Therapeutic Use for Alpha1 Proteinase Inhibitor in Hematopoiesis
20180003699 · 2018-01-04
Inventors
Cpc classification
A61P37/06
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
G01N2800/52
PHYSICS
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
A previously unrecognized fundamental property of α.sub.1PI is to regulate the phenotypic composition of circulating and tissue-associated cells derived from hematopoietic stem cells. The present invention comprises screening for various unmodified and modified α.sub.1PI's which are useful in the treatment of abnormalities in the number of cells of myeloid or lymphoid lineage that are associated with HIV-1 infection, microbial infection, leukemia, solid tumor cancers, atherosclerosis, autoimmunity, stem cell transplantation, organ transplantation, and other diseases affected by cells of the immune system. The interaction of α.sub.1PI with its receptors, HLE.sub.cs and LRP, influences the level of cells of different lineages. Genetic and proteolytic modification of α.sub.1PI is used to target these receptors to increase or decrease specific cell populations, as needed, in the various disease states.
Claims
1.-40. (canceled)
41. A method for treating a subject suffering from a disease characterized by abnormalities in the number of cells of myeloid or lymphoid lineage comprising administering to a subject in need of such treatment a pharmaceutical composition an amount effective to treat said subject of an α1 proteinase inhibitor (α1 PI).
42. The method of claim 41 wherein said α1 proteinase inhibitor is active α1 PI.
43. The method of claim 41 wherein said α1 proteinase inhibitor is inactive α1 PI.
44. The method of claim 41 wherein said α1 PI is produced recombinantly.
45. The method of claim 42 wherein said disease characterized by abnormalities in the number of cells of lymphoid lineage is a member selected from the group consisting of immune deficiency, HIV infection, solid tumor cancers, atherosclerosis and tissue transplantation.
46. The method of claim 43 wherein said disease characterized by abnormalities in the number of cells of myeloid lineage is a member selected from the group consisting of inflammation, microbial infection, stem cell transplantation and neutropenia.
47. The method of claim 44 wherein said pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.
48. The method of claim 47 wherein said pharmaceutical composition is administered parenterally.
49. The method of claim 48 wherein said pharmaceutical composition is administered by infusion.
50. The method of claim 44 wherein said recombinant α1 PI is administered by ingestion.
51. The method of claim 46 wherein said cells of myeloid lineage are selected from the group consisting of neutrophils, monocytes and dendritic cells.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0017]
[0018]
[0019]
[0020]
DETAILED DESCRIPTION OF THE INVENTION
Definitions:
[0021] Human α.sub.1PI—Alpha.sub.1-Proteinase Inhibitor (Human) is a sterile, stable, lyophilized preparation of highly purified human alpha.sub.1-proteinase inhibitor (α.sub.1PI) also known as alpha.sub.1-antitrypsin derived from human plasma. There are three products of alpha.sub.1-Proteinase Inhibitor (Human) that are currently FDA approved for treatment. Prolastin® (www.prolastin.com) produced by Talecris Biotherapeutics (www.talecris.com), Zemaira® (www.zemaira.com) produced by ZLB Behring (www.zlbbehring.com), and Aralast™ (www.aralast.com) produced by Baxter Healthcare Corp.
[0022] Active α.sub.1PI—the fraction of α.sub.1PI in plasma or other fluids that has the capacity to inhibit elastase activity.
[0023] Inactive α.sub.1PI—the fraction of α.sub.1PI in plasma or other fluids that does not have the capacity to inhibit elastase activity. Active α.sub.1PI may be inactivated by proteolytic cleavage, proteinase complexing, antibody complexing, or oxidation.
[0024] Genetically modified α.sub.1PI—active α.sub.1PI synthesized from the cDNA encoding human α.sub.1PI which has been modified by site-directed mutagenesis. There are no current recombinant products that have been FDA approved for treatment.
[0025] Proteolytically modified α.sub.1PI—active or genetically modified human π.sub.1PI which has been further modified by limited proteolysis to generate fragments. Proteolytic modification inactivates α.sub.1PI.
[0026] Pharmaceutical Composition—When formulated in a pharmaceutical composition, the therapeutic compound of the invention can be admixed with a pharmaceutically acceptable carrier or excipient. The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are “generally regarded as safe”, e.g., that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a statement government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and, more particularly, in humans. The term“carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin. [0027] 1. Treatment population: Active α.sub.1PI promotes migration of lymphocytes and monocytic cells expressing HLE.sub.cs (Bristow et al., 2003) (Examples 1-3 below). Inactive α.sub.1PI promotes migration of neutrophils and cells expressing the LDL-receptor related protein, LRP (Kounnas et al., 1996; Weaver et al., 1997), Treatment with active human α.sub.1PI is indicated in individuals manifesting abnormal numbers of functional lymphocytes, monocytic cells, or dendritic cells such as in HIV-1 disease, stem cell transplantation, solid organ transplantation, autoimmune exacerbations, diabetes, leukemia, lymphoma, solid tumors, and, atherosclerosis. Treatment with inactive human α.sub.1PI is indicated in individuals manifesting abnormal numbers of functional granulocytic, monocytic cells, dendritic, eosinophilic, or basophilic cells such as in microbial infection, neutropenia, and immunosuppressed patients. Treatment outcome is determined as described below in Section 7 of the Detailed Description. [0028] 2. Treatment regimen: According to the Prolastin® Product Monograph (www.prolastin.com/pdf/prolastin_monograph.pdf), the Zemaira® prescribing information literature, and the Aralast™ prescribing information, the recommended dosage for α.sub.1PI is repeated weekly infusions of 60 mg/kg at a rate of 0.08 ml/kg/minute leading to the historical target threshold of 11 μM α.sub.1PI in serum. The ideal blood threshold is 35 μM α.sub.1PI, but this level has not been achieved therapeutically. Delivery is traditionally by infusion, but recombinant α.sub.1PI is also produced for ingestion (Chowanadisai et al., 2003),
[0029] The specific activity of Zemaira® is 70%, Prolastin® is 35%, and Aralast™ is 55% where specific activity is defined as inhibition of porcine pancreatic elastase (PPE) as described in the package insert. Thus, the recommended dose of Zemaira® α.sub.1PI may be stated as 42 mg/kg active α.sub.1PI, Prolastin® as 21 mg/kg, and Aralast™ as 33 mg/kg active α.sub.1PI. Conversely, the inactive fraction of Zemaira® is 30% or 18 mg/kg, of Prolastin® is 65% or 39 mg/kg, and of Aralast is 45% or 27 mg/kg
[0030] The dosage of genetically modified α.sub.1PI is determined by its capacity to inhibit PPE as described in Section 6 of the Detailed Description (see also, U.S. Pat. No. 6,887,678). In accordance with the recommended treatment regimen using wild-type α.sub.1PI, subjects are infused with genetically modified α.sub.1PI at a dosage that is in the range of 1 to 420 mg/kg active α.sub.1PI, with a target blood threshold of 35 μM genetically modified α.sub.1PI. In some cases, either active or genetically modified α.sub.1PI are further modified by limited proteolytic cleavage to generate fragments that are chemotactic for myeloid-lineage cells. For example, in microbial infections that attend neutropenia, proteolytically modified α.sub.1PI is used to recruit neutrophils into infected tissue. In this case, individuals are infused with proteolytically modified α.sub.1PI at the concentration that is equivalent to 39 mg/kg inactive α.sub.1PI. In addition to being monitored for PPE inhibitory activity, proteolytically modified α.sub.1PI is screened as described in Section 3.2 of the Detailed Description for its capacity of to induce receptor capping and cell motility of myeloid-lineage blood cells such as neutrophils. [0031] 3. Recombinant α.sub.1PI: In addition to plasma-derived α.sub.1PI, recombinant α.sub.1PI has the capacity to mobilize progenitor cells. A bioengineered form of α.sub.1PI has been shown to partition into two cleavage fragments (Jean et al., 1998), and an α.sub.1PI-insulin-like growth factor chimera has been shown to induce chemotaxis (Sandoval et al., 2003). Modifications of recombinant α.sub.1PI provide an improvement specific to HIV-1 and other diseases for mobilization of specific progenitor cells.
[0032] 3.1 Structural features of α.sub.1PI: The following represents the full length amino acid sequence for α.sub.1PI (accession # K01396) including the 24 aa signal peptide:
TABLE-US-00001 -24 MPSSVSWGIL LLAGLCCLVP VSLA 1 EDPQGDAAQK TDTSHHDQDH FITNKITPNL AEFAFSEYRQ LAHQSNSTNI 51 FFSPVSIATA FAMLSLGTKA DTHDETLEGL NFNLTEIPEA QIHEGFQELL 101 RTLNQPDSQL QLTTGNGLFL SEGLKLVDKF LEDVKKLYHS EAFTVNFGDT 151 EEAKKQLNDY VEKGTQGKIV DLVKELDRDT VFALVNYIFF KGKWERPFEV 201 KDTEEEDFHV DQVTTVKVPM MKRLGMFNIQ HCKKLSSWVL LMKYLGNATA 251 IFFLPDEGKL QHLENELTHD IITKFLENED RRSASLHLPK LSITGTYDLK 301 SVLGQLGITK VFSNGADLSG VTEEAPLKLS KAVHKAVLTI DEKGTEAAGA 351 MFLEAIPMSI PPEVKFNKPF VFLMIEQNIK SPLFMGKVVN PTQK
[0033] The known Asn-linked carboxylation sites (denoted in bold underlined letters) are found at aa 46, 83, and 247 (Nukiwa et al., 1986; Jeppsson et al., 1985). The oligosaccharide structure at each site is either tri-antenary or bi-antenary, and the various combinations give the protein a characteristic electrophoretic charge denoted as phenotypic subtypes of the four common genotypic alleles, M1A, M1V, M2, and M3.
[0034] The frequencies in US Caucasians of M1A, M1V, M2, and M3 are 0.20-0.23, 0.44-0.49, 0.1-0.11, and 0.14-0.19, respectively, accounting for 95% of this population (Jeppsson et al., 1985). M1A is thought to be the oldest variant, and M1V has a single aa substitution, at position 213, Ala to Val. The M3 allele has a single aa difference with M1V, Glu to Asp at position 376. The M2 allele has a single aa difference with M3, Arg to His at position 101.
