Solid supports and phosphoramidite building blocks for oligonucleotide conjugates
10781175 ยท 2020-09-22
Assignee
Inventors
- Andrei Pavel GUZAEV (Escondido, CA, US)
- Vladimir Y. VVEDENSKIY (San Diego, CA, US)
- Khirud GOGOI (San Marcos, CA, US)
Cpc classification
Y02P20/55
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C07H1/00
CHEMISTRY; METALLURGY
C07F9/6561
CHEMISTRY; METALLURGY
C07H15/26
CHEMISTRY; METALLURGY
C07D401/12
CHEMISTRY; METALLURGY
C07H21/00
CHEMISTRY; METALLURGY
C07F9/65586
CHEMISTRY; METALLURGY
C07D205/04
CHEMISTRY; METALLURGY
C07F9/65583
CHEMISTRY; METALLURGY
International classification
C07J43/00
CHEMISTRY; METALLURGY
C07F9/6558
CHEMISTRY; METALLURGY
C07H15/26
CHEMISTRY; METALLURGY
C07H1/00
CHEMISTRY; METALLURGY
C07D205/04
CHEMISTRY; METALLURGY
C07D401/12
CHEMISTRY; METALLURGY
C07D409/06
CHEMISTRY; METALLURGY
C07H21/00
CHEMISTRY; METALLURGY
Abstract
Novel non-nucleoside solid supports and phosphoramidite building blocks for preparation of synthetic oligonucleotides containing at least one non-nucleosidic moiety conjugated to a ligand of practical interest and synthetic processes for making the same are disclosed. Furthermore, oligomeric compounds are prepared using said solid supports and phosphoramidite building blocks, preferably followed by removal of protecting groups to provide oligonucleotides conjugated to ligands of interest.
Claims
1. A compound of Formula I: ##STR00167## wherein: each A and A.sup.1 is independently selected from CH.sub.2 or (CH.sub.2).sub.2; each E and E.sup.1 is independently selected from CH.sub.2, OCH.sub.2, (CH.sub.2).sub.2, or O(CH.sub.2).sub.2; G is selected from 6-(trifluoroacetylamino)hexanoyl; -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl; -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol; 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl; 6-[(6-heptynoyl-1)amino]hexanoyl; 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid; 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid; 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein; 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein; 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid; 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid; or a residue of diglycolic acid that forms an amide with a first amino group of 1,13-diamino-4,7,10-trioxatridecane further acylated at a second amino group with optionally protected D-biotin; one of R and R.sup.1 is selected from hydrogen, acetyl (Ac), or a protecting group of trityl type selected from (4-methoxyphenyl)diphenylmethyl (MMT or methoxytrityl), bis-(4-methoxyphenyl)phenylmethyl (DMT or dimethoxytrityl), tris-(4-methoxyphenyl)methyl (TMT or trimethoxytrityl), 9-phenylxanthen-9-yl, or 9-(p-methoxyphenyl)xanthen-9-yl; the other of R and R.sup.1 is selected from hydrogen, acetyl, PA, or (CO)CH.sub.2CH.sub.2COOH, wherein: PA is a phosphoramidite moiety: ##STR00168##
2. The compound of claim 1, wherein one of R and R.sup.1 is a protecting group selected from tris-(4-methoxyphenyl)methyl, bis-(4-methoxyphenyl)phenylmethyl, 9-phenylxanthen-9-yl, or 9-(4-methoxyphenyl)xanthen-9-yl and the other of R and R.sup.1 is a phosphoramidite moiety PA.
3. The compound of claim 1, wherein one of R and R.sup.1 is dimethoxytrityl and the other is PA, each A and A.sup.1 is CH.sub.2, and each E and E.sup.1 is independently selected from CH.sub.2 and (CH.sub.2).sub.2.
4. The compound of claim 3, wherein E.sup.1 is CH.sub.2.
5. The compound of claim 4, wherein G is selected from 6-(trifluoroacetyl amino)hexanoyl; -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl; -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[(6-heptynoyl-1)amino]hexanoyl; 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein; 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein; 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid; and 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid.
6. The compound of claim 1, wherein one of R and R.sup.1 is trimethoxytrityl and the other is PA, each A and A.sup.1 is CH.sub.2, and each E and E.sup.1 is (CH.sub.2).sub.2.
7. The compound of claim 6, wherein G is selected from 6-(trifluoroacetylamino)hexanoyl; -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl; -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol; 6-[(6-heptynoyl-1)amino]hexanoyl; 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl; 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein; 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein; 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid; 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid; 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid; and 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid.
8. The compound of claim 1, wherein one of R and R.sup.1 is trimethoxytrityl and the other is PA, and each A, A.sup.1, E, and E.sup.1 is CH.sub.2.
9. The compound of claim 8, wherein G is selected from 6-(trifluoroacetyl amino)hexanoyl; -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl; -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol; 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein; 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein; 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid; and 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(7) The present invention provides chemical preparations of oligonucleotides, chemical entities useful in such preparation, and processes for such preparation. More specifically, the invention provides novel non-nucleosidic phosphoramidite building blocks and solid supports for incorporation of a variety of useful ligands to natural oligonucleotides and their phosphorothioate analogs in the course of synthesis on solid phase. The phosphoramidite building blocks and solid supports according to the invention are highly efficient. These compounds are inexpensive to manufacture. They are stable in the solid state or in solution over an extensive period of time. The attachment thereof to oligonucleotides does not create any new chiral centers and hence does not complicate the isolation of the ligand-modified oligonucleotides. Said oligonucleotides do not suffer from any unwanted side reactions. The patents and publications cited in this specification are well-known to those skilled in the art and are hereby incorporated by reference in their entirety.
(8) Upon examination of the data disclosed in the prior art, skilled artisans will appreciate the fact that, in order to eliminate side reactions in modified oligonucleotides, an optimal structure for preparation of such oligonucleotides should be derived from 1,3-propanediol or a longer ,-alkanediol and that a functional group to serve as an attachment point for ligands of interest should be at least 4 carbons away from any of the hydroxy groups. Further, to avoid the formation of new chiral centers in such modified oligonucleotides, the optimal linker should not possess any chiral or pro-chiral centers. Phosphoramidite building blocks and solid supports derived from such linkers are described herein in accordance with the present invention.
(9) Thus, in a first aspect, the invention provides novel compounds which may serve as building blocks for the preparation of oligomeric compounds, analogs of natural oligonucleotides, wherein an artificial moiety is attached at the 5- or at the 3-termini, or in the middle of the chain, or in any combination thereof according to Formula I:
(10) ##STR00001##
wherein: Each A and A.sup.1 is, independently, a linking moiety [(CH.sub.2).sub.aM(CH.sub.2).sub.b].sub.c wherein: Each a, b, and c is, independently, an integer from 0 to 6; M is a chemical bond, oxygen atom, sulfur atom, NQ.sup.1, N(Q.sup.1)C(O)N(Q.sup.2)-, C(O)N(Q.sup.1)-, or N(Q.sup.1)C(O) wherein: Each Q.sup.1 and Q.sup.2 is independently hydrogen atom, methyl group, ethyl group, propyl group, isopropyl group, acetyl group, trifluoroacetyl group, phenoxyacetyl group, benzoyl group, or 9-fluorenylmethyloxycarbonyl group; Each E and E.sup.1 is, independently, a linking moiety [(CH.sub.2).sub.dM.sup.1(CH.sub.2).sub.e].sub.f wherein: Each d, e, and f is, independently, an integer from 0 to 3; M.sup.1 is a chemical bond, oxygen atom, sulfur atom, NQ.sup.3, N(Q.sup.3)C(O)N(Q.sup.4)-, C(O)N(Q.sup.3)-, or N(Q.sup.3)C(O) wherein: Each Q.sup.3 and Q.sup.4 is independently hydrogen atom, methyl group, ethyl group, propyl group, isopropyl group, acetyl group, trifluoroacetyl group, phenoxyacetyl group, benzoyl group, or 9-fluorenylmethyloxycarbonyl group; G is selected from hydrogen, a substituted or unsubstituted aliphatic group, a substituted or unsubstituted cycloaliphatic group, a substituted or unsubstituted aromatic group, a substituted or unsubstituted heteroaromatic group, a substituted or unsubstituted heterocyclic group, a nitrogen protecting group, CH.sub.2-L, C(O)-L, C(O)OL, C(O)NHL, S(O)-L, S(O)NHL, SO.sub.2-L, and SO.sub.2NHL, wherein: L is selected from hydrogen, an optionally protected hydroxy group, an optionally protected amino group, or a linking moiety [[(CH.sub.2).sub.gX.sup.1(CH.sub.2).sub.h]X.sup.2[(CH.sub.2).sub.iX.sup.3(CH.sub.2).sub.j]].sub.k-J, wherein: Each g, h, i, j, and k is, independently, an integer from 0 to 6; Each X.sup.1, X.sup.2, and X.sup.3 is, independently, an atom of oxygen, CH.sub.2 group, an atom of sulfur, C(O), SS, S(O), SO.sub.2, NQ.sup.5, C(O)N(Q.sup.5)-, OC(O)N(Q.sup.5)-, N(Q.sup.5)C(O), N(Q.sup.5)C(O)O, N(Q.sup.5)C(O)N(Q.sup.6)-, 1,4-phenylidene, or 1H-1,2,3-triazole-1,4-diyl wherein: Each Q.sup.5 and Q.sup.6 is, independently, hydrogen atom, methyl group, ethyl group, propyl group, isopropyl group, acetyl group, trifluoroacetyl group, phenoxyacetyl group, benzoyl group, or 9-fluorenylmethyloxycarbonyl group; J is selected from a hydrogen atom, an optionally protected hydroxyl group, an optionally protected primary amino group, an optionally protected alkylamino group, a dialkylamino group, a trialkylammonium group, an azido group, an ethynyl group CCH, a hydroxy group alkylated with -tocopherol, a hydroxy group alkylated with optionally protected N-acetyl-D-galactosamine, a primary amino group acylated with a ligand selected from optionally protected fluorescein-5-carboxylic acid, optionally protected fluorescein-6-carboxylic acid, N,N,N,N-tetramethylrhodamine-5-carboxylic acid, N,N,N,N-tetramethylrhodamine-6-carboxylic acid, -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, optionally protected biotin, 4-(dimethylamino)-azobenzene-4-carboxylic acid, 4-pyrenylbutyryc acid, triethyl ethylenediaminetetraacetic acid, bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 3-(cyclooctatetraene)propionic acid, lipoic acid, a primary or a secondary amino group sulfonylated with 4-(dimethylamino)-azobenzene-4-sulfonic acid, a primary or a secondary amino group carbamoylated with cholesterylcarbonic acid, a primary or a secondary amino group alkylated with 6-chloro-2-methoxyacridine, an optionally protected carboxy group, a carboxy group forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a carboxy group forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, or a carboxy group forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine; One of R and R.sup.1 is selected from hydrogen or a protecting group of trityl type selected from (4-methoxyphenyl)diphenylmethyl, bis-(4-methoxyphenyl)phenylmethyl, tris-(methoxyphenyl)methyl, 9-phenylxanthen-9-yl, or 9-(p-methoxyphenyl)xanthen-9-yl; The other of R and R.sup.1 is selected from hydrogen, a protecting group, PA, or L.sup.1, wherein: PA is a phosphoramidite moiety:
(11) ##STR00002## wherein: Each R.sup.2 and R.sup.3 is, independently, C1 to C6 alkyl, or R.sup.2 and R.sup.3 together with the nitrogen atom they are attached to form a cycle wherein R.sup.2+R.sup.3(CH.sub.2).sub.mY(CH.sub.2).sub.n wherein Y is an atom of oxygen or CH.sub.2 group; Each m and n is, independently, an integer from 2 to about 5; R.sup.4 is a phosphite and phosphate protecting group selected from methyl, allyl, 2-cyanoethyl, 4-cyano-2-butenyl, 2-cyano-1,1-dimethylethyl, 2-(trimethylsilyl)ethyl, 2-(S-acetylthio)ethyl, 2-(S-pivaloylthio)ethyl, 2-(4-nitrophenyl)ethyl, 2,2,2-trichloroethyl, 2,2,2-trichloro-1,1-dimethylethyl, 1,1,1,3,3,3-hexafluoro-2-propyl, fluorenyl-9-methyl, 2-chlorophenyl, 4-chlorophenyl, or 2,4-dichlorophenyl; L.sup.1 is a linking moiety C(O)[[(CH.sub.2).sub.pZ.sup.1(CH.sub.2).sub.q].sub.rZ.sup.2[(CH.sub.2).sub.sZ.sup.3(CH.sub.2) t].sub.u].sub.vW, wherein: Each p, q, r, s, t, u, and v is, independently, an integer from 0 to 6; Each Z.sup.1, Z.sup.2, and Z.sup.3 is selected, independently, from a chemical bond, an atom of oxygen, an atom of sulfur, C(O), SS, S(O), SO.sub.2, NQ.sup.7, C(O)N(Q.sup.7)-, OC(O)N(Q.sup.7)-, N(Q.sup.7)C(O), N(Q.sup.7)C(O)O, or N(Q.sup.7)C(O)N(Q.sup.8)-, wherein: Each Q.sup.7 and Q.sup.8 is independently an atom of hydrogen, methyl group, ethyl group, propyl group, isopropyl group, acetyl group, trifluoroacetyl group, phenoxyacetyl group, benzoyl group, or 9-fluorenylmethyloxycarbonyl group; W is a hydroxy group, a negatively charged atom of oxygen O.sup., or a solid phase material selected from a controlled pore glass, magnetic controlled pore glass, silica-containing particles, polymers of styrene, copolymers of styrene and divinylbenzene, controlled pore glass grafted with polymers of styrene, controlled pore glass grafted with copolymers of styrene and divinylbenzene, copolymers of styrene and divinylbenzene grafted with polyethyleneglycol, copolymers of dimethylacrylamide and N,N,-bisacryloylethylenediamine, flat glass surface, or soluble support media;
(12) In certain embodiments of the present invention, one of R and R.sup.1 of Formula I is selected from tris-(4-methoxyphenyl)methyl protecting group, bis-(4-methoxyphenyl)phenylmethyl protecting group, 9-phenylxanthen-9-yl protecting group, or 9-(4-methoxyphenyl)xanthen-9-yl protecting group and the other of R and R.sup.1 is selected from a residue of succinic acid optionally further attached to a solid phase material W via the second carboxylic function or a residue of diglycolic acid optionally further attached to a solid phase material W via the second carboxylic function.
(13) In certain embodiments of the present invention, one of R and R.sup.1 is selected from tris-(4-methoxyphenyl)methyl protecting group, bis-(4-methoxyphenyl)phenylmethyl protecting group, 9-phenylxanthen-9-yl protecting group, or 9-(4-methoxyphenyl)xanthen-9-yl protecting group and the other of R and R.sup.1 is a phosphoramidite moiety PA.
(14) In certain embodiments of the present invention, each R.sup.2 and R.sup.3 is isopropyl group or R.sup.2 and R.sup.3 together with the nitrogen they are attached to form a cycle so that R.sup.2+R.sup.3=(CH.sub.2).sub.4, R.sup.2+R.sup.3=(CH.sub.2).sub.5, or R.sup.2+R.sup.3=(CH.sub.2).sub.2O(CH.sub.2).sub.2.
(15) In certain embodiments of the present invention, each A and A.sup.1 of Formula I is independently selected from CH.sub.2 or (CH.sub.2).sub.2.
(16) In certain embodiments of the present invention, each E and E.sup.1 of Formula I is independently selected from CH.sub.2, OCH.sub.2, (CH.sub.2).sub.2, or O(CH.sub.2).sub.2.
(17) In certain embodiments of the present invention, G of Formula I is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(18) In certain embodiments of the present invention, one of R and R.sup.1 of Formula I is 4,4-dimethoxytrityl group, and the other is a residue of succinic acid optionally attached to a solid phase material, each A and A.sup.1 is CH.sub.2, each E and E.sup.1 is (CH.sub.2).sub.2, and G is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(19) In other embodiments of the present invention, one of R and R.sup.1 of Formula I is 4,4-dimethoxytrityl group, and the other is a residue of succinic acid optionally attached to a solid phase material, each A, A.sup.1, E, and E.sup.1 is CH.sub.2, and G is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(20) In yet another embodiment of the present invention, one of R and R.sup.1 of Formula I is 4,4,4-trimethoxytrityl group, and the other is a residue of succinic acid optionally attached to a solid phase material, each A and A is CH.sub.2, each E and E.sup.1 is (CH.sub.2).sub.2, and G is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(21) In yet another embodiment of the present invention, one of R and R.sup.1 of Formula I is 4,4,4-trimethoxytrityl group, and the other is a residue of succinic acid optionally attached to a solid phase material, each A, A.sup.1, E, and E.sup.1 is CH.sub.2, and G is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(22) In yet another embodiment of the present invention, one of R and R.sup.1 of Formula I is 4,4-dimethoxytrityl group, and the other is PA wherein each R.sup.2 and R.sup.3 is isopropyl group and R.sup.4 is 2-cyanoetyl group, each A and A.sup.1 is CH.sub.2, each E and E.sup.1 is (CH.sub.2).sub.2, and G is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(23) In yet another embodiment of the present invention, R.sup.1 of Formula I is 4,4-dimethoxytrityl group, R.sup.2 is PA wherein each R.sup.2 and R.sup.3 is isopropyl group and R.sup.4 is 2-cyanoetyl group, each A, A.sup.1, E, and E.sup.1 is CH.sub.2, and G is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(24) In yet another embodiment of the present invention, one of R and R.sup.1 of Formula I is 4,4,4-trimethoxytrityl group, and the other is PA wherein each R.sup.2 and R.sup.3 is isopropyl group and R.sup.4 is 2-cyanoetyl group, each A and A.sup.1 is CH.sub.2, each E and E.sup.1 is (CH.sub.2).sub.2, and G is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(25) In yet another embodiment of the present invention, one of R and R.sup.1 of Formula I is 4,4,4-trimethoxytrityl group, and the other is PA wherein each R.sup.2 and R.sup.3 is isopropyl group and R.sup.4 is 2-cyanoetyl group, each A, A.sup.1, E and E.sup.1 is CH.sub.2, and G is selected from an atom of hydrogen, an alkyl group, a trifluoroacetyl group, (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, 6-(trifluoroacetylamino)hexanoyl, 6-heptynoyl, 6-azidohexanoyl, 6-aminohexanoyl protected at the amino group with (9H-fluoren-9-yl)methoxycarbonyl (Fmoc) group, [4-(1-pyrenyl)butyryl-1], -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoyl, -hydroxyalkanoic acid further alkylated at the hydroxy group with -tocopherol, 6-[[4-(1-pyrenyl)butyryl-1]amino]hexanoyl, 6-[(6-heptynoyl-1)amino]hexanoyl, 6-aminohexanoyl further acylated at the amino group with 4-(dimethylamino)azobenzene-4-carboxylic acid, 6-aminohexanoyl further sulfonylated at the amino group with 4-(dimethylamino)azobenzene-4-sulfonic acid, 6-aminohexanoyl further acylated at the amino group with a protected 6-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with a protected 5-carboxyfluorescein, 6-aminohexanoyl further acylated at the amino group with 5-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with 6-carboxy-N,N,NN-tetramethylrhodamine, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 6-aminohexanoyl further acylated at the amino group with 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 6-aminohexanoyl further acylated at the amino group with -(bicyclo[2.2.1]hept-5-en-2-yl)alkanoic acid, 6-aminohexanoyl further acylated at the amino group with 8-[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]-3,6-dioxooctanoic acid, 6-aminohexanoyl further acylated at the amino group with -[[(3,4,6-tri-O-acetyl-2-acetamido-2-deoxy--D-galactopyranosyl)]oxy]alkanoic acid, 6-aminohexanoyl further acylated at the amino group with lipoic acid, 6-aminohexanoyl further acylated at the amino group with 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 6-aminohexanoyl further acylated at the amino group with 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 6-aminohexanoyl further acylated at the amino group with 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 6-aminohexanoyl further acylated at the amino group with 3-(cyclooctatetraene)propionic acid, 6-aminohexanoyl further carbamoylated at the amino group with cholesterylcarbonic acid, 6-aminohexanoyl further acylated at the amino group with optionally protected D-biotin, 6-[(6-chloro-2-methoxyacridin-9-yl)amino]hexanoyl, a residue of diglycolic acid optionally protected at the second carboxylic group, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a residue of diglycolic acid further forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic further acid forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine, a residue of diglycolic acid further forming an amide with 1,13-diamino-4,7,10-trioxatridecane, optionally protected at the second amino group, or a residue of diglycolic acid wherein the second carboxy group further forms an amide with 1,13-diamino-4,7,10-trioxatridecane further acylated at the second amino group with optionally protected D-biotin.
