Citrus tristeza virus based vectors for foreign gene/s expression
10781454 ยท 2020-09-22
Assignee
Inventors
- William O. Dawson (Winter Haven, FL)
- Svetlana Folimonova (Gainesville, FL, US)
- Choaa Amine El Mohtar (Lake Alfred, FL, US)
- Siddarame Gowda (Lakeland, FL, US)
- Subhas Hajeri (Visalia, CA, US)
Cpc classification
International classification
Abstract
Disclosed herein are viral vectors based on modifications of the Citrus Tristeza virus useful for transfecting citrus trees for beneficial purposes. Included in the disclosure are viral vectors including one or more gene cassettes that encode heterologous polypeptides. The gene cassettes are positioned at desirable locations on the viral genome so as to enable expression while preserving functionality of the virus. Also disclosed are methods of transfecting plants and plants transfected with viral vector embodiments.
Claims
1. A Citrus Tristesa Virus (CTV) viral vector engineered to comprise a gene cassette comprising a heterologous nucleic acid, the CTV viral vector engineered such that the gene cassette is inserted 3 behind the p23 gene, wherein the CTV viral vector infects trees.
2. The CTV viral vector of claim 1, wherein said heterologous nucleic acid encodes an RNA interfering molecule.
3. The CTV viral vector of claim 2, wherein said RNA interfering molecule targets a nucleic acid of a plant pathogen, biological vector, or pest.
4. The CTV viral vector of claim 2, wherein said RNA interfering molecule targets a psyllid or endogenous plant mRNA.
5. The CTV viral vector of claim 1, wherein said heterologous nucleic acid encodes a protein.
6. The CTV viral vector of claim 1, wherein said gene cassette lacks a subgenomic controller element for control of said heterologous nucleic acid.
7. The CTV viral vector of claim 3, wherein the pest comprises an arthropod or nematode.
8. The CTV viral vector of claim 4 wherein the RNA interfering molecule targets D. citri Awd.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
DETAILED DESCRIPTION
(35) The early development of viral vectors was aimed at the inexpensive production of high levels of specialty proteins that could be scaled up in the field. The first attempt at a plant viral vector utilized Cauliflower mosaic virus, a dsDNA virus (Brisson et al., 1984; Gronenborn et al., 1981). However, this vector was too unstable to be useful (Ftterer et al., 1990). The development of reverse genetics systems amenable for manipulation of RNA viruses made many more viruses candidates for vector development (Ahlquist et al., 1984). There was considerable controversy concerning the value of RNA viruses for vectors (Siegel, 1983, 1985; Van Vluten-Dotting, 1983 Van Vluten-Dotting et al., 1985). It was argued that the lack of proof-reading of the RNA virus replicases would result in too rapid sequence drift to maintain foreign sequences during replication. However, subsequent development and use of RNA virus-based vectors demonstrated that this concern was overstated.
(36) Ongoing efforts have been underway to create virus-based vectors for citrus trees based on Citrus tristeza virus (CTV). CTV has the largest reported RNA of a plant virus of approximately 20 kb (Karasev et al., 1995; Pappu et al., 1994). It has two conserved gene blocks associated with replication and virion formation (Karasev, 2000). The replication gene block occupies the 5 half of the genome. Its proteins are expressed from the genomic RNA via a poly protein strategy with a +1 ribosomal frame shift to occasionally express the RNA dependent RNA polymerase (Karasev et al., 1995). The filamentous virions of CTV are encapsidated by two coat proteins, with the major coat protein (CP) encapsidating about 97% of the virion and the 5 700 nts encapsidated by the minor coat protein (CPm) (Satyanarayana et al., 2004). Virion formation is a complex process requiring two proteins (Hsp70h and p61) in addition to the coat proteins (Satyanarayana et al., 2000, 2004; Tatineni et al., 2010). These four genes as well as the 6 remaining genes are differentially expressed via a nested set of 3 co-terminal sub genomic (sg) RNAs (Hilf et al., 1995). Upstream of each ORF there is a controller element (CE) that determines the transcription level (Gowda et al., 2001). Levels of transcription are also associated with the +1 transcription start site (Aylln et al., 2003), the presence of a non-translated region upstream of the ORF (Gowda et al., 2001), and the closeness of the ORF to the 3 terminus (Satyanarayana et al., 1999).
(37) The first generations of CTV vector examined three different strategies that were fusion of the CP gene, insertion of an extra gene, and replacement of the p13 ORF (Folimonov et al., 2007). Replacement of the p13 ORF and fusion to the coat protein ORF did not result in effective vectors, but the addition of an extra gene resulted in viable vectors that produce relative large amounts of foreign gene and were stable in citrus trees for years. However, the first efforts in designing vectors based on CTV examined only a few of the many possibilities for expressing foreign genes in this large virus. In this work, the inventors attempted to examine the limitations of CTV to be manipulated into a vector. The inventors examined whether the virus allowed insertions in different positions within the genome and which resulted in maximal expression with different sizes of inserts. The inventors also examined whether different fusion strategies with different viral genes are viable and whether multiple foreign genes can be expressed. The CTV constructs disclosed herein are amazingly tolerant to manipulation at several positions within the genome giving a multitude of different vector strategies that are viable.
(38) Once citrus is infected with a CTV vector containing a foreign gene, it is easy to move the vector to other citrus trees by grafting. However, a limitation of the CTV vector system is the difficulty of initially getting citrus infected with new vector constructs. Directly inoculating citrus from the cDNA clones, either by agro-inoculation, particle bombardment, or mechanical inoculation with RNA transcripts is extremely difficult and unpredictable (Gowda et al., 2005; Satyanarayana et al., 2001). An alternative has been to inoculate with virions purified from Nicotiana benthamiana protoplasts (Folimonov et al., 2007; Robertson et al., 2005; Satyanarayana et al., 2001; Tatineni et al., 2008). However, infection of only approximately 0.01-0.1% of protoplasts with in vitro transcribed RNA has been achieved (Satyanarayana et al., 2001). Yet, since virions are much more infectious to the protoplasts than RNA (Navas-Castillo et al., 1997), the inventors were able to amplify the infection by sequential passage in protoplasts (Folimonov et al., 2007; Robertson et al., 2005; Satyanarayana et al., 2001; Tatineni et al., 2008). Although workable, this is an extremely difficult system. The inventors are now able to agro-inoculate N. benthamiana plants that result in systemic infection. This result allows analysis of the vector constructs more quickly in these plants and provides copious amounts of recombinant virus for inoculation of citrus. Thus, the inventors report the activity of the different vector constructs in N. benthamiana and Citrus.
(39) According to one embodiment, the invention pertains to a CTV viral vector engineered to comprise a gene cassette comprising a heterologous nucleic acid. The gene cassette is located at a targeted position on the CTV genome. In a more specific embodiment, the CTV viral vector is engineered such that the gene cassette is positioned at CTV genome regions p13-p20, p20-p23 or p23-3NTR. In other embodiments, the CTV viral vector is engineered to include multiple genes at one or multiple positions. It is shown herein that CTV viral vectors can successfully be engineered to include up to 3 or at least 4 genes that are expressible by the vector, while maintaining the proper function and infectivity of the vector.
(40) In related embodiments, the invention pertains to a plant that includes at least one cell transfected with the CTV viral vector engineered to comprise a gene cassette comprising a heterologous nucleic acid, the CTV viral vector engineered such that one or more gene cassettes are positioned at CTV genome regions p13-p20, p20-p23 or p23-3NTR. Other related embodiments pertain to methods of expressing at least one heterologous nucleic acid or polypeptide in a plant by infecting the plant with the specified vector.
(41) In a further embodiment, the invention is directed to a CTV viral vector engineered to comprise at least one gene cassette that includes a heterologous nucleic acid, wherein the CTV viral vector engineered such that the gene cassette is inserted in place of the CTV p13 gene. In related embodiments, the invention pertains to a plant that includes at least one cell transfected with the CTV viral vector or to methods of expressing the heterologous nucleic acid or polypeptide in a plant by infecting the plant with the specified vector.
(42) In another embodiment, the invention relates to a CTV viral vector engineered to comprise at least one gene cassette comprising a polynucleotide encoding heterologous polypeptide and IRES sequence conjugated thereto. In related embodiments, the invention pertains to a plant that includes at least one cell transfected with the CTV viral vector or to methods of expressing the heterologous polypeptide in a plant by infecting the plant with the specified vector.
(43) In further embodiments, the invention relates to a CTV viral vector engineered to comprise a gene cassette comprising a polynucleotide sequence with continuous amino acid codons extending from the p23 ORF encoding a first heterologous polypeptide (protease) with cleavage sites on each side plus a second heterologous polypeptide. In related embodiments, the invention pertains to a plant that includes at least one cell transfected with the CTV viral vector or to methods of expressing the heterologous polypeptide in a plant by infecting the plant with the specified vector.
(44) In further embodiments, the polynucleotide further comprises a sequence encoding a first control element upstream of said first heterologous polypeptide, a second sequence encoding a protease with cleavage sites engineered on each side, and a sequence encoding a second heterologous polypeptide.
(45) According to another embodiment, the invention is directed to CTV viral vector engineered to comprise a first gene cassette comprising a polynucleotide sequence encoding a first heterologous nucleic acid and a first controller element upstream of said first heterologous nucleic acid encoding sequence; and a second gene cassette comprising a polynucleotide sequence encoding a second heterologous nucleic acid and a second control element upstream of said second heterologous nucleic acid encoding sequence. Optionally, the CTV viral vector further comprises a third gene cassette comprising a polynucleotide sequence encoding a third heterologous nucleic acid and a third controller element upstream of said third heterologous nucleic acid encoding sequence; and a fourth gene cassette comprising a polynucleotide sequence encoding a fourth heterologous nucleic acid and a fourth controller element upstream of said fourth heterologous nucleic acid encoding sequence. Those skilled in the art will appreciate that additional gene cassettes can be added to the vector so long as function and infectivity of the vector is maintained. In related embodiments, the invention pertains to a plant that includes at least one cell transfected with the CTV viral vector or to methods of expressing the heterologous nucleic acid in a plant by infecting the plant with the specified vector.
(46) Examples of controller elements (CE) useful in accordance with the teachings herein include but are not limited to controller elements homologous to CTV or heterologous control elements. Heterologous controller elements include, but are not limited to, coat protein controller elements (CP-CEs) of three closteroviruses: Beet yellows virus (BYV) (94 nts from 13547-13640 Genbank accession # AF190581) (Peremyslov et al., 1999), Beet yellow stunt virus (BYSV) (101 nts from 8516-8616 Genbank accession # U51931)(Karasev et al., 1996) and Grape vine leaf roll associated virus-2 (GLRaV-2) (198 nts from 9454-9651 Genbank accession # DQ286725). It will be evident to those skilled in the art, in view of the teachings herein, that other controller elements may be implemented, and in particular control elements having strong promoter like activity.
(47) Silencing of Target Genes
(48) Heterologous nucleic acid used to transfect plants may include nucleic acids that interact with a target nucleic acid. Namely, the heterologous polynucleotide encodes a molecule able to modulate expression, RNA processing, translation or activity of a target nucleic acid. The encoded molecule may be a RNA interfering molecule, antibody, antisense molecule, PMO, ribozyme or small molecule.
(49) RNA interference (RNAi) is a process by which double-stranded RNA (dsRNA) is used to silence gene expression. While not wanting to be bound by theory, RNAi begins with the cleavage of longer dsRNAs into small interfering RNAs (siRNAs) by an RNaselll-like enzyme, dicer. SiRNAs are dsRNAs that are usually about 19 to 28 nucleotides, or 20 to 25 nucleotides, or 21 to 22 nucleotides in length and often contain 2-nucleotide 3 overhangs, and 5 phosphate and 3 hydroxyl termini One strand of the siRNA is incorporated into a ribonucleoprotein complex known as the RNA-induced silencing complex (RISC). RISC uses this siRNA strand to identify mRNA molecules that are at least partially complementary to the incorporated siRNA strand, and then cleaves these target mRNAs or inhibits their translation. Therefore, the siRNA strand that is incorporated into RISC is known as the guide strand or the antisense strand. The other siRNA strand, known as the passenger strand or the sense strand, is eliminated from the siRNA and is at least partially homologous to the target mRNA. Those of skill in the art will recognize that, in principle, either strand of an siRNA can be incorporated into RISC and function as a guide strand. However, siRNA design (e.g., decreased siRNA duplex stability at the 5 end of the desired guide strand) can favor incorporation of the desired guide strand into RISC.
(50) The antisense strand of an siRNA is the active guiding agent of the siRNA in that the antisense strand is incorporated into RISC, thus allowing RISC to identify target mRNAs with at least partial complementarity to the antisense siRNA strand for cleavage or translational repression. RISC-related cleavage of mRNAs having a sequence at least partially complementary to the guide strand leads to a decrease in the steady state level of that mRNA and of the corresponding protein encoded by this mRNA. Alternatively, RISC can also decrease expression of the corresponding protein via translational repression without cleavage of the target mRNA.
(51) The term siRNA as used herein refers to a double-stranded interfering RNA unless otherwise noted. Typically, an siRNA of the invention is a double-stranded nucleic acid molecule comprising two nucleotide strands, each strand having about 19 to about 28 nucleotides (i.e. about 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides). The phrase interfering RNA having a length of 19 to 49 nucleotides when referring to a double-stranded interfering RNA means that the antisense and sense strands independently have a length of about 19 to about 49 nucleotides, including interfering RNA molecules where the sense and antisense strands are connected by a linker molecule.
(52) In addition to siRNA molecules, other interfering RNA molecules and RNA-like molecules can interact with RISC and silence gene expression. Examples of other interfering RNA molecules that can interact with RISC include short hairpin RNAs (shRNAs), single-stranded siRNAs, microRNAs (miRNAs), and dicer-substrate 27-mer duplexes. Examples of RNA-like molecules that can interact with RISC include siRNA, single-stranded siRNA, microRNA, and shRNA molecules containing one or more chemically modified nucleotides, one or more non-nucleotides, one or more deoxyribonucleotides, and/or one or more non-phosphodiester linkages. All RNA or RNA-like molecules that can interact with RISC and participate in RISC-related changes in gene expression are referred to herein as interfering RNAs or interfering RNA molecules. SiRNAs, single-stranded siRNAs, shRNAs, miRNAs, and dicer-substrate 27-mer duplexes are, therefore, subsets of interfering RNAs or interfering RNA molecules.
(53) During replication of CTV, large amounts of double stranded RNA intermediates are produced of the genomic and subgenomic RNAs that are processed into small interfering RNA molecules. The subgenomic RNAs are 3-coterminal, so the more 3 sequences are produced multiple times in the longer subgenomic RNAs. Sequences designed to target specific sequences in the plant, pathogen, or pest do not need an extra subgenomic mRNA controller element. Multiple target sequences can be fused together as one larger heterologous sequence.
(54) Single-stranded interfering RNA has been found to effect mRNA silencing, albeit less efficiently than double-stranded RNA. Therefore, embodiments of the present invention also provide for administration of a single-stranded interfering RNA that has a region of at least near-perfect contiguous complementarity with a portion of the target nucleic acid. The single-stranded interfering RNA has a length of about 19 to about 49 nucleotides as for the double-stranded interfering RNA cited above. The single-stranded interfering RNA has a 5 phosphate or is phosphorylated in situ or in vivo at the 5 position. The term 5 phosphorylated is used to describe, for example, polynucleotides or oligonucleotides having a phosphate group attached via ester linkage to the C5 hydroxyl of the sugar (e.g., ribose, deoxyribose, or an analog of same) at the 5 end of the polynucleotide or oligonucleotide.
(55) Single-stranded interfering RNAs can be synthesized chemically or by in vitro transcription or expressed endogenously from vectors or expression cassettes as described herein in reference to double-stranded interfering RNAs. 5 Phosphate groups may be added via a kinase, or a 5 phosphate may be the result of nuclease cleavage of an RNA. A hairpin interfering RNA is a single molecule (e.g., a single oligonucleotide chain) that comprises both the sense and antisense strands of an interfering RNA in a stem-loop or hairpin structure (e.g., a shRNA). For example, shRNAs can be expressed from DNA vectors in which the DNA oligonucleotides encoding a sense interfering RNA strand are linked to the DNA oligonucleotides encoding the reverse complementary antisense interfering RNA strand by a short spacer. If needed for the chosen expression vector, 3 terminal T's and nucleotides forming restriction sites may be added. The resulting RNA transcript folds back onto itself to form a stem-loop structure.
(56) Nucleic acid sequences cited herein are written in a 5 to 3 direction unless indicated otherwise. The term nucleic acid, as used herein, refers to either DNA or RNA or a modified form thereof comprising the purine or pyrimidine bases present in DNA (adenine A, cytosine C, guanine G, thymine T) or in RNA (adenine A, cytosine C, guanine G, uracil U). Interfering RNAs provided herein may comprise T bases, particularly at 3 ends, even though T bases do not naturally occur in RNA. Nucleic acid includes the terms oligonucleotide and polynucleotide and can refer to a single-stranded molecule or a double-stranded molecule. A double-stranded molecule is formed by Watson-Crick base pairing between A and T bases, C and G bases, and between A and U bases. The strands of a double-stranded molecule may have partial, substantial or full complementarity to each other and will form a duplex hybrid, the strength of bonding of which is dependent upon the nature and degree of complementarity of the sequence of bases.
(57) In certain embodiments, interfering RNA target sequences (e.g., si RNA target sequences) within a target mRNA sequence are selected using available design tools. Interfering RNAs corresponding to a target sequence are then tested in vitro by transfection of cells expressing the target mRNA followed by assessment of knockdown as described herein. The interfering RNAs can be further evaluated in vivo using animal models as described herein.