[0035] More than a hundred genotypic alleles have been identified, but except for the S and Z alleles, most of them are exceedingly rare (OMIM, 2000). The S allele, frequency 0.02-0.04, has a single aa substitution at position 264, Glu to Val, and individuals homozygous for this allele manifest 60% normal α.sub.1PI blood levels, but are not at risk for emphysema or other known diseases except in combination with the Z allele (Brantly et al., 1991; Sifers et al., 1988), The Z allele, frequency 0.01-0.02, has a single aa substitution at position 342, Glu to Lys, and individuals homozygous for this allele manifest 1.0% normal α.sub.1PI blood levels, and are at risk for emphysema and autoimmunity.
[0036] 3.2 Functional properties of α.sub.1PI: There are three distinct activities of α.sub.1PI that are determined by sites in the C-terminal region of α.sub.1PI defined herein as aa 357-394,
[0037] PMSI PPEVKFNKPF VFLMIEQNTK SPLFMGKVVN PTQK.
[0038] The crystal structure for active α.sub.1PI (1HP7, NIH NCBI Molecular Modeling DataBase mmdbId:15959) is depicted in
[0039] The first activity of α.sub.1PI is its well characterized proteinase inhibition which is a property only of active, uncleaved α.sub.1PI. The reactive site for this activity is Met (aa 358) contained in the domain Pro-Met-Ser-Ile-Pro (PMSIP, aa 357-361). Active α.sub.1PI may be inactivated by proteinase complexing, cleavage, or oxidation of Met (aa 358). Interaction at the scissile bond Met-Ser (aa 358-359) may be mediated by many proteinases including HLE.sub.G. The two cleavage products of α.sub.1PI may dissociate under some circumstances, but may remain associated in a new, rearranged configuration that may irreversibly incorporate HLE.sub.G, but may not incorporate other proteinases, for example metalloproteinases (Perkins et al., 1992).
[0040] The tertiary structure for the rearranged α.sub.1PI configuration has not been solved (Mellet et al., 1998); however, X-ray diffraction and kinetic analyses of cleaved α.sub.1PI suggest that the strand SIPPEVKFNKP (aa 359-369) may separate 70A° from its original position and insert into the β-sheet formation on the opposite face of the molecule (β-sheet A) in a manner that would significantly alter proteinase and receptor recognition (Elliott et al., 2000). Thus, four configurations of the C-terminal region of α.sub.1PI are thought to occur (Table 1).
TABLE-US-00002 TABLE 1 Functions of the C-terminal region of α.sub.1PI Proteinase Lymphoid cell Myeloid cell anti-gp120 HIV-1 entry Inhibition migration migration binding co-factor Native configuration in the active α.sub.1PI + + − + + Rearranged configuration in cleaved α.sub.1PI − − Unknown + − Complexed with HLE in cleaved α.sub.1PI − − + Unknown − Independent of other α.sub.1PI cleavage products − Unknown + Unknown Unknown
[0041] Because the cleaved configuration of α.sub.1PI lacks proteinase inhibitory activity, in deficient concentrations of active α.sub.1PI, the result is emphysema and respiratory-related infections which are facilitated by the presence of certain environmental factors, cigarette smoke, microbial factors, and inherited mutations that prohibit successful production of active α.sub.1PI.
[0042] A second activity of α.sub.1PI is the stimulation of cell migration, and this activity is a property of both cleaved and uncleaved α.sub.1PI. Cleaved α.sub.1PI is recognized by LRP, and stimulates migration of myeloid-lineage cells including neutrophils and monocytic cells (Joslin et al., 1992). Active, uncleaved α.sub.1PI is recognized by HLE.sub.cs and stimulates migration of lymphoid-lineage cells and myeloid-committed progenitor cells (Bristow et al., 2003). Cell migration is initiated by α.sub.1 PI-induced co-capping of receptors such as HLE.sub.cs, CXCR4, and CD4 into podia formation (Cepinskas et al., 1999; Banda et al., 1988). In addition to the participation of podia formation during cell migration, this configuration is also the preferred binding site for HIV-1 (Bristow et al., 2003). The reactive site in α.sub.1PI for this activity is Phe-Val-Phe-Leu-Met (FVFLM, aa 370-374).
[0043] A third non-physiologic activity of α.sub.1PI is binding to antibodies reactive with HIV-1 envelope protein gp120, and this activity results in inactivation of α.sub.1PI and blocking of the other two activities described above. The anti-gp120 monoclonal antibodies 1C1 (Repligen, inc., Cambridge, Mass.) and 3F5 (hybridoma culture supernatant, 0085-P3F5-D5-F8, Dr. Larry Arthur, NCI-Frederick) were previously shown to be reactive with an epitope near the gp120 C5 domain (Moore et al., 1994). The antibody cross-reactive site of human α.sub.1PI is contained in the domain Phe-Leu-Met-Ile-Glu-Gln-Asn-Thr-Lys-Ser-Pro-Leu-Phe-Met-Gly-Lys-Val-Val (FLMIEQNTKSPLFMGKVV, aa 372-389) (Bristow et al., 2001) Chimpanzee α.sub.1PI, which differs from human α.sub.1PI by a single amino acid, Val (aa 385), does not bind anti-gp120, consistent with the ability of chimpanzees to resolve HIV-1 infection and regain normal CD4.sup.+ lymphocyte levels. This suggests that the anti-gp120 cross-reactive site in human α.sub.1PI is determined primarily by the Met residue (aa 385).
[0044] 3.3 Expression of recombinant α.sub.1PI: Any method known in the art may be used for producing genetically modified α.sub.1PI's according to the invention. Two preferred methods are briefly described below for producing such recombinant α.sub.1PI's; one method allows expression of α.sub.1PI in rice cells and the other allows bacterial expression. The cDNA encoding human α.sub.1PI is obtained from a human cDNA bank by and amplification of the fragment in accession number K01396 using two PCR primers: N-terminal primer 5′ GAGGATCCCCAGGGAGATGCTGCCCAGAA 3′ and C-terminal primer 5′CGCGCTCGAGTTATTTTTGGGTGGGATTCACCAC 3′ as previously described (Courtney et al., 1984; Terashima et al., 1999; Jean et al., 1998).
[0045] For expression in rice cells, expression cassettes are prepared by using a 1.1. kb Nhei-PstI fragment, derived from p1AS1.5, is cloned into the vector pGEM5zf- (Promega, Madison, Wis.): ApaI, AatII, SphI, NcoI, SstII, EcoRV, SpeI, NotI, PstI, SalI, NdeI, SacI, MluI, NsiI at the SpeI and PstI sites to form pGEM5zf-(3D/NheI-PstI). The GEM5zf-(3D/NheI-PstI) is digested with PstI and SacI and ligated in two nonkinased 30 mers with the complementary sequences 5′ GCTTG ACCTG TAACT CGGGC CAGGC GAGCT 3′ and 5′ CGCCT AGCCC GAGTT ACAGG TCAAG CAGCT 3′ to form p3DProSig. A 5-kb BamHI-KpnI fragment from lambda clone λOSg1 A is used as a terminator. Hygromycin resistance is obtained from the 3-kb BamHI fragment containing the 35 S promoter-Hph-NOS of the plasmid pMON410.
[0046] Microprojectile bombardment is applied for transforming a Japonica rice variety TP309. The bombarded calli are then transferred to NB medium containing 50 mg/l hygromycin and incubated in the dark at 25° C. for 10±14 days. Rice cells are cultured at 28° C. (dark) using a shaker with rotation speed 115 rpm in the AA(+sucrose) media. The medium is changed every 5 days to maintain cell lines. AA(−sucrose) is used for α.sub.1PI expression. A bioreactor is used for 2-1-scale culture. The reactor is operated at 28° C. (dark) at agitation speed 30±50 rpm with aeration rate 100 ml/min. During the growth phase (10 days), the pH of the media is controlled at pH 5.7, while in the production phase the PH is 5.7±6.3 (un-controlled).
[0047] Recombinant α.sub.1PI is purified using polyclonal anti-human α.sub.1PI antibody (Enzyme Research Laboratories, South Bend, Ind.) immobilized to CNBr-activated Sepharose 4B with a concentration of 1.5 mg/ml gel. The gel (3.5 ml) is packed in a column (inner diameter 1.26 cm), and equilibrated with 50 mM Tris-HCl buffer (pH 7.6). Crude medium is applied to the column at 1.0 ml/min. Absorbance at 280 nm is monitored at the outlet of the column. After washing with the equilibrium buffer, α.sub.1PI is eluted with 0.1N HCl solution. A peak fraction is collected, and its pH is immediately adjusted with 1M Tris-HCl buffer (pH 8.0). These methods yield an estimated 5.7 mg α.sub.1PI/g dry Cell.
[0048] Alternatively, the α.sub.1PI cDNA are expressed in Escherichia coli strain BL21. transformed with pDS56α.sub.1PI/hf (Invitrogen, Carlsbad, Calif.). Protein expression is induced by addition of 1 mM isopropyl b-D-thiogalactoside, and cultures are grown overnight at 31° C. The cells are washed in metal-chelation chromatography binding buffer (5 mM imidazole/0.5M NaCl/20 mM Tris, pH 7.9) and disrupted by cavitation. The clarified and filtered supernatants containing soluble α.sub.1PI variants are applied to a Ni.sup.2+-agarose column, and bound proteins are eluted with 100 mM EDTA. The eluates are adjusted to 3.5M NaCl and applied to a phenyl-Sepharose column. The bound α.sub.1PI/hf is eluted with 20 mM Bis-Tris, pH 7.0 and concentrated (4 mg/ml final) by diafiltration in the same buffer. [0049] 4. Genetic modification of active α1PI: Recombinant active α1PI is expressed according to the procedures described in Section 3 of the Detailed Description. Wild-type human α.sub.1PI is modified genetically to diminish or enhance sequence-specific reactive sites. For example, in HIV-1 disease, therapeutic α1PI variants maintain its inhibition of soluble HLE.sub.G and its induction of cell migration, but diminish its capacity to facilitate HIV-1 entry and bind antibodies reactive with HIV-1.