(26) In certain embodiments of the present invention, W is selected from controlled pore glass, a copolymer of styrene and divinylbenzene, controlled pore glass grafted with a polymer of styrene, controlled pore glass grafted with a copolymer of styrene and divinylbenzene, or flat glass surface.
(27) In a second aspect, the present invention provides novel oligomeric compounds, analogs of natural oligonucleotides, having the structure according to Formula II:
(28) ##STR00003##
wherein: with the proviso that only one of R.sup.5, R.sup.6, and R.sup.10 is simultaneously a linker connected to a solid support, R.sup.5 is hydrogen atom, a protecting group selected from (4-methoxyphenyl)diphenylmethyl, bis-(4-methoxyphenyl)phenylmethyl, tris-(methoxyphenyl)methyl, 9-phenylxanthen-9-yl, or 9-(p-methoxyphenyl)xanthen-9-yl, a point of attachment to solid phase material, or a linker of universal family; R.sup.6 is hydrogen atom, a protecting group selected from (4-methoxyphenyl)diphenylmethyl, bis-(4-methoxyphenyl)phenylmethyl, tris-(methoxyphenyl)methyl, 9-phenylxanthen-9-yl, or 9-(p-methoxyphenyl)xanthen-9-yl, a point of attachment to solid phase material, a linker of universal family, a non-nucleosidic moiety of Formula III or a nucleosidic moiety of Formula IV:
(29) ##STR00004## wherein: R.sup.10 is, independently, hydrogen atom, a protecting group selected from (4-methoxyphenyl)diphenylmethyl, bis-(4-methoxyphenyl)phenylmethyl, tris-(4-methoxyphenyl)methyl, 9-phenylxanthen-9-yl, or 9-(4-methoxyphenyl)xanthen-9-yl, or a point of attachment to solid phase material; Each R.sup.7 is, independently, a negative charge compensated by a cation or a phosphate protecting group selected from methyl, allyl, 2-cyanoethyl, 4-cyano-2-butenyl, 2-cyano-1,1-dimethylethyl, 2-(trimethylsilyl)ethyl, 2-(S-acetylthio)ethyl, 2-(S-pivaloylthio)ethyl, 2-(4-nitrophenyl)ethyl, 2,2,2-trichloroethyl, 2,2,2-trichloro-1,1-dimethylethyl, 1,1,1,3,3,3-hexafluoro-2-propyl, fluorenyl-9-methyl, 2-chlorophenyl, 4-chlorophenyl, or 2,4-dichlorophenyl; Each R.sup.8 is independently an optionally protected nucleic base selected from adenine, cytosine, guanine, thymine, uracil, 2-aminoadenine, N6-methyladenine, 7-deazaadenine, 7-deaza-8-azaadenine, 8-aminoadenine, 5-methylcytosine, N4-ethylcytosine, 7-deazaguanine, 7-deaza-8-azaguanine, 8-aminoguanine, 7-deazaxanthyne, hypoxanthine; Each R.sup.9 is, independently, hydrogen atom, fluorine atom, hydroxy group, substituted hydroxy group OR.sup.11, or substituted amino group NR.sup.12R.sup.13 wherein: Each R.sup.11 is, independently, a C.sub.1 to C.sub.6 alkyl, 2-alkoxyethyl group, trialkysilyl group, or N-methylcarboxamidomethyl group; Each R.sup.12 and R.sup.13 is, independently, hydrogen atom, methyl group, ethyl group, propyl group, isopropyl group, acetyl group, trifluoroacetyl group, phenoxyacetyl group, benzoyl group, or 9-fluorenylmethyloxycarbonyl group; Each W.sup.1 and W.sup.2 is, independently, oxygen or sulfur; and Each x, y, and z is, independently, an integer from 0 to about 100 (in some illustrative embodiments, x, y, and z are independently 0-50; in other embodiments x, y, and z are independently 0-20; in further embodiments x, y, and z are independently 0-10, or any other suitable range). Each A and A.sup.1 is, independently, a linking moiety [(CH.sub.2).sub.aM(CH.sub.2).sub.b].sub.c wherein: Each a, b, and c is, independently, an integer from 0 to 6; M is a covalent bond, oxygen atom, sulfur atom, NQ.sup.1, N(Q.sup.1)C(O)N(Q.sup.2)-, C(O)N(Q.sup.1)-, or N(Q.sup.1)C(O) wherein: Each Q.sup.1 and Q.sup.2 is independently hydrogen atom, methyl group, ethyl group, propyl group, isopropyl group, acetyl group, trifluoroacetyl group, phenoxyacetyl group, benzoyl group, or 9-fluorenylmethyloxycarbonyl group; Each E and E.sup.1 is, independently, a linking moiety [(CH.sub.2).sub.dM.sup.1(CH.sub.2).sub.e].sub.f wherein: Each d, e, and f is, independently, an integer from 0 to 6; M.sup.1 is a covalent bond, oxygen atom, sulfur atom, NQ.sup.3, N(Q.sup.3)C(O)N(Q.sup.4)-, C(O)N(Q.sup.3)-, or N(Q.sup.3)C(O) wherein: Each Q.sup.3 and Q.sup.4 is independently hydrogen atom, methyl group, ethyl group, propyl group, isopropyl group, acetyl group, trifluoroacetyl group, phenoxyacetyl group, benzoyl group, or 9-fluorenylmethyloxycarbonyl group; G is selected from hydrogen, a substituted or unsubstituted aliphatic group, a substituted or unsubstituted cycloaliphatic group, a substituted or unsubstituted aromatic group, a substituted or unsubstituted heteroaromatic group, a substituted or unsubstituted heterocyclic group, a nitrogen protecting group, CH.sub.2-L, C(O)-L, C(O)OL, C(O)NHL, S(O)-L, S(O)NHL, SO.sub.2-L, and SO.sub.2NHL, wherein: L is selected from hydrogen, an optionally protected hydroxy group, an optionally protected amino group, or a linking moiety [[(CH.sub.2).sub.gX.sup.1(CH.sub.2).sub.h]X.sup.2[(CH.sub.2).sub.iX.sup.3(CH.sub.2).sub.j]].sub.k-J, wherein: Each g, h, i, j, and k is, independently, an integer from 0 to 6; Each X.sup.1, X.sup.2, and X.sup.3 is, independently, an atom of oxygen, CH.sub.2 group, an atom of sulfur, C(O), SS, S(O), SO.sub.2, NQ.sup.5, C(O)N(Q.sup.5)-, OC(O)N(Q.sup.5)-, N(Q.sup.5)C(O), N(Q.sup.5)C(O)O, N(Q.sup.5)C(O)N(Q.sup.6)-, 1,4-phenylidene, or 1H-1,2,3-triazole-1,4-diyl wherein: Each Q.sup.5 and Q.sup.6 is, independently, hydrogen atom, methyl group, ethyl group, propyl group, isopropyl group, acetyl group, trifluoroacetyl group, phenoxyacetyl group, benzoyl group, or 9-fluorenylmethyloxycarbonyl group; J is selected from a hydrogen atom, an optionally protected hydroxyl group, an optionally protected primary amino group, an optionally protected alkylamino group, a dialkylamino group, a trialkylammonium group, an azido group, an ethynyl group CCH, a hydroxy group alkylated with -tocopherol, a hydroxy group alkylated with optionally protected N-acetyl-D-galactosamine, a primary amino group acylated with a ligand selected from optionally protected fluorescein-5-carboxylic acid, optionally protected fluorescein-6-carboxylic acid, N,N,N,N-tetramethylrhodamine-5-carboxylic acid, N,N,N,N-tetramethylrhodamine-6-carboxylic acid, -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)alkanoic acid, -((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)alkanoic acid, optionally protected biotin, 4-(dimethylamino)-azobenzene-4-carboxylic acid, 4-pyrenylbutyryc acid, triethyl ethylenediaminetetraacetic acid, bicyclo[2.2.1]hept-5-ene-2-carboxylic acid, 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid, 2-((6,6-difluorocyclooct-4-yn-1-yl)oxy)acetic acid, 4-((2,2-difluorocyclooct-3-yn-1-yl)methyl)benzoic acid, 11,12-didehydro--oxo-dibenz[b,f]azocine-5(6H)-butanoic acid, 3-(cyclooctatetraene)propionic acid, lipoic acid, a primary or a secondary amino group sulfonylated with 4-(dimethylamino)-azobenzene-4-sulfonic acid, a primary or a secondary amino group carbamoylated with cholesterylcarbonic acid, a primary or a secondary amino group alkylated with 6-chloro-2-methoxyacridine, an optionally protected carboxy group, a carboxy group forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-methanoisoindol-2-yl)oxy]alkane, a carboxy group forming an amide with 1-amino--[(1,3-dioxo-3a,4,7,7a-tetrahydro-2H-4,7-epoxyisoindol-2-yl)oxy]alkane, a carboxy group forming an amide with 11,12-didehydro-5,6-dihydrodibenz[b,f]azocine;
(30) In a third aspect, the present invention provides methods for synthetic preparation of said oligonucleotide conjugates according to Formula II wherein R.sup.6 is the compound of Formula III: providing a solid support of Formula I wherein one of R and R.sup.1 is hydrogen and the other of R and R.sup.1 is L.sup.1; reacting said solid support of Formula I with a compound of Formula I wherein one of R and R.sup.1 is a hydroxy protecting group and the other of R and R.sup.1 is PA or with a protected nucleoside phosphoramidite building blocks as required by the sequence of a target oligonucleotide conjugate; further reacting said functionalized solid support with a capping agent and optionally treating said functionalized solid support with an oxidizing agent or with a sulfurizing agent. In certain embodiments, said method further comprises: (a) deblocking said hydroxy protecting group to give a reactive hydroxy group; (b) treating said reactive hydroxy group with an additional phosphoramidite building block bearing a further protected hydroxy group to produce an extended compound; (c) reacting the extended compound with a capping reagent; (d) optionally contacting the product of step (b) with an oxidizing or sulfurizing agent; and optionally repeating steps (a)-(d) one or more times to form an oligonucleotide conjugate.
(31) In a fourth aspect, the present invention provides methods for synthetic preparation of said oligonucleotide conjugates according to Formula II wherein R.sup.6 is the compound of Formula IV: providing a compound of Formula I wherein one of R and R.sup.1 is a hydroxy protecting group and the other of R and R.sup.1 is PA; reacting said compound of Formula I or a protected nucleoside phosphoramidite building block, as required by the sequence of a target oligonucleotide conjugate, with a solid support of Formula V wherein one of R.sup.14 and R.sup.15 is hydrogen and the other of R.sup.14 and R.sup.15 is an attachment to a solid phase material;
(32) ##STR00005## further reacting said functionalized solid support with a capping agent and optionally treating said functionalized solid support with an oxidizing agent or with a sulfurizing agent. In certain embodiments, said method further comprises: (a) deblocking said hydroxy protecting group to give a reactive hydroxy group; (b) treating said reactive hydroxy group with an additional phosphoramidite building block bearing a further protected hydroxy group to produce an extended compound; (c) reacting the extended compound with a capping reagent; (d) optionally contacting the product of step (b) with an oxidizing or sulfurizing agent; and optionally repeating steps (a)-(d) one or more times to form an oligonucleotide conjugate.
(33) Certain starting materials used in the present invention are protected nucleoside phosphoramidites readily available from commercial sources (Glen Research, Sterling, Va., ChemGenes, Inc., Waltham, Mass.; Rasayan, Inc., Encinitas, Calif.). 3,3-Bis(hydroxymethyl)azetidine hydrochloride, p/n AZB30083 can be purchased from A2Z Chemicals (Irvine, Calif.).
(34) Commercial compound 1 was first reacted with aqueous formaldehyde in the presence of a catalytic amount of K.sub.2CO.sub.3 to form a product of aldol addition 2, which was, without isolation, reduced to a diol 2. To remove the Boc protection, the latter was treated with an anhydrous
(35) ##STR00006##
solution of hydrogen chloride in dioxane to give a hydrochloride of 4,4-bis(hydroxymethyl)piperidine 3.
(36) N-acylated 4,4-bis(hydroxymethyl)piperidines 5a-5k and 3,3-bis(hydroxymethyl)azetidines 6a-6k (
(37) The obtained compounds 5a-5k and 6a-6k were selectively protected at one of the hydroxy groups by treating with either DMT-Cl or TMT-Cl in pyridine to give compounds 7a-7k, 8a-8k, 9a-9k, and 10a-10k. These were directly converted to phosphoramidite building blocks 11a-11k, 12a-12k, 13a-13k, and 14a-14k by the action of 2-cyanoethyl N,N,NN-tetraisopropylphosphorodiamidite in the presence of 1H-tetrazole and, by treating with succinic anhydride in pyridine, to hemisuccinate esters 15a-15k, 16a-16k, 17a-17k, and 18a-18k. The hemisuccinate esters were, upon activation with TBTU, attached to solid phase materials, aminopropyl-derivatized CPG and aminomethylated MPPS to give solid supports 19a-19k, 20a-20k, 21a-21k, and 22a-22k for the 3-derivatization of synthetic oligonucleotides.
(38) In order to obtain phosphoramidite building blocks and solid supports with an extended side chain, Fmoc protecting group in compounds 7a, 8a, 9a, and 10a was removed first by treatment with piperidine in methanol to give compounds 23, 24, 25, and 26 followed by the selective acylation of the latter compounds at their amino group with the respective carboxylic acids upon activation of the latter with HOBT and EDC-HCl (
(39) To obtain phosphoramidite building blocks and solid supports derivatized with Dabsyl group at the side chain, compounds 19-22 were first sulfonylated at the amino function by treating with Dabsyl chloride in the presence of TEA (
(40) To afford synthetic tools for introduction of D-biotin into synthetic oligonucleotides, phosphoramidite building blocks 63 and 64 and solid supports 67, 68 were synthesized (
(41) The utility of a ureido linkage for construction of non-nucleosidic phosphoramidites and solid supports was demonstrated by synthesis of N-acetyl-D-galactosamine-derivatized phosphoramidite building blocks 71 and 76 and solid supports 74 and 78 as disclosed in
(42) TABLE-US-00001 TABLE 1 Structures of Radicals R and R.sup.2 in Compounds 5-58. Compound # R R.sup.2 5a-22a
(43) The non-nucleosidic phosphoramidite building blocks and solid supports synthesized as disclosed above were tested in preparation of oligonucleotide conjugates derivatized at the 5- or the 3-termini, respectively. The following oligonucleotides wherein X stands for a non-nucleosidic moiety were synthesized:
(44) TABLE-US-00002 (SEQ ID NO: 1) 5-X-(Tp).sub.11T-3; (SEQIDNO:2) 5-(Tp).sub.15-X-3; (SEQIDNO:3) 5-X-d(TAGTGCTAGATGCCT)-3; (SEQIDNO:3) 5-d(TAGTGCTAGATGCCT)-X-3; (SEQIDNO:4) 5-X-d(CCACTACCTGAGCACCCAGTT)-3; (SEQIDNO:4) 5-d(CCACTACCTGAGCACCCAGTT)-X-3; (SEQIDNO:5) 5-X-d(CTGGGTGCTCAGGTAGTGGTT)-3; (SEQIDNO:5) 5-d(CTGGGTGCTCAGGTAGTGGTT)-X-3; (SEQIDNO:5) 5-X-d(CTGGGTGCTCAGGTAGTGGTT)-3 phosphorothioate; 5 (SEQIDNO:5) 5-d(CTGGGTGCTCAGGTAGTGGTT)-X-3 phosphorothioate.
(45) The final cleavage and deprotection of nucleic bases was carried out by treating the solid support-bound, 5-DMT or 5-TMT-protected oligonucleotides under the following conditions widely accepted in the industry: 1. Conc. aqueous ammonium hydroxide for 8 h at 65 C. 2. Treatment with a mixture of diethylamine and acetonitrile (5:1) for 3 min followed by acetonitrile wash and final deprotection with conc. aqueous ammonium hydroxide for 8 h at 65 C. 3. A mixture of conc. aqueous ammonium hydroxide with 40% aqueous methylamine (1:1) for 15 min at 65 C. 4. Treatment with a mixture of diethylamine and acetonitrile (5:1) for 3 min followed by acetonitrile wash and final deprotection with a solution of ethylenediamine in toluene (1:1) for 2 h at room temperature, acetonitrile wash, and eltion of the product with water. 5. 50 mM K.sub.2CO.sub.3 in methanol at room temperature.
Crude reaction mixtures were analyzed by reverse-phase HPLC and by ES MS to demonstrate that the non-nucleosidic moieties were stable under all tested conditions except for 50 mM K.sub.2CO.sub.3 in methanol.
(46) Accordingly, the efficient preparation of analogs of oligonucleotides modified with ligands of practical interest and their phosphorothioate analogs using the novel non-nucleosidic solid supports and phosphoramidite building blocks described herein has been demonstrated. Said solid supports and phosphoramidite building blocks can be readily synthesized by artisans possessing ordinary skills. Conveniently, oligonucleotide analogs synthesized using said solid supports and phosphoramidite building blocks are stable under the most common basic deprotection conditions and do not possess any additional stereoheterogeneity.
EXAMPLES
(47) The following examples are intended to further illustrate certain preferred embodiments of the invention and are not intended to be limiting in their nature.
(48) General Information
(49) Protected 2-deoxynucleoside 2-cyanoethyl phosphoramidites, protected ribonucleoside 2-cyanoethyl phosphoramidites, 5-O-DMT-thymidine CPG500, and all ancillary reagents for oligonucleotide synthesis were purchased from Glen Research (Sterling, Va.). Sulfurizing reagent, N-(3-thioxo-3H-1,2,4-dithiazol-5-yl)-N,N-dimethylmethanimidamide was prepared as disclosed in U.S. Pat. No. 7,723,582. Anhydrous MeCN was purchased from Honeywell Burdick & Jackson (Muskegon, Mich.). All other chemicals were purchased from TCI America (Portland, Oreg.).
Example 1
(50) ##STR00032##
4,4-Bis(hydroxymethyl)piperidine hydrochloride 3
(51) Dipotassium carbonate (32.2 g, 0.233 mol) was added to a stirred mixture of compound 1 (AK Scientific, 99.5 g, 0.466 mol), water (250 mL), methanol (350 mL), and formaldehyde (37.85 g of 37%, 0.466 mol) at 0 C. and was then kept for 18 h at 0 C. The solvent was evaporated to about 30% of the initial volume, and the mixture was extracted with ethyl acetate (5100 mL). The organic phase was washed with water, brine, dried over Na.sub.2CO.sub.3, and evaporated to dryness. The crude material was dissolved in methanol (400 mL), and NaBH.sub.4 (39.51 g, 2.24 eq) was added at 0 C. over 30 min. The reaction mixture was stirred for 30 min at 0 C. and overnight at room temperature. The mixture was quenched with concentrated NH.sub.4Cl solution and evaporated to about 25% of the initial volume. This was extracted with ethyl acetate (6100 mL) and washed with brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The solid obtained was re-crystallized from ethyl acetate/hexanes (1:3) to give 70.25 g (61.4%) of pure diol 2.
(52) Cold HCl in dioxane (4.25N, 100 mL) was added to compound 2 (26.14 g, 0.107 mol) dissolved in DCM (50 mL) over 15 min at 0 C. The mixture was kept at room temperature for 24 h and evaporated. The residue was stirred with anhydrous ether, and the solid formed was filtered off, washed with ether, and dried in vacuo to give compound 3 (19.03 g, 98.2%) as a white hygroscopic solid.
Example 2
(53) ##STR00033##
(9H-fluoren-9-yl)methyl (6-(4,4-bis(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)carbamate 5a
(54) A solution of N-Fmoc-6-aminohexanoic acid (Chem Impex International, Inc., 3.533 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DCM (40 mL) was stirred at room temperature for 30 min. Compound 3 (2.276 g, 12.53 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 4.26 g (88.6%) of diol 5a as a white solid foam.
(55) NMR H.sup.1 (, CDCl.sub.3): 7.73-7.74 (m, 2H), 7.57-7.59 (m, 2H), 7.36-7.39 (m, 2H), 7.26-7.30 (m, 2H), 5.25 (br. s, J=5 Hz), 4.35 (d, J=7.0 Hz), 4.19 (t, J=7.0 Hz, 1H), 3.59 (s, 4H), 3.53 (br. s, 2H), 3.37 (br. s, 2H), 3.16 (q, J=6.5 Hz, 2H), 2.29 (m, 2H), 1.33-1.60 (m, 10H).
