<i>Salmonella paratyphi A </i>with an O-antigen having an extended carbohydrate chain and use thereof

10780154 ยท 2020-09-22

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention discloses a Salmonella paratyphi A with an O-antigen having an extended carbohydrate chain and uses thereof. The method comprises the following steps: inactivating an cld gene encoding an enzyme controlling chain length of O-antigen of a Salmonella paratyphi A strain to obtain a Salmonella paratyphi A with deletion of cld gene; allowing overexpression of cld.sub.LT2 gene encoding an enzyme controlling chain length of O-antigen of Salmonella typhimurium in Salmonella paratyphi A deficient in the cld gene encoding an enzyme controlling chain length of O-antigen, so as to extend carbohydrate chain length of O-antigen. Both of the Salmonella paratyphi A O-polysaccharide-recombinant fusion protein conjugate vaccines rCTB4573.sub.3-OPS.sub.Spty50973 and rEPA4573-OPS.sub.Spty50973 as prepared by using Salmonella paratyphi A with an O-antigen having an extended carbohydrate chain can induce mice to generate specific antibodies against Salmonella paratyphi A, and their antibody titers are significantly improved.

Claims

1. A recombinant strain, which is obtained by introducing a cld.sub.LT2 gene encoding an enzyme controlling chain length of O-antigen of Salmonella typhimurium into Salmonella paratyphi A which is deficient in cld gene encoding an enzyme controlling chain length of O-antigen; wherein the amino acid sequence of the enzyme controlling chain length of the O-antigen of Salmonella typhimurium has the amino acid sequence as shown in SEQ ID NO: 2.

2. The recombinant strain according to claim 1, characterized in that the Salmonella paratyphi A which is deficient in cld gene encoding an enzyme controlling chain length of O-antigen is obtained by a method comprising the following steps: (1) preparing a linear targeting DNA fragment 1, which has a nucleotide sequence as shown in SEQ ID NO: 11, and contains a cat gene; (2) transforming pKD46 plasmid into a Salmonella paratyphi strain, to obtain a recombinant strain designated as S. paratyphi/pKD46; (3) inducing expression of Red recombination system in the S. paratyphi/pKD46 strain, and transforming the linear targeting DNA fragment 1 into the S. paratyphi/pKD46 strain, so that the linear targeting DNA fragment 1 replaces the cld gene of the S. paratyphi/pKD46 strain to obtain a recombinant strain designated as S. paratyphi cld::cat/pKD46; (4) deleting the pKD46 plasmid from the S. paratyphi cld::cat/pKD46 strain, to obtain a recombinant strain designated as S. paratyphi fcld::cat; the S. paratyphi cld::cat is a S. paratyphi in which cld gene sequence is substituted with cat gene sequence; (5) transforming plasmid pCP20 into the S. paratyphi cld::cat and deleting cat gene, to obtain a recombinant strain designated as S. paratyphi cld; the S. paratyphi cld is a cld gene-deleted S. paratyphi.

3. The recombinant strain according to claim 1, wherein the gene encoding the enzyme controlling chain length of the O-antigen of Salmonella typhimurium has a sequence as shown in SEQ ID NO: 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows a PCR identification diagram of S. paratyphi CMCC50973 with knockout of cld gene.

(2) FIG. 2 shows a silver staining diagram of LPS before and after S. paratyphi CMCC50973 cld gene is replaced.

(3) FIG. 3 shows a detection diagram of glycosylation modification of the recombinant fusion protein after the substitution of cld gene.

(4) FIG. 4 shows a detection diagram of multi-site glycosylation modification of the recombinant CTB fusion proteins.

(5) FIG. 5 shows a detection diagram of rEPA4573-OPS.sub.Spty50973 purification effect.

(6) FIG. 6 shows a detection diagram of rCTB4573.sub.3-OPS.sub.Sp50973 purification effect.

(7) FIG. 7 shows an immunogenicity evaluation of glycoprotein conjugates.

(8) FIG. 8 shows a molecular identification of S. paratyphi CMCC50973cldwaaL.

BEST MODELS FOR CARRYING OUT THE INVENTION

(9) The experimental methods used in the following examples are conventional methods unless otherwise specified.

(10) The materials, reagents and the like used in the following examples are commercially available, unless otherwise specified.

(11) Experimental materials: Salmonella paratyphi A CMCC50973 strain (Salmonella. paratyphi CMCC50973), purchased from the China Medical Bacteria Deposit Management Center.

(12) pET-22b plasmid, purchased from Novagen Corporation under catalog number 69744.

(13) pKOBEG plasmid, disclosed in the literature A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans [J]. Nucleic Acids Res. 2000 Nov. 15; 28 (22): E97, available for the public in the Institute of Bioengineering of the Academy of Military Medical Sciences of the Chinese People's Liberation Army; the plasmid is a temperature-sensitive plasmid with chloramphenicol resistance.

(14) pKD3 plasmid, disclosed in the literature Datsenko, K. A. and B. L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA, 2000, 97(12): p. 6640-5.; available for the public in the Institute of Bioengineering of the Academy of Military Medical Sciences of the Chinese People's Liberation Army.

(15) pKD46 plasmid, discloses in the literature Datsenko, K. A. and B. L. Warmer, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA, 2000, 97(12): p. 6640-5.; available for the public in the Institute of Bioengineering of the Academy of Military Medical Sciences of the Chinese People's Liberation Army. The replicons of the pKD46 plasmid are temperature sensitive, which would be disappeared during culture at 37 C., and this plasmid contains DNA encoding three recombinases for the Red recombination system, which is controlled by arabinose promoter.

(16) pCP20 plasmid, disclosed in the literature Datsenko, K. A. and B. L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA, 2000, 97(12): p. 6640-5.; available for the public in the Institute of Bioengineering of the Academy of Military Medical Sciences of the Chinese People's Liberation Army. The replicons of the pCP20 plasmid are temperature sensitive, which be lost during culture at 42 C. The plasmid contains DNA encoding FLP recombinase, which is controlled by a thermo-sensitive promoter, and the expression of FLP recombinase is induced at 42 C., while the plasmid is lost.

(17) Aluminum hydroxide adjuvant Rehydragel LV was purchased from General Chemical Company.

Example 1. Method for Extending Length of Salmonella paratyphi A O-Antigen Carbohydrate Chain

(18) I. Knocking Out cld Gene Encoding an Enzyme Controlling Chain Length of O-Antigen of Salmonella paratyphi A CMCC50973 Strain

(19) 1. Preparation of Linear Targeting DNA Fragment 1

(20) 1) Design of PCR Primer

(21) The targeting fragment of the cld gene (sites 887812 to 888789) was designed according to the S. paratyphi ATCC9150 genome sequence (CP000026) published by GeneBank, and the cld gene of Salmonella paratyphi A CMCC50973 was knocked out. In the upstream and downstream of the cld gene, 500 bp fragments were cut out and used as the homologous arms, and the targeting fragment of chloramphenicol resistant gene containing 500 bp homologous sequence and FRT site at both ends was amplified by PCR. 50973cld up 5 and 50973cld down 3 were used to identify whether the cld gene was knocked out. The specific primer design was shown in Table 1.