[0050] The genetic modifications of interest are described in Section 4.1 of the Detailed Description. Site-directed mutagenesis of active α1PI is performed using standard procedures which are well known in the art (e.g., Parfrey et al., 2003; Current Protocols in Molecular Biology, 2002). For example, the DNA sequence encoding the human α1PI signal peptide in pDS56α.sub.1PI/hf is replaced with sequences encoding the epitope (FLAG)-tag by insertion of the annealed complimentary oligos 5′ CTAGAGGATCCCATGGACTACAAGGACGACGATGACAAGGAA 3′ and 5′GATCTTCCTTGTCATCGTCGTCCTTGTAGTCCATGGGATCCT 3′. The resulting cDNA is subcloned into pDS56-6 His to generate pDS56α1PI/hf. To generate pDS56α1Pl/hf carrying an amino acid substitution, the DNA sequences encoding the wild-type amino acid are replaced by the complimentary oligos ending for the amino acids described in Section 4.1 of the Detailed Description. The resulting ORFs directed cytosolic expression of the recombinant proteins initiating with a Met followed by the His and FLAG tags and the mature sequences of mutant α1PI.
[0051] 4.1 Genetic modification within the domain that determines cell migration (FVFLM, aa 370-374) is prepared by site-directed mutagenesis of specific amino acids: [0052] 4.1.1 Phe (aa 370) to Ile, Leu, Val, Tyr, or Gly. [0053] 4.1.2 Val (aa 371) to Phe, Leu, Ile, or Gly. [0054] 4.1.3 Phe (aa 372) to Ile, Leu, Val, Tyr or Gly. [0055] 4.1.4 Leu (aa 373) to Ile, Val, Phe, or Gly. [0056] 4.1.5 Met (aa 374) to Phe, Thr, Ile, Leu, Val, or Gly.
[0057] 4.2 Modification within the domain that determines HIV-1 gp120 antibody recognition is prepared by site-directed mutagenesis of Met (aa 385) to Phe, Thr, Ile, Leu, Val, or Gly. [0058] 5. Proteolytic modification of active or recombinant α.sub.1PI: Proteolytic fragments of chemotactic molecules, such as complement, thrombin, and α.sub.1PI, impart a primordial system of immune clearance mediators producing discrete classes of cellular responses. The appearance of variant chemotactic molecules avails immediate recruitment of pathogen-responsive immune cells as a direct function of the proteases specific to each pathogen. To replicate this system for therapeutic application, active or recombinant α.sub.1PI are modified proteolytically to diminish or enhance conformation-specific reactive sites.
[0059] Cleavage of α.sub.1PI producing inactive α.sub.1PI maybe accomplished using a variety of proteinases. Cleavage by elastase is between Met-Ser (aa 358-359) (Berninger, 1985), and by stromelysin-3, a stromal cell-derived matrix metalloproteinase (MMP), between Ala-Met (aa 350-351) (Pei et al., 1994). Cleavage of α.sub.1PI by neutrophil collagenase or gelatinase is between Phe-Leu (aa 352-353) producing inactive α.sub.1PI (Desrochers et al., 1992). Other MMPs have also been shown to cleave α.sub.1PI (Mast et al., 1991). Significantly, α.sub.1PI is cleaved by proteinase derived from pathogenic organisms such as Pseudomonas elastase (Barbey-Morel and Perlmutter, 1991).
[0060] The C-terminal α.sub.1PI proteolytic fragments acquire attributes that allow interaction with the LDL receptor-related protein (LRP) (Poller et al., 1995) and other receptors that recognize a pentapeptide sequence FVFLM (aa 370-374) (Joslin et al., 1992) in a manner that produces, chemotaxis of neutrophils, increased LDL binding to monocytes, upregulated LDL receptors, increased cytokine production, and α.sub.1PI synthesis (Banda et al., 1988; Janciauskiene et al., 1999; Janciauskiene et al., 1999). It has been shown that fibrillar aggregates of the C-terminal fragment of α.sub.1PI facilitate uptake of LDL by LRP on the hepatolastoma cell line HepG2 (Janciauskiene and Lindgren, 1999), and these fragments participate in atherosclerosis (Dichtl et al., 2000).
[0061] Specifically, active or recombinant α.sub.1Pl are incubated at the relevant optimal conditions with one or a combination of pepsin, plasmin, urokinase, chymotrypsin, thrombin, CD26, matrix metalloproteinases, complement components C1 or C3, and other proteinases that facilitate the generation of chemotactic fragments of α.sub.1PI (Methods in Enzymology, 1970; Hooper, 2002). Cleavage of α.sub.1PI is then terminated by changing the optimal conditions in the proteinase mixture to conditions that prevent proteinase activity, for example at temperature or pH extremes (Methods in Enzymology, 1970; Hooper, 2002). [0062] 6. Functional capacity of active, genetically modified, and proteolytically modified α.sub.1PI: Various unmodified and modified α.sub.1PI's are screened and selected for use in treatment of specific diseases by determining their capacity in vitro and/or in vivo to perform the following functions in the following assays:
[0063] 6.1 inhibit elastase: The procedures for measuring the capacity of α.sub.1PI to inhibit soluble forms of porcine pancreatic elastase (PPE) or HLE.sub.G are well established (U.S. Pat. No. 6,887,678) (Bristow et al., 1998). Briefly, PPE is incubated for 2 min with α1PI, and to this mixture is added, the elastase substrate succinyl-L-Ala-L-Ala-L-Ala-p-nitroanilide (SA.sup.3NA). Results are detected by measuring the color change at 405 nm.
[0064] In complex mixtures, α.sub.1PI competes for binding to PPE with other proteinase inhibitors or ligands present in the mixture. For example, PPE has higher affinity for α.sub.2macroglobulin (α.sub.2M) than for α.sub.1PI, and when complexed with α.sub.2M, PPE retains the ability to cleave small substrates. In the presence of α.sub.2M, PPE binds α.sub.2M and is protected from inhibition by α.sub.1PI, and the complexation of PPE with α.sub.2M can be measured by detecting the activity of PPE using SA.sup.3NA. To measure the inhibitory capacity of α.sub.1PI in complex mixtures such as serum, two-fold serial dilutions of serum are incubated with a constant, saturating concentration of PPE. The added PPE is bound by α.sub.2M and α.sub.1PI in the diluted serum dependant on their concentrations, the greater the concentration of serum, the greater the concentration of α.sub.2M and α.sub.1PI. Since there is more α.sub.1PI in serum than α.sub.2M, as serum is diluted, α.sub.2M is diluted out, and in the absence of α.sub.2M, PPE is bound and inhibited by α.sub.1PI. The complexation of PPE with α.sub.1PI can be measured by detecting the loss of activity of PPE using SA.sup.3NA. As serum is further diluted, α.sub.1PI is also diluted out, and the loss of complexation of PPE with α.sub.1PI can be measured by detecting the gain in activity of PPE using SA.sup.3NA. The plot of PPE activity versus serum dilution makes a V shaped curve, PPE activity first decreasing as serum is diluted, and then increasing as serum is further diluted. The nadir of PPE activity is used to calculate the precise concentration of active α.sub.1PI in the mixture (Bristow et al., 1998).
[0065] 6.2 Induce receptor co-capping and cell motility: The procedures for inducing receptor capping have been described (Bristow et al., 2003). The cells of interest (monocytes, lymphocytes, neutrophils, or other blood cells, e.g. leukemic cells) are isolated from blood or tissue using standard techniques (Messmer et al., 2002) and examined for reactivity with α.sub.1PI.
[0066] To examine receptor capping, cells are incubated with active or modified α.sub.1PI for 15 min in humidified 5% CO.sub.2 at 37° C. Cells are applied to the sample chambers of a cytospin apparatus (Shandon Inc. Pittsburgh, Pa.), and slides are centrifuged at 850 rpm for 3 min. Slides are fixed by application of 500 μl 10% formalin to the sample chambers of the cytospin apparatus followed by an additional centrifugation at 850 rpm for 5 min. Slides are incubated for 90 min at 20° C. with fluorescently-labeled monoclonal antibodies having specificity for the receptors of interest and examined by microscopy.
[0067] Cell motility results from selective and sequential adherence and release produced by activation and deactivation of receptors (Wright and Meyer, 1986; Ali et al., 1996), consequent polar segregation of related membrane proteins to the leading edge or trailing uropod, and both clockwise and counterclockwise propagation of Ca.sup.++ waves which initiate from different locations in the cell (Kindzelskii and Petty, 2003). Thus, several aspects of the complex process may be quantitated. The most direct and most easily interpreted method for quantitating cell motility is the enumeration of adherent cells in response to a chemotactic agent such as α.sub.1PI.
[0068] For detecting adherence, sterile coverslips are washed in endotoxin-free water, and to each coverslip is delivered various dilutions of active or modified α.sub.1PI. Cells are subsequently delivered to the coverslips, mixed to uniformity with α.sub.1PI, and incubated for 30 min in humidified 5% CO.sub.2 at 37° C. without dehydration. After stringently washing the coverslips free of non-adherent cells, adherent cells are fixed by incubation for 10 min at 20° C. with 4% paraformaldehyde containing 2.5 μM of the nuclear staining fluorescent dye, acridine orange (3,6-bis[dimethylamino]acridine. Slides are examined by microscopy, and means and standard deviations are determined by counting adherent cells in at least three fields/coverslip.
[0069] 6.3 Mobilize lymphoid-committed progenitor cells: In the nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mouse model, bone marrow-engrafted human cells can be mobilized by G-CSF (Petit et al., 2002). This model is adapted to assess the capacity of active or modified α.sub.1PI to mobilize human lymphoid- or myeloid-lineage cells, respectively.