(58) Techniques for selecting target sequences for si RNAs are provided, for example, by Tuschl, T. et al., The siRNA User Guide, revised May 6, 2004, available on the Rockefeller University web site; by Technical Bulletin #506, siRNA Design Guidelines, Ambion Inc. at Ambion's web site; and by other web-based design tools at, for example, the Invitrogen, Dharmacon, Integrated DNA Technologies, Genscript, or Proligo web sites. Initial search parameters can include G/C contents between 35% and 55% and siRNA lengths between 19 and 27 nucleotides. The target sequence may be located in the coding region or in the 5 or 3 untranslated regions of the mRNA. The target sequences can be used to derive interfering RNA molecules, such as those described herein.
(59) Many of the embodiments of the subject invention make reference to particular methods of inhibiting or disruption of genetic expression. Based on the teachings herein, methods of inhibiting expression include but are not limited to siRNA; ribozyme(s); antibody(ies); antisense/oligonucleotide(s); morpholino oligomers; microRNA; or shRNA that target expression of the target nucleic acid. The subject invention is not to be limited to any of the particular related methods described. One such method includes siRNA (small interfering/short interfering/silencing RNA). SiRNA most often is involved in the RNA interference pathway where it interferes with the expression of a specific nucleic acid. In addition to its role in the RNA interference pathway, siRNA also act in RNA interference-related pathways, e.g., as an antiviral mechanism or in shaping the chromatin structure of a genome.
(60) Another method by which to inhibit expression and to inhibit the expression of the target nucleic acid in particular is shRNA. ShRNA (short hairpin or small hairpin RNA) refers to a sequence of RNA that makes a tight hairpin turn and is used to silence gene expression via RNA interference. It uses a vector introduced into cells and a U6 or H1 promoter to ensure that the shRNA is always expressed. The shRNA hairpin structure is cleaved by cellular machinery into siRNA which is then bound to the RNA-induced silencing complex. This complex binds to and cleaves mRNAs which match the siRNA that is bound to it.
(61) Target nucleic acid can also be blocked by subjecting procured cells to an antibody specific to target nucleic acid or expression product thereof. An antisense nucleotide may also be used to block or inhibit expression, in particular, the expression of target nucleic acid. Expression may also be inhibited with the use of a morpholino oligomer or phosphorodiamidate morpholino oligomer (PMO). PMOs are an antisense technology used to block access of other molecules to specific sequences within nucleic acid. PMOs are often used as a research tool for reverse genetics, and function by knocking down gene function. This is achieved by preventing cells from making a targeted protein or by modifying splicing of pre-mRNA. One embodiment of the subject disclosure pertains to a method of treating neurons under oxidative stress by expressing an RNA interfering molecule, antisense molecule or PMO in a subject in need thereof.
(62) In one embodiment, the target nucleic acid may be endogenous in the plant transfected with the heterologous nucleic acid. Alternatively, the heterologous nucleic acid targets a nucleic acid that relates to a plant pathogen, a biological vector (e.g. insect that spreads pathogen), or an arthropod or nematode pest. For example, the heterologous nucleic acid encodes an RNA interfering molecule specific to a target nucleic acid relating to a protein or sequence vital to the plant pathogen or biological vector. This in effect neutralizes the pathogen or biological vector. Proteins or peptides can be to add value to the plant or to prevent attack by pest and pathogens. Examples of plant value-added products include addition of vitamins or increase of flavor or stability to fruit or juice. Proteins or peptides can be to attract microbes or remove necessary microbes or to interfere with processes in pathogens or pests. RNAi targets can be the removal of any gene product in plants or prevention of protein production in pathogens or pests.
(63) In addition to D. citri, almost any other insect could be a target to gene silencing. Other insect pests of citrus are aphids and whiteflies that vector viruses, mites (not an insect) that are a problem on their own, as well as vector viruses, leaf miners that damage leaves and increase susceptibility to canker, diaprepie roots weevils. Also, RNAi can be used to control nematodes.
(64) As far as other pathogens, other viruses and fungi could be controlled by RNAi. Value added traits can be induced by RNAi that allow for silencing of undesired gene expression and gene products. For example, genes whose expression modulates flavor, color, or pathogen resistance could be targeted.
(65) These and other embodiments are further described below and encompassed within the appended claims.
Materials and Methods for Examples 1-7 Below
Plasmids Construction
(66) pCTV9Rp33 and pCTVCla 333R (Gowda et al., 2001; Satyanarayana et al., 1999, 2000, 2003; Tatineni et al., 2008) were used as base plasmids for developing all expression vectors that were used in the protoplast reverse genetics system. The numbering of the nucleotides (nts) is based on the full length T36 clone (Genbank Accession # AY170468) (Satyanarayana et al., 1999, 2003). CTVp333R-23-ITEV-GFP and CTVp333R-23-I3ARC-GFP (
(67) The expression vectors created in pCTV9Rp33 were introduced into the CTV genome by digesting the plasmid with PstI (nts 17208-17213) and NotI or StuI (introduced behind 19,293 the final CTV nucleotide). Overlap extension PCR (Horton et al., 1989) was used to introduce the appropriate genes at the different locations. Replacement of the p13 gene was done by deletion of nts 17293-17581 in the p13 ORF and (CE) by overlap extension PCR (
(68) The binary plasmid pCAMBIACTV9R (Gowda et al., 2005) was modified to eliminate the p33 gene by deleting nts 10858-11660 (Satyanarayana et al., 2000; Tatineni et al., 2008) and introducing a SwaI site behind the ribozyme engineered based on subterranean clover mottle virusoid (Turpen et al., 1993). PCR products amplified from the expression vectors in the pCTV9Rp33 back-bone were introduced into the modified binary plasmid pCAMBIACTV9Rp33 digested with PstI (Forward primer C-749) and SwaI (Reverse primer C-1894). When introducing the bimolecular fluorescence complementation (BiFC) genes into constructs CTV33-23-BYbJunN-GbFosC-59 (
(69) TABLE-US-00001 TABLE1-1 Listofprimersusedinbuildingexpressionvector Primername Sequence5-3* Description* C-749 AGTCCTCGAGAACCA 3endofp18(CTVT36 CTTAGTTGTTTAGCT clonesnts#17121-17145) ATC withanaddedXhoIsite beforent#17121) (downstreamofthisprimer thereexistwithinCTV genomeaPstIsite(nts 17208-17213ofCTVT36) usedforcloning)(F.P.) C-1358 TTATGCGGCCGCAGG 3endof3NTR(nts CCTTGGACCTATGTT 19,270-19,293ofCTVT36 GGCCCCCCATAG clone)contain(StuIand NotIsites)(R.P.) C-1568 TAATCGTACTTGAGT 5endofGFP(nts1-21) TCTAATATGGCTAGC withextensioninto3 end AAAGGAGAAGAA ofBYVCPIR(nts# 13620-13640Genbank Accession#AF190581) (F.P.) C-1894 GCCGCACTAGTATTT 3endof3NTR(nts AAATCCCGTTTCGTC 19,262-19,293ofCTV CTTTAGGGACTCGTC T36clone)withextensions AGTGTACTGATATAA thatincludearibozymeof GTACAGACTGGACCT subterraneanclover ATGTTGGCCCCCCAT virusoid(underlined) AGGGACAGTG (Turpenetal.,1993)and SwaIandSpeIrestriction sites(R.P.) C-1973 ATGGATGAGCTCTAC 5endof3NTR(nts19021- AAATGATTGAAGTGG 19043ofCTVT36clone) ACGGAATAAGTTCC withextensionintoGFP 3end(nts700-720)(F.P.) C-1974 GGAACTTATTCCGTC 3endofGFP(nts700- CACTTCAATCATTTG 720)withextensioninto TAGAGCTCATCCAT 5endof3NTR(nts19021- 19043ofCTVT36clone) (R.P.) C-1975 GCACGTTGTGCTATA GLRaV-2intergenicregion GTACGTGCCATAATA ofCP(nts9568-9651 GTGAGTGCTAGCAAA GenbankAccession GTATAAACGCTG numberDQ286725)(F.P.) GTGTTTAGCGCATAT TAAATACTAACG C-1976 CAGCTTGCTTCT BYSVCPintergenicregion ACCTGACACAGTTAA of(nts8516-8616 GAAGCGGCATAAATC Genbankaccesion# GAAGCCAAACCCTAA U51931)(F.P). ATTTTGCAA CTCGATCAATTGTAA CCTAGAGCGAAGTGC AATCA C-1977 TTTAGCGCATATTAA 5 endofGFP(nts1-21) ATACTAACGATGGCT withextensionintothe AGCAAAGGAGAA 3endofGLRaV-2CP GAA intergenicregion(nts 9628-9651Genbank Accessionnumber DQ286725)(F.P.) C-1979 ACTGTGTCAGGTAGA 3endofp23(nts19,000- AGCAAGCTGTCAGAT 19,020ofCTVT36clone) GAAGTGGTGTTCACG withextensioninto5end ofBYSVCPIR(nts8516- 8539Genbankaccesion# U51931)(R.P.) C-1982 TTGG Sp6promoter(underlined
TGGAC andItalics)with3 endof CTATGTTGGCCCCCC 3NTR(nts19271-19293 ATA ofCTVT36clone)usedto developdiglabeledprobe (R.P.) C-1983 GTAACCTAGAGCGAA 5endofGFP(nts1-23) GTGCAATCAATGGCT withextensioninto3end AGCAAAGGAGAA ofBYSVIRofCP(nts GAA 8593-8616Genbank Accession#U51931) (F.P.) C-1984 GCCTAAGCTTACAAA 3Xactiveribosome TACTCCCCCACAACA complementarysequence GCTTACAATACTCCC (3XARC-1nts1-86) CCACACAGCTTACAA (Akbergenovetal.,2004) ATACTCCCCCACAAC (F.P.) AGCTTGTCGAC C-1985 CTCCGTGAACAC 5 endofTEV5NTR(nts CACTTCATCTGAAAA 1-21GenbankAccession# TAACAAATCTCAACA M11458)withextension CAA into3 endofp23(nts 18997-19020ofCTVT36 clone)(F.P.) C-1986 TTGTGTTGAGATTTG 3endofp23(nts18997- TTATTTTCAGATGAA 19020ofCTVT36clone) GTGGTGTTCACGGAG withextensioninto5 end ofTEV5NTR(nts1-21 GenbankAccession# M11458)(R.P.) C-1989 GGAGTATTTGTA 3endofp23(nts18997- AGCTTAGGCTCAGAT 19020ofCTVT36clone) GAAGTGGTGTTCACG withextensioninto5end GAG of3XARC-1(nts1-21) (R.P.) C-1990 CCCCACAACAGCTTG 5endofGFP(nts1-25) TCGACATGGCTAGCA withextensioninto3end AAGGAGAAGAACTTT of3XARC-1(nts66-86) (F.P.) C-2007 CGTGAACACCACTTC BYV3endofCPmandthe ATCTGATTCGACCTC intergenicregionofCP GGTCGTCTTAGTTAA (nts13547-13570 GenbankAccession# AF190581)withextension intop233end(nts19,000- 19,020ofCTVT36clone) (F.P.) C-2008 TTAACTAAGACGACC 3endofp23(nts19,000- GAGGTCGAATCAGAT 19,020ofCTVT36clone) GAAGTGGTGTTCACG withextensionintothe 3endofCPmandCP intergenicregionofBYV (nts13,547-13,570 GenbankAccession# AF190581)(R.P.) C-2009 GGCGATCACGAC GLRaV-23endofCPm AGAGCCGTGTCAATT and5 endofCP GTCGCGGCTAAGAAT intergenicregion(nts GCTGTGGATCGCAGC 9454-9590Genbank GCTTTCACTGGAGGG Accessionnumber GAGAGAAAAATAGTT DQ286725)(F.P.) AGTTTGTATGCCTTA GGAAGGAACTAAGCA CGTTGTGCTATAGTA CGTGC C-2010 TGACACGGCTCTGTC 3endofp23(nts19,000- GTGATCGCCTCAGAT 19,020ofCTVT36clone) GAAGTGGTGTTCACG withextensionintothe 3endofGLRaV-2CPm codingsequence(nts 9454-9477Genbank Accession#DQ286725) (R.P.) C-2011 GCCACCTACGTTATA 3endofGFP(nts697- GGTCTTCATTTTGTA 717)withextensioninto GAGCTCATCCATGCC theTEVHC-Proprotease recognitionsequence(nts 2412-2435(geneticcode redundancyusedto eliminateduplication GenbankAccession# M11458)(R.P.) C-2012 AAGACCTATAACGTA 5 endofTEVHC-Pro GGTGGCATGAAG proteasemotif(nts1959- GCTCAATATTCGGAT 1979GenbankAccession CTA #M11458)withextension intotheHC-Pro recognitionsequence(nts 2415-2438geneticcode redundancyusedto eliminateduplication GenbankAccession# M11458)(F.P.) C-2013 ATGAAAACTTACAAT 5endofGUS(nts4-21) GTTGGAGGGATGTTA withextensionintothe CGTCCTGTAGAAACC TEVHC-Prorecognition sequenceand3 endof TEVHC-Proprotease motif(nts2412-2438 GenbankAccession# M11458)(F.P.) C-2014 GGTTTCTACAGGACG TEVHC-Prorecognition TAACATCCCTCCAAC sequence(nts2412-2438 ATTGTAAGTTTTCAT GenbankAccession# M11458)withextension intothe5 endofGUS ORFsequence(nts4-21) (R.P.) C-2015 CCGCAGCAGGGA 5 endof3NTR(nts GGCAAACAATGATTG 19021-19041ofCTVT36 AAGTGGACGGAATAA clone)withextensioninto GTT the3 endofGUSORF (nts1789-1812)(F.P.) C-2016 AACTTATTCCGTCCA 3 endofGUS(nts1789- CTTCAATCATTGTTT 1812)withextensioninto GCCTCCCTGCTGCGG the5endof3NTR(nts 19021-19041ofCTVT36 clone)(R.P.) C-2017 CTTACTCTGAAAATA 3endofGFP(nts697- AAGATTCTCTTTGTA 717)withextensioninto GAGCTCATCCATGCC the5endofTEV-NIa proteaserecognition sequence(nts8499-8519 GenbankAccession# M11458)and5 endof TEVNIaproteasemotif (nts6270-6272Genbank Accession#M11458) (R.P.) C-2018 AAAGAGAATCTTTAT 5 endofTEVNIa TTTCAGAGTAAGGGA proteasemotif(nts6270- CCACGTGATTACAAC 6290GenbankAccession #M11458)withextension intoitsrecognition sequence(nts8499-8519 GenbankAccession# M11458)and3 endof GFP(nts715-717)(F.P.) C-2019 CGATTGGAAGTATAG 3endofTEVNIamotif(nts GTTTTCTTGCGAGTA 6961-6980Genbank CACCAATTCACTCAT Accession#M11458)with extensionintoNIa recognitionsequence(nts 8499-8519Genbank Accession#M11458 geneticcoderedundancy usedtoeliminate duplication)(R.P.) C-2020 CAAGAAAACCTATAC 5endofGUSwith TTCCAATCGATGTTA extensionintotheTEVNIa CGTCCTGTAGAAACC recognitionsequence(nts 8499-8519Genbank Accession#M11458 geneticcoderedundancy usedtoeliminate duplication)and3 endof TEVNIaproteasemotif (nts6978-6980Genbank Accession#M11458) (F.P.) C-2021 GTCACTTTGTTTAGC 5endofBYSVCPIR(nts GTGACTTAGCAGCTT 8516-8536Genbank GCTTCTACCTGACAC Accession#U51931)with extensioninto3endofp18 (nts17269-17292ofCTV T36clone)(F.P.) C-2022 GTGTCAGGTAGAAGC 3 endofp18(nts17269- AAGCTGCTAAGTCAC 17292ofCTVT36clone) GCTAAACAAAGTGAC withextensioninto5 end BYSVCPIR(nts8516- 8536GenbankAccession #U51931)(R.P.) C-2023 TTAGTCTCTCCATCT 5endofBYSVCPIR(nts TGCGTGTAGCAGCTT 8516-8536Genbank GCTTCTACCTGACAC Accession#U51931)with extensionintothe3endof p20(nts18286-18309of CTVT36clone)(F.P.) C-2024 GTGTCAGGTAGAAGC 3endofp20(nts18286- AAGCTGCTACACGCA 18309ofCTVT36clone) AGATGGAGAGACTAA withextensionintothe5 endofBYSVCPIR(nts 8516-8536Genbank Accession#U51931) (R.P.) C-2025 ATGGATGAGCTCTAC 3endofp13ORF(nts AAATGA--GTTTCA 17581-17604ofCTVT36 GAAATTGTCGAATCG clone)withextensioninto CAT the3endofGFPORF(nts 700-720)(F.P.) C-2026 ATGCGATTCGACAAT 3endofGFPORF(nts TTCTGAAACTCATTT 700-720)withextension GTAGAGCTCATCCAT intothe3endofp13ORF (nts17581-17604ofCTV T36clone)(R.P.) C-2027 ATGGATGAGCTCTAC 5endofp23IR(nts AAATGAGTTAATACG 18,310-18,330ofCTVT36 CTTCTCAGAACGTGT clone)withextensioninto 3 endofGFP(nts700- 720)(F.P.) C-2028 ACACGTTCTGAGAAG 3endofGFP(nts700- CGTATTAACTCATTT 720)withextensioninto GTAGAGCTCATCCAT p23IR(nts18310-18330 ofCTVT36clone)(R.P.) C-2029 TTTAGCGCATATTAA 5 endofHATAG(21nts) ATACTAACGATGTAC inpHA-CMVcarryingbFos CCATACGATGTTCCA (AA118-210)-YC(AA 155-238)(Huetal.,2002) withextensionintothe GLRaV-2CPIR3 end (nts9628-9651Genbank Accessionnumber DQ286725)(F.P.) C-2030 TGGAACATCGTATGG 3 endofCPmGLRaV-2 GTACATCGTTAGTAT (nts9628-9651Genbank TTAATATGCGCTAAA Accessionnumber DQ286725)withextension into5 endofHAtag (21nts)inpHA-CMV carryingbFos(AA118- 210)-YC(AA155-238) (Huetal.,2002)(R.P.) C-2031 