(56) NMR C.sup.13 (, CDCl.sub.3): 172.0, 156.8, 144.1 (2C), 141.4 (2C), 127.8 (2C), 127.2 (2C), 125.2 (2C), 120.1 (2C), 68.0, 66.7, 47.4, 41.9, 40.9, 37.9, 37.7, 33.3, 29.8, 29.5, 28.7, 26.6, 24.9.
(57) ##STR00034##
Example 3
N-(6-(4,4-bis(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)-2,2,2-trifluoroacetamide 5b
(58) N-Trifluoroacetyl-6-aminohexanoic acid prepared as disclosed in Jagt, R. B. C.; Gomez-Biagi, R. F.; Nitz M. Angew. Chem., Int. Ed. 2009, 48(11), 1995. Compound 3 (4.54 g, 20 mmol), N,N,N,N-tetramethyl-O-(benzotriazol-1-yl)uronium tetrafluoroborate (TBTU, 7.06 g, 22 mmol), 4-(N,N-dimethylamino)pyridine (DMAP, 0.35 g, 2.86 mmol) were suspended in 30 mL of dry acetonitrile, then diisopropylethylamine (DIPEA, 3.10 g, 24 mmol) was added. The clear reaction mixture was stirred at room temperature for 15 min.
(59) A stirred suspension of hydrochloride 3 (4.00 g, 22 mmol) in acetonitrile (28 mL), dry DCM (50 mL), and N,N-diisopropylethylamine (DIPEA, 3.36 g, 26 mmol) was sonicated in ultrasound bath for 10 min. The suspension was combined with the solution of the reactive ester prepared above under stirring at 0 C. After stirring at room temperature for 18 h, the mixture was concentrated in vacuo, treated with concentrated aqueous solution of sodium bicarbonate (10 mL) plus solid NaHCO.sub.3 (5 g) and extracted with ethyl acetate (7200 mL). The combined organic extracts were dried over sodium sulfate, filtered, and concentrated on rotary evaporator. The crude material obtained was re-crystallized from ethyl acetate/hexanes to give 5.52 g (77.9%) of compound 5b as white needles (m.p. 84-86 C.). The mother liquor was concentrated and purified on flash column (silica gel, 2-20% MeOH in DCM) to give another 1.50 g of compound 5b (total yield of 99.0%).
(60) NMR H.sup.1 (, CDCl.sub.3): 7.03 (br. s, 1H), 3.68 (d, J=5.0 Hz, 4H), 3.57-3.59 (m, 2H), 3.40-3.45 (m, 4H), 2.34 (t, J=5.0 Hz, 2H), 2.28 (br. t, J=5.0 Hz, 2H), 1.57-1.68 (m, 6H), 1.44-1.46 (m, 2H), 1.37-1.40 (m, 2H).
(61) NMR C.sup.13 (, CDCl.sub.3): 157.5 (q, J.sub.CF=36.2 Hz), 116.1 (q, J.sub.CF=286.2 Hz), 69.1, 41.7, 39.4, 37.8, 32.9, 29.5, 28.8, 28.3, 26.18, 23.8.
Example 3
(62) ##STR00035##
1-(4,4-bis(hydroxymethyl)piperidin-1-yl)hept-6-yn-1-one 5d
(63) A solution of 7-heptynoic acid (Chem Impex International, Inc., 1.26 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DCM (40 mL) was stirred at room temperature for 30 min. Compound 3 (2.276 g, 12.53 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 2.341 g (92.4%) of diol 5d as a white solid.
Example 4
(64) ##STR00036##
1-(4,4-bis(hydroxymethyl)piperidin-1-yl)-5-(pyren-1-yl)pentan-1-one 5e
(65) Solution of 4-(pyren-1-yl)butanoic acid (0.993 g, 3.44 mmol), TBTU (1.16 g, 3.61 mmol), and DIPEA (1.5 mL, 8.6 mmol) dissolved in NMP (13 g) was stirred for 15 min and added to compound 3 (1.93 g, 3.44 mmol) in NMP (9 g) at 0 C. followed by stirring at this temperature for 1 h. The reaction mixture was diluted with ethyl acetate (200 mL), washed with concentrated NaHCO.sub.3 and brine (8 times). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The product was isolated on a silica gel column (50% hexanes in DCM to 5% MeOH, DCM) to give compound 5e (2.517 g, 88.1%).
Example 5
(66) ##STR00037##
Bicyclo[2.2.11]hept-5-en-2-yl(4,4-bis(hydroxymethyl)piperidin-1-yl)methanone 5f
(67) A solution of bicyclo[2.2.1]hept-5-ene-2-carboxylic acid (Alfa Aesar, 1.38 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DCM (40 mL) was stirred at room temperature for 30 min. Compound 3 (2.276 g, 12.53 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 2.444 g (92.1%) of diol 5f as a white solid.
Example 6
(68) ##STR00038##
2-(bicyclo[2.2.1]hept-5-en-2-yl)-1-(4,4-bis(hydroxymethyl)piperidin-1-yl)ethan-1-one 5g
(69) A solution of 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid (Alfa Aesar, 1.52 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DCM (40 mL) was stirred at room temperature for 30 min. Compound 3 (2.276 g, 12.53 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 2.615 g (93.6%) of diol 5g as a white solid.
Example 7
(70) ##STR00039##
2-(2-(2-(4,4-bis(hydroxymethyl)piperidin-1-yl)-2-oxoethoxy)ethoxy)-3a,4,7,7a-tetrahydro-1H-4,7-epoxyisoindole-1,3(2H)-dione 5h
(71) A solution of 2-(2-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)ethoxy)acetic acid (2.83 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DMF (40 mL) was stirred at room temperature for 30 min. Compound 3 (2.276 g, 12.53 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, diluted with ethyl acetate (200 mL), washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 3.439 g (83.8%) of diol 5h as a white solid.
Example 8
(72) ##STR00040##
2-((6-(4,4-bis(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)oxy)-3a,4,7,7a-tetrahydro-1H-4,7-epoxyisoindole-1,3(2H)-dione 5i
(73) A solution of 6-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)hexanoic acid (2.95 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DMF (40 mL) was stirred at room temperature for 30 min. Compound 3 (2.276 g, 12.53 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, diluted with ethyl acetate (200 mL), washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 3.223 g (76.3%) of diol 5i as a white solid.
Example 9
(74) ##STR00041##
(R)-1-(4,4-bis(hydroxymethyl)piperidin-1-yl)-5-(1,2-dithiolan-3-yl)pentan-1-one 5j
(75) A solution of (R)-5-(1,2-dithiolan-3-yl)pentanoic acid (2.06 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DMF (40 mL) was stirred at room temperature for 30 min. Compound 3 (2.276 g, 12.53 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, diluted with ethyl acetate (200 mL), washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 2.271 g (68.1%) of diol 5j as a white solid.
Example 10
(76) ##STR00042##
N-(8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3,6-dioxaoctanoyl)-4,4-bis(hydroxymethyl)piperidine 5k
(77) A solution of 8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3,6-dioxaoctanoic acid (4.93 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DMF (40 mL) was stirred at room temperature for 30 min. Compound 3 (2.276 g, 12.53 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, diluted with ethyl acetate (200 mL), washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 4.522 g (72.9%) of diol 5k as a white solid.
(78) ##STR00043##
Example 11
(9H-fluoren-9-yl)methyl (6-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)carbamate 7a
(79) DMTrCl (3.24 g, 9.56 mmol) was gradually added to a stirred solution of compound 5a (4.38 g, 9.11 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 7a (3.515 g, 49.3%).
(80) NMR H.sup.1 (, CD.sub.3CN): 7.81-7.83 (m, 2H), 7.63-7.65 (m, 2H), 7.39-7.45 (m, 4H), 7.28-7.34 (m, 8H), 7.20-7.23 (m, 1H), 6.84-6.87 (m, 4H), 5.69 (br. s, 1H), 4.31 (d, J=7.0 Hz, 2H), 4.21 (t, J=7.0, 1H), 3.75 (s, 6H), 3.54 (d, J=5.0 Hz, 2H), 3.43-3.50 (m, 1H), 3.30-3.36 (m, 1H), 3.00-3.10 (m, 4H), 3.02 (s, 2H), 2.64 (t, J=5.0 Hz, 1H), 2.22 (t, J=7.5 Hz, 2H), 1.23-1.53 (m, 10H).
(81) ##STR00044##
Example 12
6-amino-1-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)hexan-1-one 23
(82) Compound 7a (3.515 g, 4.49 mmol) was treated with of 10% piperidine in MeOH (100 mL) overnight. The reaction mixture was evaporated, co-evaporated with xylenes, and separated on a silica gel column (1% NH.sub.4OH, 3% MeOH in DCM to 2% NH.sub.4OH, 10% MeOH in DCM) to give pure amine 23 (1.966 g, 78.1%) of as a white solid foam.
(83) NMR H.sup.1 (, DMSO-d.sub.6): 7.36-7.40 (m, 2H), 7.28-7.33 (m, 2H), 7.24-7.26 (m, 4H), 7.18-7.23 (m, 1H), 6.87-6.91 (m, 4H), 3.73 (s, 6H), 3.47 (s, 2H), 3.27-3.41 (m, 2H), 2.96-3.05 (m, 2H), 2.93 (s, 2H), 2.20 (t, 7.0 Hz), 1.20-1.46 (m, 10H).
(84) NMR C.sup.13 (, DMSO-d.sub.6): 170.2, 157.9 (2C), 145.2, 135.9 (2C), 129.7 (4C), 127.7 (2C), 127.7 (2C), 126.5, 113.0 (4C), 84.9, 64.2, 64.0, 55.0 (2C), 41.5, 40.9, 39.3, 39.2, 39.0, 37.6, 33.1, 32.3, 26.1, 24.7.
Example 13
(85) ##STR00045##
6-Amino-1-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-1-yl)hexan-1-one 24
(86) A mixture of compound 5b (5.64 g, 15.9 mmol), 1,1,1-trimethoxyethane (3.82 g, 31.8 mmol), trifluoroacetic acid (0.05 mL), and acetonitrile (17 mL) was briefly heated at 60 C. and then was stirred at room temperature for 40 min. The reaction mixture was concentrated to of its original volume and water (0.715 g, 39.7 mmol) was added. After heating at 60 C. for 1 h, the mixture was concentrated in vacuo, co-evaporated five times with toluene, dissolved in anhydrous DCM (20 mL), mixed with DIPEA (4.40 g, 34.04 mmol), and dried over freshly flamed molecular sieves 4A (1.0 g) for 1 h at stirring. The reaction mixture was treated with 4, 4, 4-trimethoxytrityl chloride (7.05 g, 19.11 mmol) at 0 C. and was stirred at room temperature for 18 h. The mixture obtained was diluted with ethyl acetate (200 mL), washed sequentially with concentrated aqueous sodium bicarbonate, dilute aqueous citric acid (pH 6), and brine. The organic phase was dried over Na.sub.2SO.sub.4, filtered, and evaporated. Sample (0.1 g) of the crude compound 7 was purified for analytical purposes (flash column, silica gel, 2-5% MeOH in DCM).
(87) NMR H.sup.1 (, CDCl.sub.3): 7.39 (br. s, 1H), 7.26-7.30 (m, 6H), 6.80-6.82 (m, 6H), 4.14, 4.19 (AB, J=10.0 Hz, 2H), 3.77 (s, 9H), 2.58-3.62 (m, 1H), 3.34-3.38 (m, 3H), 2.19-2.23 (m, 1H), 3.04-3.11 (m, 3H), 2.25-2.28 (m, 2H), 1.97 (s, 3H), 1.55-1.62 (m, 4H), 1.46-1.54 (m, 4H), 1.32-1.38 (m, 2H).
(88) NMR C.sup.13 (, CDCl.sub.3): 171.1, 171.2, 158.5, 157.5 (q, J.sub.CF=36.2 Hz), 136.6, 129.9, 116.3 (q, J.sub.CF=286.1 Hz), 113.2, 85.6, 67.1, 63.7, 55.3, 53.6, 41.4, 39.4, 37.5, 37.0, 32.8, 30.3, 29.5, 28.3, 26.2, 23.9, 20.9.
(89) The remaining crude 7 was dissolved in a mixture of methanol (30 mL) and conc. aqueous ammonia (32%, 30 mL) and heated in a pressure-resistant flask at 55 C. for 5 days. The resulting mixture was evaporated, co-evaporated with toluene, and separated on a silica gel column using a step gradient of conc. aqueous ammonia and MeOH in DCM from 1:3:96 to 2:10:88 to give pure amine 24 (8.98 g, 95.6%) as a white solid foam.
(90) NMR H.sup.1 (, CDCl.sub.3): 7.26-7.30 (m, 6H), 6.81-6.84 (m, 6H), 3.78 (s, 9H), 3.55-3.62 (m, 2H), 3.46-3.54 (m, 1H), 3.30-3.42 (m, 2H), 3.15-3.21 (m, 1H), 3.05-3.14 (m, 2H), 2.29 (br. s, 3H), 2.69 (t, J=7.0 Hz, 2H), 2.26 (t, J=5.5 Hz, 2H), 1.57-1.62 (m, 4H), 1.44-1.50 (m, 4H), 1.33-1.36 (m, 2H).
(91) NMR C.sup.13 (, CDCl.sub.3): 171.6, 158.7, 136.3, 129.9, 113.4, 86.2, 67.8, 67.6, 55.4, 42.0, 41.7, 37.9, 37.7, 33.4, 33.2, 30.2, 29.4, 26.8, 25.2.
Example 14
(92) ##STR00046##
N-(6-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)-2,2,2-trifluoroacetamide 7b
(93) Compound 23 (1.873 g, 3.34 mmol) was dissolved in DCM (10 g), and treated with triethylamine (0.1 mL) and methyltrifluoroacetate (0.855 g, 6.68 mmol) at 30 C. for 4 h. The reaction mixture was evaporated and purified on a silica gel column (50% hexanes/DCM.fwdarw.4% MeOH/DCM) to give compound 7b (1.673 g, 78.6%).
Example 15
(94) ##STR00047##
N-(6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)-2,2,2-trifluoroacetamide 8b
(95) Compound 24 (2.127 g, 3.6 mmol) was dissolved in DCM (10 g), and treated with triethylamine (0.1 mL) and methyltrifluoroacetate (0.922 g, 7.2 mmol) at 30 C. for 4 h. The reaction mixture was evaporated and purified on a silica gel column (50% hexanes/DCM.fwdarw.4% MeOH/DCM) to give compound 8b (1.914 g, 77.4%).
Example 16
(96) ##STR00048##
1-(4-(hydroxymethyl)-4-(((4,4,4-trimethoxytrityl)oxy)methyl)piperidin-1-yl)hept-6-yn-1-one 8d
(97) Trimethoxytrityl chloride (3.69 g, 10 mmol) was gradually added to a stirred solution of compound 5d (2.533 g, 10 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 8d (2.87 g, 49.0%).
Example 17
(98) ##STR00049##
1-(4-(hydroxymethyl)-4-(((4,4,4-trimethoxytrityl)oxy)methyl)piperidin-1-yl)-4-(pyren-1-yl)butan-1-one 8e
(99) Trimethoxytrityl chloride (1.85 g, 5 mmol) was gradually added to a stirred solution of compound 5e (2.078 g, 5 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 8e (1.960 g, 52.4%).
Example 18
(100) ##STR00050##
N-(bicyclo[2.2.1]hept-5-en-2-carbonyl)-4-(hydroxymethyl)-4-((4,4,4-trimethoxytrityl)oxy)methylpiperidine 8f
(101) Trimethoxytrityl chloride (1.85 g, 5 mmol) was gradually added to a stirred solution of compound 5f (1.327 g, 5 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 8f (1.635 g, 54.7%).
Example 19
(102) ##STR00051##
N-(2-(bicyclo[2.2.1]hept-5-en-2-yl)acetyl)-4-(hydroxymethyl)-4-((4,4,4-trimethoxytrityl)oxy)methylpiperidine 8g
(103) Trimethoxytrityl chloride (2.951 g, 8 mmol) was gradually added to a stirred solution of compound 5g (2.235 g, 8 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 8g (2.873 g, 58.7%).
Example 20
(104) ##STR00052##
2-(2-(2-(4-(hydroxymethyl)-4-(((4,4,4-trimethoxytrityl)oxy)methyl)piperidin-1-yl)-2-oxoethoxy)ethoxy)-3a,4,7,7a-tetrahydro-1H-4,7-epoxyisoindole-1,3(2H)-dione 8h
(105) Trimethoxytrityl chloride (3.689 g, 10 mmol) was gradually added to a stirred solution of compound 5h (4.104 g, 10 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 8h (4.013 g, 53.3%).
Example 21
(106) ##STR00053##
2-((6-(4-(hydroxymethyl)-4-(((4,4,4-trimethoxytrityl)oxy)methyl)piperidin-1-yl)-6-oxohexyl)oxy)-3a,4,7,7a-tetrahydro-1H-4,7-epoxyisoindole-1,3(2)-dione 8i
(107) Trimethoxytrityl chloride (3.689 g, 10 mmol) was gradually added to a stirred solution of compound 5i (4.225 g, 10 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 8i (3.918 g, 51.9%).
Example 22
(108) ##STR00054##
(R)-1-(4-(hydroxymethyl)-4-(((4,4,4-trimethoxytrityl)oxy)methyl)piperidin-1-yl)-5-(1,2-dithiolan-3-yl)pentan-1-one 8j
(109) Trimethoxytrityl chloride (3.689 g, 10 mmol) was gradually added to a stirred solution of compound 5j (3.335 g, 10 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 8j (2.823 g, 42.4%).
Example 23
(110) ##STR00055##
N-(8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3,6-dioxaoctanoyl)-(4-(hydroxymethyl)-4-(((4,4,4-trimethoxytrityl)oxy)methyl)piperidine 8k
(111) Trimethoxytrityl chloride (3.689 g, 10 mmol) was gradually added to a stirred solution of compound 5k (6.207 g, 10 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 8k (5.042 g, 52.9%).
Example 24
(112) ##STR00056##
(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(2,2,2-trifluoroacetamido)hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 11b
(113) Compound 7a (1.580 g, 2.41 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.943 g, 3.13 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 0.96 mmol, 2.14 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 11b (1.58 g, 76.5%) as a white solid foam.
Example 25
(114) ##STR00057##
(4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(6-(2,2,2-trifluoroacetamido)hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12b
(115) Compound 8b (1.374 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.784 g, 2.6 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.0 mmol, 2.22 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12b (1.38 g, 74.3%) as a white solid foam.
Example 26
(116) ##STR00058##
(4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(7-heptynoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12d
(117) Compound 8d (1.464 g, 2.5 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.980 g, 3.2 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.25 mmol, 2.78 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12d (1.619 g, 82.4%) as a white solid foam.
Example 27
(118) ##STR00059##
(4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(4-(pyren-1-yl)butanoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12e
(119) Compound 8e (1.374 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.784 g, 2.6 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.0 mmol, 2.22 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12e (1.453 g, 76.6%) as a white solid foam.
Example 28
(120) ##STR00060##
(1-(bicyclo[2.2.1]hept-5-ene-2-carbonyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12f
(121) Compound 8f (0.956 g, 1.6 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.627 g, 2.08 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 0.8 mmol, 1.78 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12f (1.122 g, 87.9%) as a white solid foam.
Example 29
(122) ##STR00061##
(1-(2-(bicyclo[2.2.1]hept-5-en-2-yl)acetyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12g
(123) Compound 8g (1.224 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.784 g, 2.6 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.0 mmol, 2.22 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12g (1.366 g, 84.1%) as a white solid foam.
Example 30
(124) ##STR00062##
(1-(2-(3-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-methanoisoindol-2-yl)oxy)propoxy)acetyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12h
(125) Compound 8h (1.510 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.784 g, 2.6 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.0 mmol, 2.22 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12h (1.57 g, 82.2%) as a white solid foam.
Example 31
(126) ##STR00063##
(1-(6-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12i
(127) Compound 8i (1.510 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.784 g, 2.6 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.0 mmol, 2.22 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12i (1.543 g, 80.8%) as a white solid foam.
Example 32
(128) ##STR00064##
(1-(5-((R)-1,2-dithiolan-3-yl)pentanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl) piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12j
(129) Compound 8j (1.332 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.784 g, 2.6 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.0 mmol, 2.22 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12j (1.270 g, 73.3%) as a white solid foam.