[0070] NOD/SCID mice are housed under defined flora conditions in. individually ventilated (HEPA-filtered air) sterile micro-isolator cages. Human chimeric mice are obtained after sublethal irradiation (375 cGy at 67 cGy/min) and injection of 2×10.sup.7 human cord blood mononuclear cells. Four to five weeks post transplantation, mobilization is performed by application of either G-CSF or α.sub.1PI. For mobilization of myeloid-committed progenitors, mice receive daily subcutaneous injections of 300 μg/kg G-CSF (Filgrastim, Neupogen® or Neulasta®, Amgen, Inc) in 250 μl of 0.9% NaCl, 5% fetal calf serum for 4-5 days. Alternatively, mice receive twice weekly infusion via the dorsal tail vein of inactive or modified α.sub.1PI (39 mg/kg) at a rate of 0.08 ml/kg/minute. For mobilization of lymphoid-committed progenitors, mice receive twice weekly infusion via the dorsal tail vein of active or modified α.sub.1PI (42 mg/kg) at a rate of 0.08 ml/kg/minute. Mice are asphyxiated with dry ice, peripheral blood is collected by cardiac aspiration into heparinized tubes, and bone marrow is harvested, and cells are flushed from femurs and tibias into single-cell suspensions. Peripheral blood and bone marrow cells are analyzed by flow cytometry for the presence of myeloid and lymphoid markers including CD34 CD38, CD10, CD11b, CD11c, CD13, CD14, CD19, CD3, CD4, CD8, CD45, CD184 (CXCR4), CD66, and HLE.sub.cs (U.S. Pat. No. 6,858,400).
[0071] 6.4 Bind anti-HIV-1 gp120: Active or modified α.sub.1PI are incubated in fluid phase with monoclonal antibodies reactive with HIV-1 gp120. The anti-gp120 monoclonal antibodies 3F5 (hybridoma culture supernatant, 0085-P3F5-D5-F8) is reactive with an epitope near the gp120 C5 domain (Moore et al., 1994). Clone α70 (ICN Biochemicals, Aurora, Ohio) is reactive with the V3-loop of gp120, a domain that is identical to the HLE ligand inter-α-trypsin inhibitor (Pratt et al., 1987). Immune complexes are captured by incubating mixtures in wells of a microtiter plate pre-coated with chicken anti-human α.sub.1PI IgG. Binding is detected using horse radish peroxidase-conjugated rabbit anti-mouse IgG followed by substrate, orthophenylene diamine HCl.
[0072] 6.5 Facilitate HIV-1 infectivity: Primary non-syncytium inducing HIV-1 clinical isolates (Advanced Biotechnologies, Rivers Park, Ill.) are used to infect peripheral blood mononuclear cells maintained in wells of a 96 well tissue culture plate at 2×10.sup.6cells/ml in RPMI-1640 containing 20% autologous serum and 10% IL-2 (Cellular Products, Buffalo, N.Y.). Prior to addition of HIV-1, cells are incubated with active or modified α.sub.1PI for 0 min or 60 min at 37° C., 5% CO.sub.2. In vitro infectivity outcome is determined in triplicate by p24 accumulation or by RT activity as previously described (Bristow, 2001). Cell counts and viability are determined at the final time point. [0073] 7. Treatment Outcome Measurements:
[0074] 7.1 To determine the effectiveness of treatment on elastase inhibitory capacity, individuals are monitored weekly for active and inactive α.sub.1PI blood levels (Bristow et al., 1998) (U.S. Pat. No. 6,887,678). Briefly, a constant amount of active site-titrated PPE is allowed to incubate with serial dilutions of serum for 2 min at 37° C. after which a PPE substrate is added. Determination of the molecules of substrate cleaved by residual, uninhibited PPE is used to calculate the molecules of active and inactive α.sub.1PI in blood.
[0075] 7.2 To determine the effectiveness of treatment on inducing changes in levels of targeted blood cell populations, treated individuals are monitored weekly for changes in complete blood count and differential, as well as for changes in specific subsets of blood cells such as CD4.sup.+ cells and HLE.sub.cs.sup.+ cells using flow cytometry (Bristow et al 2001; Bristow, 2001) (U.S. Pat. No. 6,858,400). Briefly, 100 μl of whole blood is incubated with a panel of fluorescently-labeled monoclonal antibodies approved by the FDA for medical diagnostics. These antibodies are selected to specifically recognize the cell receptors that uniquely identify the cell population of interest. Identification and enumeration of the cells in blood that are bound to the monoclonal antibodies is performed using flow cytometry.
[0076] 7.3 To determine the influence of treatment on disease progression, individuals are monitored for the specific pathologic determinants of disease which are well known in the art for the various indications, e.g. in stem cell transplantation, organ transplantation, autoimmunity, diabetes, leukemia, cancer, HIV-1 infection, atherosclerosis, and other diseases influenced by blood cells. For example, in HIV-1 disease, individuals are monitored for changes in CD4.sup.+ lymphocyte levels and HIV levels (Bristow et al., 2001; Bristow, 2001). In leukemia or cancer, individuals are monitored for changes in the presence of leukemic or cancerous cells (Tavor. S. et al., 2005). In stem cell transplantation, individuals are monitored for changes in normal blood cells (Jansen et al., 2005). In organ transplantation, individuals are monitored for organ rejection (Kirschfink, 2002). In autoimmunity, individuals are monitored for the presence of autoantibodies and specific functions of the affected organs (Marinaki et al., 2005). In diabetes and atherosclerosis, individuals are monitored for changes in total cholesterol, LDL, HDL, and triglyceride levels (Talmud et al., 2003).
EXAMPLES
[0077] 1. Increased CD4.sup.+ lymphocytes are correlated with increased α.sub.1PI and decreased HLE.sub.cs.sup.+ lymphocytes in healthy individuals. In healthy individuals, circulating α.sub.1PI ranges from 18-53 μM between the 5.sup.th and 95.sup.th percentiles, and 90-100% of this protein is in its active form as determined by inhibition of porcine pancreatic elastase (Bristow et al., 2001). To investigate the relationship between active α.sub.1PI, HLE.sub.cs.sup.+, and CD4.sup.+ lymphocytes, 6 healthy HIV-1 seronegative adults, 3 males and 3 females, were specifically selected to represent a wide spectrum of α.sub.1PI (1.9-61.5 μM). Subjects were measured for CD4, CXCR4, CCR5, HLE.sub.cs, active and inactive α.sub.1PI levels, and α.sub.2-macroglobulin (α.sub.2M). Independently, neither active α.sub.1PI, HLE.sub.cs.sup.+ lymphocytes, α.sub.2M, CXCR4.sup.+ lymphocytes, nor CCR5.sup.+ lymphocytes were correlated with CD4.sup.+ lymphocytes. However, by multilinear regression analysis, it was found that higher numbers of CD4+ lymphocytes (% lymphocytes) were correlated (r.sup.2=0.937) with two counterbalancing variables together, higher active α.sub.1PI (p=0.008) and lower HLE.sub.cs.sup.+ lymphocytes (p=U.034) (
[0078] To investigate CD4.sup.+ lymphocyte levels in the general population, blood was collected from an additional 18 healthy, HIV-1 seronegative adults, 9 males and 9 females, who were measured for CD4, CXCR4, CCR5, SDP--1, active and inactive α.sub.1PI levels. HLE.sub.cs was measured in 16 of these individuals. Values for active α.sub.1PI (19-37 μM) and SDF-1 levels (191-359 pM) for these volunteers were found to be within normal ranges. Higher CD4.sup.+ lymphocytes (%) were again found to be correlated (r.sup.z=0.803) with higher active α.sub.1PI (p<0.007) and lower HLE.sub.cs.sup.+ lymphocytes (p<0.001) (
[0079] There was no statistical difference between the volunteers in
[0080] 2. Monoclonal anti-gp120 binds human, but not chimpanzee chili. Two monoclonal antibodies (1C1 and 3F5) which bind a conformationally determined epitope near the C5 domain of gp120 (Moore et al., 1994) were found to also bind human α.sub.1PI (Bristow et al., 2001.). It was hypothesized that anti-gp120 mediated depletion of active α.sub.1PI might be pathognomonic for HIV-1 AIDS. If true, chimpanzee α.sub.1 PI should differ from human α.sub.1PI since HIV-1 infected chimpanzees survive infection and regain normal levels of CD4.sup.+ lymphocytes (Rutjens et al., 2003). Sequence comparison revealed that human α.sub.1PI differs from chimpanzee α.sub.1PI by one amino acid (aa 385) caused by a single nucleotide change (NCBI accession numbers BT019455 and XP_522938), and this aa difference lies in the gp120-homologous region of α.sub.1PI. To determine whether this sequence difference affects the binding of anti-gp120 to α.sub.1PI, 20 human and 20 chimpanzee sera were compared. Both 1C1 (data not shown) and 3F5 exhibited 8- to 14-fold greater binding to human, than chimpanzee α.sub.1PI in 6 repeat measurements (p<0.001) (
[0081] To examine the relationship between lower CD4.sup.+ lymphocyte levels and lower active α.sub.1PI levels HIV-1 in disease, blood from 38 HIV-1 infected patients was analyzed. Of these 38 patients, 29% had detectable IgG-α.sub.1PI immune complexes, 89% were on antiretroviral therapy, and 60% had <500 HIV-1 RNA copies/ml (
[0082] None of the sera from healthy chimpanzees, nor sera collected from 2 chimpanzees post-HIV-1 inoculation, had evidence of detectable IgG-α.sub.1PI immune complexes. The HIV-1 inoculated chimpanzees were confirmed to be HIV-1 infected, but had normal CD4.sup.+ lymphocytes (Girard et al., 1998). In addition, despite the presence of anti-gp120, we found no evidence of. IgG-α.sub.1PI immune complexes in 10 rhesus macaques following immunization with simian/human immunodeficiency virus (SHIV 89.6) gp120 or gp140, or in 3 macaques infected with SHIV (data not shown). Extensive in vitro analyses failed to demonstrate bi-molecular complexes between gp120 and α.sub.1PI (data not shown), and the absence of detection of IgG-α.sub.1PI immune complexes in sera from HIV-1 infected chimpanzees suggests gp120 and α.sub.1PI are not associated by aggregation in sera. These results suggest that IgG-α.sub.1PI immune complexes are unique to HIV-1 disease in humans.