(22) TABLE-US-00001 TABLE1 Primersusedforknockingoutcldgeneof SalmonellaparatyphiACMCC50973strain Effect Nameof Primersequence ofprimer primer (5.fwdarw.3) Notes pair 50973cld CCAGCTTCATCCTTTTTTTA Under- Amplifying cat5 GTTAGGGTATCTATGACAAG lined toobtain CGATTGTGTAGGCTGGAG part chloram- (SEQIDNO:15) wascld phenicol homo- resistant logous gene arm. fragments with cld upstream and downstream homologous arms. 50973cld CCTTTCGAAGCCGACCACCA cat3 TCCGGCAAAGAAGCTAATTA ACGGCTGACATGGGAATTAG (SEQIDNO:16) 50973cld CAGTTGCTGGCTAATTATCA Amplifying up5 GTCAGTGCCT cld (SEQIDNO:17) primersof upstream and downstream homologous arms. 50973cld GTCATAGATACCCTAACTAA up3 AAAAAGGATGAAGC (SEQIDNO:18) 50973cld TTCTTTGCCGGATGGTGGTC down5 GGCTTCGAAA (SEQIDNO:19) 50973cld TTATGGACCAAAGGCGAAAC down3 CTCAGGCCAT (SEQIDNO:20)

(23) 2) Acquisition of Linear Targeting DNA Fragment 1

(24) Using the plasmid pKD3 as template, primers 50973 cld cat 5 and 50973 cld cat 3 were used to amplify a chloramphenicol resistant gene fragment 50973 cld cat which had at both ends homologous arms 41 bp upstream and downstream of the cld gene and FRT site; using Salmonella paratyphi A CMCC50973 genomic DNA as template, amplification was performed by using 50973 cld up5 and 50973 cld up3 to obtain cld upstream 500 bp homologous arm 50973 cld up, while using 50973 cld down 5 and 50973 cld down 3 to obtained cld downstream 500 bp homologous arm 50973 cld down, and then the 3 fragments 50973 cld cat, 50973 cld up and 50973 cld down were fused by PCR to obtain linear targeting DNA fragment 1 (SEQ ID NO: 11).

(25) PCR reaction system was of 50 L, which comprised Q5 super-fidelity DNA polymerase 0.5 L, 5 buffer 10 L, template 1 L, dNTP 4 L, primer 2.5 L, deionized water 29.411;

(26) PCR reaction conditions: 98 C. 20 s; 98 C. 10 s, 55 C. 10 s, 72 C. 50 s, 30 cycles; 72 C. 5 min, to obtain the linear targeting DNA fragment 1 as shown in SEQ ID NO: 11. The product was separated by 1% agarose gel electrophoresis, the target strip was cut out from the gel, and the PCR product was recovered by using a DNA gel recovery kit. The procedure was carried out according to the instructions.

(27) 2. Acquisition of Salmonella paratyphi A (S. paratyphi CMCC50973cld) Deficient in cld Gene Encoding an Enzyme Controlling Chain Length of O-Antigen

(28) 1) Preparation of S. paratyphi CMCC50973/pKD46

(29) (1) S. paratyphi CMCC50973 was inoculated in a LB liquid medium, incubated overnight at 37 C., transferred to LB liquid medium at 1:100, and incubated at 37 C. until OD.sub.600 reached 0.6.

(30) (2) Bacteria were collected by centrifugation, washed with autoclavation sterilized 10% glycerol (v/v) for four times, and finally were suspended with 400 L of 10% glycerol, to obtain competent cells for electroporation, which were sub-packaged, ready to use.

(31) (3) pKD46 plasmid was electroporated into the prepared S. paratyphi CMCC50973 competent cells, coated on a LB plates containing 100 g/mL ampicillin, cultured at 30 C. overnight, to obtain positive clones as S. paratyphi CMCC50973/pKD46 strain.

(32) 2) Acquisition of S. paratyphi CMCC50973 cld::cat Strain

(33) (1) The above obtained S. paratyphi CMCC50973/pKD46 was cultured overnight at 30 C. and passed at 1:100 in a LB liquid medium containing ampicillin.

(34) (2) When OD.sub.600 was about 0.2, L-arabinose at a final concentration of 0.2% (w/v) was added to induce the expression of Red recombination system, and when OD.sub.600 value was 0.6, S. paratyphi CMCC50973/pKD46 competent cells were prepared by the steps as described above.

(35) (3) 10 L of the linear targeting DNA fragment 1 obtained in the above Step 1 was taken and electroporated into the sub-packaged S. paratyphi CMCC50973/pKD46 competent cells.

(36) (4) The cells were rapidly added to 1 mL of pre-cooled LB medium, resuscitated at 30 C. for about 2.5 h, and then coated on a LB plate containing 30 g/mL chloramphenicol at a final concentration, and placed in a 30 C. incubator for culture overnight.

(37) (5) The positive clones were screened, and subjected to PCR identification using primers 50973 cld cat 5 and 50973 cld cat 3, in which the wild-type bacteria could not be amplified to generate fragments, the cld gene was identified to have a size of 1100 bp after being substituted by cat gene. According to the PCR results, positive clones of S. paratyphi CMCC50973 cells in which the cld gene was replaced by the cat gene were screened out, to obtain the deletion mutant S. paratyphi CMCC50973 cld::cat/pKD46.

(38) 3) Acquisition of S. paratyphi CMCC50973cld Strain

(39) (1) The positive clone S. paratyphi CMCC50973 cld::cat/pKD46 was inoculated into a LB liquid medium containing 30 g/mL chloramphenicol, cultured and passed at 37 C. for three times (cultured for 12 h each time), to remove pKD46 plasmid, so as to obtain S. paratyphi CMCC50973 cld::cat strain.

(40) (2) The S. paratyphi CMCC50973 cld::cat as prepared according to the above method was used for electroporation of the competent cells, and plasmid pCP20 was electroporated into S. paratyphi CMCC50973 cld::cat competent cells, and then coated with a LB plate containing ampicillin, so as to obtain S. paratyphi CMCC50973 cld::cat/pCP20 strain.

(41) (3) S. paratyphi CMCC50973 cld::cat/pCP20 monoclones were picked and placed in a LB liquid medium, incubated at 30 C. until OD.sub.600 was about 0.6, and transferred and cultured at 42 C. overnight.

(42) (4) The bacterial solution cultured overnight at 42 C. was streaked on a LB plate, and monoclones were picked out on LB plates and LB plates containing chloramphenicol. The monoclones that grew on the LB plates but did not grow on chloramphenicol-containing LB plates were chosen, and subjected to PCR identification by using primers 50973 cld up 5 and 50973 cld down 3. The PCR identification showed the size of wild S. paratyphi CMCC50973 fragment was 2028 bp, while the size after knockout of the cld gene was 1100 bp. The results of the PCR identification were shown in FIG. 1. The positive clone was named S. paratyphi CMCC50973cld.