(130) ##STR00065##
Example 33
(N-(8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy-j-D-galactopyranosyl)oxy)-3,6-dioxaoctanoyl)-4-(((4,4,4-trimethoxytrityl)oxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 12k
(131) Compound 8k (1.906 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.784 g, 2.6 mmol) in anhydrous acetonitrile (25 mL) were shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.0 mmol, 2.22 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The mixture was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 12k (1.541 g, 66.8%) as a white solid foam.
Example 34
(132) ##STR00066##
Triethylammonium 4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(2,2,2-trifluoroacetamido)-hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 15b
(133) Compound 7b (0.073 g, 0.111 mmol), succinic anhydride (0.434 g, 4.34 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 15b (0.151 g, 56.7%).
Example 35
(134) ##STR00067##
Triethylammonium 4-((4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(6-(2,2,2-trifluoroacetamido)-hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 16b
(135) Compound 8b (1.373 g, 2.0 mmol), succinic anhydride (0.600 g, 6.0 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 16b (1.575 g, 88.7%).
Example 36
(136) ##STR00068##
Triethylammonium 4-((1-(hept-6-ynoyl)-4-((tris(4-methoxyphenyl)methoxy) methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 16d
(137) Compound 8d (1.171 g, 2.0 mmol), succinic anhydride (0.600 g, 6.0 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 16d (1.433 g, 91.1%).
Example 37
(138) ##STR00069##
Triethylammonium 4-oxo-4-((1-(4-(pyren-1-yl)butanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)butanoate 16e
(139) Compound 8e (1.496 g, 2.0 mmol), succinic anhydride (0.600 g, 6.0 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 16e (1.572 g, 82.8%).
Example 38
(140) ##STR00070##
Triethylammonium 4-((1-(bicyclo[2.2.1]hept-5-ene-2-carbonyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 16f
(141) Compound 8f (1.195 g, 2.0 mmol), succinic anhydride (0.600 g, 6.0 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 16f (1.346 g, 84.2%).
Example 39
(142) ##STR00071##
Triethylammonium 4-((1-(2-(bicyclo[2.2.1]hept-5-en-2-yl)acetyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 16g
(143) Compound 8g (1.224 g, 1.5 mmol), succinic anhydride (0.450 g, 4.5 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 16g (1.357 g, 83.5%).
Example 40
(144) ##STR00072##
Triethylammonium 4-((1-(6-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 16i
(145) Compound 8i (1.661 g, 1.5 mmol), succinic anhydride (0.660 g, 6.6 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 16i (1.487 g, 70.7%).
Example 41
(146) ##STR00073##
Triethylammonium (R)-4-((1-(5-(1,2-dithiolan-3-yl)pentanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 16j
(147) Compound 8j (1.099 g, 1.65 mmol), succinic anhydride (0.495 g, 4.95 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 16j (1.057 g, 73.9%).
Example 42
(148) ##STR00074##
Triethylammonium (N-(8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3,6-dioxaoctanoyl)-4-(((4,4,4-trimethoxytrityl)oxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 16k
(149) Compound 8k (2.954 g, 3.1 mmol), succinic anhydride (0.931 g, 9.3 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 16k (3.02 g, 84.4%).
Example 43
(150) ##STR00075##
N-(6-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-1-yl)-6-oxohexyl)-6-(2,2,2-trifluoroacetamido)hexanamide 28a
(151) 6-(trifluoroacetamido)hexanoic acid (Chemimpex, 0.631 g, 5.25 mmol), HOBt (0.804 g, 5.25 mmol) and EDC-HCl (1.006 g, 5.25 mmol) were dissolved in DCM (25 mL) and stirred at room temperature for 30 min. At 0 C. amine 24 (2.45 g, 4.37 mmol) and DIPEA (1.358 g, 10.5 mmol) were added. The reaction mixture was stirred 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give 2.604 g (74.5%) compound 28a as a white solid foam.
Example 44
(152) ##STR00076##
N-(6-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)hept-6-ynamide 27b
(153) Hept-6-ynoic acid (TCI America, 0.529 g, 4.20 mmol), HOBt (0.643 g, 4.20 mmol) and EDC-HCl (0.805 g, 4.20 mmol) were dissolved in DCM (20 mL) and stirred at room temperature for 30 min. At 0 C. amine 23 (1.960 g, 3.50 mmol) and DIPEA (1.086 g, 8.4 mmol) were added. The reaction mixture was stirred 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give 2.123 g (90.7%) compound 27b as a white dry foam.
Example 45
(154) ##STR00077##
N-(6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)hept-6-ynamide 28b
(155) Hept-6-ynoic acid (TCI America, 0.303 g, 2.4 mmol), HOBt (0.367 g, 2.40 mmol) and EDC-HCl ((0.46 g, 2.4 mmol) were dissolved in DCM (20 mL) and stirred at room temperature for 30 min. At 0 C. amine 24 (1.960 g, 2.0 mmol) and DIPEA (0.620 g, 4.8 mmol) were added. The reaction mixture was stirred 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give 1.320 g (94.4%) compound 28b as a white dry foam.
Example 18
(156) ##STR00078##
N-(6-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)-4-(pyren-1-yl)butanamide 27c
(157) Solution of 4-(pyren-1-yl)butanoic acid (0.993 g, 3.44 mmol), TBTU (1.16 g, 3.61 mmol), and DIPEA (1.5 mL, 8.6 mmol) dissolved in NMP (13 g) was stirred for 15 min and added to compound 23 (1.93 g, 3.44 mmol) in NMP (9 g) at 0 C. followed by stirring at this temperature for 1 h. The reaction mixture was diluted with ethyl acetate (200 mL), washed with concentrated NaHCO.sub.3 and brine (8 times). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The product was isolated on a silica gel column (50% hexanes in DCM to 5% MeOH, DCM) to give compound 27c (2.517 g, 88.1%).
(158) NMR H.sup.1 (, DMSO-d.sub.6): 8.36 (d, J=9.5 Hz, 1H), 8.23-8.27 (m, 2H), 8.19-8.23 (m, 2H), 8.08-8.13 (m, 2H), 8.03 (t, J=8.0 Hz, 1H), 7.92 (d, J=8.0 Hz, 1H), 7.79 (t, J=5.5 Hz, 1H, NH), 7.35-7.33 (m, 2H), 7.27-7.31 (m, 2H), 7.18-7.26 (m, 5H), 6.84-6.88 (m, 4H), 4.54 (t, J=5.0 Hz, 1H, OH), 3.71 (s, 6H), 3.43 (d, J=5.0 Hz, 2H), 3.20-3.36 (m, 2H), 3.04 (q, J=7.0 Hz, 2H), 2.84-3.0 (m, 2H), 2.90 (s, 2H), 2.20 (t, J=7.0, 2H), 2.17 (t, J=7.5 Hz, 2H), 1.97-2.03 (m, 2H), 1.20-1.45 (m, 10H).
(159) NMR C.sup.13 (, DMSO-d.sub.6): 171.6, 170.1, 157.9 (2C), 145.2, 136.5, 135.9 (2C), 130.8, 130.4, 129.7, 129.2, 128.1, 127.7, 127.6, 127.4, 127.4, 127.1, 126.6, 126.4, 126.0, 124.9, 124.7, 124.2, 124.1, 123.4, 113.0, 84.9, 64.2, 64.0, 55.0, 40.0, 39.0, 37.6, 35.0, 32.2, 29.0, 28.5, 27.5, 26.1, 24.5.
Example 46
(160) ##STR00079##
N-(6-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-1-yl)-6-oxohexyl)-4-(pyren-1-yl)butanamide 28c
(161) 4-(pyren-1-yl)butanoic acid (TCI America, 0.623 g, 2.16 mmol), HOBt (0.331 g, 2.16 mmol) and EDC-HCl (0.414 g, 2.16 mmol) were dissolved in DMF (20 mL) and stirred at room temperature for 30 min. At 0 C. amine 24 (1.063 g, 1.80 mmol) and DIPEA (0.558 g, 4.32 mmol) were added. The reaction mixture was stirred 18 h at room temperature, diluted with ethyl acetate (200 mL), washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give 1.341 g (86.5%) compound 28c as a white dry foam.
Example 47
(162) ##STR00080##
N-(6-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-1-yl)-6-oxohexyl)bicyclo[2.2.1]hept-5-ene-2-carboxamide 28d
(163) bicyclo[2.2.1]hept-5-ene-2-carboxylic acid (TCI America, 0.398 g, 2.88 mmol), HOBt (0.441 g, 2.88 mmol) and EDC-HCl (0.552 g, 2.88 mmol) were dissolved in DCM (20 mL) and stirred at room temperature for 30 min. At 0 C. amine 24 (1.418 g, 2.4 mmol) and DIPEA (0.744 g, 5.76 mmol) were added. The reaction mixture was stirred 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give 1.341 g (86.5%) compound 28d as a white dry foam.
Example 48
(164) ##STR00081##
2-(bicyclo[2.2.1]hept-5-en-2-yl)-N-(6-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-1-yl)-6-oxohexyl)acetamide 28e
(165) 2-(bicyclo[2.2.1]hept-5-en-2-yl)acetic acid (TCI America, 0.365 g, 2.4 mmol), HOBt (0.368 g, 2.4 mmol) and EDC-HCl (0.460 g, 2.4 mmol) were dissolved in DCM (20 mL) and stirred at room temperature for 30 min. At 0 C. amine 24 (1.182 g, 2.0 mmol) and DIPEA (0.620 g, 4.8 mmol) were added. The reaction mixture was stirred 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give 1.569 g (90.2%) compound 28e as a white dry foam.
Example 49
(166) ##STR00082##
2-(2-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)ethoxy)-N-(6-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-1-yl)-6-oxohexyl)acetamide 28f
(167) 2-(2-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)ethoxy)acetic acid (0.816 g, 2.88 mmol), HOBt (0.441 g, 2.88 mmol) and EDC-HCl (0.552 g, 2.88 mmol) were dissolved in DCM (20 mL) and stirred at room temperature for 30 min. At 0 C. amine 24 (1.417 g, 2.4 mmol) and DIPEA (0.744 g, 5.76 mmol) were added. The reaction mixture was stirred 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give compound 28f (1.689 g, 82.2%) as a white dry foam.
Example 50
(168) ##STR00083##
6-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)-N-(6-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-1-yl)-6-oxohexyl)hexanamide 28g
(169) 6-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)hexanoic acid (0.709 g, 2.4 mmol), HOBt (0.367 g, 2.4 mmol) and EDC-HCl (0.460 g, 2.4 mmol) were dissolved in DCM (20 mL) and stirred at room temperature for 30 min. At 0 C. amine 24 (1.181 g, 2.0 mmol) and DIPEA (0.620 g, 4.8 mmol) were added. The reaction mixture was stirred 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give compound 28g (1.453 g, 83.7%) as a white dry foam.
Example 51
(170) ##STR00084##
(R)-5-(1,2-dithiolan-3-yl)-N-(6-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-1-yl)-6-oxohexyl)pentanamide 28h
(171) Lipoic acid (0.470 g, 2.28 mmol), HOBt (0.349 g, 2.28 mmol) and EDC-HCl (0.437 g, 2.28 mmol) were dissolved in DMF (20 mL) and stirred at room temperature for 30 min. At 0 C. amine 24 (1.122 g, 1.9 mmol) and DIPEA (0.589 g, 4.56 mmol) were added. The reaction mixture was stirred 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, brine, dried over Na.sub.2SO.sub.4, concentrated and purified on a silica gel column (1-5% MeOH, DCM) to give compound 28h (0.922 g, 62.3%) as a white dry foam.
Example 52
(172) ##STR00085##
4-Hydroxymethyl-4-(((4,4-dimethoxytrityl)oxy)methyl)-N-(5-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)pentenoyl)piperidine 27i
(173) 1-O-(4-carboxybut-1yl)-3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranoside (0.447 g, 1.0 mmol), HOBt (0.184 g, 1.2 mmol) and EDC-HCl (0.230 g, 1.2 mmol) were dissolved in DCM (3 mL) and stirred at room temperature for 30 min. This mixture was added to the solution of amine 23 (0.561 g, 1.0 mmol) and DIPEA (0.310 g, 2.4 mmol) in 10 ml of DCM at 0 C. The reaction mixture was stirred 18 h at room temperature and was diluted with DCM (50 mL). The obtained solution was washed with 5% NaHCO.sub.3, 5% HCl, and brine. The organic phase was dried over Na.sub.2SO.sub.4 and concentrated. The residue was separated on a silica gel column (1-5% MeOH in DCM) to give compound 27i (0.856 g, 86.5%) as a white solid foam.
Example 53
(174) ##STR00086##
4-Hydroxymethyl-4-(((4,4,4-trimethoxytrityl)oxy)methyl)-N-(5-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)butanoyl)piperidine 28i
(175) 1-O-(4-carboxybut-1yl)-3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranoside (10.57 g, 19.79 mmol), HOBt (3.21 g, 23.75 mmol), 4-dimethylaminopyridine (DMAP, 0.09 g), and EDC-HCl (4.55 g, 23.75 mmol) were dissolved in DCM (120 mL) and stirred at room temperature for 30 min. The amine 24 (11.69 g, 19.79 mmol) was added at 0 C., and the mixture was stirred at room temperature for 18 h. The resulting solution was washed with saturated aqueous sodium bicarbonate and brine. The organic phase was dried over sodium sulfate, filtered, and evaporated. The crude product was purified on a silica gel column using a step gradient of MeOH (3 to 8%) in DCM to give compound 28i (18.93 g, 95.1%) as a white solid foam.
(176) NMR H.sup.1 (, CDCl.sub.3): 7.26-7.30 (m, 6H), 6.80-6.84 (m, 6H), 6.45 (br. t, J=9.0 Hz, 1H), 6.20 (br. t, J=5.5 Hz, 1H), 5.33 (d, J=3.0 Hz, 1H), 5.16 (dd, J=11.0, 3.0 Hz, 1H), 4.61 (dd, J=8.0, 4.0 Hz, 1H), 4.00-4.20 (m, 3H), 3.85-3.93 (m, 2H), 3.78 (s, 9H), 3.57-3.63 (m, 2H), 3.45-3.55 (m, 2H), 3.30-3.40 (br. m, 2H), 3.15-3.30 (m, 3H), 3.05-3.15 (m, 2H), 2.45-2.53 (m, 1H), 2.15-2.30 (m, 4H), 2.13 (s, 3H), 2.03 (s, 3H), 1.98 (s, 3H), 1.94 (s, 3H), 1.85-1.91 (m, 2H), 1.55-1.64 (m, 3H), 1.40-1.55 (m, 5H), 1.33-1.40 (m, 2H).
(177) NMR C.sup.13 (, CDCl.sub.3): 173.1, 171.5, 170.9, 170.7, 170.5, 170.5, 158.7, 136.3, 129.9, 113.4, 101.6, 86.3, 70.8, 70.6, 68.7, 67.8, 67.4, 66.9, 61.7, 55.4, 51.4, 41.8, 39.3, 37.9, 37.8, 33.2, 32.9, 30.2, 29.3, 26.8, 25.9, 24.9, 24.8, 23.6, 21.6, 20.9, 20.9.
Example 54
(178) ##STR00087##
Cholest-5-en-3-yl {6-[4-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-4-(hydroxymethyl)piperidin-1-yl]-6-oxohexyl}carbamate 27j
(179) Compound 23 (1.556 g, 2.77 mmol) and sodium bicarbonate (1.11 g, 13.25 mmol) were dissolved in THE (25 ml) and water (12.5 mL) at 5 C., then cholesteryl chloroformate (1.191 g, 2.65 mmol) was added and mixture was stirred at room temperature for 18 h. The reaction mixture was diluted with ethyl acetate and washed with water and brine. The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The residue was purified on a silica gel column (50% hexanes/DCM.fwdarw.5% MeOH/DCM) to give compound 27j (2.11 g, 81.8%).
(180) NMR H.sup.1 (, DMSO-d.sub.6): 7.37-7.39 (m, 2H), 7.27-7.31 (m, 2H), 7.27-7.31 (m, 4H), 7.19-7-25 (m, 1H), 7.00 (t, J=5.5 Hz, 1H, NH), 6.86-6.89 (m, 4H), 5.32 (m, 1H), 4.55 (br. S, 1H, OH), 4.25-4.33 (m, 1H), 3.73 (s, 6H), 3.46 (br. s, 2H), 3.26-3.40 (m, 2H), 2.95-3.03 (br. m, 2H), 2.93 (s, 2H), 2.88-2.93 (m, 2H), 2.14-2.30 (m, 2H), 2.19 (t, J=7.5 Hz, 2H), 1.72-2.00 (m, 5H), 1.45-1.56 (m, 6H), 1.25-1.45 (m, 15H), 1.16-1.25 (m, 6H), 0.85-1.16 (m, 6H), 0.96 (s, 3H), 0.89 (d, J=6.5 Hz, 3H), 0.85 (d, J=7.0 Hz, 3H), 0.84 (d, J=7.0 Hz, 3H), 0.65 (s, 3H).
(181) NMR C.sup.13 (, DMSO-d.sub.6): 170.2, 157.9, 145.2, 135.9, 129.7, 127.7, 127.7, 121.7, 113.0, 84.9, 72.7, 64.3, 64.2, 56.1, 55.5, 55.0, 49.4, 41.8, 40.1, 39.8, 39.0, 38.9, 37.9, 37.6, 36.8, 36.5, 36.0, 35.6, 35.1, 32.3, 31.4, 31.3, 29.1, 29.2, 28.3, 27.8, 27.7, 27.3, 25.9, 24.5, 23.8, 23.1, 22.6, 22.3, 20.5, 18.9, 18.5, 11.6.
Example 55
(182) ##STR00088##
Cholest-5-en-3-yl {6-[4-{[tris(4-methoxyphenyl)methoxy]methyl}-4-(hydroxymethyl)piperidin-1-yl]-6-oxohexyl}carbamate 28j
(183) Compound 24 (1.556 g, 3.1 mmol) and sodium bicarbonate (1.11 g, 13.25 mmol) were dissolved in THF (25 ml) and water (12.5 mL) at 5 C., then cholesteryl chloroformate (1.392 g, 3.1 mmol) was added and mixture was stirred at room temperature for 18 h. The reaction mixture was diluted with ethyl acetate and washed with water and brine. The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The residue was purified on a silica gel column (50% hexanes/DCM.fwdarw.5% MeOH/DCM) to give compound 28j (2.417 g, 77.7%).
Example 56
(184) ##STR00089##
(E)-N-(6-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)-4-((4-(dimethylamino)phenyl)diazenyl)benzamide 27k
(185) 4-Dimethylaminoazobenzene-4-carboxylic acid (TCI America, 0.849 g, 3.15 mmol), TBTU (1.065 g, 3.31 mmol), and DIPEA (1.31 mL, 7.87 mmol), were dissolved in NMP (10 mL) and stirred for 15 min. The obtained solution was added to compound 23 (1.683 g, 3.00 mmol) in NMP (5 g) at 0 C. The mixture was stirred at for 1 h this temperature plus for additional 18 h at room temperature. The reaction mixture was diluted with ethyl acetate (200 mL), washed with conc. aqueous NaHCO.sub.3 and brine (850 mL). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (50% hexanes in DCM to 5% MeOH, DCM) to give compound 27k (1.88 g, 88.1%) as an orange solid foam.
Example 57
(186) ##STR00090##
(E)-N-(6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)-4-((4-(dimethylamino)phenyl)diazenyl)benzamide 28k
(187) 4-Dimethylaminoazobenzene-4-carboxylic acid (TCI America, 0.849 g, 3.15 mmol), TBTU (1.065 g, 3.31 mmol), and DIPEA (1.31 mL, 7.87 mmol), were dissolved in NMP (10 mL) and stirred for 15 min. The obtained solution was added to compound 24 (1.772 g, 3.00 mmol) in NMP (5 g) at 0 C. The mixture was stirred at for 1 h this temperature plus for additional 18 h at room temperature. The reaction mixture was diluted with ethyl acetate (200 mL), washed with conc. aqueous NaHCO.sub.3 and brine (850 mL). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (50% hexanes in DCM to 5% MeOH, DCM) to give compound 28k (2.337 g, 92.5%) as an orange solid foam.