ACTGTGTCAGGTAGA 3endEYFP-YC(AA232- AGCAAGCTGTTACTT 238)(Huetal.,2002)with GTACAGCTCGTCCAT extensionintotheBYSV CP5IR(nts8516-8539 GenbankAccession# U51931)(R.P.) C-2032 GTAACCTAGAGCGAA 5endofFLAGtag(21nts) GTGCAATCAATG frompFLAG-CMV2 GACTACAAAGACGAT carryingbJunN(Huetal., GAC 2002)withextensioninto the3endofBYSVCPIR (nts8593-8616Genbank Accession#U51931) (F.P.) C-2051 GTCACTTTGTTTAGC 3endofGLRaV-2CPm GTGACTTAGGGCGAT (nts9454-9474Genbank CACGACAGAGCC Accession#DQ286725) GTG withextensioninto3end ofp18(nts17269-17292of CTVT36clone)(F.P.) C-2052 CACGGCTCTGTCGTG 3endofp23(nts19,000- ATCGCCCTAAGTCAC 19,020)withextension GCTAAACAAAGTGAC intothe3endofGLRaV-2 CPmcodingsequence(nts 9454-9474Genbank Accession#DQ286725) (R.P.) C-2053 GTCACTTTGTTTAGC BYV3endofCPmandthe GTGACTTAGTTCGAC intergenicregionofCP CTCGGTCGTCTTAGT (nts13547-13567 GenbankAccession# AF190581)withextension into3endofp18(nts 17269-17292ofCTVT36 clone)(F.P.) C-2054 ACTAAGACGACC 3endofp18(nts17269- GAGGTCGAACTAAGT 17292ofT36CTVclone) CACGCTAAACAAAGT withextensionintoBYV GAC 3endofCPmandthe intergenicregionofCP (nts13547-13567 GenbankAccession# AF190581)(R.P.) C-2055 CACAACGTCTATATC 3endofp13ORF(nts ATGGCCTAGGTTTCA 17581-17601ofCTVT36 GAAATTGTCGAATCG clone)withextensioninto the3endofEYFP-YN(AA 147-154)frompFlag- CMV2carryingbJun-YN (Huetal.,2002) C-2056 CGATTCGACAATTTC 3endofEYFP-YN(AA TGAAACCTAGGCCAT 147-154)frompFlag- GATATAGACGTTGTG CMV2carryingbJun-YN (Huetal.,2002)with extensionintothe3endof p13(nts17581-17601of CTVT36clone) C-2057 GGCATGGACGAG 3endEYFP-YC(AA231- CTGTACAAGTAATTG 238)(Huetal.,2002)with AAGTGGACGGAATAA extensioninto5endof GTT 3NTR(nts19021-19041 ofCTVT36clone) C-2058 AACTTATTCCGTCCA 5endof3NTR(nts19021- CTTCAATTACTTGTA 19041ofCTVT36clone) CAGCTCGTCCATGCC withextensioninto3end EYFP-YC(AA231-238) (Huetal.,2002) C-2059 TCGCTCTTACCTTGC BYSVCPSIR(nts8516- GATAACTAGCAGCTT 8536GenbankAccession GCTTCTACCTGACAC #U51931)withextension intothe3endofp13(nts 17,662-17,685ofCTVT36 clone)(F.P.) C-2063 GTAACCTAGAGCGAA 5endofGUSORF(nts1- GTGCAATCAATGTTA 21)withextensionintothe CGTCCTGTAGAAACC 3 endofBYSVCPIR (withextensionintothe 3endofBYSVCPIR(nts 8593-8616Genbank Accession#U51931) (F.P.) C-2064 GGTTTCTACAGGACG 3endofBYSVCPIR(nts TAACATTGATTG 8591-8616Genbank CACTTCGCTCTA Accession#U51931)with GGTTACAA extensionintothe5 endof GUSORF(nts1-21)(R.P) C-2067 CCGCAGCAGGGA 3endofp13(nts17581- GGCAAACAATGAGTT 17601ofCTVT36clone) TCAGAAATTGTC withextensionintothe GAATCG 3endofGUS(nts1789- 1812)(F.P.) C-2068 CGATTCGACAATTTC 3endofGUS(nts1789- TGAAACTCATTGTTT 1812)withextensioninto GCCTCCCTGCTGCGG the3endofp13(nts 17581-17601ofCTVT36 clone) C-2069 GTGTCAGGTAGAAGC 3endofp13(nts17662- AAGCTGCTAGTTATC 17685ofCTVT36clone) GCAAGGTAAGAG withextensioninto5end CGA ofBYSVIRCPSIR(nts 8516-8536Genbank Accession#U51931) (R.P.) C-2070 ATGGATGAGCTCTAC 5IRofp20(nts17686- AAATGAAGTCTACTC 17709ofCTVT36clone) AGTAGTACGTCTATT withextensionintothe 3endofGFP(nts700- 720)(F.P.) C-2071 AATAGACGTACTACT 3endofGFP(nts700- GAGTAGACTTCATTT 720)withextensioninto GTAGAGCTCATCCAT theSIRofp20(nts17686- 17709ofCTVT36clone) (R.P.) C-2085 GCGGATGCATTATTT 3endofp18(nts17201- GGTTTTACAACAACG 17245ofCTVT36clone) GTACGTTTCAAAATG withtwopointmutations (C-A(17205)andG- T(17210))creatingNsiI sitetoreplacethePstIsite (F.P.) C-2087 AAGACCTATAACGTA 5 endofTEVHC-Pro GGTGGCATGAAG proteasemotif(nts1959- GCTCAATATTCGGAT 1979GenbankAccession CTA #M11458)withextension intotheHC-Pro recognitionsequence(nts 2415-2438geneticcode sequenceredundancywas usedtoeliminate duplicationGenbank Accession#M11458 (F.P.) C-2088 ATGAAAACTTACAAT 5endofGFPORF(nts4- GTTGGAGGGATGGCT 21)withextensionintothe AGCAAAGGAGAA TEVHC-Prorecognition GAA sequence(nts2412-2438 GenbankAccession #M11458)(F.P.) C-2089 TTCTTCTCCTTTGCT TEVHC-Prorecognition AGCCATCCCTCCAAC sequence(nts2412-2438 ATTGTAAGTTTTCAT GenbankAccession #M11458)withextension intothe5 endofGFP ORFsequence(nts4-21) (R.P.) C-2091 GAGAATCTTTATTTT 5 endofTEVNIa CAGAGTAAGGGA proteasemotif(nts6270- CCACGTGATTACAAC 6291GenbankAccession C #M11458)withextension intoitsrecognition sequence(nts8499-8519 GenbankAccession #M11458)(F.P.) C-2092 GAAAACCTATACTTC 5endofGFPORF(nts1- CAATCGATGGCTAGC 23)withextensionintothe AAAGGAGAAGAACT TEV-NIaprotease recognitionsequence(nts 8499-8519geneticcode seqenceredundancyused toeliminateduplication GenbankAccession #M11458)(F.P.) C-2093 AGTTCTTCTCCTTTG TEVNIaprotease CTAGCCATCGATTG recognitionsequence(nts GAAGTA 8499-8519geneticcode TAGGTTTTC sequenceredundancy usedtoeliminate duplicationGenbank Accession#M11458)with extensionintotheGFP ORFsequence(nts1-23) (R.P.) C-2094 AAGACCTATAACGTA 5 endofTEV-NIa GGTGGCATGAAG proteasemotifsequence GGACCACGTGATTAC nts6270-6291Genbank AAC Accession#M11458)with extensionintotheHC-Pro recognitionsequence(nts 2415-2438geneticcode sequenceredundancywas usedtoeliminate duplicationGenbank Accession#M11458) (F.P.) C-2095 CCCTCCAACATTGTA 3endofTEVNIaprotease AGTTTTCATTTGCGA motif(nts6959-6981 GTACACCAATTCACT Genbankaccession# DQ986288)withextension intotheTEVHC-Pro proteasemotif(nts2415- 2438Genbankaccession #M11458)(R.P.) C-2096 GAGAATCTTTATTTT 5endofTEVHC-Pro CAGAGTAAGGCT proteasemotif(nts1959- CAATATTCGGATCTA 1979GenbankAccession AAG #M11458)withextension intotheTEVNIaprotease recognitionsequence(nts 8499-8519Genbank accession#M11458) (F.P.) C-2097 CGATTGGAAGTATAG 3endofHC-Proprotease GTTTTCTTCGGATTC motif(nts2388-2411 CAAACCTGAATGAAC Genbankaccession# M11458)withextension intotheTEVNIaprotease recognitionsequence(nts 8499-8519Genbank accession# M11458)(R.P.) C-2098 GCCACCTACGTTATA 3endofp23(nts18997- GGTCTTCATGATGAA 19017ofCTVT36clone) GTGGTGTTCACGGAG withextensionintothe 5endofTEVHC-Pro proteaserecognition sequence(nts2412- 2435(geneticcode seqenceredundancyused toeliminateduplication) GenbankAccession# M11458)(R.P.) C-2099 ACTCTGAAAATAAAG 3endofp23(nts18994- ATTCTCGATGAAGTG 19017ofCTVT36clone) GTGTTCACGGAGAAC withextensionintothe 5endofTEVNIaprotease recognitionsequence(nts 8499-8519Genbank Accession#M11458) (R.P.) M-804 CATTTACGAACGATA 5endofGFP(nts1-20) GCCATGGCTAGCAAA with3endofTEV5NTR GGAGAAGAA (nts126-143Genbank Accession#M11458) (F.P.)
Polymerase Chain Reaction (PCR)
(70) PCR was performed using diluted plasmids (1:50) as templates using Vent DNA polymerase (New England Biolabs, Ipswich, Ma.) according to the manufacturer recommendations.
Agro-Injection/Infiltration
(71) Agro-inoculation of Nicotiana benthamiana was performed according to the procedure developed by Gowda et al., (2005) with minor modifications. Agrobacterium tumefaciens EHA 105 was transformed with the binary plasmid containing CTV, variants (expression vectors) and silencing suppressors (p19 of Tomato bushy stunt virus (Gowda et al., 2005); p24 of GLRaV-2 (Chiba et al., 2007), P1/HC-Pro of Turnip mosaic virus (Kasschau et al., 2003) and p22 of Tomato chlorosis virus (Caizares et al., 2008) by heat shock method (37 C. for 5 minuets) and subsequently were grown at 28 C. for 48 hours (hrs) on luria burtani (LB) (Sigma-Aldrich, St Louis, Mo.) plates supplemented with antibiotics (kanamycin (50 microgram (g)/milliliter (ml)) and Rifampicilin ((50 g/ml)). The colonies (two individual colonies per construct) were grown overnight as seed cultures in LB medium supplemented with antibiotics. On the next day 0.5 ml of the seed culture was used to inoculate 35 ml of LB medium supplemented with antibiotics for overnight growth. The bacterial culture was centrifuged at 6,000 rotation per minute (rpm) and resuspended in 10 milli molar (mM) MgCL.sub.2 and 10 mM MES. The pellet was washed with 10 mM MgCL.sub.2 and 10 mM MES and suspended in induction medium; 10 mM MgCL.sub.2 and 10 mM MES containing acetosyringone at a final concentration of 150 M. The suspension was incubated in the induction medium for at least 5 hrs before injection into the stem or infiltration into the abaxial (lower) surface of N. benthamiana leaves.
Plant Growth Conditions
(72) N. benthamiana plants maintained in a growth-room (21 C. with 16 hrs of light in a 24 hr period) were used for agro-injection/agro-infiltration four weeks after tansplanting.
Infection of Citrus Plants
(73) Recombinant virions of CTV for infection of citrus plants were obtained from infiltrated and/or systemic leaves of N. benthamiana. The virions were partially purified and enriched by concentration over a sucrose cushion in a TL 100 or SW41 rotor (Robertson et al., 2005). Virions of constructs expressing two foreign proteins were concentrated two times over a step gradient followed by a cushion gradient in SW28 and SW41 rotors, respectively (Garnsey and Henderson, 1982). Inoculation of citrus plants was carried out by bark flap inoculation into 1-1.5 year old Citrus macrophylla seedlings (Robertson et al., 2005) which were grown in a greenhouse with temperatures ranging between approximately 25-32 C.
Protoplast Preparation, Transfection, RNA Isolation and Northern Blot Analysis
(74) N. benthamiana leaf mesophyll protoplasts were prepared according to the procedure previously developed by Nava-Castillo et al., (1997). Surface sterilized leaves from three week old N. benthamiana plants were gently slashed on the lower side with a sterile blade and incubated overnight in the dark (16-20 hrs) in 0.7M MMC (0.7M mannitol, 5 mM MES, 10 mM CaCl.sub.2) supplemented with the 1% cellulose (Yakult Honsh, Tokyo, Japan) and 0.5% macerase pectinase enzymes (Calbiochem, La Jolla, Ca.).
(75) Capped in vitro RNA transcripts from NotI or StuI linearized plasmid DNA were generated (Satyanarayana et al., 1999) using Sp6 RNA polymerase (Epicentre Technologies, WI) and were transfected into the protoplasts using PEG (poly ethylene glycol) as described by Satyanarayana et al., (1999). Four days after transfection, protoplasts were used for preparation of total RNA for northern blot hybridization analysis and isolation of virions. Protoplasts were pelleted in equal amounts in two 1.5 ml eppendorf tubes. The first tube was flash frozen in liquid nitrogen and stored at 80 C. for isolation of virions to subsequently inoculate a new batch of protoplasts to amplify virions (Satyanarayana et al., 2000). The second tube was used for RNA isolation by the buffard buffer disruption of protoplasts followed by phenol: chloroform:isoamyl alcohol (25:24:1) extraction and ethanol precipitation as previously described by Navas-Castillo et al., (1997) and Robertson et al., (2005). Total RNA was resuspended in 20 l DNAse/RNAase free water and used in Northern blot hybridization analysis as previously described by Lewandowski and Dawson (1998). In brief, isolated RNA was heat denatured in denaturing buffer (8.6% formaldehyde, 67% formamide in 1MOPS (5 mM sodium acetate, 1 mM EDTA, 0.02M MOPS pH=7.0) separated in a 0.9% agarose gel in 1MOPS containing 1.9% formaldehyde, and transferred onto a nylon membrane (Boehringer Mannheim, Germany) by electroblotting. Pre-hybridization (at least 1 hr) and hybridization (overnight) were carried out in a hybridization oven (Sigma-Aldrich, St. Louis, Mo.) at 68 C. A 900 nts digoxigenin labeled RNA probe corresponding to the 3 end of the CTV genome (plus strand specific CTV RNA probe) (Satyanarayana et al., 1999) was used for hybridization except when the insertion of the foreign genetic material was behind p23 in which case a digoxigenin labeled RNA probe was produced from PCR amplified DNA (reverse primer contain 3NTR of CTV and SP6 phage promoter (C-1982) according to the manufacturer recommendation (Boehringer Mannheim, Germany) that is complimentary to the sequence inserted behind p23 in addition to the 3NTR sequence of CTV.
Western Blots
(76) After powdering the plant tissue in liquid nitrogen via grinding in a mortar and pestle, laemmli buffer (50 mM Tris-Cl, pH 6.8, 2.5% 2-mercaptoethanol, 2% SDS, 0.1% bromophenol blue, 10% glycerol) was added (100 l per 100 mg tissue). The sample was transferred to a 1.5 ml centrifuge tube and boiled in a water bath for 3 minutes followed by centrifugation at maximum speed for 2 minutes. The supernatant was transferred to a new tube and stored at 20 C. until further use. The electrophoresis was carried out in a 12% SDS-Polyacrylamide gel (Bio-Rad, Hercules, Ca.) followed by two hours of semi-dry blotting to transfer the protein onto a nitrocellulose membrane (Bio-Rad, Hercules, Ca.). The membrane was blocked for 1 hr at room temperature followed by incubation with the primary antibody of either CP (1:5000), GFP (1:100) (Clontech Laboratories, Palo Alto, Ca.) or GUS (1:1000) (Molecular probes, Eugene, Or.) for an hour followed incubation for 1 hr in horseradish peroxidase conjugated donkey anti-rabbit secondary antibody (1:10,000) (Amersham, Buckinghamshire, United Kingdom). Finally, the chemiluminescent system for western blot (Amersham, Buckinghamshire, United Kingdom) development on an X-ray film (Kodak, Rochester, N.Y.) was used according to the manufacturer recommendations.
Plant and Protoplast Photos
(77) Plant pictures under UV or white light were taken with a Canon Camera (Canon EOS Digital Rebel XTi 400D, Lake Success, N.Y.). Close up fluorescent pictures of plant parts or protoplast were taken using a fluorescent dissecting microscope (Zeiss Stemi SV 11 UV-fluorescence dissecting microscope, Carl Zeiss Jena, GmbH., Jena, Germany). High resolution protoplast pictures were taken using a confocal scanning microscope (Leica TCS SL, Leica Microsystems, Inc., Exton, Pa.).
Enzyme Linked Immunosorbent Assay (ELISA)
(78) Double antibody sandwiched ELISA was used according to the procedure developed by Garnsey and Cambra (1991). A rabbit polyclonal antibody (1 g/ml) was used for coating the ELISA plate. The plant tissue sample was diluted at a 1:20 in PBS-T (phosphate buffer saline-1% Tween 20) extraction buffer. The detection antibody used was Mab ECTV 172 (1:100K dilution).
GUS Assay
(79) Citrus bark pieces or systemic leaves from Agro-inoculated N. benthamiana plants that were surface sterilized in alcohol (70% ethanol) followed by Sodium hypo chloride (10% solution) and washing three times in sterile distilled water before staining for GUS. The samples were incubated overnight in an EDTA-phosphate buffer (0.1M Na.sub.2HPO.sub.4, 1 mM Na.sub.2EDTA) containing 1 mg/ml X-gluc (cyclohexylammounium salt: Gold Biotechnology, St Louis, Mo.). Fixing of the tissue was done in 95% ethanol:glacial acetic acid solution (3:1.