(43) II. Acquisition and Phenotype Identification of O-Antigen Carbohydrate Chain-Extended Salmonella paratyphi A

(44) 1. Construction of a Vector Expressing cld.sub.LT2 Gene Encoding an Enzyme Controlling Chain Length of O-Antigen of Salmonella typhimurium

(45) The DNA sequence as shown in SEQ ID NO: 1 was synthesized according to the nucleotide sequence of cld gene (GeneBank No.: NC_003197.1, position 2156832 to 2157815) encoding an enzyme controlling chain length of O-antigen of Salmonella typhimurium, and this gene was named as cld.sub.LT2. The enzyme controlling chain length of O-antigen has an amino acid sequence as shown in SEQ ID NO: 2, and the cld.sub.LT2 gene encoding the enzyme has a sequence as shown in SEQ ID NO: 1.

(46) The synthesized cld.sub.LT2 gene was digested with EcoRI and Hind III, linked into pMMB66EH expression vector (purchased from ATCC, ATCC37620), to construct transition vector pMMB66EH-cld.sub.LT2, the primers 66tac 5 and 66tac 3 were designed by using pMMB66EH-cld.sub.LT2 as template, the expression cassette carrying cld.sub.LT2 gene was amplified, and linked to pET28a (purchased from Novagen) between restriction enzyme cutting sites of Xba I and XhoI, so as to construct expression vector pETtac28-cld.sub.LT2. The primers were as follows:

(47) TABLE-US-00002 (SEQIDNO:21) 66tac5:AAAATCTAGAGCGCCGACATCATAACGGTTCTGGCA; (SEQIDNO:22) 66tac3:TTTTCTCGAGCGTTCACCGACAAACAACAGATAA.

(48) The sequencing results showed that the sequence as shown in SEQ ID NO: 1 was inserted between the restriction enzyme cutting sites of Xba I and Xho I in the pET28a vector, which indicated the vector was correct.

(49) 2. Salmonella paratyphi A LPS Length Detection

(50) The above-prepared S. paratyphi CMCC50973cld electroporation competent cells were electroporated with the above-obtained pETtac28-cld.sub.LT2, coated on kanamycin-containing LB plates, and positive clones were picked and cultured at 37 C. When OD.sub.600 was about 0.6, IPTG with a final concentration of 1 mM was added to induce expression of cld.sub.LT2 gene.

(51) After 10 h of induction, 1 mL of culture was taken and the cells were collected by centrifugation, washed with PBS once, and 100 L of lysis buffer (2 mL of 10% SDS, 0.4 mL of 2-mercaptoethanol, 1 mL of 100% glycerol, 5 mL of 2M Tris-HCL pH 6.8, 20 L of 10% bromophenol blue, 1.6 mL of ddH.sub.2O) was added and fully mixed, heated with boiling water for 10 min, added with 4 L of 20 mg/mL of proteinase K, reacted at 60 C. for 1-2 h, 15 L of product was taken for loading and performing SDS-PAGE, in which the separation gel was 15%, the concentrated gel was 4%, and the electrophoresis was ceased after the bromophenol blue gel exuded for 30 minutes.

(52) The above-mentioned polyacrylamide gel was placed in an immobilized solution overnight, added with a sensitizing solution and reacted for 30 min, washed with deionized water 3 times, 15 min per time, added a silver nitrate solution and reacted for 20 min, washed twice with deionized water, 1 min per time, add with a developer solution for color development, the reaction was finally terminated, and the product was washed with deionized water. At the same time, the wild strain of S. paratyphi CMCC50973 was used as control.

(53) The results were showed in FIG. 2, in which the result of silver staining test showed that the LPS of the wild S. paratyphi CMCC50973 was distributed in the lower molecular weight region, while when the cld gene thereof was replaced by cld.sub.LT2, relatively concentrated LPS stripes appeared in the higher molecular weight region, which indicated that by replacing the cld gene of S. paratyphi CMCC50973 with cld.sub.LT2, the O-antigen carbohydrate chain thereof was significantly extended.

Example 2. Salmonella paratyphi A O-Antigen-Recombinant Fusion Protein Conjugate Vaccine as Prepared by One-Step Bio-Crosslinking Method and Uses Thereof

(54) I. Construction of O-Antigen Ligase Gene waaL Deficient Salmonella paratyphi A

(55) (I) Preparation of Linear Targeting DNA Fragment 2

(56) 1. Design and Synthesis of PCR Primers

(57) By referring to the waaL gene (GeneBank No. CP000026, sites 3696236-3697450) in the whole genome sequence (NC_006511) of the Salmonella paratyphi A 50973 strain (S. paratyphi CMCC50973) and its upstream and downstream sequences, a pair of primers was designed for each of upstream (5 end) and downstream (3 end) of the waaL gene, namely 73waaLu1/73 waaLu2 and 73waaLd1/73waaLd2. For ease of manipulation, the restriction sites BamH I and Sal I were added to the primer ends of the upstream homologous arm up, and the restriction sites Hind III and Xho I were added to the primer ends of the downstream homologous arm down. In the meantime, besides the waaL gene upstream and downstream homologous arms on the genome, a pair of primers (73waaLw1/73waaLw2), a pair of internal detection primers (73waaLn1/73waaLn2) and a pair of kan gene primers (Kan1/Kan2) were designed for simultaneous sequencing and verification, in order to test whether the mutants were constructed successfully. The above-mentioned primers had sequences as shown in Table 2 (the underlined sequences were recognition sites for restriction enzyme digestion).

(58) TABLE-US-00003 TABLE2 Sequencesofprimers Primer Sequence(5.fwdarw.3) Use 73waaLu1 CGGGATCCAGGCTTTGACTATGTGGA Amplifying (SEQIDNO:23) upfragment 73waaLu2 GCGTCGACATCTGGCGATATGAGTATG (SEQIDNO:24) 73waaLd1 CCAAGCTTTAGTGCAGGCATATTGGG Amplifying (SEQIDNO:25) downfragment 73waaLd2 CCCTCGAGTATCACCTCGCAGAACCT (SEQIDNO:26) 73waaLw1 AACACCGGATTACGGATAA Identifying (SEQIDNO:27) mutants 73waaLw2 TGCATGGTGGCTGTAGAA (SEQIDNO:28) 73waaLn1 AGAAACGGTTGCGAAAAT Identifying (SEQIDNO:29) mutants 73waaLn2 ATAGCCGTAGCCCTTGAT (SEQIDNO:30) Kan1 GCGTCGACGTGTAGGCTGGAGCTGCTTC Identifying (SEQIDNO:31) mutants Kan2 CCAAGCTTATGGGAATTAGCCATGGTCC (SEQIDNO:32)

(59) 2. Construction of Linear Targeting DNA Fragment 2

(60) 1) Using the genomic DNA of Salmonella paratyphi A 50973 as template, the upstream and downstream homologous arms, up fragment and down fragment, of the waaL gene were amplified by 73waaLu1/73waaLu2 and 73waaLd1/73waaLd2, respectively. The PCR procedures were as follows: 94 C. 10 min; 94 C. 30 s, 50 C. 30 s, 72 C. 30 s, 30 cycles; 72 C. 10 min.