Example 58
(188) ##STR00091##
6-((6-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)carbamoyl)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-3,6-diyl bis(2,2-dimethylpropanoate) 27m
(189) N,N-Dicyclohexylcarbodiimide (DCC, 1.171 g, 5.67 mmol) was added to a solution of 6-carboxyfluorescein dipivaloate (3.00 g, 5.51 mmol) and N-hydroxysuccinimide (0.824 g, 7.16 mmol) in DCM (50 mL) at 0 C., and the mixture was stirred at room temperature for 2 h. Then amine 23 (3.09 g, 5.51 mmol) was added and stirring was continued for 18 h. The solid was filtered off. The filtrate was diluted with ethyl acetate, washed with 5% NaCl acidified with citric acid to pH 4 followed by triethylammonium bicarbonate buffer (pH 7.19). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (0.02% AcOH, 1-3% MeOH, DCM) to give compound 27m (5.78 g, 96.4%).
(190) NMR H.sup.1 (, CD.sub.3CN): 8.11, 8.05 (AB, J=8.0 Hz, 2H), 7.63 (s, 1H), 7.42-7.46 (m, 2H), 7.26-7.32 (m, 6H), 7.25 (t, J=5.0 Hz, 1H, NH), 7.18-7.23 (m, 1H), 7.09-7.12 (m, 2H), 6.88-6.93 (m, 2H), 6.81-6.87 (m, 6H), 3.75 (s, 6H), 3.52 (d, J=5.0 Hz, 2H), 3.36-3.43 (m, 1H), 3.24-3.33 (m, 3H), 2.96-3.03 (m, 2H), 2.99 (s, 2H), 2.65 (t, J=5.5 Hz, 1H, OH), 2.18 (t, J=7.0 Hz), 1.45-1.52 (m, 2H), 1.37-1.42 (m, 2H), 1.30-1.35 (m, 2H), 1.32 (s, 18H), 1.25-1.30 (m, 2H).
(191) NMR C.sup.13 (, CD.sub.3CN): 177.6, 171.9, 169.2, 166.2, 159.7, 154.1, 154.0, 152.6, 146.5, 143.1, 137.4, 131.2 (4C), 130.6, 130.3 (2C), 129.2 (2C), 129.0, 128.9 (2C), 127.8, 126.3, 123.6, 119.3 (2C), 117.2, 114.1 (4C), 111.5 (2C), 86.7, 82.7, 66.5, 65.8, 56.0 (2C), 42.3, 40.5, 39.9, 39.0, 38.2, 33.5, 30.6, 29.9, 29.6, 27.4 (3C), 27.3 (3C), 25.5.
(192) ##STR00092##
Example 59
6-((6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)carbamoyl)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-3,6-diyl bis(2,2-dimethylpropanoate) 28m
(193) N,N-Dicyclohexylcarbodiimide (DCC, 1.171 g, 5.67 mmol) was added to a solution of 6-carboxyfluorescein dipivaloate (3.00 g, 5.51 mmol) and N-hydroxysuccinimide (0.824 g, 7.16 mmol) in DCM (50 mL) at 0 C., and the mixture was stirred at room temperature for 2 h. Then amine 24 (3.249 g, 5.5 mmol) was added and stirring was continued for 18 h. The solid was filtered off. The filtrate was diluted with ethyl acetate, washed with 5% NaCl acidified with citric acid to pH 4 followed by triethylammonium bicarbonate buffer (pH 7.19). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (0.02% AcOH, 1-3% MeOH, DCM) to give compound 28m (5.764 g, 93.8%).
Example 60
(194) ##STR00093##
5-((6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)carbamoyl)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-3,6-diyl bis(2,2-dimethylpropanoate) 28m
(195) N,N-Dicyclohexylcarbodiimide (DCC, 1.171 g, 5.67 mmol) was added to a solution of 5-carboxyfluorescein dipivaloate (3.00 g, 5.51 mmol) and N-hydroxysuccinimide (0.824 g, 7.16 mmol) in DCM (50 mL) at 0 C., and the mixture was stirred at room temperature for 2 h. Then amine 24 (3.249 g, 5.5 mmol) was added and stirring was continued for 18 h. The solid was filtered off. The filtrate was diluted with ethyl acetate, washed with 5% NaCl acidified with citric acid to pH 4 followed by triethylammonium bicarbonate buffer (pH 7.19). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (0.02% AcOH, 1-3% MeOH, DCM) to give compound 28m (5.764 g, 93.8%).
Example 61
(196) ##STR00094##
6-((6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)carbamoyl)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-3,6-diyl bis(2,2-dimethylpropanoate) 28n
(197) N,N-Dicyclohexylcarbodiimide (DCC, 1.171 g, 5.67 mmol) was added to a solution of 6-carboxyfluorescein dipivaloate (3.00 g, 5.51 mmol) and N-hydroxysuccinimide (0.824 g, 7.16 mmol) in DCM (50 mL) at 0 C., and the mixture was stirred at room temperature for 2 h. Then amine 24 (3.249 g, 5.5 mmol) was added and stirring was continued for 18 h. The solid was filtered off. The filtrate was diluted with ethyl acetate, washed with 5% NaCl acidified with citric acid to pH 4 followed by triethylammonium bicarbonate buffer (pH 7.19). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (0.02% AcOH, 1-3% MeOH, DCM) to give compound 28n (5.370 g, 87.4%).
Example 62
(198) ##STR00095##
3,6-bis(dimethylamino)-N-(6-(4-(hydroxymethyl)-4-((tris(4-methoxyphenyl) methoxy)methyl)piperidin-1-yl)-6-oxohexyl)-3-oxo-3-spiro[isobenzofuran-1,9-xanthene]-5-carboxamide 28p
(199) N,N-Dicyclohexylcarbodiimide (DCC, 0.681 g, 3.3 mmol) was added to a solution of 3,6-bis(dimethylamino)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-5-carboxylic acid (1.382 g, 3.21 mmol) and N-hydroxysuccinimide (0.480 g, 4.17 mmol) in DCM (30 mL) at 0 C., and the mixture was stirred at room temperature for 2 h. Then amine 24 (1.891 g, 3.2 mmol) was added and stirring was continued for 18 h. The solid was filtered off. The filtrate was diluted with ethyl acetate, washed with 5% NaCl acidified with citric acid to pH 4 followed by triethylammonium bicarbonate buffer (pH 7.19). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (0.02% AcOH, 1-3% MeOH, DCM) to give compound 28p (2.513 g, 70.3%).
Example 63
(200) ##STR00096##
(E)-N-(6-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)-4-((4-(dimethylamino)phenyl)diazenyl)benzenesulfonamide 17
(201) DABSYL chloride (1 g, 3.088 mmol) was added to compound 23 (1.730 g, 3.09 mmol) in triethylamine (0.319 g, 3.15 mmol) and anhydrous DCM (15 mL) at 0 C. The mixture was stirred overnight and diluted with ethyl acetate. The organic phase was washed with conc. aqueous NaHCO.sub.3, dried over Na.sub.2SO.sub.4, and evaporated. The crude product was purified on silica gel column (50% hexanes/DCM.fwdarw.3% MeOH/DCM) to give compound 43k (2328 g, 90.4%) as an orange solid foam.
Example 64
(202) ##STR00097##
(E)-N-(6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-6-oxohexyl)-4-((4-(dimethylamino)phenyl)diazenyl)benzenesulfonamide 44k
(203) DABSYL chloride (0.950 g, 2.93 mmol) was added to compound 24 (1.644 g, 2.94 mmol) in triethylamine (0.303 g, 2.99 mmol) and anhydrous DCM (15 mL) at 0 C. The mixture was stirred overnight and diluted with ethyl acetate. The organic phase was washed with conc. aqueous NaHCO.sub.3, dried over Na.sub.2SO.sub.4, and evaporated. The crude product was purified on silica gel column (50% hexanes/DCM.fwdarw.3% MeOH/DCM) to give compound 44k (2.320 g, 89.9%) as an orange solid foam.
Example 65
(204) ##STR00098##
((1-(6-(6-(2,2,2-trifluoroacetamido)hexanamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl) (2-cyanoethyl) diisopropylphosphoramidite 32a
(205) Compound 28a (1.600 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.783 g, 2.60 mmol) were dissolved in anhydrous acetonitrile (25 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.0 mmol, 2.22 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 32a (1.548 g, 77.4%) as a white solid foam.
Example 66
(206) ##STR00099##
(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(hept-6-ynamido)hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 31b
(207) Compound 27b (1.821 g, 2.72 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.873 g, 2.90 mmol) were dissolved in anhydrous acetonitrile (25 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.09 mmol, 2.42 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 31b (1.805 g, 76.4%) as a white solid foam.
Example 67
(208) ##STR00100##
(1-(6-(hept-6-ynamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 32b
(209) Compound 28b (1.468 g, 2.1 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.823 g, 2.73 mmol) were dissolved in anhydrous acetonitrile (25 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. This was cooled to 10 C., and 1H-tetrazole (0.45M, 1.05 mmol, 2.33 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 32b (1.595 g, 84.5%) as a white solid foam.
Example 68
(210) ##STR00101##
(4-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(4-(pyren-1-yl)butanamido)hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 31c
(211) 1H-tetrazole in acetonitrile (0.45M, 2.45 mL, 1.1 mmol) was added to compound 27c (2.293 g, 2.76 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.915 g, 3.04 mmol) dissolved in a mixture of anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL). The reaction mixture was stirred overnight and was quenched with triethylamine (0.5 mL). The mixture was evaporated to mobile oil, which was dissolved in DCM (70 mL). The solution was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The product was isolated on a silica gel column (5% Et.sub.3N, 30.fwdarw.95% ethyl acetate in hexanes), to give 2.34 g (82.2%) of compound 31c as a white solid foam.
(212) NMR H.sup.1 (, CD.sub.3CN): 8.38 (d, J=9.5 Hz, 1H), 8.18-8.23 (m, 2H), 8.16-8.18 (m, 2H), 8.04-8.08 (m, 2H), 8.03 (t, J=8.0 Hz, 1H), 7.92 (d, J=8.0 Hz, 1H), 7.41-7.44 (m, 2H), 7.28-7.31 (m, 6H), 7.19-7.24 (m, 1H), 6.81-6.85 (m, 4H), 6.43 (t, J=5.5 Hz, 1H, NH), 3.74 (s, 6H), 3.65-3.72 (m, 3H), 3.50-3.60 (m, 3H), 3.31-3.41 (m, 3H), 3.18-3.25 (m, 1H), 3.13-3.18 (m, 2H), 2.85-3.0 (m, 4H), 2.58 (t, J=7.0 Hz, 2H), 2.25 (m, 2H), 2.13-2.19 (m, 2H), 2.07-2.13 (m, 2H), 1.26-1.53 (m, 10H), 1.15 (d, J=7.5 Hz, 6H), 1.09 (dd, J=7.5, 5.0 Hz, 6H).
(213) NMR C.sup.13 (, CD.sub.3CN): 173.3, 171.8, 159.7, 146.6, 137.9, 137.3, 132.5, 132.0, 131.2, 130.9, 129.7, 129.2, 128.8, 128.6, 128.6, 128.2, 127.8, 127.6, 127.2, 126.0, 126.0, 125.8, 125.7, 124.7, 119.6, 118.0, 114.0, 86.6, 67.4 (d, .sup.2J.sub.P.sup.31=16.0 Hz), 65.1, 59.4 (d, .sup.2J.sub.P.sup.31=18.0 Hz), 56.0, 44.0 (d, .sup.2J.sub.P.sup.31=12.5 Hz), 42.1, 39.6, 38.9 (d, .sup.3J.sub.P.sup.31=8.8 Hz), 38.0, 36.6, 33.6 (d, .sup.3J.sub.P.sup.31=10.0 Hz), 30.8 (d, .sup.3J.sub.P.sup.31=11.0 Hz), 30.1, 30.1, 28.8, 27.4, 25.6, 25.1 (d, .sup.3J.sub.P.sup.31=7.5 Hz), 25.0 (d, .sup.3J.sub.P.sup.31=7.5 Hz), 21.2 (d, .sup.3J.sub.P.sup.31=6.2 Hz).
Example 69
(214) ##STR00102##
(4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(6-(4-(pyren-1-yl)butanamido)hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 32c
(215) 1H-tetrazole in acetonitrile (0.45M, 3.0 mL, 1.35 mmol) was added to compound 28c (2.325 g, 2.7 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (1.058 g, 3.51 mmol) dissolved in a mixture of anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL). The reaction mixture was stirred overnight and was quenched with triethylamine (0.5 mL). The mixture was evaporated to mobile oil, which was dissolved in DCM (70 mL). The solution was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The product was isolated on a silica gel column (5% Et.sub.3N, 30.fwdarw.95% ethyl acetate in hexanes), to give 2.525 g (88.1%) of compound 32c as a white solid foam.
Example 70
(216) ##STR00103##
(1-(6-(bicyclo[2.2.11]hept-5-ene-2-carboxamido)hexanoyl)-4-((tris(4-methoxyphenyl) methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 32d
(217) 1H-tetrazole in acetonitrile (0.45M, 2.78 mL, 1.25 mmol) was added to compound 28d (1.777 g, 2.5 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.980 g, 3.25 mmol) dissolved in a mixture of anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL). The reaction mixture was stirred overnight and was quenched with triethylamine (0.5 mL). The mixture was evaporated to mobile oil, which was dissolved in DCM (70 mL). The solution was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The product was isolated on a silica gel column (5% Et.sub.3N, 30.fwdarw.95% ethyl acetate in hexanes), to give 1.888 g (82.9%) of compound 32d as a white solid foam.
Example 71
(218) ##STR00104##
(1-(6-(2-(bicyclo[2.2.1]hept-5-en-2-yl)acetamido)hexanoyl)-4-((tris(4-methoxyphenyl) methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 32e
(219) 1H-tetrazole in acetonitrile (0.45M, 2.22 mL, 1.0 mmol) was added to compound 28e (1.450 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.783 g, 2.6 mmol) dissolved in a mixture of anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL). The reaction mixture was stirred overnight and was quenched with triethylamine (0.5 mL). The mixture was evaporated to mobile oil, which was dissolved in DCM (70 mL). The solution was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The product was isolated on a silica gel column (5% Et.sub.3N, 30.fwdarw.95% ethyl acetate in hexanes), to give 1.562 g (84.4%) of compound 32e as a white solid foam.
Example 72
(220) ##STR00105##
(1-(6-(2-(2-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)ethoxy)acetamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 32f
(221) 1H-tetrazole in acetonitrile (0.45M, 2.22 mL, 1.0 mmol) was added to compound 28f (1.711 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.783 g, 2.6 mmol) dissolved in a mixture of anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL). The reaction mixture was stirred overnight and was quenched with triethylamine (0.5 mL). The mixture was evaporated to mobile oil, which was dissolved in DCM (70 mL). The solution was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The product was isolated on a silica gel column (5% Et.sub.3N, 30.fwdarw.95% ethyl acetate in hexanes), to give 1.616 g (76.5%) of compound 32f as a white solid foam.
Example 73
(222) ##STR00106##
(1-(6-(6-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)hexanamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 32g
(223) 1H-tetrazole in acetonitrile (0.45M, 2.22 mL, 1.0 mmol) was added to compound 28g (1.736 g, 2.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.783 g, 2.6 mmol) dissolved in a mixture of anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL). The reaction mixture was stirred overnight and was quenched with triethylamine (0.5 mL). The mixture was evaporated to mobile oil, which was dissolved in DCM (70 mL). The solution was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The product was isolated on a silica gel column (5% Et.sub.3N, 30.fwdarw.95% ethyl acetate in hexanes), to give 1.690 g (79.1%) of compound 32g as a white solid foam.
Example 74
(224) ##STR00107##
(1-(6-(5-((R)-1,2-dithiolan-3-yl)pentanamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 32h
(225) 1H-tetrazole in acetonitrile (0.45M, 2.13 mL, 1.0 mmol) was added to compound 28h (1.496 g, 1.92 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.752 g, 2.5 mmol) dissolved in a mixture of anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL). The reaction mixture was stirred overnight and was quenched with triethylamine (0.5 mL). The mixture was evaporated to mobile oil, which was dissolved in DCM (70 mL). The solution was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The product was isolated on a silica gel column (5% Et.sub.3N, 30.fwdarw.95% ethyl acetate in hexanes), to give 1.386 g (73.7%) of compound 32h as a white solid foam.
Example 75
(226) ##STR00108##
2-Cyanoethyl (N(O-(5-(3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)pentanoyl)-4-(((4,4-dimethoxytrityl)oxy)methyl)piperidin-4-yl)methyl N,N-diisopropylamidophosphite 31i
(227) Compound 27i (0.990 g, 1.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.316 g, 1.05 mmol) were dissolved in anhydrous acetonitrile (20 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. This was cooled to 10 C., 1H-tetrazole (0.45M, 0.40 mmol, 0.889 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 5-45% of ethyl acetate in hexanes) to yield 31i (1.097 g, 92.2%) as a white solid foam.
Example 76
(228) ##STR00109##
2-Cyanoethyl (N(O-(5-(3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)butanoyl)-4-(((4,4-dimethoxytrityl)oxy)methyl)piperidin-4-yl)methyl N,N-diisopropylamidophosphite 32i
(229) Compound 28i (5.00 g, 4.97 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (1.778 g, 5.90 mmol) were dissolved in anhydrous acetonitrile (25 mL). The solution was gently shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h, cooled to 10 C., and treated with 1H-tetrazole in acetonitrile (0.45 M, 5.08 mL). Next day, the reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated sodium bicarbonate solution. The product was extracted with DCM and purified on a silica gel column (5% Et.sub.3N, 0-1% MeOH in ethyl acetate) to give 32i (4.524 g, 75.4%) as a white solid foam.
(230) NMR H.sup.1 (, CD.sub.3CN): 7.30-7.33 (m, 6H), 6.84-6.86 (m, 6H), 6.55 (br. d, J=9.5 Hz, 1H), 6.42 (br. t, J=5.5 Hz, 1H), 5.28 (d, J=3.0 Hz, 1H), 5.02 (dd, J=11.5, 3.5 Hz, 1H), 4.54 (d, J=8.5, 1H), 4.00-4.13 (m, 2H), 3.85-3.93 (m, 2H), 3.76 (s, 9H), 3.40-3.80 (m, 8H), 3.30-3.40 (m, 1H), 3.06-3.15 (m, 3H), 3.00-3.06 (m, 2H), 2.59 (t, J=5.5 Hz, 2H), 2.18-2.27 (m, 4H), 2.13 (t, J=7.0 Hz, 2H), 2.09 (s, 3H), 1.97 (s, 3H), 1.91 (s, 3H), 1.84 (s, 3H), 1.71-1.80 (m, 2H), 1.48-1.55 (m, 3H), 1.36-1.48 (m, 5H), 1.25-1.35 (m, 2H), 1.17 (d, J=7.0 Hz, 6H), 1.11 (d, J=7.0 Hz, 6H).
(231) NMR C.sup.13 (, CD.sub.3CN): 173.1, 172.0, 171.3, 171.2, 171.2, 171.1, 159.6, 137.9, 130.9, 119.6, 114.0, 102.4, 86.3, 71.7, 71.6, 69.8, 68.1, 67.0 (d, J.sub.CP=18.0 Hz), 65.2, 62.6, 59.4 (d, J.sub.CP=18.7 Hz), 56.0, 51.4, 44.0 (d, J.sub.CP=11.2 Hz), 42.3, 39.7, 39.0 (d, J.sub.CP=7.5 Hz), 38.2, 33.8, 33.1, 30.9 (d, J.sub.CP=13.7 Hz), 30.2, 30.1, 27.5, 26.6, 25.8, 25.1 (d, J.sub.CP=7.5 Hz), 25.0 (d, J.sub.CP=7.5 Hz), 23.4, 21.2 (d, J.sub.CP=7.5 Hz), 21.0, 21.0, 20.9.
Example 77
(232) ##STR00110##
Cholest-5-en-3-yl {6-{[4-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-4-({[(2-cyanoethoxy)(diisopropylamino)phosphino]oxy}methyl)piperidin-1-yl]-6-oxohexyl}carbamate 31j
(233) Compound 27j (1.925 g, 1.98 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.776 g, 2.57 mmol) were dissolved in a mixture of anhydrous DCM (22 mL) and anhydrous acetonitrile (17 mL). The solution was gently shaken with flame-dried molecular sieves 4 (1.34 g) for 1 h, cooled to 10 C., and treated with 1H-tetrazole in acetonitrile (0.45 M, 2.28 mL). Next day, the reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated sodium bicarbonate solution. The product was extracted with DCM and purified on a silica gel column (5% Et.sub.3N, 20.fwdarw.50% ethyl acetate in hexanes), to yield compound 31j (1.90 g, 81.8%) as a white solid foam.
