/ml to about 100 g/ml. Where the formulation is a solid, contemplated compounds will be present in an amount of between about 0.1 ng/g to about 100 mg/g, more typically in an amount of between about 10 ng/g to about 10 mg/g, and most typically between about 1 g/g to about 100 g/g. With respect to a dosage unit, it is generally contemplated that contemplated compounds are administered at a dosage effective to achieve a desired therapeutic effect in vitro and/or in vivo.
(63) Therefore, suitable amounts of contemplated compounds will be in the range of 0.1 g per dosage unit to about 0.5 gram per dosage unit, more typically between 10 g per dosage unit to about 0.05 gram per dosage unit, and most typically between 50 g per dosage unit to about 100 mg per dosage unit. Thus, suitable dosages will be in the range of about 0.01 g/kg and 100 mg/kg, more typically between 1 g/kg and 50 mg/kg, and most typically between 10 g/kg and 10 mg/kg.
EXAMPLES
(64) Viruses:
(65) SARS-CoV strain HKU39849 and MERS-CoV isolate HCoV-EMC/2012 were provided by Ron Fouchier.sup.27. Viruses were propagated in VeroE6 cells (obtained from ATCC) in Dulbecco modified Eagle Medium (DMEM) supplemented with 10% fetal calf serum (FCS) and 100 units/ml penicillin+100 g/ml streptomycin (1% PS). All studies were performed according to biosafety level 3 practices.
(66) Virus Titration by TCID.sub.50 Assay:
(67) The 50% tissue culture infectious dose (TCID.sub.50) per ml was determined for MERS-CoV and SARS-CoV in VeroE6 cells by observation of cytopathic effects (CPE). Briefly, cells were plated in 96-well plates at a density of 510.sup.4 cells/well in 150 l of DMEM. The virus was serially diluted by half-log from 10.sup.3 to 10.sup.14 in DMEM. One hundred microliters of each dilution was added per well; and the plates were observed daily for CPE for 5 consecutive days.
(68) Cell Culture:
(69) HK-2 cells (obtained from ATCC) were cultured in DMEM/F12 medium (obtained from Life Technologies) supplemented with 5% FCS and 1% PS. Normal Human Mesangial cells (NHMC) (obtained from Lonza) were cultured in Mesangial Cell Basal Medium (MsBM) (obtained from Lonza) supplemented with 10% FCS, 1% PS, 5 g/ml transferrin and 5 g/ml insulin. All experiments using NHMC were done within their tenth passage.
(70) Ex Vivo Human Kidney and Lung Organ Culture and Infection:
(71) Fresh surgically resected kidney or lung specimens were obtained from patients undergoing nephrectomy or pneumonectomy, respectively, at Queen Mary Hospital, Hong Kong, as part of the standard clinical management. Ex vivo cultures were performed.sup.28. The kidney cortical and lung tissues in small strips of 1 mm width were placed into a 24-well plate directly with 1 ml of Kaighn's Modification of Ham's F-12 Medium (F-12K) and with 1% PS at 37 C. Tissues were infected with MERS-CoV and SARS-CoV at a viral titer of 6 logs TCID.sub.50 s/ml for 4 hours at 37 C. Unbound viruses were washed away with phosphate buffered saline (PBS). Tissues were collected at 0, 18, 48, and 72 hours post-infection (hpi) and then fixed in 10% paraformaldehyde for immunohistochemistry and electron microscopy.
(72) Common Marmoset Infection Model:
(73) The experiments were performed as the inventors and others have described previously.sup.25,26 with modifications. Briefly, six male common marmosets (Callithrix jacchus; 3 years old) were inoculated with MERS-CoV intranasally with 100 l in each nare, 500 l orally, 500 l intratracheally, and 50 l in each eye with DMEM containing a total dose of 110.sup.7 TCID.sub.50 of MERS-CoV. Necropsies of the six common marmosets were scheduled on 3 days post-infection (dpi). The common marmosets were observed twice daily for clinical signs of disease and scored using a clinical scoring system prepared for common marmosets.sup.26. The in-study euthanasia criteria were established prior to the start of the experiment based on the scoring sheet and euthanasia was indicated at a clinical score of 35 or above. On 1 and 3 dpi, clinical examinations were performed on anaesthetized animals, X-rays were taken and nasal, oral, and rectal swabs were collected in 1 ml DMEM with 50 U/ml penicillin and 50 mg/ml streptomycin. Samples of all lung lobes, kidney, heart, liver, spleen, brain, lymph node, salivary gland, pancreas, adrenal gland, bladder and spleen were collected on necropsy.