[0083] Consistent with evidence from a previous patient study, active α.sub.1PI in the HIV-1 infected patients was significantly below normal (median 17 μM, p<0.001) (
[0084] To determine whether α.sub.1PI becomes inactivated after complexing with the 3F5 anti-gp120 monoclonal antibody, 3F5 was incubated with sera samples from five healthy individuals. In comparison to untreated sera, α.sub.1PI activity was significantly diminished to the same degree in all sera (mean difference=5.8±0.5 μM, p<0.001.) (
[0085] The gp120 epitope recognized by 1C1 and 3F5 is considered to be conformation-dependent (Moore et al., 1994). The gp120 peptide immunogen used to raise 1C1 and 3F5 (aa 300-321, GGGDMRDNWRSELYKYKVVK) (Ratner et al., 1985) contains both an α-helix (aa 306-313) and linear strand (aa 314-321) (
[0086] In α.sub.1PI, the sequence GKVV (aa 386-389) lies within 5A° of M-385, N-46, and the N-linked oligosaccharide in a space occupying 5A° by 5A° by 5A°. In gp120, in the same relative orientation as in et.sub.iPI, the sequence YKVV (aa 315-318) lies within 5A° of M-17 and 8A° of N-92 and the N-linked mannose-containing oligosaccharide (Leonard et al., 1987) in a space occupying 5A° by 5A° by 8A°. Evidence that α.sub.1PI polymorphisms may influence 3F5 binding (
[0088] In the 23 patients with <500 HIV-1 RNA copies/ml, higher CD4.sup.+ lymphocyte levels were correlated with higher active α.sub.1PI concentration (r.sup.2=0.927) and lower inactive α.sub.1PI concentration (r.sup.2=0.946) (
[0090] Patients with <500 HIV-1 RNA copies/ml and <200 CD4 cells/μl who are receiving antiretroviral therapy are treated using Zemaira® α.sub.1PI. Patients receive weekly infusions of Zemaira® at 60 mg/kg as described in Section 2 of the Detailed Description. Treatment outcome is monitored as described in Section 7.3 of the Detailed Description. Specifically, patients receiving Zemaira® are monitored weekly for changes in active and inactive α.sub.1PI levels as well as for CD4.sup.+ T lymphocytes and other subsets of circulating blood cells. Patients are also monitored for changes in HIV-1 RNA copies/ml, LDL, HDL, cholesterol, triglycerides, and the occurrence of infections designated by the CDC as parameters of HIV-1 disease progression (Castro et al., 1992). To determine possible adverse effects of immune complex disease, individuals are monitored for the presence of antibodies reactive with α.sub.1PI as well as for the occurrence of glomerulonephritis by measuring either proteinuria or serum creatinine levels (Bristow et al., 2001; Virella et al., 1981). [0091] 5. α.sub.1PI augmentation therapy in HIV-1 infected patients using genetically modified α.sub.1PI. Antibodies that recognize HIV-1 arc the only diagnostic marker of infectivity. The presence of an anti-gp120 antibody that also binds α.sub.1PI has been detected in most HIV-1 infected individuals (Bristow et al., 2001), and this antibody inactivates and produces deficient levels of α.sub.1PI. Anti-gp120 does not bind chimpanzee α.sub.1PI which differs from human α.sub.1PI by a single amino acid (aa 385) (Example 2). To therapeutically augment α.sub.1PI in HIV-1 infected individuals, it is desirable to use genetically modified α.sub.1PI which substitutes a different aa in place of Met (aa 385). In addition, a hydrophobic domain (aa 370-374) near Met (aa 385) has been shown to facilitate HIV-1 entry (Bristow et al., 2001). Thus, it is also desirable to change one or more of the aa in this hydrophobic domain for treatment in HIV-1 disease.
[0092] α.sub.1PI is genetically modified as described in Section 4 of the Detailed Description with three substitutions, aa 385 (Met to Val), aa 372 (Phe to Gly), and aa 373 (Leu to Gly), and is designated α.sub.1PI.β.F372G.L373G.M385V (α.sub.1PI.β). The α.sub.1PI.β sequence with aa changes represented in bold underlined letters is as follows:
TABLE-US-00003 -24 MPSSVSWGIL LLAGLCCLVP VSLA 1 EDPQGDAAQK TDTSHHDQDH PTFNKITPNL AEFAFSLYRQ LAHQSNSTNI 51 FFSPVSIATA FAMLSLGTKA DTHDEILEGL NFNLTEIPEA QIHEGFQELL 101 RTLNQPDSQL QLTTGNGLFL SEGLKLVDKF LEDVKKLYHS EAFTVNFGDT 151 EEAKKQINDY VEKGTQGKIV DLVKELDRDT VFALVNYIFF KGKWERPFEV 201 KDTEEEDRIV DQVTTVKVPM MKRLGMFNIQ HCKKLSSWVL LMKYLGNATA 251 IFFLPDEGKL QHLENELTHD IITKFLENED RRSASLHLPK LSITGTYDLK 301 SVLGQLGITK VFSNGADLSG VTEEAPLKLS KAVHKAVLTI DEKGTEAAGA 351 MFLEAIPMSI PPEVKFNKPF VGGMIEQNTK SPLFVGKVVN PTQK
[0093] The functional capacity of α.sub.1PI.β depicted in Table 2 is determined as described in Section 6 of the Detailed Description.
TABLE-US-00004 TABLE 2 Functions of the C-terminal region of α.sub.1PI.β Proteinase Lymphoid cell Myeloid cell anti-gp120 HIV-1 entry Inhibition migration migration binding co-factor Native configuration in the active α.sub.1PI.β + − − − + Rearranged configuration in cleaved α.sub.1PI.β − − − − − Complexed with HLE in cleaved α.sub.1PI.β − − − − − Independent of other α.sub.1PI.β cleavage products + − − − Unknown
[0094] The recommended dose of α.sub.1PI is 60 mg/kg. The specific activity of Zemaira® is 70%, where specific activity is defined as inhibition of PPE (Bristow et al., 1998). Thus, the recommended dose of Zemaira® α.sub.1PI may be stated as 42 mg/kg active α.sub.1PI. In accordance with the recommended Zemaira® treatment regimen, HIV-1 patients with <500 HIV-1 RNA copies/ml and <200 CD4 cells/μl who are receiving antiretroviral therapy are infused with the concentration of α.sub.1PI.β that is in the range of 1 to 420 mg/kg active α.sub.1PI with a target blood threshold of 35 μM α.sub.1PI.β. Treatment of HIV-1 infected patients with α.sub.1PI.β is indicated in patients who are simultaneously receiving one or a combination of the four currently known classes, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, HIV-1 aspartyl protease inhibitors, and fusion inhibitors. Treatment outcome is monitored as described in Section 7.3 of the Detailed Description. Specifically, patients receiving α.sub.1PI.β are monitored weekly for changes in active and inactive α.sub.1PI levels as well as for CD4.sup.+ T lymphocytes and other subsets of circulating blood cells. Patients are also monitored for changes in HIV-1 RNA copies/ml, LDL, HDL, cholesterol, triglycerides, and the occurrence of infections designated by the CDC as parameters of HIV-1 disease progression (Castro et al., 1992). To determine possible adverse effects of immune complex disease, individuals are monitored for the presence of antibodies reactive with α.sub.1PI as well as for the occurrence of glomerulonephritis by measuring either proteinuria or serum creatinine levels (Bristow et al., 2001; Virella et al., 1981). [0095] 6. α.sub.1PI inhibits SDF-1 induced migration of human leukemic cells in, but enhances migration of human stem cells. Human acute myeloid leukemia cells (AML) not only secrete HLE.sub.G, but also express HLE.sub.cs constitutively on the cell surface in a manner that is regulated by the CXCR4/SDF-1 axis (Tavor. S. et al., 2005). Preincubation of AML cells with α.sub.1PI significantly reduced their SDF-1 dependent migration in all AML cells tested using an in vitro transwell assay (Tavor. S. et al., 2005). Further, in a mouse model it was found that α.sub.1PI inhibited homing of transplanted human stem cells to bone marrow and egress of transplanted AML cells from bone marrow. The influence of α.sub.1PI was shown to occur by its action on HLE.sub.cs. When AML cells were treated with α.sub.1PI, SDF-1 induced pseudopodia formation was prevented. These results are in contrast to previous studies using a U937 promonocytic cell line which demonstrated that α.sub.1PI—induced pseudopodia formation was prevented by pretreatment with SDF-1 (Bristow et al., 2003), and this difference emphasizes the importance of α.sub.1PI and SDF-1 in promoting cell migration of various cells dependent on their stage of differentiation. Augmentation with active and modified α.sub.1PI is used therapeutically to control the proliferation and spread of leukemia and lymphoma cells. Active α.sub.1PI is used to prevent proliferation and spread of leukemia and lymphoma cells triggered by SDF-1. Inactive α.sub.1PI is used to prevent proliferation and spread of leukemia and lymphoma cells triggered by active α.sub.1PI. Patients receive therapeutic augmentation with active or modified α.sub.1PI with a target blood threshold of 35 μM active α.sub.1PI and are monitored for active and inactive α.sub.1PI levels as well as for changes in the number of AML cells in circulation using flow cytometry. [0096] 7. α.sub.1PI augmentation therapy in patients with a microbial infection. High levels of neutrophils and HLE.sub.G are present in the respiratory secretions of patients with cystic fibrosis. The primary cause of this inflammatory situation is chronic infection with Pseudomonas aeruginosa and other bacteria. Abundant α.sub.1PI is present in these patients, but is predominantly inactivated by HLE.sub.G and P. aeruginosa elastase (Barbey-Morel and Perlmutter, 1991). Prolastin® has demonstrated improvement by reducing elastase activity, neutrophil counts, and bacterial colonies in a rat model (Cantin and Woods, 1999). Inactivated α.sub.1PI is a chemo-attractant for neutrophils (Joslin et al., 1992). In addition to the therapeutic benefit of inhibiting the elevated elastase activity that attends the inflammatory sequelae of microbial infection, augmentation with active α.sub.1PI diminishes the inactivated α.sub.1PI-induced neutrophil infiltrate. Patients receive active α.sub.1PI with a target blood threshold of 35 μM active α.sub.1PI and are monitored for active and inactive α.sub.1PI levels as well as for changes in the number of neutrophils in circulation using flow cytometry and changes in infection driven inflammation.