(234) NMR H.sup.1 (, CD.sub.3CN): 7.37-7.39 (m, 2H), 7.27-7.31 (m, 2H), 7.27-7.31 (m, 4H), 7.19-7-25 (m, 1H), 7.00 (t, J=5.5 Hz, 1H, NH), 6.86-6.89 (m, 4H), 5.32 (m, 1H), 4.55 (br. S, 1H, OH), 4.25-4.33 (m, 1H), 3.73 (s, 6H), 3.46 (br. s, 2H), 3.26-3.40 (m, 2H), 2.95-3.03 (br. m, 2H), 2.93 (s, 2H), 2.88-2.93 (m, 2H), 2.14-2.30 (m, 2H), 2.19 (t, J=7.5 Hz, 2H), 1.72-2.00 (m, 5H), 1.45-1.56 (m, 6H), 1.25-1.45 (m, 15H), 1.16-1.25 (m, 6H), 0.85-1.16 (m, 6H), 0.96 (s, 3H), 0.89 (d, J=6.5 Hz, 3H), 0.85 (d, J=7.0 Hz, 3H), 0.84 (d, J=7.0 Hz, 3H), 0.65 (s, 3H).
(235) NMR P.sup.31 (, CD.sub.3CN): 147.6 (100%).
Example 78
(236) ##STR00111##
Cholest-5-en-3-yl {6-[4-{[tris(4-methoxyphenyl)methoxy]methyl}-4-({[(2-cyanoethoxy)(diisopropylamino)phosphino]oxy}methyl)piperidin-1-yl]-6-oxohexyl}carbamate 32j
(237) Compound 28j (2.689 g, 2.68 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (1.050 g, 3.48 mmol) were dissolved in a mixture of anhydrous DCM (22 mL) and anhydrous acetonitrile (17 mL). The solution was gently shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h, cooled to 10 C., and treated with 1H-tetrazole in acetonitrile (0.45 M, 2.98 mL, 1.34 mmol). Next day, the reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated sodium bicarbonate solution. The product was extracted with DCM and purified on a silica gel column (5% Et.sub.3N, 20.fwdarw.50% ethyl acetate in hexanes), to yield compound 32j (2.864 g, 88.8%) as a white solid foam.
Example 79
(238) ##STR00112##
(E)-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(4-((4-(dimethylamino)phenyl)diazenyl)benzamido)-hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl)diisopropylphosphoramidite 31k
(239) Compound 27k (1.710 g, 2.11 mmol) and 2-cyanoethyl-N,N,N,N-tetraisopropylphosphoramidite (0.825 g, 2.73 mmol) were dissolved in anhydrous acetonitrile (25 mL). The solution was gently shaken with flame-dried molecular sieves 4 (1.2 g) for 1 h, cooled to 10 C., and treated with 1H-tetrazole in acetonitrile (0.45 M, 1.872 mL). Next day, the reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated sodium bicarbonate solution. The product was extracted with DCM (70 mL), the extract was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 31k (1.936 g, 90.8%) as an orange solid foam.
Example 80
(240) ##STR00113##
(E)-(4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(6-(4-((4-(dimethylamino)phenyl)diazenyl)benzamido)-hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl)diisopropylphosphoramidite 32k
(241) Compound 28k (1.474 g, 1.75 mmol) and 2-cyanoethyl-N,N,N,N-tetraisopropylphosphoramidite (0.686 g, 2.27 mmol) were dissolved in anhydrous acetonitrile (25 mL). The solution was gently shaken with flame-dried molecular sieves 4 (1 g) for 1 h, cooled to 10 C., and treated with 1H-tetrazole in acetonitrile (0.45 M, 1.94 mL, 0875 mmol). Next day, the reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated sodium bicarbonate solution. The product was extracted with DCM (70 mL), the extract was washed with saturated aqueous sodium bicarbonate solution, dried over Na.sub.2SO.sub.4, and evaporated to oil. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 32k (1.536 g, 84.2%) as an orange solid foam.
Example 81
(242) ##STR00114##
5-((6-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-((((2-cyanoethoxy)(diisopropylamino)phosphino)-oxy)methyl)piperidin-1-yl)-6-oxohexyl)carbamoyl)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-3,6-diyl bis(2,2-dimethylpropanoate) 31m
(243) 1H-Tetrazole (0.45 M, 2.4 mL, 1.1 mmol) in acetonitrile was added to a solution of compound 27m (2.400 g, 2.20 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.816 g, 2.71 mmol) in anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL), and the mixture was stirred overnight. The reaction mixture was quenched with saturated sodium bicarbonate, the product was extracted with DCM and purified on a silica gel column (3% Py, 70-97% ethyl acetate in hexanes) to give compound 31m (1,748 g, 61.7%) as a white solid foam.
(244) NMR H.sup.1 (, CD.sub.3CN): 8.11, 8.05 (AB, J=8.0 Hz, 2H), 7.63 (s, 1H), 7.42-7.45 (m, 2H), 7.20-7.32 (m, 7H), 7.18-7.22 (m, 1H), 6.90-7.10 (m, 2H), 6.88-6.92 (m, 2H), 6.78-6.86 (m, 6H), 3.74 (s, 6H), 3.66-3.74 (m, 3H), 3.60-3.66 (m, 1H), 3.53-3.58 (m, 2H), 3.35-3.42 (m, 1H), 3.22-3.33 (m, 3H), 2.98-3.08 (m, 4H), 2.58 (t, J=6.0 Hz, 2H), 2.15-2.20 (m, 2H), 1.25-1.52 (m, 10H) 1.32 (s, 18H), 1.16 (d, J=7.0 Hz, 6H), 1.11 (dd, J=7.0 Hz, 1.5 Hz, 6H).
(245) NMR C.sup.13 (, CD.sub.3CN): 177.6, 171.9, 169.2, 166.2, 159.7, 154.1, 154.0, 152.6, 146.6, 143.0, 137.3, 131.2, 130.6, 130.3, 129.2, 129.0, 128.8, 127.8, 126.3, 123.6, 119.6, 119.3, 117.2, 114.1, 111.4, 86.6, 82.6, 67.5 (d, .sup.2J.sub.P.sup.31=16.3 Hz), 65.3, 59.4 (d, .sup.2J.sub.P.sup.31=17.6 Hz), 56.0, 44.0 (d, .sup.2J.sub.P.sup.31=12.5 Hz), 42.2, 40.5, 39.9, 39.0 (d, .sup.3J.sub.P.sup.31=8.8 Hz), 38.1, 33.6, 30.8, 30.1, 29.7, 27.4, 25.5, 25.2 (d, .sup.3J.sub.P.sup.31=7.5 Hz), 25.03 (d, .sup.3J.sub.P.sup.31=7.5 Hz), 21.2 (d, .sup.3J.sub.P.sup.31=7.5 Hz).
(246) NMR P.sup.31 (, CD.sub.3CN): 147.6 (98.8%).
Example 82
(247) ##STR00115##
5-((6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-((((2-cyanoethoxy)(diisopropylamino)phosphino)-oxy)methyl)piperidin-1-yl)-6-oxohexyl)carbamoyl)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-3,6-diyl bis(2,2-dimethylpropanoate) 32m
(248) 1H-Tetrazole (0.45 M, 2.7 mL, 1.2 mmol) in acetonitrile was added to a solution of compound 28m (2.681 g, 2.40 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.940 g, 3.12 mmol) in anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL), and the mixture was stirred overnight. The reaction mixture was quenched with saturated sodium bicarbonate, the product was extracted with DCM and purified on a silica gel column (3% Py, 70-97% ethyl acetate in hexanes) to give compound 32m (2.105 g, 66.6%) as a white solid foam.
Example 83
(249) ##STR00116##
6-((6-(4-((tris(4-methoxyphenyl)methoxy)methyl)-4-((((2-cyanoethoxy)(diisopropylamino)phosphino)-oxy)methyl)piperidin-1-yl)-6-oxohexyl)carbamoyl)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-3,6-diyl bis(2,2-dimethylpropanoate) 32n
(250) 1H-Tetrazole (0.45 M, 3.9 mL, 1.75 mmol) in acetonitrile was added to a solution of compound 28n (3.911 g, 3.50 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (1.371 g, 4.55 mmol) in anhydrous DCM and anhydrous acetonitrile (1:1, 10 mL), and the mixture was stirred overnight. The reaction mixture was quenched with saturated sodium bicarbonate, the product was extracted with DCM and purified on a silica gel column (3% Py, 70-97% ethyl acetate in hexanes) to give compound 32n (2.896 g, 62.8%) as a white solid foam.
Example 84
(251) ##STR00117##
(E)-(4-((bis(4-methoxyphenyl)(phenyl oxy)methyl)-1-(6-(4-((4-(dimethylamino)phenyl)diazenyl)-phenylsulfonamido)hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 47k
(252) Compound 43k (1.952 g, 2.30 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.902 g, 2.99 mmol) were dissolved in anhydrous acetonitrile (17 mL). The solution was gently shaken with flame-dried molecular sieves 4 (1.2 g) for 1 h, cooled to 10 C., and treated with 1H-tetrazole in acetonitrile (0.45 M, 1.81 mL). Next day, the reaction mixture was quenched with triethylamine (0.4 mL) and diluted with saturated sodium bicarbonate solution. The product was extracted with DCM and purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to give 47k (1.888 g, 78.3%) as an orange solid foam.
Example 85
(253) ##STR00118##
(E)-(4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(6-(4-((4-(dimethylamino)phenyl)diazenyl)-phenylsulfonamido)hexanoyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 48k
(254) Compound 44k (2.283 g, 2.6 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (1.019 g, 3.38 mmol) were dissolved in anhydrous acetonitrile (17 mL). The solution was gently shaken with flame-dried molecular sieves 4 (1.5 g) for 1 h, cooled to 10 C., and treated with 1H-tetrazole in acetonitrile (0.45 M, 2.9 mL, 1.3). Next day, the reaction mixture was quenched with triethylamine (0.4 mL) and diluted with saturated sodium bicarbonate solution. The product was extracted with DCM and purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to give 48k (2.085 g, 74.4%) as an orange solid foam.
Example 86
(255) ##STR00119##
Triethylammonium 4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(hept-6-ynamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 35b
(256) Compound 27b (0.223 g, 0.333 mmol), succinic anhydride (0.470 g, 4.70 mmol) and pyridine (2.42 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.4 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 35b (0.246 g, 84.9%).
Example 87
(257) ##STR00120##
Triethylammonium 4-oxo-4-((1-(6-(6-(2,2,2-trifluoroacetamido)hexanamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)butanoate 36a
(258) Compound 28a (1.360 g, 1.7 mmol), succinic anhydride (0.510 g, 5.1 mmol) and pyridine (4.5 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.4 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 36a (1.530 g, 85.5%).
Example 88
(259) ##STR00121##
Triethylammonium 4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(hept-6-ynamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 35b
(260) Compound 27b (0.223 g, 0.333 mmol), succinic anhydride (0.470 g, 4.70 mmol) and pyridine (2.42 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.4 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 35b (0.246 g, 84.9%).
Example 89
(261) ##STR00122##
Triethylammonium 4-((4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(6-(hept-6-ynamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36b
(262) Compound 28b (0.908 g, 1.3 mmol), succinic anhydride (0.390 g, 3.90 mmol) and pyridine (2.42 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (1 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 36b (1.0 g, 85.5%).
Example 90
(263) ##STR00123##
Triethylammonium 4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(4-(pyren-1-yl)butanamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 35c
(264) Compound 27c (0.167 g, 0.200 mmol), succinic anhydride (0.200 g, 2 mmol), and pyridine (2 mL) were stirred at room temperature for 10 days. The reaction mixture was quenched with water (0.1 mL, 5.55 mmol) and triethylamine (5 mmol, 0.697 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a preparative TLC plate (1% Et.sub.3N, 2.5% MeOH, DCM) to yield 35c (0.166 g, 80.4%).
(265) NMR H.sup.1 (, DMSO-d.sub.6): 8.36 (d, J=9.5 Hz, 1H), 8.18-8.27 (m, 4H), 8.08-8.13 (m, 2H), 8.03 (t, J=8.0 Hz, 1H), 7.92 (d, J=8.0 Hz, 1H), 7.86 (t, J=5.5 Hz, 1H, NH), 7.27-7.36 (m, 4H), 7.17-7.23 (m, 5H), 6.85-6.89 (m, 4H), 4.06 (s, 2H), 3.71 (s, 6H), 3.19-3.40 (m, 2H), 3.04 (q, J=7.0 Hz, 2H), 2.85-3.0 (m, 2H), 2.89 (s, 2H), 2.42 (q, J=7.5 Hz, 3.39H, non-stoichiometric Et3N salt), 2.36 (t, J=7.0 Hz), 2.19-2.23 (m, 4H), 2.13-2.18 (m, 2H), 1.97-2.03 (m, 2H), 1.20-1.45 (m, 10H), 0.92 (t, J=7.5 Hz, 5.05H, non-stoichiometric Et.sub.3N salt).
(266) NMR C.sup.13 (, DMSO-d.sub.6): 173.8, 172.7, 171.6, 170.2, 158.0 (2C), 144.8, 136.5, 135.5 (2C), 130.8, 130.4, 129.6, 129.2, 128.1, 127.7, 127.6, 127.4, 127.4, 127.1, 126.6, 126.4, 126.0, 124.8, 124.7, 124.2, 124.1, 123.4, 113.1, 85.0, 65.5, 63.4, 55.0, 45.6, 40.5, 36.5, 36.4, 35.0, 32.2, 32.1, 31.2, 30.3, 29.6, 28.9, 27.5, 26.1, 24.4, 11.7.
Example 91
(267) ##STR00124##
Triethylammonium 4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(4-(pyren-1-yl)butanamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36c
(268) Compound 28c (0.775 g, 0.900 mmol), succinic anhydride (0.80 g, 8 mmol), and pyridine (5 mL) were stirred at room temperature for 10 days. The reaction mixture was quenched with water (0.4 mL) and triethylamine (1 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a preparative TLC plate (1% Et.sub.3N, 2.5% MeOH, DCM) to yield 36c (823 g, 86.1%).
Example 92
(269) ##STR00125##
Triethylammonium 4-((1-(6-(bicyclo[2.2.1]hept-5-ene-2-carboxamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36d
(270) Compound 28d (0.355 g, 0.9 mmol), succinic anhydride (0.90 g, 9 mmol) and pyridine (2.42 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water (1 mL) and triethylamine (1 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (1 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 36d (0.421 g, 92.3%).
Example 93
(271) ##STR00126##
Triethylammonium 4-((1-(6-(2-(bicyclo[2.2.1]hept-5-en-2-yl)acetamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36e
(272) Compound 28e (0.544 g, 0.75 mmol), succinic anhydride (0.750 g, 7.5 mmol) and pyridine (2.42 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water (1 mL) and triethylamine (1 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (1 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 36e (0.579 g, 83.4%).
Example 94
(273) ##STR00127##
Triethylammonium 4-((1-(6-(2-(2-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)ethoxy)acetamido)hexanoyl)-4-((tris(4-methoxyphenyl) methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36f
(274) Compound 28f (0.942 g, 1.1 mmol), succinic anhydride (1.10 g, 11 mmol) and pyridine (2.42 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water (1 mL) and triethylamine (1 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (1 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 36f (0.978 g, 84.1%).
Example 95
(275) ##STR00128##
Triethylammonium 4-((1-(6-(6-((1,3-dioxo-1,3,3a,4,7,7a-hexahydro-2H-4,7-epoxyisoindol-2-yl)oxy)hexanamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36g
(276) Compound 28g (0.868 g, 1.0 mmol), succinic anhydride (1.0 g, 10 mmol) and pyridine (2.42 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water (1 mL) and triethylamine (1 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (1 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 36g (0.885 g, 82.8%).
Example 96
(277) ##STR00129##
Triethylammonium (R)-4-((1-(6-(5-(1,2-dithiolan-3-yl)pentanamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36h
(278) Compound 28h (0.576 g, 0.74 mmol), succinic anhydride (0.740 g, 7.4 mmol) and pyridine (2.42 g) were stirred at room temperature for 5 days. The reaction mixture was quenched with water (1 mL) and triethylamine (1 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (1 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 36h (0.531 g, 73.2%).
Example 97
(279) ##STR00130##
Triethylammonium N(O-(5-(3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)pentenoyl)-4-(((4,4-dimethoxytrityl)oxy)methyl)piperidin-4-yl)methyl hemisuccinate 35i
(280) Compound 27i (0.990 g, 1.0 mmol), succinic anhydride (1.00 g, 10 mmol), and pyridine (5.0 mL) were stirred at room temperature for 4 days. The reaction mixture was quenched with water and triethylamine (2 mL) for 4 h, evaporated to an oil, diluted with DCM (50 mL), and washed with 10% aqueous citric acid. The organic phase was basified with triethylamine (4.0 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-4% MeOH in DCM) to yield 35i (1.045 g, 87.7%).
Example 98
(281) ##STR00131##
(N(O-(5-(3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)butanoyl)-4-(((4,4-dimethoxytrityl)oxy)methyl)piperidin-4-yl)methyl hemisuccinate 36i
(282) Compound 28i (0.99 g, 0.984 mmol), succinic anhydride (0.56 g, 5.60 mmol), and pyridine (8.0 mL) were stirred at room temperature for 3 days. The reaction mixture was quenched with water (1 mL, 55.5 mmol) and triethylamine (1.12 g, 11.08 mmol) for 4 h and was co-evaporated with toluene (310 mL). The product was isolated on a silica gel column using a step gradient of MeOH (3 to 5%) in a mixture of Et.sub.3N and DCM (1:99) to yield compound 36i (0.874 g, 73.6%).
(283) NMR H.sup.1 (, CDCl.sub.3): 7.26-7.29 (m, 6H), 6.80-6.83 (m, 6H), 6.49 (br. d, J=9.0 Hz, 1H), 6.20 (br. q, J=5.0 Hz, 1H), 5.33 (d, J=3.0 Hz, 1H), 5.14-5.18 (m, 1H), 4.62 (dd, J=8.5, 3.0 Hz, 1H), 4.16-4.22 (m, 2H), 4.02-4.16 (m, 3H), 3.85-3.92 (m, 2H), 3.78 (s, 9H), 3.47-3.68 (m, 3H), 3.45-3.55 (m, 2H), 3.30-3.40 (m, 1H), 3.08-3.15 (m, 1H), 3.00-3.08 (m, 2H), 2.80 (q, J=7.5 Hz, 6H), 2.52-2.57 (m, 2H), 2.45-2.50 (m, 2H), 2.15-2.30 (m, 4H), 2.13 (s, 3H), 2.03 (s, 3H), 1.98 (s, 3H), 1.94 (s, 3H), 1.85-1.91 (m, 2H), 1.54-1.63 (m, 3H), 1.45-1.54 (m, 5H), 1.33-1.40 (m, 2H), 1.14 (t, J=7.5 Hz, 9H).
(284) NMR C.sup.13 (, CDCl.sub.3): 177.7, 173.7, 173.2, 171.5, 171.0, 170.7, 170.6, 170.5, 158.6, 136.7, 130.0, 113.3, 101.6, 85.7, 70.9, 70.6, 68.7, 67.0, 66.9, 63.9, 61.7, 55.4, 51.4, 45.5, 41.6, 39.3, 37.6, 37.2, 33.2, 32.9, 31.8, 30.9, 30.2, 29.5, 29.3, 26.7, 26.0, 24.9, 24.7, 23.6, 20.9, 20.9, 9.9.
Example 99
(285) ##STR00132##
Triethylammonium 4-{[4-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-1-(6-{[(cholest-5-en-3-yloxy)carbonyl]amino}hexanoyl)piperidin-4-yl]methoxy}-4-oxobutanoate 35j
(286) Compound 27j (0.157 g, 0.162 mmol), succinic anhydride (0.467 g, 4.66 mmol), and pyridine (2 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water (0.2 mL, 11.1 mmol) and triethylamine (1.62 mL, 11.65 mmol) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a preparative TLC plate (1% Et.sub.3N, 3% MeOH, DCM) to yield 35j (0.140 g, 73.7%).