(74) Results of these studies are shown in
(75) Immunohistochemical Staining and Electron Microscopy:
(76) Infected primate kidneys were fixed in 10% paraformaldehyde and cryosectioned. The mounted slides were blocked with TBS4 for 1 hour. MERS-CoV NP was stained with mouse anti-MERS-CoV NP (1:200) overnight at 4 C. Rabbit antibodies against cell type-specific markers synaptopodin (obtained from Abcam), CD31 (obtained from Abcam), cytokeratin 18 (obtained from Abcam), Smad7 (obtained from Santa Cruz), FGF2 (obtained from Abcam) and Caspase-3 (obtained from Cell Signaling Technology) were also used. Unbound antibodies were washed away with 3 phosphate buffered saline (PBS) with Tween-20 (PBST). Alexa Fluor 488 goat anti-mouse IgG (H+L) antibodies (1:500) (Life Technologies) and Alexa Fluor 594 goat anti-rabbit IgG (1:500) (obtained from Life Technologies) was then applied to the slides for signal detection, followed by washing with 3PBST. Stained slides were then mounted with coverslips in the presence of anti-fade mountant (obtained from Dako) and 1 g/ml DAPI (obtained from Sigma). Human kidney tissues were embedded in Tissue-Tek OCT compound (obtained from Miles Inc., Elkhart, Ind.), snap frozen and stored at 80 C. before sectioning. Sections of 5-10 m thickness were cut on a cryostat and transferred to glass microscope slides pre-coated with poly-lysine (obtained from Sigma-Aldrich). Sections were then fixed with cold acetone for 20 minutes at room temperature. Fixed sections were washed three times with PBS before blocking and staining with anti-MERS-CoV NP as described above. Digital images were acquired using NIKON Eclipse Ni-U with SPOT RT3 camera. To prepare samples for electron microscopic examination, the paraformaldehyde fixed tissues were post-fixed for 30 minutes with 0.5% osmium tetroxide/0.8% potassium ferricyanide in 0.1 M sodium cacodylate, 1 hour with 1% tannic acid and overnight with 1% uranyl acetate at 4 C. Specimens were dehydrated with a graded ethanol series from water through 10%-20%-50%-95%-100% ethanol with two final exchanges in 100% propylene oxide before infiltration and final embedding in Embed-812 resin. Thin sections were cut with a Leica EM UC6 ultra microtome (obtained from Leica), and stained with 1% uranyl acetate and Reynold's lead citrate before viewing at 120 kV on a FEI Tecnai G2 20 S-TWIN Scanning Transmission Electron Microscope. Digital images were acquired with a Gatan 794 1K1K Camera System with DigitalMicrograph Acquisition Software.
(77) Quantitative Real-Time PCR (qPCR):
(78) Total RNAs and viral RNAs were isolated using Trizol (obtained from Life Technologies Ltd.) and Viral RNA Mini kit (obtained from QIAGEN), respectively. After RNA quantification, 1 g of RNAs was reverse transcribed into cDNA using random hexamers. Total MERS-CoV transcripts were detected using Novel Coronavirus 2012 Real-Time RT-PCR assay (obtained from CDC; Catalog # KT0136). The viral RNAs isolated from cell lysates and conditioned media were normalized with the mRNA expression level of GAPDH and a spike-in control, enterovirus 71 (EV71) strain SZ/HK08-5, using primers 5-GCTCACTGGCATGGCCTTCCGTGT-3 (GADPH, SEQ ID NO. 1) and 5-TGGAGGAGTGGGTGTCGCTG TTGA-3 (GAPDH, SEQ ID NO. 2) as well as 5-CCCCTGAATGCGGCTAATCC-3 (EV71, SEQ ID NO. 3) and 5-ACACGGACACCCAAAGTAGT-3 (EV71, SEQ ID NO. 4). For each reaction, equal amounts of cDNA were mixed with FS Universal SYBR Green Master Rox (obtained from Roche) plus 5 pmol each of forward and reverse primers. Amplification was done under thermal cycling conditions of 15 seconds at 95 C. and 1 minute at 60 C. for 55 cycles in a 7900 real-time PCR detection System (obtained from ABI).