(61) 2) Construction of pETKan

(62) The kan gene fragment represented by the nucleotide sequence at sites 578-2073 in SEQ ID NO: 12 was artificially synthesized, and the kan gene fragment and pET-22b plasmid were digested with the restriction enzymes SalI and Hind IIII, and a recombinant plasmid was obtained after ligating, and named as pETKan. The pETKan was sequenced and the results were correct.

(63) 3) The up fragment was doubly digested with restriction endonucleases BamH I and SalI to obtain a gene fragment 1; the plasmid pETKan was doubly digested with restriction endonucleases BamH I and Sal I to obtain a vector large fragment 1; and the gene fragment 1 was ligated with the vector large fragment 1 to obtain an intermediate vector 1;

(64) the down fragment was doubly digested with restriction endonuclease Hind III and Xho I to obtain a gene fragment 2; the intermediate vector 1 was doubly digested with restriction endonuclease Hind III and Xho I to obtain a vector large fragment 2; and the gene fragment 2 was ligated with the vector large fragment 2 to obtain an intermediate vector 2.

(65) 4) The intermediate vector 2 was doubly digested with restriction endonucleases BamH I and Xho I to obtain the desired targeting DNA fragment that had homologous arms at both sides and contained the kan gene in the middle part, and the fragment has a nucleotide sequence as shown in SEQ ID NO: 12. In the SEQ ID NO: 12, as counting from the 5 end, the nucleotides at sites 7-571 were the up fragment, the nucleotides at sites 578-2073 were the kan gene, and the nucleotides at sites 2080-2543 were the down fragment.

(66) A linear targeting DNA fragment 2 (SEQ ID NO: 12) with a concentration of up to 300 ng/L was obtained by further PCR amplification of the target fragment by using the DNA fragment shown in SEQ ID NO: 12 as template and 73waaLu1 and 73waaLd2 as primers.

(67) (II) Construction of S. paratyphi CMCC50973/pKOBEG

(68) Since the pKOBEG plasmid contained the various enzymes required to encode the -Red recombination system, the pKOBEG plasmid was electroporated into S. paratyphi CMCC50973 competent cells, coated to chloramphenicol resistant (pKOBEG plasmid resistance, chloramphenicol) LB plate, and cultured at 30 C. overnight to obtain a positive clone, which was named as S. paratyphi CMCC50973/pKOBEG strain.

(69) (III) Using Linear Targeting DNA Fragment 2 to Electroporate S. paratyphi CMCC50973/pKOBEG

(70) 1. S. paratyphi CMCC50973/pKOBEG was inoculated to a low salt LB medium containing chloramphenicol in a final concentration of 30 g/mL and cultured overnight at 30 C., then passaged to a low salt LB liquid medium at a volume ratio of 1:100, and continuously cultured.

(71) 2. The culture medium in Step 1 was added with L-arabinose at a final concentration of 1 mmol/L at 1 hour before the OD.sub.600 value reached 0.6, so as to induce the expression of the Red recombination system.

(72) 3. When the OD.sub.600 value of the culture medium in step 2 reached 0.6, 5 L of the 300 ng/L linear targeting DNA fragment 2 as prepared in step (I) was taken and used to electroporate and transform S. paratyphi CMCC50973/pKOBEG.

(73) 4. 1 mL of pre-cooled low salt LB liquid medium was rapidly added to the transformed cells, resuscitation was performed at 30 C. for about 2.5 hours, and then the medium was coated on LB plates containing kanamycin at a concentration of 50 g/mL, placed in 30 C. incubator and cultured overnight, and positive clones were screened out.

(74) 5. The positive clones were inoculated into a liquid LB medium (with kanamycin resistance at a concentration of 50 g/mL), cultured and passaged twice at 42 C. (12 hours each time) to remove pKOBEG plasmid, and finally obtain a mutant with kanamycin resistance waaL deletion, named S. paratyphi CMCC50973 waaL::kan.

(75) (IV) The plasmid pCP20 coding FRT site-specific recombinase was electroporated and transferred into S. paratyphi CMCC50973waaL::kan, cultured at 30 C. on a LB plate that contained chloramphenicol at a concentration of 50 g/mL and was free of kanamycin, positive clones of Cm.sup.rKm.sup.s (chloramphenicol resistant, Kanamycin sensitive) were screened out.

(76) (V) The positive clones screened out in step (IV) were transferred into a liquid LB and cultured at 42 C. for 12 h to obtain a mutant with deletion of target genes that did not contain kanamycin and plasmid pCP20, which were named as S. paratyphi CMCC50973waaL, so that Salmonella paratyphi A with deletion of waaL gene was obtained.

(77) II. Construction of Salmonella paratyphi A with Deletion of waaL Gene and cld Gene

(78) (I) Preparation of Linear Targeting DNA Fragment 2

(79) The steps were the same of the above step (I).

(80) (II) Construction of S. paratyphi CMCC50973cld/pKOBEG

(81) Since the pKOBEG plasmid contained the various enzymes required to encode the -Red recombination system, the pKOBEG plasmid was electroporated and transformed into S. paratyphi CMCC50973cld competent cells, and coated a LB plate with chloramphenicol resistance (pKOBEG plasmid resistance, chloramphenicol), cultured at 30 C. overnight to give a positive clone named S. paratyphi CMCC50973cld/pKOBEG strain.

(82) (III) Using Linear Targeting DNA Fragment 2 to Electroporate S. paratyphi CMCC50973cld/pKOBEG

(83) 1. S. paratyphi CMCC50973cld/pKOBEG was inoculated to a low salt LB liquid culture medium containing chloramphenicol at a final concentration of 30 g/mL and cultured at 30 C. overnight, and then passaged to a low salt LB liquid medium at a volume ratio of 1:100, and continuously cultured.

(84) 2. The culture medium in Step 1 was added with L-arabinose at a final concentration of 1 mmol/L at 1 hour before the OD.sub.600 value reached 0.6, so as to induce the expression of the Red recombination system.

(85) 3. When the OD.sub.600 value of the culture medium in step 2 reached 0.6, 5 L of the 300 ng/L linear targeting DNA fragment 2 as prepared in step (I) was taken and used to electroporate and transform S. paratyphi CMCC50973cld/pKOBEG.

(86) 4. 1 mL of pre-cooled low salt LB liquid medium was rapidly added to the transformed cells, resuscitation was performed at 30 C. for about 2.5 hours, and then the medium was coated on LB plates containing kanamycin at a concentration of 50 g/mL, placed in 30 C. incubator and cultured overnight, and positive clones were screened out.