(287) NMR H.sup.1 (, DMSO-d.sub.6): 7.35-7.37 (m, 2H), 7.29-7.33 (m, 2H), 7.20-7.24 (m, 5H), 7.00 (t, J=5.5 Hz, 1H, NH), 6.88-6.90 (m, 4H), 5.32 (m, 1H), 4.26-4.31 (m, 1H), 4.11 (s, 2H), 3.73 (s, 6H), 3.26-3.40 (br. m, 2H), 3.02-3.15 (br. m, 2H), 2.95 (br. s, 2H), 2.90-2.95 (m, 2H), 2.43 (q, J=7.0 Hz, 6H), 2.33-2.38 (m, 2H), 2.14-2.33 (m, 2H), 2.19 (t, J=7.5 Hz, 2H), 1.72-2.00 (m, 5H), 1.45-1.56 (m, 6H), 1.25-1.45 (m, 15H), 1.16-1.25 (m, 4H), 0.85-1.16 (m, 8H), 0.93 (t, J=7.0 Hz, 9H), 0.96 (s, 3H), 0.89 (d, J=6.5 Hz, 3H), 0.85 (d, J=7.0 Hz, 3H), 0.84 (d, J=7.0 Hz, 3H), 0.65 (s, 3H).
Example 100
(288) ##STR00133##
Triethylammonium 4-{[4-{[tris(4-methoxyphenyl)methoxy]methyl}-1-(6-{[(cholest-5-en-3-yloxy)carbonyl]amino}hexanoyl)piperidin-4-yl]methoxy}-4-oxobutanoate 36j
(289) Compound 28j (0.903 g, 0.9 mmol), succinic anhydride (0.9 g, 9 mmol), and pyridine (2 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water (0.5 mL) and triethylamine (0.5 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.5 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a preparative TLC plate (1% Et.sub.3N, 3% MeOH, DCM) to yield 36j (0.842 g, 77.7%).
Example 101
(290) ##STR00134##
Triethylammonium (E)-4-((4-((tris(4-methoxyphenyl)methoxy)methyl)-1-(6-(4-((4-(dimethylamino)phenyl)diazenyl)benzamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36k
(291) Compound 28k (0.632 g, 0.75 mmol), succinic anhydride (0.588 g, 5.87 mmol) and pyridine (3.0 mL) were stirred at room temperature for 6 days. The reaction mixture was quenched with water and triethylamine (0.5 mL), evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 36k (0.641 g, 81.9%).
Example 102
(292) ##STR00135##
Pyridin-1-ium 4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(3-oxo-3,6-bis(pivaloyloxy)-3H-spiro[isobenzofuran-1,9-xanthen]-6-ylcarboxamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 35m
(293) Compound 27m (0.221 g, 0.200 mmol), succinic anhydride (0.159 g, 1.59 mmol), and of pyridine (1 mL) were stirred at room temperature for 2 weeks. The reaction mixture was quenched with excess saturated solution of sodium bicarbonate for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. The organic phase was dried over Na.sub.2SO.sub.4, concentrated, and the residue was separated on a silica gel column (0.5% pyridine, 1.fwdarw.5% MeOH, DCM) to yield 35m (0.184 g, 72.6%).
(294) NMR H.sup.1 (, CDCl.sub.3): 8.61 (m, 1.15H, Py), 8.14, 8.15 (AB, J=8.0 Hz, 2H), 7.70 (m, 0.56H, Py), 7.56 (s, 1H), 7.38-7.41 (m, 2H), 7.27-7.33 (m, 7.15H), 7.19-7.21 (m, 1H), 6.98-7.00 (m, 2H), 6.99 (t, J=5.0 Hz, 1H, NH), 6.74-6.83 (m, 8H), 4.16, 4.29 (AB, J=11.0 Hz, 2H), 3.78 (s, 6H), 3.58-3.65 (m, 1H), 3.32-3.48 (m, 3H), 3.00-3.15 (m, 4H), 2.51-2.60 (m, 4H), 2.20-2.35 (m, 2H), 1.36-1.65 (m, 10H) 1.35 (s, 18H).
(295) NMR C.sup.13 (, CDCl.sub.3): 176.8, 174.2, 173.0, 172.9, 168.8, 165.7, 158.7, 153.6, 153.0, 151.8, 149.6, 145.0, 142.5, 136.5, 136.1, 130.3, 129.6, 129.1, 128.4, 128.0, 127.1, 125.7, 124.1, 122.9, 118.1, 118.8, 113.3, 110.6, 86.1, 83.0, 67.1, 64.2, 55.4, 41.8, 39.7, 39.4, 37.9, 37.5, 32.9, 30.1, 29.5, 28.9, 28.9, 28.6, 27.3, 26.3, 23.8.
Example 103
(296) ##STR00136##
Triethylammonium 4-oxo-4-((1-(6-(3-oxo-3,6-bis(pivaloyloxy)-3H-spiro[isobenzofuran-1,9-xanthene]-5-carboxamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl) piperidin-4-yl)methoxy)butanoate 36m
(297) Compound 28m (1.676 g, 1.50 mmol), succinic anhydride (1.50 g, 15 mmol), and of pyridine (15 mL) were stirred at room temperature for 1 week. The reaction mixture was quenched with excess saturated solution of sodium bicarbonate for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. The organic phase was dried over Na.sub.2SO.sub.4, concentrated, and the residue was separated on a silica gel column (0.5% pyridine, 1.fwdarw.5% MeOH, DCM) to yield 36m (1.271 g, 64.3%).
Example 104
(298) ##STR00137##
Triethylammonium 4-oxo-4-((1-(6-(3-oxo-3,6-bis(pivaloyloxy)-3H-spiro[isobenzofuran-1,9-xanthene]-5-carboxamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl) piperidin-4-yl)methoxy)butanoate 36n
(299) Compound 28n (1.676 g, 1.50 mmol), succinic anhydride (1.50 g, 15 mmol), and of pyridine (15 mL) were stirred at room temperature for 1 week. The reaction mixture was quenched with excess saturated solution of sodium bicarbonate for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. The organic phase was dried over Na.sub.2SO.sub.4, concentrated, and the residue was separated on a silica gel column (0.5% pyridine, 1.fwdarw.5% MeOH, DCM) to yield 36n (1.323 g, 66.9%).
Example 105
(300) ##STR00138##
Triethylammonium 4-((1-(6-(3,6-bis(dimethylamino)-3-oxo-3H-spiro[isobenzofuran-1,9-xanthene]-5-carboxamido)hexanoyl)-4-((tris(4-methoxyphenyl)methoxy)methyl)piperidin-4-yl)methoxy)-4-oxobutanoate 36p
(301) Compound 28p (0.662 g, 0.66 mmol), succinic anhydride (0.70 g, 7 mmol), and of pyridine (5 mL) were stirred at room temperature for 1 week. The reaction mixture was quenched with excess saturated solution of sodium bicarbonate for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. The organic phase was dried over Na.sub.2SO.sub.4, concentrated, and the residue was separated on a silica gel column (0.5% pyridine, 1.fwdarw.5% MeOH, DCM) to yield 36p (433 g, 54.5%).
Example 106
(302) ##STR00139##
Triethylammonium (E)-4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(4-((4-(dimethylamino)phenyl)diazenyl)phenylsulfonamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 51k
(303) Compound 43k (0.277 g, 0.334 mmol), succinic anhydride (0.77 g, 7.69 mmol) and pyridine (3.0 mL) were stirred at room temperature for 4 days. The reaction mixture was quenched with water (0.346 mL, 19.23 mmol), and triethylamine (1.90 g, 19.22 mmol) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. The organic phase was basified with triethylamine (0.4 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 51k (0.249 g, 65.7%).
Example 107
(304) ##STR00140##
Triethylammonium (E)-4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(4-((4-(dimethylamino)phenyl)diazenyl)phenylsulfonamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 52k
(305) Compound 44k (0483 g, 0.55 mmol), succinic anhydride (0.55 g, 5.5 mmol) and pyridine (3.0 mL) were stirred at room temperature for 6 days. The reaction mixture was quenched with water (0.5 mL), and triethylamine (0.5 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. The organic phase was basified with triethylamine (0.4 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 52k (0.440 g, 74.1%).
Example 108
(306) ##STR00141##
(9H-fluoren-9-yl)methyl (6-(3,3-bis(hydroxymethyl)azetidin-1-yl)-6-oxohexyl)carbamate 6a
(307) A solution of N-Fmoc-6-aminohexanoic acid (Chem Impex International, Inc., 2.208 g, 6.25 mmol), N-hydroxybenzotriazole (HOBt, 1.148 g, 7.5 mmol) and EDC-HCl (1.438 g, 7.5 mmol) in DCM (17 mL) was stirred at room temperature for 30 min. Azetidine-2,2-dimethanol hydrochloride 4 (A2Z Chemicals, Irvine, Calif., 1.00 g, 6.51 mmol) and DIPEA (1.939 g, 15.62 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, washed with 5% NaHCO.sub.3, 5% HCl, and brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM) to give 2.015 g (68.03%) of compound 6a as a white solid foam.
(308) NMR H.sup.1 (, CDCl.sub.3): 7.76-7.74 (m, 2H), 7.57-7.59 (m, 2H), 7.36-7.40 (m, 2H), 7.25-7.30 (m, 2H), 5.06 (br. t, J=5 Hz, 1H), 4.37 (d, J=7.0 Hz, 2H), 4.20 (t, J=6.5 Hz, 1H), 3.88 (s, 2H), 3.80 (s, 4H), 3.70 (s, 2H), 3.18 (q, J=6.5 Hz, 2H), 2.08 (m, 2H), 1.33-1.60 (m, 6H).
(309) NMR C.sup.13 (, CDCl.sub.3): 174.0, 156.9, 144.2, 141.5, 127.9, 127.3, 125.3, 120.2, 66.8, 66.0, 54.9, 52.4, 47.5, 41.1, 39.7, 31.2, 26.5, 24.6.
Example 109
(310) ##STR00142##
N-(8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3,6-dioxaoctanoyl)-3,3-bis(hydroxymethyl)azetidine 6k
(311) A solution of 8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3,6-dioxaoctanoic acid (4.93 g, 10 mmol), N-hydroxybenzotriazole (HOBt, 1.837 g, 12 mmol) and EDC-HCl (2.300 g, 12 mmol) in DMF (40 mL) was stirred at room temperature for 30 min. Compound 4 (1.464 g, 12.5 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, diluted with ethyl acetate (200 mL), washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 5.948 g (80.3%) of diol 6k as a white solid.
Example 110
(312) ##STR00143##
(9H-fluoren-9-yl)methyl (6-(3-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(hydroxymethyl)azetidin-1-yl)-6-oxohexyl)carbamate 9a
(313) DMT-Cl (1.359 g, 4.01 mmol) was gradually added to a stirred solution of compound 6a (1.80 g, 3.98 mmol) in pyridine (15 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 9a (1.246 g, 41.3%). Fractions containing a bis-DMT side product and the unreacted diol 6a were mixed together, treated with TFA, evaporated, co-evaporated with toluene and pyridine, dissolved in pyridine and treated with an appropriate amount of DMT-Cl. Workup and purification as disclosed above gave additional amount compound 9a (0.742 g) in a total yield of 1.951 g (64.9%).
(314) NMR H.sup.1 (, CDCl.sub.3): 7.74-7.76 (m, 2H), 7.58-7.60 (m, 2H), 7.38-7.40 (m, 4H), 7.20-7.37 (m, 9H), 6.80-6.85 (m, 4H), 4.94 (br. s, 1H), 4.39 (d, J=7.0 Hz, 2H), 4.20 (t, J=7.0, 1H), 3.92 (d, J=8.5 Hz, 1H), 3.67-3.82 (m, 11H), 3.31, 3.35 (AB, J=9.5 Hz, 2H), 3.17-3.19 (m, 2H), 2.31 (br. s, 1H), 2.03-2.07 (m, 2H), 1.55-1.65 (m, 2H), 1.46-1.52 (m, 2H), 1.30-1.40 (m, 2H).
(315) NMR C.sup.13 (, CDCl.sub.3): 173.6, 158.9, 156.7, 144.7, 144.3, 141.6, 135.8, 130.2, 128.3, 128.2, 127.9, 127.2, 125.3, 120.2, 113.5, 86.6, 66.7, 66.0, 66.0, 55.4, 55.0, 52.6, 47.6, 41.0, 39.1, 31.3, 29.9, 26.6, 24.5.
Example 111
(316) ##STR00144##
N-(8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy-j-D-galactopyranosyl)oxy)-3,6-dioxaoctanoyl)-3-(hydroxymethyl)-3-((tris-(4-methoxyphenyl)methoxy)methyl)azetidine 10k
(317) Trimethoxytrityl chloride (1.85 g, 5 mmol) was gradually added to a stirred solution of compound 6k (2.963 g, 5 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 10k (2.567 g, 55.5%).
Example 112
(318) ##STR00145##
(N-(8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3,6-dioxaoctanoyl)-3-(((4,4,4-trimethoxytrityl)oxy)methyl)azetidin-3-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 14k
(319) Compound 10k (0.675 g, 0.73 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.286 g, 0.95 mmol) were dissolved in anhydrous acetonitrile (15 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. This was cooled to 10 C., 1H-tetrazole (0.45M, 0.365 mmol, 0.81 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and was diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and was evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 14k (0.692 g, 84.2%) as a white solid foam.
Example 113
(320) ##STR00146##
Triethylammonium (N-(8-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3,6-dioxaoctanoyl)-3-(((4,4,4-trimethoxytrityl)oxy)methyl)azetidin-3-yl)methoxy)-4-oxobutanoate 18k
(321) Compound 10k (0.499 g, 0.54 mmol), succinic anhydride (0.540 g, 5.4 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 18k (0.535 g, 88.2%). Medina, Scott H.; Tekumalla, Venkatesh; Chevliakov, Maxim V.; et al. Biomaterials (2011), 32(17), 4118-4129 Nishimura, S.; Sato, M.; Furuike, T. From PCT Int. Appl. (2004), WO 2004101619 A1 20041125.
(322) ##STR00147##
Example 114
6-amino-1-(3-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(hydroxymethyl)azetidin-1-yl)hexan-1-one 25
(323) Compound 9a (1.93 g, 2.56 mmol) was treated with a solution of piperidine in MeOH (10% 100 mL) overnight. The reaction mixture was evaporated, co-evaporated with xylenes, and separated on a silica gel column (1% NH.sub.4OH, 0-12% MeOH in DCM) to give pure compound 25 (1.244 g, 91.2%) as a white solid foam.
(324) NMR H1 (, CDCl3): 7.37-7.39 (m, 2H), 7.24-7.28 (m, 6H), 7.17-7.21 (m, 1H), 6.79-6.82 (m, 4H), 3.94 (d, J=8.5 Hz, 1H), 3.66-3.80 (m, 11H), 3.25, 3.29 (AB, J=9.5 Hz, 2H), 2.94 (br. s, 3H), 2.67 (t, J=7.0 Hz, 2H), 2.01-2.07 (m, 2H), 1.55-1.61 (m, 2H), 1.42-1.48 (m, 2H), 1.30-1.36 (m, 2H).
(325) NMR C.sup.13 (, CDCl.sub.3): 173.7, 158.7, 144.7, 135.8, 130.2, 128.2, 128.0, 127.1, 113.4, 86.3, 65.4, 65.0, 55.3, 54.7, 52.4, 41.7, 39.3, 32.6, 31.3, 26.6, 24.6.
Example 115
(326) ##STR00148##
N-(6-(3-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3-(hydroxymethyl)azetidin-1-yl)-6-oxohexyl)hept-6-ynamide 29b
(327) Hept-6-ynoic acid (TCI America, 0.242 g, 1.92 mmol), HOBt (0.294 g, 1.92 mmol) and EDC-HCl (0.368 g, 2.304 mmol) were dissolved in DCM (5 mL) and stirred at room temperature for 30 min. This mixture was added to the solution of compound 25 (1.208 g, 1.60 mmol) and DIPEA (0.496 g, 3.84 mmol) in DCM (15 mL) at 0 C. The reaction mixture was stirred for 18 h at room temperature and was diluted with DCM (50 mL). The obtained solution was washed with 5% NaHCO.sub.3 and brine and was dried over Na.sub.2SO.sub.4. The extract was evaporated, and the residue was separated on a silica gel column (1-5% MeOH, DCM) to give 0.653 g (63.7%) compound 29b as a white solid foam.
(328) NMR H.sup.1 (, CDCl.sub.3): 7.37-7.39 (m, 2H), 7.25-7.29 (m, 6H), 7.18-7.20 (m, 1H), 6.79-6.83 (m, 4H), 5.99 (br. t, J=5.5 Hz, 1H), 3.94 (d, J=8.5 Hz, 1H), 3.66-3.80 (m, 11H), 3.27, 3.31 (AB, J=9.5 Hz, 2H), 3.17-3.23 (m, 2H), 2.13-2.20 (m, 4H), 2.01-2.07 (m, 2H), 1.92 (t, J=3.0 Hz, 1H), 1.70-1.74 (m, 2H), 1.45-1.56 (m, 6H), 1.30-1.35 (m, 2H).
(329) NMR C.sup.13 (, CDCl.sub.3): 173.6, 173.0, 158.8, 144.7, 135.8, 130.4, 128.2, 128.1, 127.1, 113.4, 86.4, 84.3, 68.8, 65.6, 65.4, 55.4, 54.8, 53.6, 39.3, 39.3, 36.2, 31.2, 29.4, 28.1, 26.6, 25.0, 24.4, 18.3.
(330) ##STR00149##
Example 116
2-Cyanoethyl (3-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(hept-6-ynamido)hexanoyl)azetidin-3-yl)methyl N,N-diisopropylphosphoramidite 33b
(331) Compound 29b (0.513 g, 0.80 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.253 g, 0.84 mmol) were dissolved in anhydrous acetonitrile (15 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. This was cooled to 10 C., 1H-tetrazole (0.45M, 0.336 mmol, 0.747 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and was diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and was evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 33b (0.298 g, 44.3%) as a white solid foam.
Example 117
(332) ##STR00150##
Triethylammonium 4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(6-(hept-6-ynamido)hexanoyl)piperidin-4-yl)methoxy)-4-oxobutanoate 37b
(333) Compound 29b (0.096 g, 0.150 mmol), succinic anhydride (0.079 g, 0.79 mmol) and pyridine (0.5 mL) were stirred at room temperature for 4 days. The reaction mixture was quenched with water and triethylamine (0.2 mL) for 4 h, evaporated to an oil, diluted with DCM (50 mL), and washed with 10% aqueous citric acid. The organic phase was treated with triethylamine (0.4 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-6% MeOH, DCM) to yield 37b (0.079 g, 62.6%).
(334) HRESI-MS: calcd for C.sub.43H.sub.52N.sub.2O.sub.9Na, 863.3565 (MNa.sup.+); found, 863.3563.
Example 118
(335) ##STR00151##
3-Hydroxymethyl-3-(((4,4-dimethoxytrityl)oxy)methyl)-N-(5-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)butanoyl)azetidine 29i
(336) 1-O-(4-carboxybut-1-yl)-3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranoside (0.447 g, 1.0 mmol), HOBt (0.184 g, 1.2 mmol) and EDC-HCl (0.230 g, 1.2 mmol) were dissolved in DCM (3 mL) and were stirred at room temperature for 30 min. This mixture was added to the solution of compound 25 (0.533 g, 1.0 mmol) and DIPEA (0.310 g, 2.4 mmol) in 10 ml of DCM at 0 C. The reaction mixture was stirred 18 h at room temperature and was diluted with DCM (50 mL). The obtained solution was washed with 5% NaHCO.sub.3 and brine. The organic phase was dried over Na.sub.2SO.sub.4 and concentrated. The residue was purified on a silica gel column (1-5% MeOH, DCM) to give 0.725 g (75.4%) compound 29i as a white solid foam.
Example 119
(337) ##STR00152##
3-Hydroxymethyl-3-(((4,4-dimethoxytrityl)oxy)methyl)-N-(5-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)butanoyl)azetidine 30i
(338) 1-O-(4-carboxybut-1-yl)-3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranoside (0.447 g, 1.0 mmol), HOBt (0.184 g, 1.2 mmol) and EDC-HCl (0.230 g, 1.2 mmol) were dissolved in DCM (3 mL) and were stirred at room temperature for 30 min. This mixture was added to the solution of compound 26 (0.563 g, 1.0 mmol) and DIPEA (0.310 g, 2.4 mmol) in 10 ml of DCM at 0 C. The reaction mixture was stirred 18 h at room temperature and was diluted with DCM (50 mL). The obtained solution was washed with 5% NaHCO.sub.3 and brine. The organic phase was dried over Na.sub.2SO.sub.4 and concentrated. The residue was purified on a silica gel column (1-5% MeOH, DCM) to give compound 30i (0.687 g, 70.3%) as a white solid foam.