Example 1: Systems Used to Examine CTV-Based Expression Vectors
(80) CTV-based expression vectors were examined in three systems, N. benthamiana mesophyll protoplasts as well as whole plants of N. benthamiana and Citrus macropylla. The full-length cDNA clone of CTV (pCTV9R) and a mutant with most of the p33 gene deleted (pCTV9Rp33), which has a PstI restriction site removed making cloning easier and still retaining the ability to infect most citrus varieties (Tatineni et al., 2008), was used for building constructs to infect whole plants. Relatively quick assays were done in N. benthamiana protoplasts, which require constructs to be built in the SP6 transcription plasmid (Satyanarayana et al., 1999). A mini-replicon pCTVCla 333R (Gowda et al., 2001), with most of the 3 genes removed, was convenient to use in protoplasts. The ultimate goal to obtain citrus trees infected with the different CTV expression vectors was much more difficult and time consuming So far, agro-inoculate citrus trees has proven difficult. Thus, to avoid this difficulty virions are amplified and concentrated for inoculation of citrus trees by stem-slashing or bark-flap inoculation (Robertson et al., 2005; Satyanarayana et al., 2001). N. benthamiana protoplasts can be inoculated with in vitro produced transcripts of recombinant CTV constructs and the virus amplified by successively passaging virions in crude sap through a series of protoplasts (Folimonov et al., 2007; Satyanarayana et al., 2001; Tatineni et al., 2008). Also, recombinant CTV can be amplified in N. benthamiana plants after agro-inoculation (Gowda et al., 2005). The virus can infect mesophyll cells of agro-inoculated areas of leaves, but as the virus moves systemically into upper non-inoculated leaves, it is limited to vascular tissues and usually induces vein clearing and later vein necrosis. All of the vector constructs were examined during systemic infection of N. benthamiana plants. Since CTV virions do not resuspend after centrifugation to a pellet, virions have to be concentrated by centrifugation through a sucrose step gradient (Garnsey et al., 1977; Robertson et al., 2005). After inoculation, the tops of citrus plants were removed, and viral systemic infections were monitored in new growth after 2-3 months. Once trees were infected, inoculum (buds, leaf pieces, or shoots) from the first infected plants was then used to propagate new plants for experimentation. The whole process takes approximately one year. For this reason, the inventors chose to examine only the most promising vector constructs in citrus trees. Some of the later developed constructs are not yet in citrus.
Example 2: Addition of an Extra Gene at Different Locations within the CTV Genome
(81) Insertions at the p13 Gene Site
(82) The effective CTV vector developed previously (Folimonov et al., 2007) has the additional gene inserted between the two coat protein genes, positioning the foreign gene as the sixth gene from the 3 terminus. Yet, the most highly expressed genes of CTV tend to be closer to the 3 terminus. Thus, it appeared that positioning an inserted gene closer to the 3 terminus could result in higher levels of expression. P13, the third gene from the 3 terminus, is a relatively highly expressed gene that is not necessary for the infection of most of the CTV host range (Tatineni et al., 2008; Tatineni et al., in preparation). Yet, replacement of the p13 ORF with the GFP ORF was not successful in previous attempts (Folimonov et al., 2007). There were possible reasons for the failure. The previous construct was designed with the assumption that translation initiated at the first start codon, but the p13 ORF has a second in-frame AUG. Translation might normally start at the second AUG. However, fusion of the GFP ORF behind the second in frame AUG also did not express the reporter gene (Gowda et al., unpublished result). A second possibility is that the p13 controller element (CE) might extend into the p13 ORF or that ribosome recruitment is directed from within the ORF. Here, the inventors deleted the p13 CE and ORF and inserted a new ORF behind a heterologous CE in the p13 position. The GFP ORF controlled by the CP-CE from BYSV (101 nts from 8516-8616 accession # U51931), GLRaV-2 (198 nts from 9454-9651 accession # DQ286725) or BYV were engineered into pCTV9Rp33 as a replacement for nts 17293-17581 (CTV33-13-BY-GFP-57, CTV33-13-G-GFP-65, CTV33-13-B-GFP-66 respectively) (
(83) CTV33-13-G-GFP-65 and CTV33-13-B-GFP-66 were amplified and used to inoculate Citrus macrophylla plants. The initially infected plants exhibited bright fluorescence in vascular tissue (
(84) The GFP ORF (720 nts) was replaced with the GUS ORF (1812 nts) in the same position to examine the expression of a larger foreign gene. The BYSV CP-CE was selected to drive the GUS ORF in expression vector CTV33-13-BY-GUS-61 (
(85) Virions isolated from infiltrated leaves of N. benthamiana plants of CTV33-13-BY-GUS-61 infected Citrus macrophylla plants as confirmed by ELISA (Data not presented) and the bioactivity of the GUS protein (
(86) Technically, the above constructs replaced a gene (p13) rather than added an extra gene. To examine a vector with an extra gene between p13 and p20, the CP-CE of BYSV controlling the GFP ORF was inserted between nts 17685-17686 to yield CTV33-13-BY-GFP-69 (
(87) Construct CTV33-13-BY-GFP-69 infected C. macrophylla plants as indicated by strong fluorescence throughout the vascular tissue (
(88) Insertion Between p20 and p23
(89) To examine expression of a foreign gene closer to the 3 NTR of CTV, an extra gene was inserted between the p20 and p23 genes (nts 18312-18313). The BYV or BYSV CP-CE was used to drive the GFP mRNA in two vectors based on T36 CTV9Rp33 (CTV33-20-B-GFP-49 and CTV33-20-BY-GFP-58) (
(90) Insertion Between p23 and 3NTR
(91) The next position to be examined was to make the inserted gene the 3-most gene. Since CTV gene expression tends to be highest for genes positions nearer the 3 terminus, this position could be expected to result in the highest level of expression of a foreign gene (Navas-Castillo et al., 1997; Hilf et al., 1995). Although the 3 NTR has been analyzed (Satyanarayana et al., 2002a), it was not known what effect an extra gene in this area would have on the efficiency of replication. The insertion of an extra gene between the CP gene and the 3NTR in Tobacco mosaic virus (TMV) and Alfalfa mosaic virus (AMV) failed to produce viable vectors (Dawson et al., 1989; Snchez-Navarro et al., 2001). The CP-CE of BYSV, GLRaV-2 or BYV in front of the GFP ORF was inserted between nucleotides 19020 and 19021 creating vectors CTV33-23-BY-GFP-37, CTV33-23-G-GFP-40 and CTV33-23-B-GFP-42, respectively (
(92) Construct CTV33-23-BY-GFP-37 was amplified by passage through 12 protoplast sets before citrus inoculation. C. macrophylla plants that were bark-flap inoculated with the concentrated virions became infected. The infection of citrus was confirmed by fluorescence of GFP (
(93) To examine the ability of the vector to express a larger gene at this position, the GUS ORF behind the BYSV CP-CE was inserted 3 of the p23 gene resulting in construct CTV33-23-BY-GUS-60 (
(94) Concentrated virions from Construct CTV33-23-GUS-60 were used to inoculate C. macropyhlla plants, which became infected as confirmed by ELISA (Data not presented) and activity of the GUS gene (
Example 3: Production of an Extra Polypeptide without Producing an Extra Subgenomic mRNA
(95) Internal Ribosome Entry Site Strategy (IRES)
(96) The Tobacco Etch Virus (TEV) IRES
(97) The 5NTR of TEV mediates cap independent translation of the viral mRNA. Studies on the 5NTR of TEV demonstrate its ability to initiate translation at an internal ORF in a bi-cistronic mRNA (Gallie, 2001; Niepel and Gallie, 1999). The 5NTR of TEV (nts 2-144 Genbank accession # DQ986288) was inserted into a CTV mini-replicon behind the p23 ORF (between nts 19020-19021) followed by the GFP ORF (CTVp333R-23-ITEV-GFP) (
(98) Active Ribosome Complementary Sequence (ARC) IRES
(99) Insertion of an IRES consensus sequence obtained from analysis of host and viral mRNAs (the engineered 3ARC-1 (86 nts) IRES (Akbergenov et al., 2004)) was next examined for activity in CTV. This IRES was fused behind the p23 ORF (nts 19020-19021) in both the CTV mini-replicon (CTVp333R-23-I3ARC-GFP) and p33CTV9R (CTV33-23-I3ARC-GFP-43) as described above (
(100) Poly-Peptide Fusion
(101) P23, the highest expressed gene of CTV, is a multifunctional protein that is essential for citrus infection. P23 is a silencing suppressor and controls plus to minus RNA ratio in infected cells via an RNA binding domain constituted of positive charged amino acid residues and Zn finger domain present between amino acid 50-86 (Lopez et al., 2000; Satyanarayana et al., 2002b; Lu et al., 2004). In order to create a gene fusion the HC-Pro or NIa protease motifs of TEV were selected to be fused at the C-terminus of p23 (between nts 19017 and 19018) (
Example 4: Production of More than One Extra Foreign Protein from CTV Vectors
(102) Use of Single Controller Elements to Express Multiple Proteins
(103) In order to exploit the polypeptide strategy to express multiple genes driven by the same controller element in a CTV based vector, a fusion polypeptide was created consisting of GFP/Protease (Pro)/GUS. Two different protease motifs were used in the different constructs, HC-Pro and NIa, with their proteolytic motifs and recognition sequences separating GFP ORF from the GUS ORF (
(104) Replacement of p13 Gene
(105) The two fusions of GFP/Pro/GUS described above were engineered into the p13 site of CTV in the agro-inoculation binary vector under the control of the BYSV CP-CE (CTV33-13-BYGFP-HC-GUS-77 with HC-Pro protease motif and CTV33-13-BYGFP-NIa-GUS-78 with NIa protease motif) (
(106) Insertion Between p23 and 3NTR
(107) In an attempt to improve the expression level of GFP and GUS, the fusion polypeptide was moved closer to the 3NTR. The fusion gene with either BYSV, GLRaV-2 or BYV CP-CE with the protease of HC-Pro was inserted between p23 and 3NTR referred to as CTV33-23-BY-GFP-HC-GUS-51, CTV33-23-G-GFP-HC-GUS-53 and CTV33-23-BY-GFP-HC-GUS-55 whereas with the NIa protease constructs were named, CTV33-23-BY-GFP-NIa-GUS-52, CTV33-23-G-GFP-NIa-GUS-54 and CTV33-23-BY-GFP-NIa-GUS-56, respectively (
Example 5: Use of Multiple Promoters to Express Foreign Genes Simultaneously
(108) Bimolecular Fluorescence Complementation (BiFC) in CTV.
(109) For examination of the insertion of two CP-CE controlling different ORFs, the BiFC system, which produces visible fluorescence only when the two proteins accumulate in the same cell, was used. This system was developed using the bJun fused to N-terminus of EYFP (A.A. 1-154) (referred to as bJunN) and bFos ORF fused to C-terminus of EYFP (A.A. 155-238) (referred to as bFosC) (Hu et al., 2002).
(110) Both proteins are transported to the nucleus where they directly interact enabling the EYFP protein to regain its wild type folding pattern and results in emission of fluorescence upon activation by a blue light source (Excitation wave length is 525 nm and emission wavelength is 575 nm) (Hu et al., 2002). One or both components of BiFC were introduced into the CTV mini-replicon 3 of the p23 ORF (between nts #19020 and 19021 Genbank Accession # AY170468) referred to as CTVp333R-23-BYbJunN, CTVp333R-23-GbFosC and CTVp333R-23-BYbJunN-GbFosC (
(111) As a control for the BiFC experiments, the inventors also introduced the genes individually into p33CTV9R behind p23 creating vectors CTV33-23-BYbJunN-97 and CTV33-23-GbFosC-98 so that only one component would be produced (
(112) Expression of Multiple Foreign Genes Simultaneously at the Same Location
(113) P13 Replacement.
(114) Both genes were introduced into a p33CTV9R (Satyanarayana et al., 1999, 2000, 2003; Tatineni et al., 2008) as a replacement of the p13 gene (replacement of the nucleotides deleted between 17292 and 17581), resulting in CTV33-13-BYbJunN-GbFosC-76 (
(115) Insertion Between p23 and 3NTR.
(116) The next step was to examine expression of the two genes when positioned closer to the 3 terminus. The two gene components of the BiFC system were introduced into CTV433 behind p23 (between nts #19020 and 19021), CTV33-23-BYbJunN-GbFosC-59 (
Example 6: Expression of Multiple Foreign Genes Simultaneously from Different Locations
(117) To express multiple foreign genes from two different positions, the inventors elected to replace the p13 gene and insert a second gene behind p23. CTV33-13-BYbJunN-23-GbFosC-67 (
(118) In order to further study simultaneous multiple gene expression from the different locations as above, CTV33-13-BYGUS-23-GGFP-71 was engineered such that the GUS ORF under the control of the BYSV CP-CE replaced the p13 gene (nts 17292-17582) and the GFP ORF under the control of the GLRaV-2 CP-CE was inserted between the p23 and 3NTR (nts 19020 and 19021)(
Example 7: Level of Foreign Gene Expression of the Different Constructs in Citrus
(119) It is difficult to directly compare foreign gene expression from the different vectors in citrus due to the differences in the times of infection, the ages of the tissue and the effects of the inserted foreign gene cassette on the replication of the virus. Yet, protein presence in citrus is the best measure of expression level. Thus, western blot analysis was used to compare the relative level of expression of the different GFP and GUS constructs in citrus to that of CP protein, a house keeping gene to determine the replication levels. Western blots using the GFP antibodies and the CP antibody revealed a trend which confirms the relative higher expression levels near the 3 end of the genome and a lower expression level when the inserted gene is moved further away from the 3 end with the exception for the insertion between p13 and p20 (
Example 8: Multiple Gene Vectors
(120) Plasmid Construction:
(121) Three and four gene vectors were developed by introducing different combination of gene cassettes into the CTV genome at different locations. Three of the vectors were developed in CTV9Rp33 in the pCAMBIA 1380 background (CTV33-BGFP-BYGUS-GTMVCP-79, CTV33-BGFP-GbFosC-BYbJunN-81 and CTV33-13-BGFP-BYbJunN-GbFosC-82). The other three three gene vectors (CTV-BASL-BYPTA-CP7-119, CTV-BASL-BYP10-CP7-131, CTV-BASL-BYPTA-CP10-120 and CTV-BRFP-BYGFP-CTMVCP-117) and one four gene vector (CTV13-BRFP-GbFosC-BYbJunN-CTMVCP-118) were developed by modifying CTV9R in the background of pCAMBIA1380 altered by replacing the hygromycin ORF with the p22 ORF of Tomato chlorosis virus. For the ease of cloning the PstI restriction site in p33 ORF in full length CTV9R was eliminated by introducing a silent mutation using overlap extension PCR using primers 1749 and 1750 in combination with primer C-1436 and C-253 followed by digestion of both the overlap PCR product and CTV9R with XmaI and PmeI. Most of the gene cassettes were introduced into their locations by overlap extension PCR using the primers listed in tablet. The only exception was the insertion of green fluorescent protein cycle 3 in between the CPm and CP gene. Introducing the GFPC3 gene cassette into that location was done by restriction digestion of 9-47RGFP plasmid and point mutated CTV9R in pCAMBIA1380 with PmeI and PstI.
(122) Expression of Three and Four Foreign Genes Simultaneously
(123) After successfully expressing two genes in N. benthamiana and citrus with one and two different controller elements we are building vectors to express three and four foreign genes from three and four different controller elements, respectively. The reporter genes used in different combinations were the green fluorescent protein (cycle 3 GFP, GFPC3), red fluorescent protein (tag red fluorescent protein, RFP), Bimolecular fluorescence complementation using the bFos and bJun mammalian transcription factors (Hu et al., 2002), -glucuronidase (GUS) gene from Escherichia coli and the Tobacco mosaic virus (TMV) coat protein gene (CP). Similarly, three gene vectors were built in different combinations to express two antimicrobial peptides (AMPs) from Tachypleus tridentatus and Sus scorfa, Allium sativum lectin (ASL) and Pinellia ternata agglutinin (PTA). The three gene vectors were either expressed from two or three locations within the CTV genome
(124) Expression of Three Foreign Genes from Three Different Locations Simultaneously:
(125) Six vectors were built to express three foreign genes from three different locations. The vectors were built to express the genes either from CTV9Rp33 or full length CTV9R.
Vectors Built to Express Three Genes from Three Different Locations in CTV9Rp33
(126) Two vectors were built by inserting the three extra gene cassettes into CTV9Rp33 creating expression vectors CTV33-BGFP-BYGUS-GTMVCP-79 (
Vectors Built to Express Three Genes from Three Different Locations in CTV9R
(127) Four vectors were built to express three foreign genes from the same three different locations within the CTV genome. The three locations selected were insertion between CPm and CP, p13 and p20 and p23 and 3UTR. For the ease of cloning into the full length CTV infectious clone a the PstI site within the p33 ORF was eliminated by introducing a silent point mutation by overlap extension PCR. Three of the four vectors were created by using different combinations of the two AMPs, ASL and PTA resulting in expression vectors CTV-BASL-BYPTA-CP7-119, CTV-BASL-BYP10-CP7-131 and CTV-BASL-BYPTA-CP10-120. The fourth vector named CTV-BRFP-BYGFP-CTMVCP-117 was created by inserting the ORFs of GFP, RFP and TMV CP under the control of BYV, BYSV and duplicated CP-CE of CTV. All the vectors were infiltrated into N. benthamiana to monitor the development of systemic infection. CTV-BASL-BYPTA-CP7-119 developed efficient systemic infection in 1 N. benthamiana plant. Plants infiltrated with vector CTV-BRFP-BYGFP-CTMVCP-117 revealed fluorescence in systemic leaves under hand held UV. Upon development of pronounced systemic infection, virions from CTV-BRFP-BYGFP-CTMVCP-117 will be concentrated over a sucrose step gradient and a sucrose cushion in order to inoculate citrus plants similar to the procedure recently followed for vector CTV-BASL-BYPTA-CP7-119
(128) Expression of Three Foreign Genes from Two Different Locations Simultaneously:
(129) Two vectors were created for the simultaneous expression of three genes from two different locations within the CTV genome. One vector was built in CTV9Rp33 creating expression vector CTV33-BGFP-GbFosC-BYbJunN-81 whereas the other vector was built in full length CTV9R named CTV13-GbFosC-BYbJunN-CTMVCP-129.