(87) 5. The positive clones were inoculated into a liquid LB medium (with kanamycin resistance at a concentration of 50 g/mL), cultured and passaged twice at 42 C. (12 hours each time) to remove pKOBEG plasmid, and finally obtain a mutant with kanamycin resistance waaL deletion, named S. paratyphi CMCC50973cldwaaL::kan.

(88) (IV) The plasmid pCP20 coding FRT site-specific recombinase was electroporated and transferred into S. paratyphi CMCC50973cldwaaL::kan, cultured at 30 C. on a LB plate that contained chloramphenicol at a concentration of 50 g/mL and was free of kanamycin, positive clones of Cm.sup.rKm.sup.s (chloramphenicol resistant, Kanamycin sensitive) were screened out.

(89) (V) The positive clones screened out in step (IV) were transferred into a liquid LB and cultured at 42 C. for 12 h to obtain a mutant with deletion of target genes that did not contain kanamycin and plasmid pCP20, which were named as S. paratyphi CMCC50973cldwaaL.

(90) II. Molecular Identification of S. paratyphi CMCC50973cldwaaL

(91) The genomic DNAs of S. paratyphi CMCC509730cld and S. paratyphi CMCC50973cldwaaL were separately used as templates, and PCR identification was performed by separately using a pair of waaL internal primers (73 waaLn1/73 waaLn2), a pair of waaL external primers (73waaLw1/73waaLw2) and kan primers (kan1/kan2). The results are shown in FIG. 8; and in FIG. 8, 50973waaL represents S. paratyphi CMCC50973cldwaaL; 50973 represents S. paratyphi CMCC50973cld.

(92) The results showed that there was not a target strip when the PCR amplification was performed by using the genomic DNA of S. paratyphi CMCC50973cldwaaL as template and waaL internal primers as primers; while there was a target strip when the PCR amplification was performed by using the genomic DNA of S. paratyphi CMCC50973cld as template and waaL internal primers as primers. Moreover, since the S. paratyphi CMCC50973cldwaaL had knockout of waaL gene, the target strip obtained when performing the PCR amplification by using the genomic DNA of S. paratyphi CMCC50973cldwaaL as template and waaL external primers as primers was smaller than the strip obtained when performing PCR amplification by using the genomic DNA of S. paratyphi CMCC50973cld as template and waaL external primers as primers. As a result of the removal of the Kan resistance gene, there was not a target strip when the PCR amplification was performed by using the genomic DNA of S. paratyphi CMCC50973cldwaaL as a template and the kan primer as a primer.

(93) These results demonstrated the successful construction of the Salmonella paratyphi A 50973 mutant S. paratyphi CMCC50973cldwaaL, which had waaL gene deletion and cld gene deletion.

(94) III. Construction of Glycosylation Engineering Salmonella paratyphi A

(95) 1. Construction of rEPA4573 and rCTB4573 Expression Vectors

(96) A recombinant Pseudomonas aeruginosa exotoxin A fusion protein (rEPA4573) was constructed according to the amino acid sequence of Pseudomonas aeruginosa exotoxin A (AE004091.2) published by GeneBank, in which its signal peptide (the first 25 amino acids) was replaced by DsbA signal peptide, its E at position 553 was deleted, in the meantime, the L at position 552 was mutated as V, and its C-terminal was fused with the polypeptide sequences shown in positions 45-73 amino acids (defined as Pla) of Neisseria meningitidis pilin PiLE (NC_003112.2) and 6His tag. The amino acid sequence of the optimized rEPA4573 was shown in SEQ ID NO: 4, wherein the 1-19 positions were the amino acid sequence of the DsbA signal peptide; the amino acids at positions 20-631 were the amino acid sequence of non-toxic mutant of Pseudomonas aeruginosa toxin protein A; the amino acids 637-665 were the amino acid sequence of the polypeptide at 45-73 positions of Neisseria meningitidis pilin PiLE (NC_003112.2), and the amino acids 666-674 were flexible linker sequence and 6His tag sequence; the optimized gene sequence of rEPA4573 was shown in SEQ ID NO: 3. The artificially synthesized rEPA4573 coding sequence was digested with EcoR I and Hind III, and ligated into pMMB66EH expression vector (ATCC, ATCC37620) to construct pMMB66EH-rEPA4573 vector.

(97) Sequencing results showed that the sequence shown in SEQ ID NO: 3 was inserted between the EcoR I and Hind III cleavage sites of the pMMB66EH expression vector, indicating that the vector was correct.

(98) The recombinant CTB fusion protein (rCTB4573) was constructed according to the amino acid sequence of cholera toxin B subunit (CTB) (X76390.1) published by GeneBank, in which its signal peptide (the first 21 amino acids) was replaced by the DsbA signal peptide, and the C-terminal of the recombinant fusion protein was fused with the polypeptide sequence at the 45-73 positions of Neisseria meningitidis pilin PiLE (NC_003112.2) and 6His tag. The amino acid sequence of the optimized recombinant CTB fusion protein was set forth in SEQ ID NO: 6, wherein the 1-19 positions were the amino acid sequence of the DsbA signal peptide, the positions 20-122 were the amino acid sequence of the cholera toxin B subunit, the 128-156 positions were the amino acid sequence at the 45-73 position of Neisseria meningitidis PilE (NC_003112.2), the 157-166 positions were the flexible linker and the 6His tag sequence; the coding sequence of the optimized recombinant CTB fusion protein was shown in SEQ ID NO: 5. The artificially synthesized gene encoding recombinant CTB fusion protein was digested with EcoR I and Hind III, and ligated into pMMB66EH expression vector (ATCC, ATCC37620) to construct pMMB66EH-rCTB4573 vector.

(99) Sequencing results showed that the sequence shown in SEQ ID NO: 5 was inserted between the EcoR I and Hind III restriction sites of the pMMB66EH expression vector, indicating that the vector was correct.

(100) 2. Construction of cld.sub.LT2 and pglL Tandem Expression Vectors

(101) According to the amino acid sequence of the Neisseria meningitidis O-oligosaccharide transferase PglL (JN200826.1) published by GeneBank, its DNA sequence was synthesized by whole gene synthesis technique. The amino acid sequence of Neisseria meningitidis O-oligosaccharide transferase PglL was shown in SEQ ID NO: 8, and the gene encoding Neisseria meningitidis O-oligosaccharide transferase PglL was shown in SEQ ID NO: 7.

(102) The artificially synthetized gene encoding PglL was digested with EcoR I and Hind III, ligated into pKK223-3 vector (commercially available from Uppasla Pharmacia LKB Biotechniligy AB, Sweden), and primers 223tac-box5 and 223tac-box3 were used for amplification to obtain the expression cassette of PglL, and ligated to the Bgl II site of pETtac28-cld.sub.T2 obtained in Example 1, so as to construct the pETtac28-pglL-cld.sub.LT2 recombinant expression vector. The primer sequences are as follows:

(103) TABLE-US-00004 (SEQIDNO:33) 223tac-box5:ATCGAGATCTACTGCATAATTCGTGTCGCTCAAG; (SEQIDNO:34) 223tac-box3:ATCGAGATCTGTCTCATGAGCGGATACATATTTG.