(339) ##STR00153##
Example 120
2-Cyanoethyl (N(O-(5-(3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)pentenoyl)-3-(((4,4-dimethoxytrityl)oxy)methyl)azetidin-3-yl)methyl N,N-diisopropylamidophosphite 33i
(340) Compound 29i (0.962 g, 1.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.316 g, 1.05 mmol) were dissolved in anhydrous acetonitrile (20 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. Upon cooling to 10 C., 1H-tetrazole (0.45M, 0.40 mmol, 0.889 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 5-50% ethyl acetate in hexanes) to yield 33i (0.953 g, 83.3%) as a white solid foam.
Example 121
(341) ##STR00154##
2-Cyanoethyl (N(O-(5-(3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)pentenoyl)-3-(((4,4-dimethoxytrityl)oxy)methyl)azetidin-3-yl)methyl N,N-diisopropylamidophosphite 34i
(342) Compound 30i (0.977 g, 1.0 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.316 g, 1.05 mmol) were dissolved in anhydrous acetonitrile (20 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. Upon cooling to 10 C., 1H-tetrazole (0.45M, 0.40 mmol, 0.889 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 5-50% ethyl acetate in hexanes) to yield 34i (1.008 g, 85.6%) as a white solid foam.
Example 122
(343) ##STR00155##
(N(O-(5-(3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)pentenoyl)-3-(((4,4-dimethoxytrityl)oxy)methyl)azetidin-3-yl)methyl hemisuccinate 37i
(344) Compound 29i (0.962 g, 1.0 mmol), succinic anhydride (1.00 g, 10 mmol), and pyridine (5.0 mL) were stirred at room temperature for 4 days. The reaction mixture was quenched with water and triethylamine (2 mL) for 4 h, evaporated to an oil, diluted with DCM (50 mL), and washed with 10% aqueous citric acid. The organic phase was treated with triethylamine (4.0 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-4% MeOH in DCM) to yield compound 37i (0.985 g, 84.7%).
Example 123
(345) ##STR00156##
A. (9H-Fluoren-9-yl)methyl (1-(4,4-bis(hydroxymethyl)piperidin-1-yl)-1,5-dioxo-3,10,13,16-tetraoxa-6-azanonadecan-19-yl)carbamate 5c
(346) N-[13-((((N-(9H-Fluore-9-yl)methyl)oxy)carbonyl)amino-4,7,10-trioxatridecan-1-yl)malonamic acid (12.00 g, 21.48 mmol, prepared as disclosed in Eur. J. Med. Chem. 2007, p. 114), was stirred at room temperature for 0.5 h with DIPEA (9.72 g, 75.2 mmol), TBTU (7.05 g, 21.91 mmol), and NMP (22 g). Compound 3 (4.10 g, 22.57 mmol) was added, and stirring was continued for 18 h. The reaction mixture was diluted with ethyl acetate (300 mL) and extracted with brine (1050 mL). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2-15% MeOH in DCM) to give compound 5c (11.87 g, 80.6%).
B. (9H-Fluoren-9-yl)methyl (1-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-1,5-dioxo-3,10,13,16-tetraoxa-6-azanonadecan-19-yl)carbamate 7c
(347) DMT-Cl (3.78 g, 11.17 mmol) was gradually added to a solution of compound 5c (7.295 g, 10.64 mmol) in pyridine (40 mL) over 4 h at 0 C. Next day, the reaction mixture was neutralized with triethylamine (5 mL) and evaporated in vacuo to a thick oil. This was dissolved in ethyl acetate and washed with conc. aqueous sodium bicarbonate and brine. The organic phase was dried over Na.sub.2SO.sub.4, evaporated, and co-evaporated with toluene (320 mL). The product was isolated on a silica gel column (0-8% MeOH, DCM) to yield compound 7c (7.04 g, 65.4%).
(348) NMR H.sup.1 (, CDCl.sub.3): 7.73-7.76 (m, 2H), 7.57-7.61 (m, 3H), 7.36-7.42 (m, 4H), 7.28-7.32 (m, 8H), 7.20-7.25 (m, 1H), 6.81-6.85 (m, 4H), 5.52 (br. t, 1H, NH), 4.38 (d, 2H), 4.21 (br. t, J=7.0 Hz, 1H), 4.16 (s, 2H), 3.99, 4.03 (AB, J=15.0 Hz, 2H), 3.78 (s, 6H), 3.46-3.64 (m, 15H), 3.33-3.40 (m, 3H), 3.30 (q, J=7.0 Hz, 2H), 3.18-3.26 (m, 1H), 3.17, 3.21 (AB, J=15.0 Hz, 2H), 3.00-3.07 (m, 1H), 2.26 (br. t, 1H, OH), 1.75-1.84 (m, 4H), 1.40-1.65 (m, 4H).
(349) NMR C.sup.13 (, CDCl.sub.3): 169.5, 167.1, 158.8, 156.8, 144.7, 144.3, 141.5, 135.7, 130.2, 128.2, 128.2, 127.8, 127.2, 127.2, 125.3, 120.1, 113.4, 86.6, 71.8, 70.8, 70.7, 70.4, 70.4, 69.9, 69.4, 67.6, 67.4, 67.3, 66.6, 55.4, 47.6, 40.6, 39.2, 39.1, 38.05, 38.0, 36.8, 30.0, 29.6, 29.2.
Example 124
(350) ##STR00157##
A. N-(3-(2-(2-(3-aminopropoxy)ethoxy)ethoxy)propyl)-2-(2-(4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(hydroxymethyl)piperidin-1-yl)-2-oxoethoxy)acetamide 59
(351) Compound 7c (6.259 g, 6.33 mmol) was treated with piperidine (25% in methanol, 100 ml) at room temperature for 3 h. The solution was evaporated and co-evaporated with xylenes (320 mL). The crude product was purified on a silica gel column (50% hexanes in DCM.fwdarw.3% NH.sub.4OH, 25% MeOH in DCM) to yield compound 59 (3.84 g, 79.1%).
(352) NMR H.sup.1 (, CDCl.sub.3): 7.66 (br. t, 1H, NH), 7.35-7.41 (m, 2H), 7.26-7.31 (m, 6H), 7.18-7.23 (m, 1H), 6.80-6.85 (m, 4H), 4.16, 4.20 (AB, J=15.0 Hz, 2H); 3.98, 4.03 (AB, J=15.0 Hz, 2H), 3.78 (s, 6H), 3.50-3.63 (m, 15H), 3.62 (t, J=7.5 Hz, 2H), 3.19-3.35 (m, 2H), 3.00-3.06 (m, 3H), 2.78 (t, J=7.5 Hz, 2H), 1.94 (br. s, 3H, NH.sub.2+OH), 1.80 (quin, J=7.5 Hz, 2H), 1.72 (quin, J=7.5 Hz, 2H), 1.43-1.63 (m, 4H).
(353) NMR C.sup.13 (, CDCl.sub.3): 169.5, 167.1, 158.8, 144.7, 135.8, 130.2, 128.2, 128.1, 127.2, 113.4, 86.5, 71.8, 70.7, 70.7, 70.4, 70.3, 70.0, 69.7, 69.4, 67.3, 66.9, 55.4, 40.7, 39.8, 38.0, 38.0, 36.8, 33.36, 29.9, 29.5, 29.2.
B. 2-{2-[4-{[bis(4-methoxyphenyl)(phenyl)methoxy]methyl}-4-(hydroxymethyl)piperidin-1-yl]-2-oxoethoxy}-N-(15-oxo-4,7, 10-trioxa-14-azahexadec-1-yl)-N-t-butylbenzoylbiotinyl amide 61
(354) Triethylammonium salt of N-[4-(t-butyl)benzoyl]biotin (Chem Impex International, Inc., 1.226 g, 2.43 mmol, prepared as disclosed in Nucl. Acids Res. 2003, 31, 2, 709), was stirred at room temperature with DIPEA (0.784 g, 6.06 mmol), TBTU (0.819 g, 2.55 mmol), and NMP (12 g) for 0.5 h. Compound 59 (1.867 g, 2.44 mmol) was added, and the mixture was stirred for 18 h. The mixture was then diluted with ethyl acetate (300 mL) and washed with brine (1020 mL). The organic phase was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (0-8% MeOH in DCM) to give compound 61 (2.33 g, 83.3%).
Example 125
(355) ##STR00158##
(4-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(25-((3aS,4S,6aR)-1-(4-(tert-butyl)benzoyl)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)-5,21-dioxo-3,10,13,16-tetraoxa-6,20-diazapentacosan-1-oyl)piperidin-4-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 63
(356) Compound 61 (1.806 g, 1.57 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.614 g, 2.04 mmol) were dissolved in anhydrous acetonitrile (17 mL). The solution was gently shaken with flame-dried molecular sieves 4 (1.2 g) for 1 h, cooled to 10 C., and treated with 1H-tetrazole in acetonitrile (0.45 M, 1.81 mL). Next day, the reaction mixture was quenched with triethylamine (0.4 mL) and diluted with saturated sodium bicarbonate solution. The product was extracted with DCM and purified on a silica gel column (5% Et.sub.3N, 0.fwdarw.8% methanol in DCM), to yield compound 63 (1.829 g, 86.3%) as a white solid foam.
Example 126
(357) ##STR00159##
Triethylammonium 4-((4-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-1-(25-((3aS,4S,6aR)-1-(4-(tert-butyl)benzoyl)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)-5,21-dioxo-3,10,13,16-tetraoxa-6,20-diazapentacosan-1-oyl)piperidin-4-yl)methoxy)-4-oxobutanoate 15a
(358) Compound 61 (0.385 g, 0.334 mmol), succinic anhydride (0.669 g, 6.68 mmol), and pyridine (3.5 mL) were stirred at room temperature for 7 days. The reaction mixture was quenched with water (0.41 mL, 22.90 mmol) and triethylamine (24.02 mmol, 3.34 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.4 mL), dried over Na.sub.2SO.sub.4, and evaporated. The product was isolated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield compound 65 (0.357 g, 79.0%).
Example 127
(359) ##STR00160##
N-(5-((3,4,6-O-tribenzoyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapentyl)-3,3-bis(hydroxymethyl)azetidine-1-carboxamide 69
(360) A solution of 5-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapentanamine prepared as disclosed in PCT Int. Appl. (2004), WO 2004101619 A1 20041125 (3.055 g, 4 mmol) and carbonyldiimidzole (0.665 g, 4.1 mmol) in DCM (40 mL) was stirred at room temperature for 30 min. Compound 4 (0.48 g, 4.1 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, diluted with ethyl acetate (200 mL), washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 2.129 g (69.7%) of diol 69 as a white solid.
Example 128
(361) ##STR00161##
N-(5-((3,4,6-O-tribenzoyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapentyl)-3-(hydroxymethyl)-3-((tris-(4-methoxyphenyl)methoxy)methyl)azetidine-1-carboxamide 70
(362) Trimethoxytrityl chloride (1.85 g, 5 mmol) was gradually added to a stirred solution of compound 69 (3.819 g, 5 mmol) in pyridine (30 mL) over 4 h at 0 C., and stirring was continued at room temperature for 72 h. The reaction mixture was concentrated, co-evaporated with toluene, and distributed between triethylammonium bicarbonate buffer (pH 7.19) and ethyl acetate. The aqueous layer was additionally extracted with ethyl acetate (250 mL). The combined organic phase was dried over Na.sub.2SO.sub.4, concentrated, and separated on a silica gel column (0-3% MeOH, DCM) to yield compound 70 (3.283 g, 59.9%).
Example 129
(363) ##STR00162##
(1-(5-((3,4,6-O-tribenzoyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapentyl)carbamoyl)-3-(((4,4,4-trimethoxytrityl)oxy)methyl)azetidin-3-yl)methyl (2-cyanoethyl) diisopropylphosphoramidite 71
(364) Compound 70 (1.315 g, 1.2 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.47 g, 1.56 mmol) were dissolved in anhydrous acetonitrile (15 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. This was cooled to 10 C., 1H-tetrazole (0.45M, 0.6 mmol, 1.33 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and was diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and was evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 71 (1.329 g, 85.4%) as a white solid foam.
Example 130
(365) ##STR00163##
Triethylammonium ((1-(5-((3,4,6-O-tribenzoyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapentyl)carbamoyl)-3-(((4,4,4-trimethoxytrityl)oxy)methyl)azetidin-3-yl)methoxy)-4-oxobutanoate 73
(366) Compound 70 (0.691 g, 0.63 mmol), succinic anhydride (0.630 g, 6.3 mmol) and pyridine (2.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 73 (0.673 g, 82.3%).
Example 131
(367) ##STR00164##
1-(5-((3,4,6-O-tribenzoyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapenthyl)--3-(6-(3-(hydroxymethyl)-3-((tris(4-methoxyphenyl)methoxy)methyl)azetidin-1-yl)-6-oxohexyl)urea 75
(368) A solution of 5-((3,4,6-O-triacetyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapentanamine prepared as disclosed in PCT Int. Appl. (2004), WO 2004101619 A1 20041125 (3.055 g, 4 mmol) and carbonyldiimidzole (0.665 g, 4.1 mmol) in DCM (40 mL) was stirred at room temperature for 30 min. Compound 26 (2.307 g, 4.1 mmol) and DIPEA (3.102 g, 24 mmol) were added at 0 C. The reaction mixture was stirred for 18 h at room temperature, diluted with ethyl acetate (200 mL), washed with 5% NaHCO.sub.3, 5% HCl, brine. The extract was dried over Na.sub.2SO.sub.4 and evaporated. The crude product was purified on a silica gel column (2% AcOH, 2-10% MeOH, DCM), to give 3.614 g (74.7%) of compound 75 as a white solid.
Example 132
(369) ##STR00165##
((1-(6-(3-(5-((3,4,6-O-tribenzoyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapentyl)ureido)hexanoyl)-3-((tris(4-methoxyphenyl)methoxy)methyl)azetidin-3-yl)methyl) (2-cyanoethyl) diisopropylphosphoramidite 76
(370) Compound 75 (1.572 g, 1.3 mmol) and 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite (0.51 g, 1.69 mmol) were dissolved in anhydrous acetonitrile (15 mL), and the mixture was shaken with flame-dried molecular sieves 4 for 1 h. This was cooled to 10 C., 1H-tetrazole (0.45M, 0.65 mmol, 1.44 mL) in acetonitrile was added, and the mixture was stirred overnight. The reaction mixture was quenched with triethylamine (0.5 mL) and was diluted with saturated aqueous sodium bicarbonate. The product was extracted with DCM, and the organic extract was dried over Na.sub.2SO.sub.4 and was evaporated to dryness. The crude product was purified on a silica gel column (5% Et.sub.3N, 20-80% ethyl acetate in hexanes) to yield 76 (1.481 g, 80.8%) as a white solid foam.
Example 133
(371) ##STR00166##
Triethylammonium 4-((1-(6-(3-(5-((3,4,6-O-tribenzoyl-2-acetylamino-2-deoxy--D-galactopyranosyl)oxy)-3-oxapentyl)ureido)hexanoyl)-3-((tris(4-methoxyphenyl)methoxy)methyl)azetidin-3-yl)methoxy)-4-oxobutanoate 77
(372) Compound 75 (0.81 g, 0.67 mmol), succinic anhydride (0.670 g, 6.7 mmol) and pyridine (5.0 mL) were stirred at room temperature for 5 days. The reaction mixture was quenched with water and triethylamine (0.4 mL) for 4 h, evaporated to oil, diluted with DCM (100 mL), and washed with 10% aqueous citric acid. Organic phase was basified with triethylamine (0.2 mL), dried over Na.sub.2SO.sub.4, and evaporated. The residue was separated on a silica gel column (1% Et.sub.3N, 0-5% MeOH, DCM) to yield 77 (0.735 g, 77.8%).
Example 134
(373) General Procedure for Synthesis of Solid Supports. Preparation of the Solid Support 39b.
(374) TBTU (155 mg, 0.48 mmol) was added to a solution of compound 35b (400 mg, 0.46 mmol) and N-ethyl-N,N-diisopropylamine (119 mg, 0.92 mmol) in a mixture of anhydrous pyridine (1 mL) and acetonitrile (4 mL). The mixture was stirred for 15 min and transferred to a suspension of aminopropyl CPG1000 (10 g) in anhydrous acetonitrile (45 mL), and the resulting suspension was shaken for 4 h. The suspension was then charged with N-methylimidazole (1 mL) and acetic anhydride (0.5 mL) and was shaken again for 45 min. The solid support was filtered off, washed on the filter with acetonitrile (550 mL) and dried in vacuo. The loading of the finished solid support 39b (43 mol/g) was determined by the standard trityl assay as disclosed in Guzaev, A. P. and Pon, R. T. Attachment of Nucleosides and Other Linkers to Solid-Phase Supports for Oligonucleotide Synthesis. In: Curr. Protoc. Nucleic Acid Chem. Ed. Beaucage, S. L., Vol. 52, Unit 3.2, pp. 3.2.1-3.2.23, John Wiley & Sons: 2013.
(375) All other solid supports 19-22, 39-42, 55k-58k, 67, 68, 74 and 78 were synthesized using the procedure disclosed above to give the loading values of 35-45 mol/g.
Example 135
(376) Oligonucleotide Synthesis, Deprotection, and Analysis.
(377) Oligonucleotides were assembled on an Applied Biosystems DNA/RNA Synthesizer 394 on 1 mol scale starting with a commercial DMT-T-Succinyl-CPG500 or with non-nucleosidic solid supports disclosed herein, using 0.1 M solutions of commercial protected nucleoside phosphoramidites (Glen Research, Sterling, Va.) and solutions of 1H-tetrazole or 5-benzylthio-1H-tetrazole as activators. Except for cholesterol phosphoramidites 31j-34j that were used as 0.1 M solutions in acetonitrile-dichloromethane (9:1), all other non-nucleosidic phosphoramidites 11-14, 31-34, 47k-50k, 63, 64, 71, and 76 disclosed herein were used as 0.1 M solutions in acetonitrile. For the attachment of phosphoramidites 11e-14e, 31c-34c, 31j-34j, 31k-34k, 31m-34m, 47k-50k, 63, and 64, the coupling protocol was extended to 23 min. With all other non-nucleosidic phosphoramidite building blocks, the coupling time was 3 min.
(378) For the attachment of the first nucleoside phosphoramidite to solid supports 19-22, 39-42, 55k-58k, 67, 68, 71, and 76 the coupling time was extended to 2 min. The remaining nucleobases were incorporated by using the standard protocols.
(379) In the synthesis of oligonucleotide phosphorothioates, the sulfurization step was carried out using 0.075 M N,N-dimethyl-N-(3-thioxo-3H-1,2,4-dithiazol-5-yl)-methanimidamide (DDTT) in pyridine as disclosed in U.S. Pat. No. 7,723,528.
(380) The final cleavage and deprotection of nucleic bases was carried out by treating the solid support-bound, 5-DMT or 5-TMT-protected oligonucleotides under the following conditions: 6. Conc. aqueous ammonium hydroxide for 8 h at 65 C. 7. Treatment with a mixture of diethylamine and acetonitrile (5:1) for 3 min followed by acetonitrile wash and final deprotection with conc. aqueous ammonium hydroxide for 8 h at 65 C. 8. A mixture of conc. aqueous ammonium hydroxide with 40% aqueous methylamine (1:1) for 15 min at 65 C. 9. Treatment with a mixture of diethylamine and acetonitrile (5:1) for 3 min followed by acetonitrile wash and final deprotection with a solution of ethylenediamine in toluene (1:1) for 2 h at room temperature, acetonitrile wash, and eltion of the product with water. 10. 50 mM K.sub.2CO.sub.3 in methanol at room temperature.
(381) Upon evaporation of deprotection mixtures in vacuo, the crude products were dissolved in water, filtered, and analyzed by reverse-phase HPLC and ES MS.
(382) HPLC analysis was carried out on a Phenomenex Gemini C18 (2504.6 mm, 5 m) column using 0.05 M aqueous Tris-HCl, pH 7.2 as Buffer A, acetonitrile as Buffer B, and a linear gradient from 0 to 60% B over a period of 40 min at a flow rate of 0.75 mL/min. Oligonucleotides derivatized with cholesterol were analyzed on a Waters Symmetry Shield Tm RP8 5 m 4.6150 mm (Part No WAT 2000662) column using buffers disclosed above, a linear gradient of 0 to 80% B in 20 min, and a flow rate of 0.75 mL/min.
(383) Skilled artisans will appreciate that numerous changes and modifications may be made to the preferred embodiments of the invention and that such changes and modifications may be made without departing from the spirit of the invention. It is therefore intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.