Vector Built to Express Three Genes from Two Different Locations in CTV9Rp33
(130) CTV33-BGFP-GbFosC-BYbJunN-81 (
Vector Built to Express Three Genes from Two Different Locations in CTV9R
(131) CTV9R was modified by inserting a double gene cassette (bFosC ORF followed by bJunN ORF under the control of GLRaV-2 and BYSV CP-CE, respectively) as replacement of p13 and a gene cassette (TMV CP ORF under the control of the duplicated CP-CE) as an insertion between p23 and 3UTR creating expression vector CTV13-GbFosC-BYbJunN-CTMVCP-129 (
(132) Expression of Four Foreign Genes from Three Different Locations Simultaneously:
(133) In order to build the four gene vector we used four gene cassettes located at three different locations within the CTV genome. The RFP ORF was introduced between CPm and CP under the control of the BYV CP-CE, the two BiFC components bFosC and bJunN under the control of GLRaV-2 and BYSV respectively were introduced as a replacement of the p13 gene and the TMV ORF under the control of the duplicated CP-CE of CTV was introduced behind p23. The four gene vector named CTV13-BRFP-GbFosC-BYbJunN-CTMVCP-118 was infiltrated into the N. benthamiana leaves for the development of systemic infection. Upon systemic infection virion concentration will be carried out over a sucrose step gradient and cushion for the infection of the citrus trees.
Discussion Related to Examples 1-8
(134) In this work, CTV constructs that are extraordinarily permissive in allowing insertion of foreign sequences at different places in the 3 portion of the genome are disclosed. Numerous different potential vector constructs to express foreign genes via additional subgenomic RNAs, di-cistronic mRNAs, or protease processing of fusion proteins were created and examined. Remarkably, most of these constructs functioned as vectors. Additionally, that the CTV constructs disclosed herein are capable of simultaneously producing large amounts of multiple foreign proteins or peptides.
(135) The ultimate goal was to develop high expressing and stable vectors for the natural CTV host, citrus. Thus, virions were concentrated from N. benthamiana plants infected with 12 different constructs that spread and expressed moderate to high levels of the foreign protein(s) and used to inoculate citrus. C. macrophylla plants became positive for infection between 6-60 weeks after inoculation depending on the insert length in the virus and the amount of virions concentrated from the N. benthamiana leaves that were used for inoculation. Most of the constructs that infected citrus produced moderate levels of the reporter gene/s.
(136) Several approaches were examined for expression of foreign genes from CTV. The first approach was the add-a-gene strategy that involved the addition or duplication of a controller element and an additional ORF, which resulted in an additional subgenomic RNA. The add-a-gene approach was developed initially in TMV via duplicating the CP subgenomic promoter controlling a foreign gene (Dawson et al., 1989; Donson et al., 1991; Shivprasad et al., 1999). An advantage of this strategy is that it expresses the exact protein with no additional amino acids added to the N or/and C terminus which could affect its biological activity, at relatively high levels. However, there are limitations of this strategy that should be considered. Duplication of the controller element can lead to homologous recombination resulting in the loss of the gene of interest (Chapman et al., 1992; Dawson et al., 1989). Although this made the TMV insert unstable, it appeared to have little effect on the stability in CTV (Folimonov et al., 2007). The use of a heterologous controller element from related viruses stabilized the TMV insertions. However, heterologous controller elements usually are differentially recognized by the replicase complex of the virus (Folimonov et al., 2007; Shivprasad et al., 1999). This observation can be utilized to regulate the levels of desired gene expression (Shivprasad et al., 1999). An important consideration is that there can be competition between the different subgenomic RNAs of a virus. With TMV, the extra gene competed with the coat protein gene and the movement gene. There appeared to be a maximal capacity for production of subgenomic RNAs that was divided among the three RNAs. Manipulations that resulted in increases in one resulted in decreases in the others. One solution was to reduce coat protein production to allow optimal foreign gene and movement gene expression (Shivprasad et al., 1999; Girdishivelli et al., 2000). Yet, CTV subgenomic mRNAs appeared to be much less competitive (Folimonov et al., 2007; Aylln et al., 2003).
(137) In previous work, a CTV vector was created that expressed an extra gene between the CP and CPm genes that was an effective and stable vector in citrus trees. The foreign gene was in position 6 from the 3 terminus (Folimonov et al., 2007). The position of the extra gene was chosen arbitrarily. Here the inventors continued vector design in an attempt to define the limits of manipulation of the CTV genome in producing extra proteins or peptides. The virus expresses its ten 3 genes via sg mRNAs (Hilf et al., 1995). One rule of CTV gene expression is that genes nearer the 3 terminus are transcribed higher than internal genes. For example, transcription of the p33 gene, which is at position 10 from the 3 terminus, is very low in its native position, but transcription became very high when the p33 gene was moved near the 3 terminus (Satyanarayana et al., 1999). Thus, expression of foreign genes from positions nearer the 3 terminus might result in higher levels than from the position 6 arbitrarily chosen in the first vector (Folimonov et al., 2007). Yet, based on results from other viruses, only certain positions within the viral genome are likely to tolerate extra gene insertions. For example, with TMV or Alfalfa mosaic virus the location between CP and 3NTR did not accommodate an insert (Dawson et al., 1989; Lehto and Dawson, 1990; Sanchez-Navarro et al., 2001). Remarkably, almost all of the constructs with insertions in CTV within the p13 deletion, between p13 and p20, and between p23 and the 3 NTR were viable. In contrast, it was found that the only position the virus did not tolerate insertions was between the p20 and p23 genes. It is possible that these insertions interfered with the transcription of either of the adjacent genes.
(138) Another strategy to express foreign genes in a viral vector consists of in-frame fusion of an ORF of interest to a viral ORF at either the N or C terminus. The two proteins can be released by engineering a protease and processing sites between the two proteins (Dolja et al., 1997; Gopinath et al., 2000). It was first adapted in the potyviridae, tobacco etch virus (Dolja et al., 1992). The major advantage of polyprotein fusion strategy is that the foreign protein is expressed in 1:1 ratio with the viral protein. A major limitation is that this process adds extra amino acids at the N and/or C termini of both proteins, which may affect their biological activities.
(139) A series of constructs utilizing the HC-Pro or NIa proteases from potyviruses to enable post translational processing of the engineered polyprotein to release free GFP, protease, and the p23 protein were created. These vectors were able to systemically infect N. benthamiana. The systemic movement of these constructs was slower than the expression vector constructs containing only the GFP ORF as an extra gene. The slower systemic movement and the lower levels of GFP expression in the systemic leaves partially could be attributed to the extra C-terminal amino acids of p23 reduced its activity in RNA silencing suppression or amplification of viral RNAs or the protease processing delayed its activity. Although these constructs did not produce the maximal levels of foreign protein, they were viable vectors expressing substantial amounts of GFP.
(140) Upon identifying the locations within the CTV genome that could accommodate foreign gene inserts, strategies were designed to construct viral vectors that express multiple genes. The first strategy depended on the use of a single controller element driving the transcription of a polypeptide gene. The fusion gene that consisted of GFP/Pro/GUS, ranged in size from 3127 nts to 3480 nts. Other strategies utilized two extra CEs to produce two extra sg RNAs simultaneously. This strategy gave the flexibility to insert the two genes in tandem in the same location or in two different locations. Both strategies worked.
(141) Heterologous protein expression in whole plant is usually accomplished by development of transgenic plants by insertion of foreign DNA into the plastid or nuclear genome. Plastid transformation has been successful for only a few annual crops. Time and success of nuclear transformation varies among the different crops. Certain plants are more recalcitrant to transformation and subsequent regeneration than others. There are other disadvantages, particularly in perennial crops. For example, citrus has a long juvenile stage after regeneration that prolongs the time necessary to evaluate the horticultural characteristics and delays the time to commercial use. Another major disadvantage is that transformation is limited to the next generation of plants.
(142) The inventors have now developed a series of different CTV vectors, each with different characteristics that are more effective under specific conditions. For example, with the add-a-gene vectors, the inventors would advocate the expression of a small gene in 3 of the p23 gene in CTV for maximal expression. A medium gene could be more efficiently expressed from within the p13 area. A large gene probably would be better accommodated as an insertion between CP and CPm where it would disrupt the viral subgenomic RNAs less and result in better systemic invasion of the plant. For expression of smaller proteins, peptides, or RNAs to target RNA silencing, it is possible that the virus could accommodate 3 or 4 different genes. Different combinations of extra sg RNAs and protease processing can be chosen. Although two foreign proteins have been produced from other viruses, CTV is unique in usefulness because of its stability. The original vector has been continuously producing GFP for 8 years.
(143) The uses of the CTV based expression vector have evolved since its inception. It was initially developed as a laboratory tool for citrus improvement. The vector was designed to express potential genes for transformation of citrus. Results of the effect of the heterologous gene in citrus, particularly if the effect was expected in mature tissue or fruit, could be obtained by the virus years before results would come from direct transformation. However, conditions and needs of the citrus industry have changed due to the invasion of a new bacterial disease referred to as Huanglongbing (HLB). This disease has spread so rapidly and is so damaging that the survival of the citrus industry is threatened. Initially, the CTV vector was used to identify antimicrobial peptides with activity against the HLB bacterium for transformation into citrus. However, the disease is spreading so rapidly that transgenic plants may not be available in time to save the industry. Due to the remarkable stability, the CTV vector now is being considered for use in the field to protect citrus trees and to treat infected trees until resistant transgenic plants become available. The CTV vector as a tool in the field to fight an invading disease of citrus is only one example of what viral vectors can do for agriculture. The possibilities are many for very stable vectors like those of CTV and perennial crops, particularly trees. Many trees are productive for 100 years or more. During the lifespan of the trees technologies changes and disease and pest pressures change. To improve trees by traditional transformation methods requires removing all of the present trees from the field and replanting. The use of a viral vector could add new genes to the existing trees.
LIST OF REFERENCES RELATED TO EXAMPLES 1-8
(144) Ahlquist, P., French, R., Janda, M., Loesch-Fries, L. S., 1984. Multi component RNA plant virus infection derived from cloned viral cDNA. Proc. Natl. Acad. Sci. USA 8, 7066-7070. Akbergenov, R., Zhanybekova, S., Kryldakov, R. V., Zhigailov, A., Polimbetova, N. S., Hohn, T., Iskakov, B. K., 2004. ARC-1, a sequence element complementary to an internal 18S rRNA segment, enhances translation efficiency in plants when present in the leader or intercistronic region of mRNAs. Nucleic Acids Res. 32, 239-247. Allison, R. F., Dougherty, W. G., Parks, T. D., Willis, L., Johnston, R. E., Kelly, M., Armstrong, F. B., 1985. Biochemical analysis of the capsid protein gene and capsid protein of tobacco etch virus: N-terminal amino acids are located on the virion's surface. J. Virol. 147, 309-316. Andrade, M., Sato, M., Uyeda, I., 2007. Two resistance modes to Clover yellow vein virus in pea characterized by a green fluorescent protein-tagged virus. Phytopathology 97, 544-550. Aylln, M. A., Gowda, S., Satyanarayana, T., Karasev, A. V., Adkins, S., Mawassi, M., Guerri, J., Moreno, P., Dawson, W. O., 2003. Effects of modification of the transcription initiation site context on citrus tristeza virus subgenomic RNA synthesis. J. Virol. 77, 9232-9243. Balvay, L., Soto Rifo, R., Ricci, E. P., Decimo, D., Ohlmann, T., 2009. Structural and functional diversity of viral IRESes. Biochim. Biophys. Acta 1789, 542-557. Baulcombe, D. C., Chapman, S., Santa Cruz, S., 1995. Jellyfish green fluorescent protein as a reporter for virus infections. Plant J. 7, 1045-1053. Beauchemin, C., Bougie, V., Lalibert, J. F., 2005. Simultaneous production of two foreign proteins from a potyvirus-based vector. Virus Res. 112, 1-8. Brisson, N., Paszkowski, J., Penswick, J. R., Gronenborn, B., Potrykus, I., Hohn, T., 1984. Expression of a bacterial gene in plants by using a viral vector. Nature 310, 511-514. Caizares, C. M., Navas-Castillo, J., Moriones, E., 2008. Multiple suppressors of RNA silencing encoded by both genomic RNAs of the crinivirus, Tomato chlorosis virus. Virology 379, 168-174. Caizares, M. C., Nicholson, L., Lomonossoff, G. P., 2005 Use of viral vectors for vaccine production in plants. Immunol. Cell Biol. 83, 263-270. Canto, T., Prior, D. A. M., Hellwald, K.-H., Oparka, K. J., Palukaitis, P., 1997. Characterization of cucumber mosaic virus IV. Movement protein and coat protein are both essential for cell-to-cell movement of cucumber mosaic virus. Virology 237, 237-248. Carrasco, P., Daros, J. A., Agudelo-Romero, P., Elena, S. F., 2007. A real-time RT-PCR assay for quantifying the fitness of tobacco etch virus in competition experiments. J. Virol. Methods 139, 181-188. Carrington, J. C., Cary, S. M., Parks, T. D. and Dougherty, W. G., 1989. A second proteinase encoded by a plant potyviral genome. EMBO J. 8, 365-370. Carrington, J. C., Dougherty, W. G., 1988. A viral cleavage site cassette: Identification of amino acid sequences required for tobacco etch virus polyprotein processing. Proc. Natl. Acad. Sci. USA 85, 3391-3395. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., Prasher, D. C., 1994. Green fluorescent protein as a marker for gene expression. Science 263, 802-805. Chapman, S., Kavanagh, T., Baulcombe, D., 1992. Potato virus X as a vector for gene expression in plants. Plant J. 2, 549-557. Chiba, M., Reed, J. C., Prokhnevsky, A. I., Chapman, E. J., Mawassi, M., Koonin, E. V., Carrington, J. C., Dolja, V. V., 2006. Diverse suppressors of RNA silencing enhance agroinfection by a viral replicon. Virology 346, 7-14. Crameri, A., Whitehorn, E. A., Tate, E., Stemmer, W. P., 1996. Improved green fluorescent protein by molecular evolution using DNA shuffling. Nat. BioTechniques 14, 315-319. Dawson, W. O., Bubrick, P., Grantham, G. L. 1988. Modifications of the tobacco mosaic virus coat protein gene affect replication, movement, and symptomatology. Phytopathology 78, 783-789. Dawson, W. O., Lewandowski, D. J., Hilf, M. E., Bubrick, P., Raffo, A. J., Shaw, J. J., Grantham, G. L. Desjardins, P. R., 1989. A tobacco mosaic virus-hybrid expresses and loses an added gene. Virology 172, 285-292. Deleris, A., Gallego-Bartolome, J., Bao, J., Kasschau, K. D., Carrington, J. C., Voinnet, O., 2006. Hierarchical action and inhibition of plant Dicer-like proteins in antiviral defense. Science 313, 68-71. Dietrich, C., Maiss, E., 2003. Fluorescent labeling reveals spatial separation of potyvirus populations in mixed infected Nicotiana benthamiana plants. J. Gen. Virol. 