(104) 3. Construction of pglL Expression Vector

(105) The expression cassette of pglL prepared in the above step 2 was ligated to the Bgl II site of pET28a (commercially available from Novagen) to construct a pETtac28-pglL recombinant expression vector.

(106) 4. Construction of S. paratyphi CMCC50973cldwaaL/pMMB66EH-rEPA4573/pETtac28-pglL-cld.sub.LT2

(107) The pMMB66EH-rEPA4573 and pETtac28-pglL-cld.sub.LT2 plasmids were electroporated orderly into the S. paratyphi CMCC50973cldwaaL electroporation competent cells as prepared by the above methods, so as to construct the glycosylation engineering Salmonella paratyphi A S. paratyphi CMCC50973cldwaaL/pMMB66EH-rEPA4573/pETtac28-pglL-cld.sub.LT2.

(108) 5. Construction of S. paratyphi CMCC50973waaL/pMMB66EH-rEPA4573/pETtac28-pglL

(109) The pMMB66EH-rEPA4573 and pETtac28-pglL plasmids were electroporated orderly into the S. paratyphi CMCC50973waaL electroporation competent cells as prepared by the above methods, so as to construct the glycosylation engineering Salmonella paratyphi A S. paratyphi CMCC50973waaL/pMMB66EH-rEPA4573/pETtac28-pglL.

(110) 6. Construction of S. paratyphi CMCC50973cldwaaL/pMMB66EH-rCTB4573/pETtac28-pglL-cld.sub.LT2

(111) The pMMB66EH-rCTB4573 and pETtac28-pglL-cld.sub.LT2 plasmids were electroporated orderly into the S. paratyphi CMCC50973cldwaaL electroporation competent cells as prepared by the above methods, so as to construct the glycosylation engineering Salmonella paratyphi A S. paratyphi CMCC50973cldwaaL/pMMB66EH-rCTB4573/pETtac28-pglL-cld.sub.LT2.

(112) 7. Construction of S. paratyphi CMCC50973waaL/pMMB66EH-rCTB4573/pETtac28-pglL

(113) The pMMB66EH-rCTB4573 and pETtac28-pglL plasmids were electroporated orderly into the S. paratyphi CMCC50973waaL electroporation competent cells as prepared by the above methods, so as to construct the glycosylation engineering Salmonella paratyphi A S. paratyphi CMCC50973waaL/pMMB66EH-rCTB4573/pETtac28-pglL.

(114) 8. Construction of S. paratyphi CMCC50973waaL/pMMB66EH-rCTB4573

(115) The pMMB66EH-rCTB4573 plasmid was electroporated orderly into the S. paratyphi CMCC50973waaL electroporation competent cells as prepared by the above methods, so as to construct the glycosylation engineering Salmonella paratyphi A S. paratyphi CMCC50973waaL/pMMB66EH-rCTB4573.

(116) 9. Construction of S. paratyphi CMCC50973waaL/pMMB66EH-rEPA4573

(117) The pMMB66EH-rEPA4573 plasmid was electroporated orderly into the S. paratyphi CMCC50973waaL electroporation competent cells as prepared by the above methods, so as to construct the glycosylation engineering Salmonella paratyphi A S. paratyphi CMCC50973waaL/pMMB66EH-rEPA4573.

(118) IV. Detection of Glycosylation Situation of rEPA4573 and rCTB4573

(119) A single clone of glycosylation engineering bacteria was picked and inoculated into a LB medium containing ampicillin at a final concentration of 100 g/mL and kanamycin at a final concentration of 50 g/mL, cultured at 37 C. until OD.sub.600 was about 0.6, and then IPTG was added at a final concentration of 1 mM, cooled to perform induction at 16 C. for 20 h.

(120) On the next day, 1 mL of the bacterial liquor induced at 16 C. for 20 h was taken, centrifuged to take the bacteria, the bacteria were slowly suspended with 1 reduction buffer, treated with boiling water bath for 10 min, then subjected to SDS-PAGE electrophoresis. After electrophoresis was completed, the protein was transferred to a PVDF membrane by a Bio-Lab semi-dry transfer, the transfer was performed at constant voltage of 20V for 1 h, and anti-His mouse monoclonal antibody (commercially available from Sigma, Cat. A7058) was used for detection, in which specific procedures could be seen in the Molecular Cloning Guide.

(121) It can be seen from FIG. 3 that the molecular weights of the glycosylation-modified rEPA4573-OPS.sub.Spty50973 and rCTB4573-OPS.sub.Spty50973 were significantly increased after the cld gene of S. paratyphi CMCC50973 itself was replaced with cld.sub.LT2, indicating that after the substitution of cld.sub.LT2, the polysaccharide protein ratio of glycoprotein was significantly improved.

(122) V. Increasing the Proportion of Polysaccharides in Salmonella paratyphi A O-Polysaccharide-Recombinant CTB Fusion Protein Via Tandem O-Glycosylation Sites

(123) 1. Construction of Recombinant CTB Fusion Protein (rCTB4573.sub.3) Expression Vector Containing Three P1a Sequences

(124) In order to increase polysaccharide-protein ratio of glycoprotein, the present invention performed tandem fusion at C-terminus of CTB with 3 polypeptide sequences (P1a sequence) of the positions 45-73 of Neisseria meningitidis pilin PilE (NC_003112.2), i.e., rCTB4573.sub.3 The amino acid sequence of the recombinant CTB fusion protein was shown in SEQ ID NO: 10, wherein the positions 1-19 were the amino acid sequence of the DsbA signal peptide; the positions 20-122 were the amino acid sequence of the cholera toxin B subunit; the positions 123-127 were the flexible linker; the positions 128-222 were the amino acid sequence of the 3 polypeptide sequences of the positions 45-73 of Neisseria meningitidis pilin PilE (NC_003112.2); the positions 223-232 were 6His tag sequence; the coding sequence of the recombinant CTB fusion protein was shown in SEQ ID NO: 9. Wherein, the gene encoding the polypeptide as set forth in positions 45 to 73 of Neisseria meningitidis pilin PilE (NC_003112.2) was shown in SEQ ID NO: 14, and the protein sequence encoded by this gene was shown in SEQ ID NO: 13.

(125) The artificially synthesized coding sequence of the recombinant CTB fusion protein was digested with EcoR I and Hind III, and ligated into pMMB66EH expression vector (ATCC, ATCC37620) to construct pMMB66EH-rCTB4573.sub.3 vector.

(126) The sequencing results showed that the sequence shown in SEQ ID NO: 9 was inserted between the EcoR I and Hind III restriction sites of the pMMB66EH expression vector, indicating that the vector was correct.