(79) High-Throughput Sequencing:
(80) Sequencing libraries were prepared at the Centre for Genomic Sciences, the University of Hong Kong by using the TruSeq Stranded mRNA Sample Prep Kit (obtained from Illumina), and were subsequently sequenced on a Illumina HiSeq 2000 system. Briefly, mRNA was isolated using polyT oligo-attached magnetic beads. The purified mRNA was fragmented and reverse transcribed using SuperScript II Reverse Transcriptase (obtained from Invitrogen) to first-strand cDNA in the presence of random hexamers. Double-stranded cDNAs were synthesized by second strand synthesis and then subjected to end repair, 3 adenylation and indexed adaptor ligation. The adaptor-ligated sequencing libraries were further enriched by 10 cycles of PCR, quantified and sequenced on a HiSeq 2000 system with 101 bp paired-end reads. Image analyses and base calling were performed with SCS2.8/RTA1.8 software (obtained from Illumina). FASTQ file generation and the removal of failed reads were performed using CASAVA ver.1.8.2 software (obtained from Illumina).
(81) Apoptosis Assay:
(82) A caspase-3/CPP32 fluorometric assay kit (obtained from BioVision) was used for measurement of caspase-3 activity. Briefly, cells were plated in six-well dishes, cultured, collected, and lysed in lysis buffer at 0, 8, 48 and 72 hpi. After the protein concentration was normalized by a Bradford protein assay. The lysates were incubated with the same amounts of reaction buffer and 50 mmol/L of DEVD-AFC substrate for 2 hours at 37 C. Fluorescence was monitored with an excitation wavelength of 400 nm and an emission wavelength of 505 nm.
(83) It should be apparent to those skilled in the art that many more modifications besides those already described are possible without departing from the inventive concepts herein. The inventive subject matter, therefore, is not to be restricted except in the spirit of the appended claims. Moreover, in interpreting both the specification and the claims, all terms should be interpreted in the broadest possible manner consistent with the context. In particular, the terms comprises and comprising should be interpreted as referring to elements, components, or steps in a non-exclusive manner, indicating that the referenced elements, components, or steps may be present, or utilized, or combined with other elements, components, or steps that are not expressly referenced. Where the specification claims refers to at least one of something selected from the group consisting of A, B, C . . . and N, the text should be interpreted as requiring only one element from the group, not A plus N, or B plus N, etc.
REFERENCES
(84) 1. Peiris, J. S., et al. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 361, 1319-1325 (2003). 2. Peiris, J. S., Guan, Y. & Yuen, K. Y. Severe acute respiratory syndrome. Nature medicine 10, S88-97 (2004). 3. Cheng, V. C., Lau, S. K., Woo, P. C. & Yuen, K. Y. Severe acute respiratory syndrome coronavirus as an agent of emerging and reemerging infection. Clin Microbiol Rev 20, 660-694 (2007). 4. Eckerle, I., Muller, M. A., Kallies, S., Gotthardt, D. N. & Drosten, C. In-vitro renal epithelial cell infection reveals a viral kidney tropism as a potential mechanism for acute renal failure during Middle East Respiratory Syndrome (MERS) Coronavirus infection. Virol J 10, 359 (2013). 5. Chan, J. F., et al. Differential cell line susceptibility to the emerging novel human betacoronavirus 2c EMC/2012: implications for disease pathogenesis and clinical manifestation. J Infect Dis 207, 1743-1752 (2013). 6. Chan, J. F., et al. Is the discovery of the novel human betacoronavirus 2c EMC/2012 (HCoV-EMC) the beginning of another SARS-like pandemic? J Infect 65, 477-489 (2012). 7. Chan, J. F., Lau, S. K. & Woo, P. C. The emerging novel Middle East respiratory syndrome coronavirus: the knowns and unknowns. J Formos Med Assoc 112, 372-381 (2013). 8. Eckerle, I., Muller, M. A., Kallies, S., Gotthardt, D. N. & Drosten, C. In-vitro renal epithelial cell infection reveals a viral kidney tropism as a potential mechanism for acute renal failure during Middle East Respiratory Syndrome (MERS) Coronavirus infection. Virology journal 10, 359 (2013). 