84, 2871-2876. Dolja, V. V., Hong, J., Keller, K. E., Martin, R. R., Peremyslov, V. V., 1997. Suppression of potyvirus infection by co-expressed closterovirus protein. Virology 234, 243-252. Dolja, V. V., McBride, H. J., Carrington, J. C., 1992. Tagging of plant potyvirus replication and movement by insertion of beta-glucuronidase into the viral polyprotein. Proc. Natl Acad. Sci. USA 89, 10208-10212. Donson, J., Kearney, C. M., Hilf, M. E., Dawson, W. O. 1991. Systemic expression of a bacterial gene by a tobacco mosaic virus-based vector. Proc. Natl. Acad. Sci. USA. 88, 7204-7208. Dorokhov, Y. L., Skulachev, M. V., Ivanov, P. A., Zvereva, S. D., Tjulkina, L. G., Merits, A., Gleba, Y. Y., Hohn, T., Atabekov, J. G., 2002. Polypurine (A)-rich sequences promote cross-kingdom conservation of internal ribosome entry. Proc. Natl. Acad. Sci. USA. 99, 5301-5306. Edelstein, M. L., Abedi, M. R. Wixon, J., 2007. Gene therapy clinical trials worldwide to 2007an update. J. Gene Med. 9, 833-842. Fernandez-Miragall, O., Lopez de Quinto, S., Martinez-Salas, E., 2009. Relevance of RNA structure for the activity of picornavirus IRES elements. Virus Res. 139, 172-182. Fitzgerald, K. D., Semler, B. L., 2009. Bridging IRES elements in mRNAs to the eukaryotic translation apparatus. Biochim. Biophys. Acta 1789, 518-528. Folimonov, A. S., Folimonova, S. Y., Bar-Joseph, M., Dawson, W. O., 2007. A stable RNA virus-based vector for citrus trees. Virology 368, 205-216. Folimonova, S. Y., Folimonov, A. S., Tatineni, S., Dawson, W. O., 2008. Citrus tristeza virus: survival at the edge of the movement continuum. J. Virol. 82, 6546-6556. Folimonova, S. Y., Robertson, C. J., Shilts, T., Folimonov, A. S., Hilf, M. E., Garnsey, S. M. Dawson, W. O., 2010. Infection with strains of Citrus tristeza virus does not exclude super infection by other strains of the virus. J. Virol. 84, 1314-1325. French, R., Janda, M., Ahlquist, P., 1986. Bacterial gene inserted in an engineered RNA virus: efficient expression in monocotyledonous plant cells. Science 231, 1294-97 Ftterer, J., Bonneville, J. M., Hohn, T., 1990. Cauliflower mosaic virus as a gene expression vector for plants. Physiol. Plant. 79, 154-157. Gallie, D. R., 2001. Cap-independent translation conferred by the 5 leader of tobacco etch virus is eukaryotic initiation factor 4G dependent. J. Virol. 75, 12141-12152. Gallie, D. R., Tanguay, R. L., Leathers, V., 1995. The tobacco etch viral 5 leader and poly(A) tail are functionally synergistic regulators of translation. Gene 165, 233-238. Garnsey, S. M., Gonsalves, D., Purcifull, D. E., 1977. Mechanical transmission of citrus tristeza virus. Phytopathology 67, 965-968. Garnsey, S. M., Cambra, M., 1991. Enzyme-linked immunosorbent assay (ELISA) for citrus pathogens. In: Roistacher, C. N. (Ed.), Graft-Transmissible Diseases of Citrus, Handbook for Detection and Diagnosis. FAO, Rome, pp. 193-216. Garnsey, S. M., Henderson C. T., 1982. Extraction, centrifugation, and assay techniques for purification of intact citrus tristeza virus. Workshop on Plant Virus Detection, Agric. Exp. Stn., University of Puerto Rico, Rio Piedras, Mar. 29-Apr. 2, 1982, 106-112. Giritch, A., Marillonnet, S., Engler, C., van Eldik, G., Botterman, J., Klimyuk, V., Gleba, Y., 2006. Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors. Proc. Natl. Acad. Sci. USA 103, 14701-14706. Gleba, Y., Klimyuk, V., Marillonnet, S., 2007. Viral vectors for the expression of proteins in plants. Curr. Opin. Biotechnol. 18, 134-141. Gopinath, K., Wellink, J., Porta, C., Taylor, K. M., Lomonossoff, G. P., van Kammen, A., 2000. Engineering cowpea mosaic virus RNA-2 into a vector to express heterologous proteins in plants. Virology 267, 159-173. Gowda, S., Satyanarayana, T., Ayllon, M. A., Albiach-Marti, M. R., Mawassi, M., Rabindran, S., Garnsey, S. M., Dawson, W. O., 2001. Characterization of the cis-acting elements controlling subgenomic mRNAs of citrus tristeza virus: production of positive- and negative-stranded 3-terminal and positive-stranded 5-terminal RNAs. Virology 286 1, 134-151. Gowda, S., Satyanarayana, T., Davis, C. L., Navas-Castillo, J., Albiach-Marti, M. R., Mawassi, M., Valkov, N., Bar-Joseph, M., Moreno, P., Dawson, W. O., 2000. The p20 gene product of Citrus tristeza virus accumulates in the amorphous inclusion bodies. Virology 274, 246-254. Gowda, S., Satyanarayana, T., Robertson, C. J., Garnsey, S. M., Dawson, W. O., 2005. Infection of citrus plants with virions generated in Nicotiana benthamiana plants agroinfiltrated with a binary vector based Citrus tristeza virus, p. 23-33. In M. E. Hilf, N. Duran-Vila, and M. A. Rocha-Pea (eds.), Proceedings of the 16th Conference of the International Organization of Citrus Virologists. IOCV, Riverside, Calif., 728 USA. Grdzelishvili, V. Z., Chapman, S. N., Dawson, W. O., Lewandowski, D. J., 2000. Mapping of the Tobacco mosaic virus movement protein and coat protein subgenomic RNA promoters in vivo. Virology 275, 177-192. Gronenborn, B., Gardner, R. C., Schaefer, S., Shepherd, R. J., 1981. Propagation of foreign DNA in plants using cauliflower mosaic virus as vector. Nature 294, 773-76. Hagiwara, Y., Peremyslov, V. V., Dolja, V. V., 1999. Regulation of closterovirus gene expression examined by insertion of a self-processing reporter and by northern hybridization. J. Virol. 73, 7988-7993. Hilf, M. E., Karasev, A. V., Pappu, H. R., Gumpf, D. J., Niblett, C. L., Garnsey, S. M., 1995. Characterization of citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208, 576-582. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. R., Pease, L. B., 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61-68. Hu, C. D., Chinenov, Y., Kerppola, T. K., 2002. Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Molecular Cell 9, 789-798. Ion-Nagy, L., Lansac, M., Eyquard, J. P., Salvador, B., Garcia, J. A., Le Gall, O., Hernould, M., Schurdi-Levraud, V., Decroocq, V., 2006. PPV long-distance movement is occasionally permitted in resistant apricot hosts. Virus Res. 120, 70-78. Ivanov, P. A., Karpova, O. V., Skulachev, M. V., Tomashevskaya, O. L., Rodionova, N. P., Dorokhov, Y. L., Atabekov, J. G., 1997. A tobamovirus genome that contains an internal ribosome entry site functional in vitro. Virology 232, 32-43. Karasev, A. V., 2000. Genetic diversity and evolution of closteroviruses. Annu. Rev. Phytopathol. 38, 293-324. Karasev, A. V., Boyko, V. P., Gowda, S., Nikolaeva, O. V., Hilf, M. E., Koonin, E. V., Niblett, C. L., Cline, K., Gumpf, D. J., Lee, R. F., Garnsey, S. M., Lewandowski, D. J., Dawson, W. O., 1995. Complete sequence of the citrus tristeza virus RNA genome. Virology 208, 511-520. Karasev, A. V., Nikolaeva, O. V., Mushegian, A. R., Lee, R. F. Dawson, W. O., 1996. Organization of the 3-terminal half of beet yellow stunt virus genome and implications for the evolution of closteroviruses. J. Virol. 221, 199-207. Kasschau, K. D., Xie, Z., Allen, E., Llave, C., Chapman, E. J., Krizan, K. A., and Carrington, J. C., 2003. P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Dev. Cell 4, 205-217. Kawakami, S., Watanabe, Y., Beachy, R. N., 2004. Tobacco mosaic virus infection spreads cell to cell as intact replication complexes. Proc. Natl. Acad. Sci. USA 101, 6291-6296. Kelloniemi, J., Mkinen, K., Valkonen, J. P. T., 2008. Three heterologous proteins simultaneously expressed from a chimeric potyvirus: infectivity, stability and the correlation of genome and virion lengths. Virus Res. 135, 282-291. Kneller, E. L., Rakotondrafara, A. M., Miller, W. A., 2006. Cap independent translation of plant viral RNAs. Virus Res. 119, 63-75. Koh, D. C., Wong, S. M., Liu, D. X., 2003. Synergism of the 3-untranslated region and an internal ribosome entry site differentially enhances the translation of a plant virus coat protein. J. Biol. Chem. 278, 20565-20573. Lehto, K., and Dawson, W. O., 1990. Replication, stability, and gene expression of tobacco mosaic virus mutants with a second 30K ORF. Virology 175, 30-40. Lewandowski, D. J. and Dawson, W. O., 1998. Deletion of internal sequences results in Tobacco mosaic virus defective RNAs that accumulate to high levels without interfering with replication of the helper virus. Virology 251, 427-437. Lico, C., Chen, Q., Santi, L., 2008. Viral vectors for production of recombinant proteins in plants. J. Cell Physiol. 216, 366-377. Liu, Y. P., Peremyslov, V. V., Medina, V., Dolja, V. V. 2009. Tandem leader proteases of Grapevine leafroll-associated virus 2: host-specific functions in the infection cycle. Virology 383, 291-299. Lpez, C., Navas-Castillo, J., Gowda, S., Moreno, P., Flores R., 2000. The 23-kDa protein coded by the 3-terminal gene of citrus tristeza virus is an RNA-binding protein. Virology 269, 462-470. Lu, R., Folimonov, A., Shintaku, M., Li, W. X., Falk, B. W., Dawson, W. O., Ding, S. W., 2004. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome. Proc. Natl. Acad. Sci. USA 101, 15742-15747. Lucy, A. P., Guo, H. S., Li, W. X., Ding, S. W., 2000. Suppression of post-transcriptional gene silencing by a plant viral protein localized in the nucleus. EMBO J. 19, 1672-1680. Marton, I., Zuker, A., Shklarman, E., Zeevi, V., Tovkach, A., Roffe, S., Ovadis, M., Tzfira, T., Vainstein, A., 2010. Nontransgenic genome modification in plant cells. Plant Physiol. 154, 1079-1087. Masoumi, A., Hanzlik, T. N., Christian, P. D., 2003. Functionality of the 59- and intergenic IRES elements of cricket paralysis virus in a range of insect cell lines, and its relationship with viral activities. Virus Res. 94, 113-120. Masuta, C., Yamana, T., Tacahashi, Y., Uyeda, I., Sato, M., Ueda, S., Matsumura, T., 2000. Development of clover yellow vein virus as an efficient, stable gene-expression system for legume species. Plant J. 23, 539-546. Navas-Castillo, J., Albiach-Mart, M. R., Gowda, S., Hilf, M. E., Garnsey, S. M., Dawson, W. O., 1997. Kinetics of accumulation of citrus tristeza virus RNAs. Virology 228, 92-97. Niepel, M., Gallie, D. R., 1999. Identification and characterization of the functional elements within the tobacco etch virus 5 leader required for cap-independent translation. J. Virol. 73, 9080-9088. Padgett, H. S., Epel, B. L., Heinlein, M. H., Watanabe, Y., Beachy, R. N. 1996. Distribution of tobamovirus movement protein in infected cells and implications for cell-to-cell spread of infection. Plant J. 10, 1079-1099. Pappu, H. R., Karasev, A. V., Anderson, E. J., Pappu, S. S., Hilf, M. E., Febres, V. J., Eckloff, R. M. G., McCaffery, M., Boyko, V., Gowda, S., Dolia, V. V., Koonin, E. V., Gumpf, D. J., Cline, K. C., Garnsey, S. M., Dawson, W. O., Lee, R. F., Niblett, C. L., 1994. Nucleotide sequence and organization of eight 3 open reading frames of the Citrus tristeza closterovirus genome. Virology 199, 35-46. Peremyslov, V. V., Hagiwara, Y., Dolja, V. V., 1999. HSP70 homolog functions in cell-to-cell movement of a plant virus. Proc. Natl. Acad. Sci. U.S.A. 96, 14771-14776. Prokhnevsky, A. I., V. V. Peremyslov, V. V., Napuli, A. J., Dolja, V. V., 2002. Interaction between long-distance transport factor and Hsp70-related movement protein of beet yellows virus. J. Virol. 76, 11003-11011. Ratcliff, F., MacFarlane, S., Baulcombe, D. C., 1999. Gene silencing without DNA: RNA-mediated cross protection between viruses. Plant Cell, 11, 1207-1215. Roberts, A. G., Santa Cruz, S., Roberts, I. M., Prior, D. A. M., Turgeon, R., Oparka, K. J., 1997. Phloem unloading in sink leaves of Nicotiana benthamiana: comparison of a fluorescent solute with a fluorescent virus. Plant Cell 9, 1381-1396. Roberts, L. O., Groppelli, E., 2009. An atypical IRES within the 50 UTR of a dicistrovirus genome. Virus Res. 139, 157-165. Robertson, C. J., Garnsey, S. M., Satyanarayana, T., Folimonova, S., Dawson, W. O., 2005. Efficient infection of citrus plants with different cloned constructs of Citrus tristeza virus amplified in Nicotiana benthamiana protoplasts. Proc. 16th Conf. IOCV. IOCV, Riverside, Calif., pp. 187-195. Roy, G., Weisburg, S., Rabindran, S., Yusibov, V., 2010. A novel two-component Tobacco mosaic virus-based vector system for high-level expression of multiple therapeutic proteins including a human monoclonal antibody in plants. Virology 405, 93-99. Snchez-Navarro, J. A., Miglino, R., Ragozzino, A., and Bol, J. F., 2001. Engineering of Alfalfa mosaic virus RNA 3 into an expression vector. Arch. Virol. 146, 923-939. Sato, M., Masuta, C., Uyeda, I., 2003. Natural resistance to Clover yellow vein virus in beans controlled by a single recessive locus. Mol. Plant Microbe Interact. 16, 994-1002. Satyanarayana, T., Bar-Joseph, M., Mawassi, M., Albiach-Mart, M. R., Aylln, M. A., Gowda, S., Hilf, M. E., Moreno, P., Garnsey, S. M., Dawson, W. O., 2001. Amplification of Citrus tristeza virus from a cDNA clone and infection of citrus trees. Virology 280, 87-96. Satyanarayana, T., Gowda, S., Aylln, M. A., Albiach-Mart, M. R., Dawson, W. O., 2002a. Mutational analysis of the replication signals in the 3-non translated region of Citrus tristeza virus. Virology 300, 140-152. Satyanarayana, T., Gowda, S., Aylon, M. A., Albiach-Marti, M. R., Rabindram, R., Dawson, W. O. 2002b. The p23 protein of Citrus tristeza virus controls asymmetrical RNA accumulation. J. Virol. 76, 473-483. Satyanarayana, T., Gowda, S., Aylln, M. A., Dawson, W. O., 2003. Frame shift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli. Virology 313, 481-491. Satyanarayana, T., Gowda, S., Aylln, M. A., Dawson, W. O., 2004. Closterovirus bipolar virion: evidence for initiation of assembly by minor coat protein and its restriction to the genomic RNA 5 region. Proc. Natl. Acad. Sci. USA 101, 799-804. Satyanarayana, T., Gowda, S., Boyko, V. P., Albiach-Marti, M. R., Mawassi, M., Navas-Castillo, J., Karasev, A. V., Dolja, V., Hilf, M. E., Lewandowski, D. J., Moreno, P., Bar-Joseph, M., Garnsey, S. M., Dawson, W. O., 1999. An engineered closterovirus RNA replicon and analysis of heterologous terminal sequences for replication. Proc. Natl. Acad. Sci. USA 96, 7433-7438. Satyanarayana, T., Gowda, S., Mawassi, M., Albiach-Marti, M. R., Aylln, M. A., Robertson, C., Garnsey, S. M., Dawson, W. O., 2000. Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly. Virology 278, 253-265. Shivprasad, S., Pogue, G. P., Lewandowski, D. J., Hidalgo, J., Donson, J., Grill, L. K., Dawson, W. O., 1999. Heterologous sequences greatly affect foreign gene expression in tobacco mosaic virus-based vectors. Virology 255, 312-323. Siegel, A., 1983. RNA viruses as cloning vehicles. Phytopathology 73, 775. Siegel, A., 1985. Plant-virus-based vectors for gene transfer may be of considerable use despite a presumed high error frequency during RNA synthesis. Plant Mol. Biol. 4, 327-29. Takahashi, T., Sugawara, T., Yamatsuta, T., Isogai, M., Natsuaki, T., Yoshikawa, N., 2007. Analysis of the spatial distribution of identical and two distinct virus populations differently labeled with cyan and yellow fluorescent proteins in coinfected plants. Phytopathology 97, 1200-1206 Takamatsu, N., Ishikawa, M., Meshi, T., Okada, Y., 1987. Expression of bacterial chloramphenicol acetyl transferase gene in tobacco plants mediated by TMV-RNA. EMBO J. 6, 307-311. Tatineni, S., Gowda, S., Dawson W. O., 2010. Heterologous minor coat proteins of Citrus tristeza virus strains affect encapsidation, but the coexpression of HSP70h and p61 restores encapsidation to wild-type levels. Virology 402, 262-270. Tatineni, S., McMechan A. J., Hein G. L., French R., 2011. Efficient and stable expression of GFP through Wheat streak mosaic virus-based vectors in cereal hosts using a range of cleavage sites: Formation of dense fluorescent aggregates for sensitive virus tracking. Virology 410, 268-281. Tatineni, S., Robertson, C. J., Garnsey, S. M., Bar-Joseph, M., Gowda, S., Dawson, W. O., 2008. Three genes of Citrus tristeza virus are dispensable for infection and movement throughout some varieties of citrus trees. Virology 376, 297-307. Toth, R. L., Chapman, S., Carr, F., Santa Cruz, S., 2001. A novel strategy for the expression of foreign genes from plant virus vectors. FEBS Lett. 489, 215-219. Turpen, T. H., Turpen, A. M., Weinzettl, N., Kumagai, M. H., Dawson, W. O., 1993. Transfection of whole plants from wounds inoculated with Agrobacterium tumefaciens containing cDNA of tobacco mosaic virus. J. Virol. Meth. 42, 227-239. Van Vloten-Doting, L., 1983. Advantages of multiple partite genomes of single-stranded RNA plant viruses in nature, for research and genetic engineering. Plant Mol. Biol. 1, 55-60. Van Vloten-Doting, L., Bol, J. F., Cornelissen, B., 1985. Plant virus-based vectors for gene transfer will be of limited use because of the high error frequency during viral RNA synthesis. Plant Mol. Biol. 4, 323-326. Verch, T., Yusibov, V., Koprowski, H., 1998. Expression and assembly of a full-length monoclonal antibody in plants using a plant virus vector. J. Immunol. Methods 220, 69-75. Verver, J., Wellink, J, Van Lent, J., Gopinath, K., and Van Kammen, A., 1998. Studies on the movement of cowpea mosaic virus using the jellyfish green fluorescent protein. Virology 242, 22-27. Woolaway, K. E., Lazaridis, K., Belsham, G. J., Carter, M. J., Robert, L. O., 2001. The 5 untranslated region of rhopalosiphum padi virus contains an internal ribosome entry site which functions efficiently in mammalian, plant, and insect translation system. J. Virol. 75, 10244-10249.