8. α.sub.1PI augmentation therapy for neutropenia. In the majority of patients with severe congenital neutropenia, mutations are found in the gene encoding HLE or in the gene encoding the receptor for G-CSF (Horwitz et al., 1999; Benson et al., 2003). HLE mutations that prevent localization to the plasma membrane cause cyclic neutropenia, and mutations that cause exclusive localization to the plasma membrane cause the pre-leukemic disorder, severe congenital neutropenia (Benson et al., 2003). Because inactive α.sub.1PI mobilizes neutrophils (Joslin et al., 1992), augmentation with inactive α.sub.1PI is used therapeutically for the purpose of increasing the number of neutrophils in circulation. Patients receive inactive α.sub.1PI with a target of 39 mg/kg inactive α.sub.1PI and are monitored for active and inactive α.sub.1PI levels as well as for changes in the number of neutrophils in circulation using flow cytometry. [0097] 9. α.sub.1PI augmentation therapy for solid tumors. Tumor cell lines and biopsy specimens exhibit inverse correlations of α.sub.1PI and the metalloproteinase MMP-26-(Li et al., 2004). Expression of MMP-26 in estrogen-dependent neoplasms is likely to contribute to the inactivation of α.sub.1PI promoting matrix destruction and malignant progression. Furthermore, evidence suggests α.sub.1PI participates in tumor cell migration (Nejjari et al., 2004).
[0098] A serious side effect of myelosuppressive chemotherapy for solid tumors, is neutropenia. G-CSF (Filgrastim, Neupogen® or Neulasta®, Amgen, Inc.) is currently used to mobilize neutrophils in patients on myelosuppressive chemotherapy. In combination with G-CSF, using active α.sub.1PI therapeutically to mobilize lymphoid-lineage cells in patients receiving myelosuppressive chemotherapy offers the additional benefit of controlling tumor metastasis. Patients receive active α.sub.1PI with a target blood threshold of 35 μM active α.sub.1PI and are monitored for active and inactive α.sub.1PI levels as well as for changes in the number of myeloid-lineage, lymphoid-lineage, and tumor cells in circulation using flow cytometry. [0099] 10. α.sub.1PI augmentation therapy in atherosclerosis. Diminished active α.sub.1PI promotes atherogenesis (Talmud et al., 2003). Oxidized α.sub.1PI has no proteinase inhibitory activity, and instead associates with LDL in vivo (Mashiba et al., 2001). The C-terminal fragment of α.sub.1PI is present in atherosclerotic plaques (Dichtl et al., 2000). The oxidized and proteolyzed inactivation of α.sub.1PI is thought to result from subclinical infections of the arterial intima by bacteria such as Porphyromonas gingivalis (Brodala et al., 2005; Beck et al., 2005). Augmentation with active α.sub.1PI is used therapeutically to mobilize lymphoid-lineage cells into the infected tissue for the purpose of controlling and clearing the infection. Patients receive augmentation with active α.sub.1PI with a target blood threshold of 35 μM active α.sub.1PI and are monitored for active and inactive α.sub.1PI levels as well as for intimal wall thickness and atherosclerotic plaque formation. [0100] 11. α.sub.1PI augmentation therapy in insulin-dependent diabetes. Increased inactive α.sub.1PI is present in insulin-dependent diabetes due to the presence of subclinical infections (Bristow et al., 1998; Sandler et al., 1988) and hyperglycemia (Sandler et al., 1988). Recombinant adeno-associated virus-mediated α.sub.1PI gene therapy in a murine model reduced the level of insulin autoantibodies and the frequency of overt diabetes (Song et. al., 2004). Augmentation with active α.sub.1PI is used therapeutically to mobilize lymphoid-lineage cells into the infected tissue for the purpose of controlling and clearing the infection as well as to ameliorate the incidence of autoantibodies in diabetes. Patients receive augmentation with active α.sub.1PI with a target blood threshold of 35 μM active α.sub.1PI and are monitored for active and inactive α.sub.1PI levels as well as for the presence of anti-insulin antibodies. [0101] 12. α.sub.1PI augmentation therapy in autoimmune diseases. A predisposing condition for the occurrence of autoimmune disease is the inborn deficiency of a proteinase or proteinase inhibitor involved in homeostasis. Wegener's granulomatosis is caused by autoimmunity to the α.sub.1PI ligand, proteinase 3 (Pendergraft et al., 2003; Csernok et al., 1990). Active α.sub.1PI ameliorates the autoimmune pathogenesis of Wegener's granulomatosis (Rooney et al., 2001). Systemic lupus erythematosis can arise in patients with complement deficiencies or α.sub.1PI deficiency (Sinico et al., 2005) Elevated HLE.sub.G activity is detected in patients with rheumatoid arthritis (Adeyemi et al., 1986). These patients benefit from augmentation with active α.sub.1PI. Patients receive augmentation with active α.sub.1PI with a target blood threshold of 35 μM active α.sub.1PI and are monitored for active and inactive α.sub.1PI levels as well as for autoimmune-mediated inflammation. [0102] 13. α.sub.1PI augmentation therapy in solid organ transplantation. Excessive activation of proteinase cascade systems has been associated with post-transplantation inflammatory disorders and organ rejection (Kirschfink, 2002). Augmentation with active α.sub.1PI diminishes post-transplantation inflammation; however, this therapy also mobilizes both lymphoid-lineage and myeloid-lineage cells potentially facilitating organ rejection. To overcome this adverse affect, α.sub.1PI is genetically modified to prevent interaction with receptors and to prevent stimulation of cell motility (see Example 5). Augmentation with genetically modified α.sub.1PI is used therapeutically to diminish inflammation and prevent recruitment of inflammatory blood cells and their products into transplants. Patients receive genetically modified α.sub.1PI with a target blood threshold of 35 μM genetically modified α.sub.1PI and are monitored for active and inactive α.sub.1PI levels as well as for markers of organ rejection. [0103] 14. α.sub.1PI augmentation therapy in stem cell transplantation. Migration of stem cells to, and progenitor cells from bone marrow is controlled by HLE.sub.cs, SDF-1, CXCR4 (Tavor. S. et al., 2005; Lapidot and Petit, 2002) and α.sub.1PI (Examples 1-3 herein). Active α.sub.1PI mobilizes lymphoid-lineage cells and inactive α.sub.1PI mobilizes myeloid-lineage cells. Active and modified α.sub.1PI are used therapeutically to mobilize stem cells to hematopoietic tissue and progenitor cells from hematopoietic tissue doling stem cell transplantation.
[0104] Patients undergoing stem cell transplantation are treated with G-CSF (Filgrastim, Neupogen® or Neulasta®, Amgen, Inc.) to mobilize progenitor cells into circulation, and these are primarily myeloid-committed progenitor cells (Cottler-Fox et al., 2003). Progenitor cells are harvested from blood and placed in culture in vitro for the purpose of proliferation before transplantation. Proliferation and differentiation is monitored using flow cytometry. Active α.sub.1PI is given therapeutically with a target blood threshold of 200 μM active α.sub.1PI to mobilize lymphoid-lineage cells into circulation. Mobilized lymphoid-committed progenitor cells are harvested from blood and placed in culture in Vitro for the purpose of proliferation before transplantation. Patients receiving mobilization treatment with active α.sub.1PI are monitored for active and inactive α.sub.1PI levels. Harvested lymphoid-committed progenitor cells are monitored for proliferation and differentiation using flow cytometry prior to reinjection. [0105] 15. α.sub.1PI in producing dendritic cell-based vaccines. Autologous stem cell transplantation involves a process of harvesting stem cells from circulation, culturing the cells in vitro to proliferate, and reinjection into the patient. This same principle is used to produce autologous dendritic cell-based vaccines. Dendritic cells are used as a vector to deliver selected immunogens to the lymph nodes where their interaction with T lymphocytes initiates an immune response to the selected immunogen. Dendritic cell-based vaccines are currently being used to induce immunity to tumor antigens (Schuler et al., 2003). Monocytic or lymphocytic cells are harvested from the blood of a patient with cancer, for example, malignant melanoma. Harvested cells are cultured in vitro in the presence of a cocktail of cytokines including G-CSF and GM-CSF that induces their differentiation into either monocyte-derived dendritic cells or plasmacytoid dendritic cells depending on the combination of cytokines used (Messmer et al., 2002). Dendritic cells are loaded with an antigen, for example melanoma peptide, and reinjected into the patient (Palucka et al., 2005; Schuler et al., 2003). Patients are monitored for the presence of melanoma-specific lymphocytes.
[0106] Active α.sub.1PI is used to stimulate in vitro differentiation of lymphoid-lineage and myeloid-lineage blood cells into dendritic cells. Differentiation and function of dendritic cells is monitored using flow cytometry and cytokine secretion as described previously (Messmer et al., 2002). Dendritic cells are pulsed with antigen and reinjected into the patient. Patients receiving α.sub.1PI-induced dendritic cells are monitored for the presence of immunogen-specific lymphocytes.