9. Assiri, A., et al. Epidemiological, demographic, and clinical characteristics of 47 cases of Middle East respiratory syndrome coronavirus disease from Saudi Arabia: a descriptive study. The Lancet infectious diseases 13, 752-761 (2013). 10. Hung, I. F., et al. Viral loads in clinical specimens and SARS manifestations. Emerging infectious diseases 10, 1550-1557 (2004). 11. Lu, L., Liu, Q., Zhu, Y., Chan, K. H., Qin, L., Li, Y., Wang, Q., Chan, J. F., Du, L., Yu, F., Ma, C., Ye, S., Yuen, K. Y., Zhang, R., Jiang, S. Structure-based discovery of Middle East respiratory syndrome coronavirus fusion inhibitor. Nature Communications (2014). 12. Chan, J. F., et al. Broad-spectrum antivirals for the emerging Middle East respiratory syndrome coronavirus. The Journal of infection 67, 606-616 (2013). 13. Falzarano, D., et al. Inhibition of novel beta coronavirus replication by a combination of interferon-alpha2b and ribavirin. Scientific reports 3, 1686 (2013). 14. Al-Tawfiq, J. A., Momattin, H., Dib, J. & Memish, Z. A. Ribavirin and interferon therapy in patients infected with the Middle East respiratory syndrome coronavirus: an observational study. International journal of infectious diseases: IJID: official publication of the International Society for Infectious Diseases (2014). 15. Chan, K. H., et al. Cross-reactive antibodies in convalescent SARS patients' sera against the emerging novel human coronavirus EMC (2012) by both immunofluorescent and neutralizing antibody tests. The Journal of infection 67, 130-140 (2013). 16. Drosten, C., et al. Clinical features and virological analysis of a case of Middle East respiratory syndrome coronavirus infection. Lancet Infect Dis 13, 745-751 (2013). 17. Schiffer, M., et al. Apoptosis in podocytes induced by TGF-beta and Smad7. J Clin Invest 108, 807-816 (2001). 18. Lan, H. Y., et al. Inhibition of renal fibrosis by gene transfer of inducible Smad7 using ultrasound-microbubble system in rat UUO model. J Am Soc Nephrol 14, 1535-1548 (2003). 19. Okado, T., et al. Smad7 mediates transforming growth factor-beta-induced apoptosis in mesangial cells. Kidney international 62, 1178-1186 (2002). 20. Bitzer, M., et al. A mechanism of suppression of TGF-beta/SMAD signaling by NF-kappa B/RelA. Genes Dev 14, 187-197 (2000). 21. Floege, J., et al. Basic fibroblast growth factor augments podocyte injury and induces glomerulosclerosis in rats with experimental membranous nephropathy. J Clin Invest 96, 2809-2819 (1995). 22. Li, Z., Jerebtsova, M., Liu, X. H., Tang, P. & Ray, P. E. Novel cystogenic role of basic fibroblast growth factor in developing rodent kidneys. American journal of physiology. Renal physiology 291, F289-296 (2006). 23. Zorzi, F., et al. A phase 1 open-label trial shows that smad7 antisense oligonucleotide (GED0301) does not increase the risk of small bowel strictures in Crohn's disease. Alimentary pharmacology & therapeutics 36, 850-857 (2012). 24. Monteleone, G., et al. Phase I clinical trial of Smad7 knockdown using antisense oligonucleotide in patients with active Crohn's disease. Molecular therapy: the journal of the American Society of Gene Therapy 20, 870-876 (2012). 25. Yao, Y., et al. An animal model of MERS produced by infection of rhesus macaques with MERS coronavirus. J Infect Dis 209, 236-242 (2014). 26. Falzarano, D., et al. Infection with MERS-CoV causes lethal pneumonia in the common marmoset. Plos Pathog 10, e1004250 (2014). 27. Zaki, A. M., van Boheemen, S., Bestebroer, T. M., Osterhaus, A. D. & Fouchier, R. A. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. The New England journal of medicine 367, 1814-1820 (2012). 28. Zhou, J., et al. Active Replication of Middle East Respiratory Syndrome Coronavirus Replication and Aberrant Induction of Inflammatory Cytokines and Chemokines in Human Macrophages: Implications for Pathogenesis. The Journal of infectious diseases (2013). 29. Chan, J. F., et al. Differential cell line susceptibility to the emerging novel human betacoronavirus 2c EMC/2012: implications for disease pathogenesis and clinical manifestation. The Journal of infectious diseases 207, 1743-1752 (2013).