Example 9
(145) 1. Introduction
(146) Virus-based vectors for expressing foreign genes in plants are routine laboratory tools (Porta and Lomonossoff, 2002 and Gleba et al., 2007), generally developed for short term laboratory experiments in herbaceous plants or for making specialty products in these plants. However, the development of vectors that stably express foreign genes for years has opened up new opportunities in perennial plants (Folimonov et al., 2007, Kurth et al., 2012, Dawson and Folimanova, 2013 and Dolja and Koonin, 2013). Virus-based vectors can be used to modify the existing generation of trees. One such opportunity is the use for field application to protect against disease or to treat infected plants. For example, the rapid spread of devastating disease of citrus, citrus greening also known as huanglongbing (HLB), which is threatening the survival of the citrus industry has changed the Citrus tristeza virus (CTV) vector from a laboratory tool to a potential management strategy for citrus groves (Hodges and Spreen, 2012 and National Research Council, 2010). At this time, the one of the hopes for survival of the Florida citrus industry is the production of resistant or tolerant trees via transgene (http://www.nytimes.com/2013/07/28/science/a-race-to-save-the-orange-by-altering-its-dna.html?pagewanted=all&_r=0). But the time to make, evaluate, and amplify transgenic citrus trees is too long to save the industry. The viral vector can be deployed more quickly and is being considered as an interim approach (National Research Council, 2010).
(147) The HLB disease manifestation requires both the phloem-limited pathogenic bacterium, Candidatus Liberibacter asiaticus (CLas), and phloem feeding Asian citrus psyllid insect vector, Diaphorina citri (Halbert and Manjunath, 2004). The disease can be controlled by suppressing either. Initial efforts have been to control the bacterium, but recent progresses in RNA interference (RNAi) in psyllids provide another possible approach (El-Shesheny et al., 2013, Wuriyanghan and Falk, 2013 and Khan et al., 2013). It is now well-established that double-stranded RNA (dsRNA)-mediated gene silencing mechanism is conserved in many eukaryotes (Geley and Mller, 2004, Gordon and Waterhouse, 2007, Fire, 2007 and Price and Gatehouse, 2008). Plant viral vectors have been utilized in virus-induced gene silencing (VIGS) by exploiting antiviral defense mechanism of the host plants (Ratcliff et al., 1997, Waterhouse et al., 2001 and Lu et al., 2003). The dsRNAs generated by viral RNA polymerases as intermediates during replication specifically are targeted by host defense machinery (Tenllado and Daz-Ruz, 2001 and Weber et al., 2006) thus, RNA viruses are inducers as-well-as targets of inherent RNA silencing machinery (Waterhouse et al., 2001). With VIGS vector carrying sequences of host gene, the defense machinery is targeted against the corresponding host mRNAs.
(148) CTV is a member of the genus Closterovirus of the family Closteroviridae, the largest and the most complex plant viral family. Single-stranded RNA genome of 19.3 kb is encapsidated by two coat proteins (CP) making a long flexuous virions (2000 nm by 10-12 nm) (Bar-Joseph et al., 1979 and Karasev et al., 1995). CTV vector has been shown to be an efficient expression vector capable of expressing more than one foreign gene engineered at different positions in its genome either as extra gene or substitution of some non-essential genes using homologous and heterologous sub-genomic RNA (sgRNA) controller elements (Dawson and Folimanova, 2013 and El-Mohtar and Dawson, 2014). However, plant virus-based vectors are notoriously unstable and tend to revert to wild type, with notable exception of CTV vector which has stably retained a foreign gene for more than a decade in citrus plants (Dawson and Folimanova, 2013). Many of the plant and animal viruses encode one silencing suppressor whereas CTV has been shown to encode three distinct suppressors of RNA silencing (Lu et al., 2004), which potentially protect CTV with such a large RNA genome from antiviral silencing machinery of the perennial woody citrus host. CTV open reading frames (ORFs) p23 and coat protein (CP) suppress the silencing pathway at intra- and inter-cellular level, respectively, while ORF p20, exhibits both at intra- and inter-cellular level silencing (Lu et al., 2004). There were serious concerns whether the CTV-based vector could effectively induce gene silencing. Yet, expression of sequences targeting citrus endogenous phytoene desaturase (PDS) gene by CTV-based vector resulted in photo-bleaching phenotype in citrus, thus demonstrating CTV as a gene silencing vector.
(149) CTV is limited to phloem and phloem-associated cells in citrus trees like CLas bacterium. Since D. citri are phloem feeders, they probe and suck phloem sap and existent alongside including CLas (when feeding on a diseased plant) and there by succor CLas transmission. This coincident cohabitation in the phloem tissue could be exploited to develop a method to combat HLB disease. In our previous study, in vitro topical application of dsRNAs of truncated abnormal wing disc (tAwd) gene to nymphs of D. citri induced wing deformation and reduced survivability in adults, both positively correlated with Awd gene down regulation (El-Shesheny et al., 2013). We hypothesized that; if D. citri could acquire the CLas bacteria from citrus phloem during feeding, it would acquire other components as well present in the phloem sap, such as virions (like virions of phloem limited CTV), virion RNAs, dsRNAs, small RNAs, etc. The objective of this study was to develop a novel method to mitigate HLB disease by controlling its insect vector, D. citri, through CTV-based plant-mediated RNA interference (RNAi). In the present study, gene silencing capabilities of CTV was exploited to express silencing triggers such as dsRNAs (replicative intermediates of both genomic and subgenomic RNAs) and small-interfering RNAs (siRNAs) specific to D. citri endogenous Awd gene in citrus phloem and associated cells. Silencing the Awd gene increased adult mortality and induced malformed wing phenotype which potentially would affect ability of psyllids to vector CLas. CTV-RNAi vector would therefore be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. By virtue of time, labor and cost, CTV-RNAi could be answer to the slow and difficult citrus transgenic approach in mitigating HLB. Besides it could be a valuable tool in functional genomics studies on citrus.
(150) 2. Materials and Methods
(151) 2.1. Plant Material
(152) Nicotiana benthamiana plants were grown under controlled growth-room with temperature of 22-24 C., 16/8 h daylight cycle and 60% humidity. One year old seedlings (approximately two feet tall & stem of a pencil thickness) of Alemow (Citrus macrophylla), Duncan grapefruit (C. paradisi) and Sour orange (C. aurantium) were maintained under a controlled greenhouse conditions at Citrus Research and Education Centre, Lake Alfred, Fla.
(153) 2.2. Citrus Tristeza Virus (CTV)-Based Vectors
(154) The infectious cDNA clone of Citrus tristeza virus (CTV isolate T36; GenBank accession no. AY170468) in the binary vector pCAMBIA-1380 was used as base plasmid for engineering all the constructs used in this study (Satyanarayana et al., 1999, Satyanayanana et al., 2001, Gowda et al., 2005 and El-Mohtar and Dawson, 2014). This plasmid referred to as wild type, CTV-wt, contained CTV genomic RNA between the duplicated 35S promoter of Cauliflower mosaic virus in the 5 end, a ribozyme sequence of Subterranean clover mottle virus satellite RNA at the 3 end. Unique restriction sites, PacI and StuI were engineered at 5 and 3 end, respectively, to ligate the inserts under coat protein (CP) sub-genomic RNA controller element (CE) between ORF-p23 and 3-untranslated region.
(155) To clone truncated fragment of green fluorescent protein (GFP) and generate CTV-tGFP, GFP gene coding fragment corresponding to the nts 4-443 of the 30B-GFP-Cycle 3 (Shivprasad et al., 1999) was amplified by SpeedSTAR HS DNA polymerase (Takara Bio. Inc.) using primers
(156) TABLE-US-00002 GFP-PacI (5-CGAGTTAATTAAGCTAGCAAAGGAGAAGAACTTTTCACTG-3) and GFP-StuI (5-GACAAGGCCTGAGTTATAGTTGTACTCGAGTTTGTGTC-3) & CTV-GFP(Satyanayananaetal.,2001)
as a template. The PCR product was digested with PacI and StuI restriction enzymes and cloned into similarly digested CTV-wt engineered with CTV CP CE and unique PacI and StuI sites to enable ligation of similarly digested tGFP product.
(157) To clone truncated PDS gene (tPDS) and generate CTV-tPDS vector, primers were designed based on C. sinensis PDS gene (Genbank accession no. DQ235261.1). The truncated fragment corresponding to the nucleotides 4-395 of the PDS gene was amplified using total RNA from C. macrophylla as a template by SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Life Technologies Corp.) and primers
(158) TABLE-US-00003 PDS-PacI (5-CGAGTTAATTAAAGCCTTTGCTTCAGCGTTTCTGAAAGTGCTTTC- 3) and PDS-StuI (5-GACAAGGCCTGTCTCATACCAGTTCCCGTCCCCATCTTTCC-3).
The PCR product was digested with PacI and StuI restriction enzymes and cloned into similarly digested CTV-tGFP by replacing tGFP with tPDS fragment.
(159) The truncated fragment corresponding to the nucleotides 4-462 of putative abnormal wing disc-like protein (Awd) gene (Genbank accession no. DQ673407.1) of D. citri was amplified from the total RNA isolated from the D. citri by SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Life Technologies Corp.) using the primers
(160) TABLE-US-00004 Awd-PacI (5-CGAGTTAATTAAGCCGAACCCAAGGAAAGAACTTTTCTCATG-3) and Awd-StuI (5-GACAAGGCCTTTATTCATAGATCCAGGATTCACTGGCATTTG-3).
The PCR product was digested with PacI and StuI restriction enzymes and cloned into similarly digested CTV-tPDS vector plasmid by replacing tPDS with tAwd fragment.
(161) 2.3. Agroinfiltration of CTV Constructs into N. benthamiana
(162) Procedures for agroinfiltration of CTV constructs into N. benthamiana was followed as described previously (Gowda et al., 2005, Ambrs et al., 2011 and El-Mohtar and Dawson, 2014). ORF p22 silencing suppressor from Tomato chlorosis Crinivirus (ToCV) ligated in place of hygromycin gene was used in the binary vector pCAMBIA1380 to help establish the CTV infection in the infiltrated leaves (El-Mohtar and Dawson, 2014).
(163) 2.4. CTV Virion Isolation and Inoculation to Citrus
(164) Systemic leaves from N. benthamiana that tested positive for CTV by ELISA, were harvested after 4-6 weeks post infiltration and used to isolate CTV virions for bark-flap inoculation of C. macrophylla as described previously (Gowda et al., 2005 and Robertson et al., 2005). An additional ultracentrifugation step at 50,000 rpm for 60 min at 4 C. was carried out in Beckman Optima TL 100 to further concentrate the virions.
(165) 2.5. Large RNA Northern Blot Hybridization
(166) Total RNA was extracted from 100 mg of C. macrophylla tissues using RNeasy Mini Kit (Qiagen) and used in large RNAs Northern hybridizations as described previously (Satyanarayana et al., 1999). The negative-stranded riboprobe with digoxigenin-labeled UTP specific to 3-untranslated region of CTV genomic RNA (273 nucleotide long) was used for hybridization.
(167) 2.6. Small RNA Isolation
(168) Total RNAs were extracted from 1 g of C. macrophylla tissue using TRIzol Reagent (Life Technologies Corp.) and was further purified by extracting 1-2 times with Phenol:Chloroform:IsoAmylAlcohol (25:24:1) (Chomczynski and Sacchi, 1987) and separated into large and small RNA fractions by following mirVana miRNA Isolation Kit (Life Technologies Corp.). To enrich small RNAs, the RNA sample was brought to 25% ethanol concentration. The lysate/ethanol mixture was passed through a glass-fiber filter to immobilize large RNAs and the ethanol concentration of the filtrate was increased to 55%, and passed through a second glass-fiber filter to immobilize small RNAs. Both glass-fiber filters were washed to elute small and large RNAs separately.
(169) 2.7. Small RNA Northern Blot Hybridization
(170) Detection of small interfering RNAs (siRNAs) by Northern blot was followed as described in the manual of mirVana miRNA Isolation Kit (Life Technologies Corp.) with few modifications. One g small RNA enriched sample was run on a 15% denaturing polyacrylamide gel (urea/TBE) at 150 volts for 90-120 min or until the dye front reaches bottom of the gel. Semi-dry method was employed to transfer small RNAs to positively charged nylon membrane at 100 mA for 60 min and the RNA was immobilized on membrane by UV crosslinking. Full-length cDNA sequence of GFP (720 bp), PDS (1662 bp) and Awd (462 bp) genes were cloned into pGEM-T Easy Vector (Promega) and negative-stranded DIG-labeled riboprobes were generated using DIG RNA labeling mix (Roche Applied Science) and T7 RNA polymerase. These probes were further hydrolyzed into 50-100 nt long RNA pieces by treating with sodium carbonate buffer as described (Dalmay et al., 2000) and used for hybridization. Prehybridization and hybridization were done at 41 C. using ULTRAhyb solution (Life Technologies Corp.) of 10 mL per 100 cm.sup.2 of membrane. The rest of the Northern protocol was followed as described previously (Satyanarayana et al., 1999) except the high stringency wash at 41 C. Synthetic 5-DIG-labeled oligonucleotide of 18 and 21 mer, which ran as 20 and 22 nucleotides respectively, were used as siRNA size markers in small RNA Northern blot hybridizations.
(171) 2.8. Reverse Transcription Quantitative PCR (RT-qPCR) for Plant Tissue
(172) The large RNA isolated from mirVana miRNA Isolation Kit was used in SYBR Green-I based RT-qPCR to measure the level of down-regulation of PDS mRNAs due to gene silencing by CTV-based silencing vector in comparison to CTV-wt control plants. Citrus actin (ACT) gene expression was used as an internal control to normalize gene expressions among treatments for RT-qPCR reactions. The level of PDS mRNA from control plants infected with CTV-wt was arbitrarily set to a value of one (1) and the level of the PDS mRNA from plants infected with CTV-tPDS was estimated as a relative number to this reference value (Hajeri et al., 2011). Similar procedures were followed to measure the level of down-regulation of GFP mRNAs from N. benthamiana line 16c due to gene silencing by CTV-tGFP vector.
(173) 2.9. Insect Bioassay
(174) Asian citrus psyllid, D. citri used in this study were collected from citrus groves, Polk Co., Fla. and maintained on Valencia sweet orange, C. sinensis (L.) (Osbeck), at 281 C., 602% RH and 16/8 h photoperiod. One year old C. macrophylla seedlings (approximately two feet tall & stem of a pencil thickness) were used for insect bioassay. In feeding experiments, each of the C. macrophylla seedling infected with either CTV-tAwd or CTV-wt control was exposed to 100 D. citri adults caged in insect rearing cages (30 in.15.5 in.15 in.) and kept in growth rooms in conditions as described above. One-month post exposure, all adults and nymphs were removed and egg masses were left. Two weeks later, newly emerged adults were counted, collected and examined for wing malformation and photographed using a Canon Power Shot S3IS digital camera, Leica M3Z stereomicroscope. Five replicative treatments for each experiment were used and compared statistically by the use of t test the number of adults with malformed wings to total adults.
(175) 2.10. Gene Expression Analysis in D. citri
(176) Total RNA was isolated using TRIzol Reagent (Life Technologies Corp.) from total of 10 D. citri for each treatment. Single-stranded RNA was purified from the total RNA by ssDNA/RNA Clean & Concentrator (Zymo Research) and expression levels of Awd was determined using SYBR Green-I based RT-qPCR in triplicate for each biological replicate. Alpha-tubulin (TubA) was used as a non-target gene control and we normalized gene expression of actin (Act) to compare the relative gene expression levels among treatments. The level of Awd transcripts in D. citri adults exposed to CTV-wt plants was arbitrarily set to the value one and the level of Awd transcripts in CTV-tAwd were presented as relative value to this reference value (Hajeri et al., 2011). Means and standard deviation of experiments in triplicate are presented.
(177) 3. Results
(178) 3.1. CTV-Induced Gene Silencing in N. benthamiana Line 16c
(179) N. benthamiana is a non-natural host of CTV. To demonstrate the gene silencing capabilities of CTV, transgene green fluorescent protein (GFP) of N. benthamiana line 16c was silenced by CTV-VIGS vector carrying truncated GFP (tGFP; Supplementary data 1a). We engineered tGFP into CTV to express 400 nucleotides of GFP under CTV CP sgRNA controller element (CE) using unique Pad and StuI restriction sites (
(180) 3.2. CTV-Induced Gene Silencing in Citrus
(181) To test the silencing induced by CTV in citrus, its natural host, citrus endogenous gene, phytoene desaturase (PDS) was targeted by CTV-VIGS vector carrying truncated PDS (tPDS; below). We engineered tPDS into CTV to express 392 nucleotides of PDS under CTV CP sgRNA CE using unique PacI and StuI restriction sites (
(182) Graft-transmissibility of CTV-VIGS vector and photo-bleaching phenotype to other citrus cultivars was tested. Source plant, C. macrophylla, harboring CTV-tPDS vector, used for side and leaf graft inoculations to Duncan grapefruit (C. paradisi) and Sour orange (C. aurantium), which induced photo-bleaching phenotype in the newly emerged systemic leaves (
(183) 3.3. CTV-Based Citrus Plant-Mediated RNAi in Phloem-Sap Sucking Insect D. citri
(184) The results presented above suggested that CTV vector could be successfully used as an efficient silencing vector. We designed CTV-RNAi vector, CTV-tAwd, to express 459 nucleotides sequence of D. citri Awd gene (tAwd; below) in citrus similar to CTV-tPDS (
(185) Alpha-tubulin (TubA) and actin (Act) were used as a non-target control gene and internal control gene, respectively to quantify Awd expression level between the treatments by t-test analysis. TubA expression did not change between treatments while Awd gene expression was down-regulated approximately 1.5-2-fold in wing-malformed adults of D. citri compared to control D. citri (
(186) 4. Discussion
(187) During replication, CTV accumulates abundant amounts of genomic and sub-genomic (sg) replicative intermediates as double-stranded RNAs (Dodds and Bar-Joseph, 1983 and Hilf et al., 1995) and copious amounts of siRNAs (Scott and Dawson, unpublished), the latter possibly the consequence of antiviral silencing activity. The sgRNAs for ORFs closer to the 3-ends accumulated in abundance compared to ORFs away from the 3-end (Navas-Castillo et al., 1997). Additionally, the sgRNAs for p23, p20 and CP with dedicated sgRNA controller elements are produced in higher abundance compared to other sgRNAs (Hilf et al., 1995). It is thus possible to augment the abundance of silencing triggers, such as dsRNAs and siRNAs, by engineering sequence of interest at the 3 end and foster CTV as a gene silencing vector. We have demonstrated the gene silencing capabilities of CTV vectors by silencing transgene GFP in N. benthamiana line 16c and endogenous gene PDS in citrus. Thus, CTV-based VIGS vector could be a useful tool for reverse genetics to study the functions of citrus genes involved in basic cellular functions, metabolic pathways, developmental biology, and plant-microbe interactions.