REFERENCE LIST
[0107] Adeyemi, E. O., Hull, R. G., Chadwick,V. S., Hughes, G. R., and Hodgson, H. J. (1986). Circulating human leucocyte elastase in rheumatoid arthritis. Rheumatol. Int. 6, 57-60: [0108] Ali., H., Tomhave, E. D., Richardson, R. M., Haribabu, B., and Snyderman, R. (1996). Thrombin primes responsiveness of selective chemoattractant receptors at a site distal to G protein activation. J. Biol. Chem. 271, 3200-3206. [0109] Banda, M. J., Rice, A. G., Griffin, G. L., and Senior, R. M. (1988). α1-proteinase inhibitor is a neutrophil chemoattractant after proteolytic inactivation by macrophage elastase. J. Biol. Chem. 263, 4481-4484. [0110] Barbey-Morel, C. and Perlmutter, D. H. (1991). Effect of Pseudomonas elastase on human mononuclear phagocyte α.sub.1-antitrypsin expression. Pediatr Res 29, 133-139. [0111] Beck, J. D., Eke, P., Lin, D., Madianos, P., Couper, D., Moss, K., Elter, J., Heiss, G., and Offenbadher, S. (2005). Associations between IgG antibody to oral organisms and carotid intima-medial thickness in community-dwelling adults. Atherosclerosis 183, 342-348. [0112] Benson, K. F., Li, F. Q., Person, R. E., Albani, D., Duan, Z., Wechsler, J., Meade-White, K., Williams, K., Acland, G. M., Niemeyer, G., Lothrop, C. D., and Horwitz, M. (2003). Mutations associated with neutropenia in dogs and humans disrupt intracellular transport of neutrophil elastase. Nat Genet 35, 90-96. [0113] Berninger, R. W. (1985). Alpha 1-antitrypsin. J. Med. 16, 23-99. [0114] Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1987). Structure of the human class I histocompatibility antigen, HLA-A2. Nature 329, 506-512. [0115] Brantly, M. L., Wittes, J. T., Vogelmeier, C. F., Hubbard, R. C., Fells, G. A., and Crystal, R. G. (1991). Use of a highly purified alpha 1-antitrypsin standard to establish ranges for the common normal and deficient alpha 1- antitrypsin phenotypes. Chest 100, 703-708. [0116] Bristow, C. L. (2001). Slow human immunodeficiency virus-(HIV) infectivity correlated with low HIV coreceptor levels. Clin. Diagn. Lab. Immunol. 8, 932-936. [0117] Bristow, C. L., di Meo, F., and Arnold, R. R, (1.998). Specific activity of α1 proteinase inhibitor and α2 macroglobulin in human serum: Application to insulin-dependent diabetes mellitus. Clin. Immunol. Immunopathol. 89, 247-259. [0118] Bristow, C. L., Fiscus, S. A., Flood, P. M., and Arnold, R. R. (1995). Inhibition of HIV-1 by modification of a host membrane protease. Int. Immunol. 7, 239-249. [0119] Bristow, C. L., Mercatante, D. R., and Kole, R. (2003). HIV-1 preferentially binds receptors co-patched with cell surface elastase. Blood 102, 4479-4486. [0120] Bristow, C. L., Patel, H., and Arnold, R. R. (2001). Self antigen prognostic for human immunodeficiency virus disease progression. Clin. Diagn. Lab. Immunol. 8, 937-942. [0121] Brodala, N., Merricks, E. P., Bellinger, D. A., Damrongsri, D., Offenbacher, S., Beck, J., Madianos, P., Sotres, D., Chang, Y. L., Koch, G and Nichols, T. C. (2005). Porphyromonas gingivalis Bacteremia Induces Coronary and Aortic Atherosclerosis in Normocholesterolemic and Hypercholesterolemic Pigs. Arterioscler Thromb Vasc Biol 25, 1446-1451. [0122] Cantin, A. M. and Woods, D. E. (1999). Aerosolized Prolastin Suppresses Bacterial Proliferation in a Model of Chronic Pseudomonas aeruginosa Lung Infection. American Journal. of Respiratory and Critical Care Medicine 160, 1130-1135. [0123] Castro, K. G., Ward, J. W., Slutsker, L., Buehler, J. W., Jaffe, Jr. J. W., Berkelman, R. L., and Curran, J. W. (1992). 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. Morbid. Mortal. Weekly Rep. 91, 1-19. [0124] Cepinskas, G., Sandig, M., and Kvietys, P. R. (1999). PAF-induced elastase-dependent neutrophil transendothelial migration is associated with the mobilization of elastase to the neutrophil surface and localization to the migrating front. J. Cell Science 1.12, 1937-1945. [0125] Chowanadisai, W., Huang, J., Huang, N., and Lonnerdal, B. (2003). Stability of recombinant human alpha-1-antitrypsin produced in rice in infant formula. J Nutr Biochem 14, 386-393. [0126] Cottler-Fox, M. H., Lapidot, T., Petit, I., Kollet, O., DiPersio, J. F., Link, D., and Devine, S. (2003). Stem Cell Mobilization. Hematology 2003, 419-437. [0127] Courtney, M., Buchwalder, A., Tessier, L.-J.M., Benavente, A., Balland, A., Kohli,V., Lathe, R., Tolstoshev, P., and Lecocq, J. P. (1984). High-level production of biologically active human α1-antitrypsin in Escherichia coli. Proc Nati Acad Sci USA 81, 669-673. [0128] Csernok, E., Ludemann, J., Gross, W. L., and Bainton, D. F. (1990). Ultrastructural localization of proteinase 3, the target antigen of anti-cytoplasmic antibodies circulating in Wegener's granulomatosis. Am. J. Pathol. 137, 1113-1120. [0129] Current Protocols in Molecular Biology (2002). Greene Publishing Associates and Wiley-Intersciences, New York). [0130] Cygler, M., Rose, D. R., and Bundle, D. R. (1991). Recognition of a cell-surface oligosaccharide of pathogenic Salmonella by an antibody Fab fragment. Science 253, 442-445. [0131] Desrochers, P. E., Mookhtiar, K., Van Wart, H. E., Hasty, K. A., and Weiss, S. J. (1992). Proteolytic inactivation of alpha 1-proteinase inhibitor and alpha 1- antichyntotrypsin by oxidatively activated human neutrophil metalloproteinases. Journal of Biological Chemistry 267, 5005-5012. [0132] Dichtl, W., Moraga, F., Ares, M. P. S., Crisby, M., Nilsson, J., Lindgren, S., and Janciauskiene, S. (2000). The carboxyl-Terminal Fragment of [alpha]1-Antitrypsin Is Present in Atherosclerotic Plaques and Regulates Inflammatory Transcription Factors in Primary Human Monocytes. Molecular Cell Biology Research Communications 4, 50-61.
[0133] Elliott, P. R., Pei, X. Y., Dafforn, T. R., and Lomas, D. A. (2000). Topography of a 2.0 A structure of alphal-antitrypsin reveals targets for rational drug design to prevent conformational disease [In Process Citation]. Protein Sci 9, 1274-1281. [0134] Flotte, T. R., Brantly, M. L., Spencer, L. T., Byrne, B. J., Spencer, C. T., Baker, D. J., and Humphries, M. (2004). Phase I trial of intramuscular injection of a recombinant adeno-associated virus alpha 1-antitrypsin (rAAV2-CB-hAAT) gene vector to AAT-deficient adults. Hum Gene Ther 15, 93-128. [0135] Garwicz, D., Lennartsson, A., Jacobsen, S. E. W., Gullberg, U., and Lindmark, A. (2005). Biosynthetic profiles of neutrophil serine proteases in a human bone marrow-derived cellular myeloid differentiation model. Haematologica 90, 38-44. [0136] Girard, M., Mahoney, J., Wei, Q., van der Ryst, E., Muchmore, E., Barre-Sinoussi, F., and Fultz, P. N. (1998). Genital infection of female chimpanzees with human immunodeficiency virus type 1. AIDS Res Hum Retroviruses 14, 1357-1367. [0137] Graziadei, I., Gaggl, S., Kaserbacher, R., Braunsteiner, H., and Vogel, W. (1994). The acute-phase protein alpha 1-antitrypsin inhibits growth and proliferation of human early erythroid progenitor cells (burst-forming units-erythroid) and of human erythroleukemic cells (K562) in vitro by interfering with transferrin iron uptake. Blood 83, 260-268. [0138] Gullberg, U., Lindmark, A., Lindgren, G., Persson, A.-M., Nilsson, E., and Olsson, I. (1995). Carboxyl-terminal prodomain-deleted human leukocyte elastase and cathepsin G are efficiently targeted to granules and enzymatically activated in the rat basophilic/mast cell line RBL. J. Biol. Chem. 270, 12912-12918. [0139] Hooper, N. M, (2002). Proteases: a primer, Essays Biochem. 38, 1-8. [0140] Horwitz, M., Benson, K. F., Duan, Z., Li, F. Q., and Person, R. E. (2004). Hereditary neutropenia: dogs explain human neutrophil elastase mutations. Trends Mol, Med. 10, 163-170. [0141] Horwitz, M., Benson, K. F., Person, R. E., Aprikyan, A. G., and Dale, D. C. (1999). Mutations in ELA2, encoding neutrophil elastase, define a 21-day clock in cyclic haematopoiesis. Nat. Genet. 23, 433436. [0142] Janciauskiene, S. and Lindgren, S. (1999). Effects of fibrillar C-terminal fragment of cleaved alpha1-antitrypsin on cholesterol homeostasis in HepG2 cells. Hepatology 29, 434-442. [0143] Janciauskiene, S., Wright, H. T., and Lindgren, S. (1999). Atherogenic properties of human monocytes induced by the carboxyl terminal proteolytic fragment of alpha-1-antitrypsin. Atherosclerosis .147, 263-275. [0144] Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., and Akar, L. P. (2005). Transplantation of hematopoietic stem cells from the peripheral blood, J Cell Mol Med. 9, 37-50. [0145] Jean, F., Stella, K., Thomas, L., Lui, G., Xiang, Y., and Reason, A. J. (1998). α1-antitrypsin Portland, a bioengineered serpin highly selective for furin: Application as an antipathogenic agent. Proc Nati Acad Sci USA 95, 7293-7298.
[0146] Jeppsson, J. O., Lilja, H., and Johansson, M. (1985). Isolation and characterization of two minor fractions of alpha 1-antitrypsin by high-performance liquid chromatographic chromatofocusing. J. Chromatogr, 327, 173-177.
[0147] Joslin, G., Fallon, R. J., Bullock, J., Adams, S. P., and Perlmutter, D. H. (1991). The SEC receptor recognizes a pentapeptide neodomain of alpha-1- antitrypsin-protease. J. Biol. Chem. 266, 11282-11288.