(127) 2. Construction of S. paratyphi CMCC50973cldwaaL/pMMB66EH-rCTB4573.sub.3/pETtac28-pglL-cld.sub.LT2

(128) The pMMB66EH-rCTB4573.sub.3 and pETtac28-pglL-cld.sub.LT2 plasmids were electroporated into the S. paratyphi CMCC50973cldwaaL electroporation competent cells as prepared by the above methods, so as to construct the glycosylation engineering S. paratyphi CMCC50973cldwaaL/pMMB66EH-rCTB4573.sub.3/pETtac28-pglL-cld.sub.LT2.

(129) 3. Preparation of rCTB4573.sub.3-OPS.sub.Spty50973

(130) The method was the same as above mentioned.

(131) It can be seen from FIG. 4 that after the addition of three glycosylation sites, the recombinant CTB fusion protein underwent O-glycosylation modification, and at the same time, due to the addition of multiple glycosylation sites, the existence of multiple clusters of glycosylation strips indicated the multiple sites were all effective glycosylation sites.

(132) VI. Acquisition of rEPA4573-OPS.sub.Spty50973 and rCTB4573.sub.3-OPS.sub.Spty50973

(133) 1. Purification of rEPA4573-OPS.sub.Spty50973

(134) Monoclones of the glycosylation engineering strain S. paratyphi CMCC50973cldwaaL/pMMB66EH-rEPA4573/pETtac28-pglL-cld.sub.LT2 were picked out, inoculated to a LB culture plate containing ampicillin and kanamycin double resistances, cultured at 37 C. until OD.sub.600 reached about 0.6, then IPTG at a final concentration of 1 mM was added, and cooled to perform induction at 25 C. for 20 h.

(135) 1) Pre-Treatment of Samples

(136) 10 g of the above bacteria after induction at 25 C. for 20 h was taken, added with 100 mL of purified water, subjected to ultrasonication (ultrasonication for 3 s and suspension for 5 s, cumulative ultrasonication time 30 min), centrifuged at 12000 g of centrifugal force, and the supernatant was collected. To this crude extract, pH 7.5 Tris-HCL at a final concentration of 20 mM, NaCL at a final concentration of 0.2M and imidazole at a final concentration of 10 mM were added, fully stirred, then centrifuged again at 12000 g of centrifugal force, and the supernatant was collected and used as a crude extract containing the recombinant EPA fusion protein (rEPA4573-OPS.sub.Spty50973) that was modified by Salmonella paratyphi A OPS.

(137) 2) Purifying Samples with Chelating Affinity Chromatographic Column

(138) Chelating affinity chromatographic column (1.6 cm*15 cm) was used for primary purification of samples. The column bed was first rinsed with 3 column bed volumes of 0.5M NaOH, then equilibrated with deionized water to neutral pH, then equilibrated with 3 column bed volumes of 0.5M NiSO.sub.4, and then equilibrated with 1 column bed volume of B1 solution (20 mM pH 7.5 Tris-HCl, 0.5M NaCl, 500 mM imidazole), and finally equilibrated with 3 column bed volumes of A1 solution (20 mM pH 7.5 Tris-HCl, 0.5M NaCl, 10 mM imidazole), wherein the above-used flow rate was always 4 mL/min. The above crude extract containing rEPA4573-OPS.sub.Spty50096 was loaded from A tube, and the unbound protein was washed off with solution A, and the elution was finally performed by using 100% B1 to collect 30 mL of eluate.

(139) 3) Desalting Samples

(140) The sample that was preliminarily purified by the Chelating affinity chromatographic column was desalted by using G25 fine chromatographic column (1.6 cm*30 cm), in which the mobile phase was A3 solution (20 mM pH 7.5 Tris-HCl). The column bed was firstly rinsed with 3 column bed volumes of 0.5M NaOH, then equilibrated with deionized water to pH neutral, and finally equilibrated with 3 column volumes of A3 solution. The sample was loaded from A tube, 60 mL of sample was collected, and the above-used flow rate was always 4 mL/min.

(141) 4) Further Purification of rEPA4573-OPS.sub.Spty50973 by Using ProteinPak DEAE8HR Anion Exchange Chromatographic Column

(142) The desalted sample was further purified by ProteinPak DEAE8HR anion exchange chromatographic column (waters). The column bed was first rinsed with 3 column bed volumes of 0.5M NaOH, then equilibrated with deionized water to pH neutral, and then equilibrated with 3 column bed volumes of A3 solution (20 mM pH 7.5 Tris-HCl). The sample was loaded from A tube, the unbound glycoprotein was washed off with A3 solution, then linear elution was performed using 0-50% B3 solution (20 mM pH 7.5 Tris-HCl, 1M NaCl) for 30 min, and the eluate was collected, in which the above used flow rate was always 1 mL/min. The peak position of glycoprotein rEPA4573-OPS.sub.Spty50973 was at position of about 8-18 mS/cm.

(143) 5) Fine Purification of rEPA4573-OPS.sub.Spty50973 by Using Superdex 75 Chromatographic Column

(144) The sample as purified by ProteinPak DEAE8HR anion exchange chromatographic column was further purified by using Superdex 75 FPLC (1:01 cm*30 cm, GE). The column bed was first washed with 3 column bed volumes of 0.5M NaOH, then equilibrated with deionized water to pH neutral, and then equilibrated with 3 column bed volumes of A4 solution (20 mM pH 7.5 PB, 0.9% NaCl). The sample in volume of 1 mL was loaded from a sample loop, and 8 to 11 mL of the effluent sample was collected, and this sample was the purified rEPA4573-OPS.sub.Spty50973.

(145) This sample was analyzed by 8% SDS-PAGE and western blot, and the results were shown in FIG. 5.

(146) 2. Purification of rCTB4573.sub.3-OPS.sub.Spty50973

(147) Monoclone of the glycosylation engineering strain S. paratyphi CMCC50973cldwaaL/pMMB66EH-rCTB4573.sub.3/pETtac28-pglL-cld.sub.LT2 was picked out, inoculated to a LB culture medium with ampicillin and kanamycin double resistance, cultured at 37 C. until OD.sub.600 was about 0.6, then IPTG at a final concentration of 1 mM was added, and cooled to perform induction at 16 C. for 20 h.

(148) 1) Pre-Treatment of Samples

(149) 10 g of the above bacteria after induction at 16 C. for 20 h was taken, added with 100 mL of purified water, subjected to ultrasonication (ultrasonication for 3 s and suspension for 5 s, cumulative ultrasonication time 30 min), centrifuged at 12000 g of centrifugal force, and the supernatant was collected. To this crude extract, pH 7.5 Tris-HCL at a final concentration of 20 mM, NaCL at a final concentration of 0.2M and imidazole at a final concentration of 10 mM were added, fully stirred, then centrifuged again at 12000 g of centrifugal force, and the supernatant was collected and used as a crude extract containing the recombinant CTB fusion protein (rCTB4573.sub.3-OPS.sub.Spty50973) that was modified by Salmonella paratyphi A O-polysaccharide.