(188) The observations that the three RNA silencing suppressors do not prevent CTV-induced gene silencing, that CTV accumulates to high levels in phloem and phloem-associated cells, that CTV produces large amounts of dsRNAs, and that D. citri nymphs suck large amounts of fluid from the phloem of young shoots encouraged us to target psyllid genes using CTV-based RNAi vector.
(189) Bt (Bacillus thuringiensis) toxin expressing transgenic plants have been effectively controlling chewing insects such as lepidopteran and coleopteran pests (Naranjo, 2011 and Shelton et al., 2002). However, for phloem sap-sucking insects, such as psyllids, aphids, whiteflies, planthoppers and plant bugs, pesticides are still the major method to control (Walker and Allen, 2010 and Gatehouse and Price, 2011). Therefore, in order to control phloem sap-sucking insects, novel methodologies such as RNAi-based technology must be considered in order to rein in economic and environmental damage (Zhang et al., 2013).
(190) The two major challenges in deploying RNAi-based technology for pest control are effective target gene selection and reliable dsRNA delivery. We targeted D. citri endogenous Awd gene for silencing; because, inhibition of the Awd gene would induce altered wing development, a visible phenotype and down regulation of wing development of D. citri would impair its ability to fly and potentially limit the successful vectoring of the bacterial pathogen between citrus trees in the grove. Once the target gene is identified, the reliable and convenient dsRNA delivery system is prerequisite for pest control at field level. Delivery of dsRNA could be achieved by micro-injection, micro-application (topical application), soaking or by feeding as a dietary component (El-Shesheny et al., 2013 and Zhang et al., 2013). However, these methods can only be used in laboratory experiments. Spraying dsRNA targeting specific insect pest could be a viable approach at the field level (Gan et al., 2010), if dsRNA can be cheaply mass produced. Expression of dsRNAs in transgenic plants has been shown to induce RNAi effects on target insects (Huang et al., 2006, Baum et al., 2007, Mao et al., 2007 and Gottula and Fuchs, 2009). However, transgenic approach in citrus is slow and difficult. By virtue of its time, labor and cost efficiency, transient expression system of CTV-based plant-mediated RNAi provides major advantage over stable transformation in citrus since the CTV vector has been shown to be stable for several years in trees. This remarkable stability of CTV vector could be used in silencing insect genes or other pest genes directly in the field as an integrated pest management practice. Graft-transmissibility of CTV-tPDS vector and its silencing triggers to other citrus cultivars suggested that the silencing trait against insect pests induced by CTV-RNAi vector could also be transferable to other commercial cultivars of citrus through vegetative grafting which is not possible with transgenic lines with such traits.
(191) Even in case of preference of transgenic approach over CTV-based RNAi, the CTV vector would act as a tool in fast-track screening of candidate genes/sequences related to insect's survivability, flight, or reproduction and ultimately affect the vectoring potential of insect vector in developing transgenic citrus. Thus CTV-based silencing vector would hasten the process of selecting right candidate sequences for stable transformation. On the other hand, CTV-based silencing vector could be used as an interim solution in mitigating the HLB disease manifestation at present in the field. The species specificity is the critical issue that needs to be addressed before using RNAi-based pest control measures in the field. But RNAi technology has the potential to address this problem by producing sequence specific and species specific RNAi pesticide (Whyard et al., 2009).
(192) 5. Conclusions
(193) Three RNA silencing suppressors of CTV do not prevent CTV from inducing gene silencing in Citrus and N. benthamiana transgenic line 16c. CTV-based plant-mediated RNAi induces gene silencing in phloem-sap sucking insect D. citri, which vectors bacterial disease HLB. Thus CTV-based RNAi vector could be a valuable tool for fast-track screening candidate sequences in developing transgenic citrus against citrus pest and diseases. Because of the slow and difficult transgenic methodology in citrus, CTV-RNAi vector could be an interim solution in mitigating the spread of HLB disease in the field.
Genes Related to Example 9
(194) TABLE-US-00005 (a)tGFP GCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGA ATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTG AAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACT GGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGG TGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTT TCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTC AAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGA TACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATG GAAACATTCTCGGACACAAACTCGAGTACAACTATAACTC (b)tPDS AGCCTTTGCTTCAGCGTTTCTGAAAGTGCTTTCAACTTGCGATATGGTTT CCGAGATAGTGAACCGATGGGTCAGAGCCTGAAAATTCGAGTTAAAACGA GGACAAGGAAGGGTTTCTGTCCTTCGAAGGCGGTTTGTGTGGACTACCCA AGACCAGATATTGATAATACATCTAATTTCTTGGAAGCTGCTTACTTATC TTCGTCATTTCGTACTTCTCCTCGTCCTTCTAAGCCGTTGAAAGTTGTAA TTGCTGGTGCAGGTTTGGCTGGTTTATCAACTGCAAAATATTTGGCAGAT GCAGGCCACAAGCCTTTGTTACTGGAAGCAAGAGATGTTCTAGGTGGAAA GATAGCTGCCTGGAAAGATGGGGACGGGAACTGGTAGAGAC (c)tAwd GCCGAACCCAAGGAAAGAACTTTTCTCATGATCAAGCCCGATGGCGTTCA AAGAGGACTTGTGGGAAACATCATCAAACGCTTTGAAGACAAAGGCTTCA AATTGGTGGCCATGAAATTCGTTTGGCCATCCGAAGAACTTCTGAAGCAA CACTACTCAGATTTGGCCACCAAACCTTTCTTCCCTGGTCTTGTCAAATA CATGTCATCTGGACCTGTTGTTCCTATGGTGTGGGAAGGATTGAACATTG TCAAAACTGGACGTGTGATGCTTGGAGCCACCAACCCTGCTGACTCTGCC CCAGGAACTGTCAGAGGAGACCTCTGCATCCAAGTTGGAAGAAACATCAT GCATGGATCAGACTCTGTTGAATCTGCAAAGAAAGAAATTGCCTTATGGT TCACTGAGAAAGAAGTCATTGGATGGACAAATGCCAGTGAATCCTGGATC TATGAATAA
REFERENCES
(195) Ambrs, S., El-Mohtar, C., Ruiz-Ruiz, S., Pena, L., Guerri, J., Dawson, W. O., Moreno, P., 2011. Agroinoculation of Citrus tristeza virus causes systemic infection and symptoms in the presumed nonhost Nicotiana benthamiana. Mol. Plant-MicrobeInteract. 24, 1119-1131. Bar-Joseph, M., Garnsey, S. M., Gonsalves, D., 1979. The closteroviruses. A distinctgroup of elongated plant viruses. Adv. Virus Res. 25, 93-168. Baum, J. A., Bogaert, T., Clinton, W., Heck, G. R., Feldmann, P., Ilagan, O., Johnson, S., Plaetinck, G., Munyikwa, T., Pleau, M., Vaughn, T., Roberts, J., 2007. Con-trol of coleopteran insect pests through RNA interference. Nat. Biotechnol. 25, 1322-1326. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159. Dalmay, T., Hamilton, A. J., Mueller, E., Baulcombe, D. C., 2000. Potato virus X ampli-cons in Arabidopsis mediate genetic and epigenetic gene silencing. Plant Cell 12, 369-380. Dawson, W. O., Folimanova, S., 2013. Virus-based transient expression vectors forwoody crops: a new frontier for vector design and use. Ann. Rev. Phytopathol. 51, 321-337. Dodds, J. A., Bar-Joseph, M., 1983. Double-stranded RNA from plants infected with closteroviruses. Phytopathology 73, 419-423. Dolja, V. V., Koonin, E. V., 2013. The closterovirus-derived gene expression and RNA interference vectors as tools for research and plant biotechnology. Front. Micro-biol. 4, 83. El-Mohtar, C., Dawson, W. O., 2014. Exploring the limits of vector construction based on Citrus tristeza virus. Virology 448, 274-283. El-Shesheny, I., Hajeri, S., El-Hawary, I., Gowda, S., Killiny, N., 2013. Silencing abnor-mal wing disc gene of the Asian Citrus Psyllid, Diaphorina citri disrupts adultwing development and increases nymph mortality. PLoS ONE 8 (5), e65392. Fire, A. Z., 2007. Gene silencing by double-stranded RNA (Nobel lecture). Cell DeathDiffer. 14, 1998-2012. Folimonov, A. S., Folimonova, S. Y., Bar-Joseph, M., Dawson, W. O., 2007. A stable RNAvirus-based vector for citrus trees. Virology 368, 205-216. Gan, D., Zhang, J., Jiang, H., Jiang, T., Zhu, S., Cheng, B., 2010. Bacterially expressed dsRNA protects maize against SCMV infection. Plant Cell Rep. 29, 1261-1268. Gatehouse, J. A., Price, D. R. G., 2011. Protection of crops against insect pests using RNA interference. Insect Biotechnol. 2, 145-168. Geley, S., Mller, C., 2004. RNAi: ancient mechanism with a promising future. Exp. Gerontol. 39, 985-998. Gleba, Y., Klimyuk, V., Marillonnet, S., 2007. Viral vectors for the expression of pro-teins in plants. Curr. Opin. Biotechnol. 18, 134-141. Gordon, K. H. J., Waterhouse, P. M., 2007. RNAi for insect-proof plants. Nat. Biotechnol. 25, 1231-1232. Gottula, J., Fuchs, M., 2009. Toward a quarter century of pathogen-derived resis-tance and practical approaches to plant virus disease control. Adv. Virus Res. 75, 161-183. Gowda, S., Satyanarayana, T., Robertson, C. J., Garnsey, S. M., Dawson, W. O., 2005. Infection of citrus plants with virions generated in Nicotiana benthamiana plantsagroinfiltrated with binary vector based Citrus tristeza virus. In: Hilf, M. E., Duran-Vila, N., Rocha-Pena, M. A. (Eds.), Proceedings of the 16th Conference of the International Organization of Citrus Virologists. IOCV, Riverside, Calif., pp. 23-33. Hajeri, S., Ramadugu, C., Manjunath, K., Ng, J., Lee, R., Vidalakis, G., 2011. In vivo generated Citrus exocortis viroid progeny variants display a range of phenotypes with altered levels of replication, systemic accumulation and pathogenicity. Virology 417, 400-409. Halbert, S. E., Manjunath, K. L., 2004. Asian citrus psyllid (Sternorrhyncha: Psyllidae) and greening disease of citrus: a literature review and assessment of risk in Florida. Fla. Entomol. 87, 330-353. Hilf, M. E., Karasev, A. V., Pappu, H. R., Gumpf, D. J., Niblett, C. L., Garnsey, S. M., 1995. Characterization of citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208, 576-582. Hodges, A. W., Spreen, T. H., 2012. EDIS document FE903, a publication of the Food and Resource Economics Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences. University of Florida, Gainesville, Fla. http://edis.ifas.ufl.edu/fe903 Huang, G., Allen, R., Davis, E. L., Baum, T. J., Hussey, R. S., 2006. Engineering broadroot-knot resistance in transgenic plants by RNAi silencing of a conserved and essential root-knot nematode parasitism gene. Proc. Natl. Acad. Sci. U.S.A. 103, 14302-14306. Karasev, A. V., Boyko, V. P., Gowda, S., Nikolaeva, O. V., Hilf, M. E., Koonin, E. V., Niblett, C. L., Cline, K., Gumpf, D. J., Lee, R. F., Garnsey, S. M., Lewandowski, D. J., Dawson, W. O., 1995. Complete sequence of the citrus tristeza virus RNA genome. Virology 208, 511-520. Khan, A. M., Ashfaq, M., Kiss, Z., Khan, A. A., Mansoor, S., Falk, B. W., 2013. Use of recombinant tobacco mosaic virus to achieve RNA interference in plants against the citrus mealybug, Planococcus citri (Hemiptera: Pseudococcidae). PLoS ONE 8(9), e73657. Kurth, E. G., Peremyslov, V. V., Prokhnevsky, A. I., Kasschau, K. D., Miller, M., Carrington, J. C., Dolja, V. V., 2012. Virus-derived gene expression and RNA interference vector for grapevine. J. Virol. 86, 6002-6009. Lu, R., Folimonov, A., Shintaku, M., Li, W. X., Falk, B. W., Dawson, W. O., Ding, S. W., 2004. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome. Proc. Natl. Acad. Sci. U.S.A. 101, 15742-15747. Lu, R., Martin-Hernandez, A. M., Peart, J. R., Malcuit, I., Baulcombe, D. C., 2003. Virus-induced gene silencing in plants. Methods 30, 296-303. Mao, Y. B., Cai, W. J., Wang, J. W., Hong, G. J., Tao, X. Y., Wang, L. J., Huang, Y. P., Chen, X. Y., 2007. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotechnol. 25, 1307-1313. Naranjo, S. E., 2011. Impacts of Bt transgenic cotton on integrated pest management. J. Agric. Food Chem. 59, 5842-5851. National Research Council, 2010. Strategic Planning for the Florida Citrus Industry: Addressing Citrus Greening Disease. The National Academic Press, Washington, D.C., pp. 84-86 (Chapter 3). Navas-Castillo, J., Albiach-Mart, M. R., Gowda, S., Hilf, M. E., Garnsey, S. M., Dawson, W. O., 1997. Kinetics of accumulation of Citrus tristeza virus RNAs. Virology 228, 92-97. Porta, C., Lomonossoff, G. P., 2002. Viruses as vectors for the expression of foreign sequences in plants. Biotechnol. Genet. Eng. Rev. 19, 245-291. Price, D. R., Gatehouse, J. A., 2008. RNAi-mediated crop protection against insects. Trends Biotechnol. 26, 393-400. Ratcliff, F., Harrison, B. D., Baulcombe, D. C., 1997. A similarity between viral defense and gene silencing in plants. Science 276, 1558-1560. Robertson, C. J., Garnsey, S. M., Satyanarayana, T., Folimonova, S., Dawson, W. O., 2005. Efficient infection of citrus plants with different cloned constructs of Cit-rus tristeza virus amplified in Nicotiana benthamiana protoplasts. In: Hilf, M. E., Duran-Vila, N., Rocha-Pena, M. A. (Eds.), Proceedings of the 16th Conference of the International Organization of Citrus Virologists. IOCV, Riverside, Calif., pp. 187-195. Satyanarayana, T., Gowda, S., Boyko, V. P., Albiach-Mart, M. R., Mawassi, M., Navas-Castillo, J., Karasev, A. V., Dolja, V., Hilf, M. E., Lewandowski, D. J., Moreno, P., Bar-Joseph, M., Garnsey, S. M., Dawson, W. O., 1999. An engineered closterovirus RNAreplicon and analysis of heterologous terminal sequences for replication. Proc. Natl. Acad. Sci. U.S.A. 96, 7433-7438. Satyanayanana, T., Bar-Joseph, M., Mawassi, M., Albiach-Mart, M. R., Aylln, M. A., Gowda, S., Hilf, M. E., Moreno, P., Garnsey, S. M., Dawson, W. O., 2001. Amplifica-tion of Citrus tristeza virus from a cDNA clone & infection of citrus trees. Virology 280, 87-96. Shelton, A. M., Zhao, J. Z., Roush, R. T., 2002. Economic, ecological, food safety, and social consequences of the deployment of Bt transgenic plants. Annu. Rev. Ento-mol. 47, 845-881. Tenllado, F., Daz-Ruz, J. R., 2001. Double-stranded RNA-mediated interference with plant virus infection. J. Virol. 75, 12288-12297. Walker, W. B., Allen, M. L., 2010. Expression and RNA interference of salivary poly-galacturonase genes in the tarnished plant bug, Lygus lineolaris. J. Insect Sci. 10, 1-13. Waterhouse, P. M., Wang, M. B., Lough, T., 2001. Gene silencing as an adaptive defense against viruses. Nature 411, 834-842. Weber, F., Wagner, V., Rasmussen, S. B., Hartmann, R., Paludan, S. R., 2006. Double-stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J. Virol. 80, 5059-5064. Whyard, S., Singh, A. D., Wong, S., 2009. Ingested double stranded RNAs can act as species-specific insecticides. Insect Biochem. Mol. Biol. 39, 824-832. Wuriyanghan, H., Falk, B. W., 2013. RNA interference towards the potato psyllid, Bactericera cockerelli, is induced in plants infected with recombinant Tobaccomosaic virus (TMV). PLoS ONE 8 (6), e66050. Zhang, H., Li, H-C., Miao, X-X., 2013. Feasibility, limitation and possible solutions of RNAi-based technology for insect pest control. Insect Sci. 20, 15-30.
(196) While various disclosed embodiments have been described above, it should be understood that they have been presented by way of example only, and not limitation. Numerous changes to the subject matter disclosed herein can be made in accordance with this Disclosure without departing from the spirit or scope of this Disclosure. In addition, while a particular feature may have been disclosed with respect to only one of several implementations, such feature may be combined with one or more other features of the other implementations as may be desired and advantageous for any given or particular application.
(197) Thus, the breadth and scope of the subject matter provided in this Disclosure should not be limited by any of the above explicitly described embodiments. Rather, the scope of this Disclosure should be defined in accordance with the following claims and their equivalents.
(198) The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms a, an, and the are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms including, includes, having, has, with, or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term comprising.
(199) Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which embodiments belong. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.
(200) The teachings of any patents, patent applications, technical or scientific articles or other references are incorporated herein in their entirety to the extent not inconsistent with the teachings herein.