(150) 2) Purifying Samples with Chelating Affinity Chromatographic Column

(151) Chelating affinity chromatographic column (1.6 cm*15 cm) was used for primary purification of samples. The column bed was first rinsed with 3 column bed volumes of 0.5M NaOH, then equilibrated with deionized water to neutral pH, then equilibrated with 3 column bed volumes of 0.5M NiSO.sub.4, and then equilibrated with 1 column bed volume of B1 solution (20 mM pH 7.5 Tris-HCl, 0.5M NaCl, 500 mM imidazole), and finally equilibrated with 3 column bed volumes of A1 solution (20 mM pH 7.5 Tris-HCl, 0.5M NaCl, 10 mM imidazole), wherein the above-used flow rate was always 4 mL/min.

(152) The above crude extract containing rCTB4573.sub.3-OPS.sub.Spty50973 was loaded from A tube, and the unbound protein was washed off with solution A, and the elution was finally performed by using 100% B1 to collect 30 mL of eluate.

(153) 3) Desalting Samples

(154) The sample that was preliminarily purified by the Chelating affinity chromatographic column was desalted by using G25 fine chromatographic column (1.6 cm*30 cm), in which the mobile phase was A2 solution (20 mM pH 5.4HAcNaAc). The column bed was firstly rinsed with 3 column bed volumes of 0.5M NaOH, then equilibrated with deionized water to pH neutral, and finally equilibrated with 3 column volumes of A2 solution. The sample was loaded from A tube, 60 mL of sample was collected, and the above-used flow rate was always 4 mL/min.

(155) 4) Further Purification of rCTB4573.sub.3-OPS.sub.Spty50973 by Using ProteinPak SP8HR Cation Exchange Chromatographic Column

(156) The desalted sample was further purified by ProteinPak SP8HR cation exchange chromatographic column (waters). The column bed was first rinsed with 3 column bed volumes of 0.5M NaOH, then equilibrated with deionized water to pH neutral, and then equilibrated with 3 column bed volumes of A2 solution (20 mM pH5.4 HAcNaAc). The sample was loaded from A tube, the unbound glycoprotein was washed off with A2 solution, then linear elution was performed using 0-50% B2 solution (20 mM pH5.4 HAcNaAc, 1M NaCl) for 30 min, and the eluate was collected, in which the above used flow rate was always 1 mL/min. The peak position of glycoprotein rCTB4573.sub.3-OPS.sub.Sp50973 was at position of about 35-45 mS/cm. The sample was analyzed by 12% SDS-PAGE and western blot, and the results were shown in FIG. 6.

(157) VII. Preparation and Animal Experimental Evaluation of Polysaccharide-Protein Conjugate Vaccines of rCTB4573.sub.3-OPS.sub.Spty50973 and rEPA4573-OPS.sub.Spty50973

(158) 1. Preparation of Polysaccharide-Protein Conjugate Vaccines of rCTB4573.sub.3-OPS.sub.Spty50973 and rEPA4573-OPS.sub.Spty50973

(159) The purified rCTB4573.sub.3-OPS.sub.Spty50973 and rEPA4573-OPS.sub.Spty50973 were sterilized by filtration, and mixed with aluminum hydroxide adjuvant (Rehydragel LV, General Chemical) at a ratio of 9:1.

(160) 2. Preparation of O-Antigen (OPS.sub.Spty50973)

(161) LPS was firstly extracted by hot phenol-water method (SUN Yang, FENG Shuzhang, ZHU Lingwei, et al, Preparation and identification of Enterohemorrhagic Escherichia coli O157 LPS monoclonal antibody, [J]. Journal of Zoonoses of China, 2007, 23 (10): 971-973), preserved by lyophilization, then dissolved with 1% glacial acetic acid at a concentration of 10 mg/ml, treated with boiling water bath for 90 minutes, then cooled to room temperature, and adjusted to pH 7.0. The supernatant was collected after centrifugation at 64,000g for 5 hours, and thoroughly dialyzed with deionized water and preserved by lyophilization.

(162) 3. Animal Immunization and Effect Evaluation of Conjugate Vaccines of rCTB4573.sub.3-OPS.sub.Spty50973 and rEPA4573-OPS.sub.Spty50973

(163) 40 female Balb/c mice of 6 weeks old were randomly divided into 4 groups. Aluminum hydroxide, OPS.sub.Spty50973, rCTB4573.sub.3-OPS.sub.Spty50973 and rEPA4573-OPS.sub.Spty50973 samples were separately injected into muscles of the 4 group of mice, in which the aluminum hydroxide group was negative control, the other three groups were injected with 10 g polysaccharide in an amount expressed in polysaccharide content; and blood samples were taken separately on the 1.sup.st, 22.sup.nd and 50.sup.th day after immunization, and on the 10.sup.th day after the third immunization.

(164) The antibody titer of anti-Salmonella paratyphi A O-polysaccharide in mice serum of each group was measured by indirect ELISA method. The enzyme-linked plate was coated with the extracted Salmonella paratyphi A LPS, in which each well was coated with 10 g of LPS, and other procedures could be seen in A Guide to Experimental Biomedical Biology.

(165) It can be seen from FIG. 7, both of the rCTB4573.sub.3-OPS.sub.Spty50973 and rEPA4573-OPS.sub.Spty50973 as prepared in the present invention via extending OPS of Salmonella paratyphi A CMCC50973 can induce mice to produce specific antibodies against Salmonella paratyphi A CMCC50973 OPS, in which the antibody titer increased significantly in comparison with the OPS group with injection of OPS only.

INDUSTRIAL APPLICATIONS

(166) In comparison with Paratyphoid A polysaccharide-protein conjugate vaccines in the prior art, the present invention prepares Paratyphoid A polysaccharide-protein conjugate vaccines by using an O-antigen with extended carbohydrate chain by one-step bio-crosslinking method. The method comprises: using Salmonella paratyphi A as a host strain wherein the O-antigen chain length was extended and O-antigen ligase gene waaL was deleted, co-expressing a recombinant fusion protein gene and a Neisseria meningitidis O-oligosaccharide transferase gene pglL in the host strain, using the O-antigen of the host strain Salmonella paratyphi A to directly modify the recombinant fusion protein in manner of O-glycosylation modification, so as to obtain O-antigen-modified recombinant fusion protein of Salmonella paratyphi A and to prepare Paratyphoid A polysaccharide-protein conjugate vaccines rCTB4573.sub.3-OPS.sub.Spty50973 and rEPA4573-OPS.sub.Spty50973. The results showed that the vaccines prepared by the present invention can induce in mice the generation of specific antibody against Salmonella paratyphi A CMCC50973 OPS, and the antibody titer is obviously improved in comparison with the mice with injection of OPS alone.

(167) Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Exemplary methods and materials are described below. Although methods and materials similar or equivalent to those described in the text can also be used to carry out the present invention, they are obvious for those skilled in the art. All publications and other references mentioned herein are incorporated by reference in their entirety. In the event of inconsistencies, the present specification including definitions should prevail. All materials, methods and examples above mentioned are illustrative only and not restrictive.