Joslin, G., August, A. M., Adams, S., Fallon, R. J., Senior, R. M., and Perlmutter, D. H. (1992). The serpin-enzyme complex (SEC) receptor mediates the neutrophil chemotactic effect of α-.sub.1 antitrypsin-elastase complexes and amyloid-β peptide. J. Clin. Invest. 90, 1150-1154. [0148] Kindzelskii, A. L. and Petty, H. R. (2003). Intracellular Calcium Waves Accompany Neutrophil Polarization, Fortnylmethionylleucylphenylalanine Stimulation, and Phagocytosis: A High Speed Microscopy Study. J. Immunol. 170, 64-72. [0149] Kirschfink, M. (2002). C1-inhibitor and transplantation. Immunolobiology 205, 534-541. [0150] Kounnas, M. Z., Church, F. C., Argraves, W. S., and Strickland, D. K. (1996). Cellular internalization and degradation of antithrombin III-thrombin, heparin cofactor II-thrombin, and alpha 1-antitrypsin-trypsin complexes is mediated by the low density lipoprotein receptor-related protein. J. Biol. Chem. 27.1, 6523-6529.
[0151] Kushner, I. (1982). The phenomenon of the acute phase response. Ann. N. Y. Acad. Sci. 389, 39-47. [0152] Lapidot, T. and Petit, I. (2002). Current understanding of stem cell mobilization: The roles of chemokines, proteolytic enzymes, adhesion molecules, cytokines, and stromal cells. Exp. Hematol, 30, 973-981. [0153] Leonard, C. K., Spellman, M. W., Riddle, L., Harris, R. J., Thomas, J. N., and Gregory, T. J. (1987). Assignment of intrachain disulfide bonds and characterization of potential glycosylation. J. Biol. Chem. 265, 10373-10382. [0154] Li, W., Savinov, A. Y., Rozanov, D. V., Golubkov, V. S., Hedayat, H., Postnova, T. I., Golubkova, N. V., Linli, Y., Krajewski, S., and Strongin, A. Y. (2004). Matrix Metalloproteinase-26 Is Associated with Estrogen-Dependent Malignancies and Targets {alpha} 1-Antitrypsin Serpin. Cancer Res 64, 8657-8665. [0155] Luisetti, M. and Travis, J. (1996). Bioengineering: alpha 1-antiproteinase inhibitor site-specific mutagenesis. The prospect for improving the inhibitor. Chest 110, 278-283. [0156] Marinaki, S., Neumann, I., Kalsch, A, I., Grimminger, P., Breedijk, A., Birck, R., Schmitt, W., Waldherr, R., Yard, B. A., and van der Woude, F. J. (2005). Abnormalities of CD4+ T cell subpopulations in ANCA-associated vasculitis. Clinical and Experimental Immunology 140, 181-191. [0157] Mashiba, S., Wada, Y., Takeya, M., Sugiyama, A., Hamakubo, T., Nakamnra, A., Noguchi, N., Niki, E., Izumi, A., Kobayashi, M., Uchida, K., and Kodama, T. (2001). In Vivo Complex Formation of Oxidized {alpha}1-Antitrypsin and LDL. Arterioscler Thromb Vasc Biol 21, 1801-1808. [0158] Mast, A. E., Enghild, J. J., Nagase, H., Suzuki, K., Pizzo, S. V., and Salvesen, G. (1991). Kinetics and physiologic relevance of the inactivation of alpha 1- proteinase inhibitor, alpha 1-antichymotrypsin, and antithrombin III by matrix metalloproteinases-1 (tissue collagenase), -2 (72-kDa gelatinase/type IV collagenase), and -3 (stromelysin). Journal of Biological Chemistry 266,15810-15816. [0159] Mellet, P., Boudier, C., Mely, Y., and Bieth, J. D. (1998). Stopped Flow Fluorescence Energy Transfer Measurement of the Rate Constants Describing the Reversible Formation and the Irreversible Rearrangement of the Elastase-alpha 1-Proteinase Inhibitor Complex. Journal of Biological Chemistry 273, 9119-9123. [0160] Messmer, D., Jacque, J.-M., Santisteban, C., Bristow, C. L., Han, S.-Y., Villamide-Herrera, L., Mehlhop, E. R., Marx, P. A., Steinman, R. M., Gettie, A., and Pope, M. (2002). Endogenously expressed nef uncouples cytokine and chemokine production from membrane phenotypic maturation in dendritic cells. J. Immunol. 169, 4172-4182. [0161] Methods in Enzymology. Proteolytic Enzymes. Perlmann, G. E. and Lorand, L. [19]. 1970. Acaemic Press. Colowick, S. P. and Kaplan, N. 0. [0162] Ref Type: Serial (Book, Monograph) [0163] Moore, J. P., Sattentau, Q. E., Wyatt, R., and Sodroski, J. (1994). Probing the structure of the human immunodeficiency virus surface glycoprotein gp120 with a panel of monoclonal antibodies, J. Virol. 68, 469-484. [0164] Nejjari, M., Berthet, V., Rigot, V., Laforest, S., Jacquier, M. F., Seidah, N. G., Remy, L., Bruyneel, E., Scoazec, J. Y., Marvaldi, J., and Luis, J. (2004). Inhibition of Proprotein Convertases Enhances Cell Migration and Metastases Development of Human Colon Carcinoma Cells in a Rat Model. Am J Pathol 164, 1925-1933. [0165] Nukiwa, T., Satoh, K., Brantly, M. L., Ogushi, F., Fells, G. A., Courtney, M., and Crystal, R. G. (1986). Identification of a second mutation in the protein-coding sequence of the Z type alpha 1-antitrypsin gene. J. Biol. Chem. 261, 15989-15994. [0166] OMIM. Online Mendelian Inheritance in Man, OMIM™. McKusick-Nathans Institute for Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.). 2000. [0167] Ref Type: Data File [0168] Palucka, A. K., Dhodapkar, M. V., Paczesny, S., Ueno, H., Fay, J., and Banchereau, J. (2005). Boosting vaccinations with peptide-pulsed CD34+ progenitor-derived dendritic cells can expand long-lived melanoma peptide-specific CD8+ T cells in patients with metastatic melanoma. J Immunother. 28, 158-168. [0169] Parfrey, H., Mahadeva, R., Ravenhill, N. A., Zhou, A., Dafforn, T. R., Foreman, R. C., and Lomas, D. A. (2003). Targeting a surface cavity of α.sub.1-antitrypsin to prevent conformational disease. J. Biol. Chem. 278, 33060-33066. [0170] Pei, D., Majmudar, G., and Weiss, S. J. (1994). Hydrolytic inactivation of a breast carcinoma cell-derived serpin by human stromelysin-3. J. Biol. Chem. 269, 25849-25855. [0171] Pendergraft, W. F., Preston, G. A., Shah, R. R., Tropsha, A., Carter, C. W., Jennette, J. C., and Falk, R. J. (2003). Autoimmunity is triggered by cPR-3(105-201), a protein complementary to human autoantigen proteinase-3. Nat Med. 10 Epub 2003 Dec. 07., 72-79. [0172] Percherancier, Y., Berchiche, Y., Slight, I., Volkmer-Engert, R., Tamamura, H., Fujii, N., Bouvier, M., and Heveker, N. (2005). Bioluminescence resonance energy transfer reveals ligand-induced conformational changes in CXCR4 homo- and heterodimers. Journal of Biological Chemistry M411151200. [0173] Perkins, S. J., Smith, K. F., Nealis, A. S., Haris, P. I., Chapman, D., Bauer, C. J., and Harrison, R. A. (1.992). Secondary structure changes stabilize the reactive-centre cleaved form of SERPINs. J. Mol. Bi.ol. 228, 1235-4254. [0174] Person, R. E., Li, F.-Q., Duan, Z., Benson, K. F., Wechsler, J., Papadaki, H. A., Eliopoulos, G., Kaufman, C., Bertolone, S. J., Nakamoto, B., Papayannopoulou, T., Gri{acute over (m)}es, H, L., and Horwitz, M. (2003). Mutations in proto-oncogene GF11 cause human neutropenia and target ELA2. Nature Genetics 34, 308-312. [0175] Petit, I., Szyper-Kravitz, M., Nagler, A., Lahav, M., Peled, A., Habler, L., Ponomaryov, T., Taichman, R. S., Arenzana-Seisdedos, F., Fujii, N., Sandbank, J., Zipori, D., and Lapidot, T. (2002). G-CSF induces stem cell mobilization by decreasing bone marrow SDF-1 and up-regulating CXCR4. Nature Immunol 3, 687-694. [0176] Poller, W., Willnow, T. E., Hilpert, J., and Herz, J. (1995). Differential recognition of alpha 1-antitrypsin-elastase and alpha 1-antichymotiypsin-cathepsin-G complexes by the low density lipoprotein receptor-related protein. J. Biol. Chem. 270, 2841-2845. [0177] Pratt, C. W., Roche, P. A., and Pizzo, S. V. (1987), The role of inter-a-trypsin inhibitor and other proteinase inhibitors in the plasma clearance of neutrophil elastase and plasmin, Arch. Biochern. Biophys. 258, 591-599. [0178] Ratner, L., Haseltine, W., Patarca, R., Livak, K. J., Starcich, B., Joseph, S. F., Doran, E. R., Rafalski, J. A., Whitehorn, E. A., Baumeister, K., and et al. (1985). Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature 313, 277-284. [0179] Rooney, C. P., Taggart, C., Coakley, R., McElvaney, N. G., and O'Neill, S. J. (2001). Anti-Proteinase 3 Antibody Activation of Neutrophils Can Be Inhibited by alpha 1-Antitrypsin. American Journal of Respiratory Cell and Molecular Biology 24, 747-754. [0180] Rutjens, E. B.-J. S., Verschoor, E., Bogers, W., Koopman, G., and Heeney, J. (2003). Lentivirus infections and mechanisms of disease resistance in chimpanzees. Front. Biosci. 8, d1134-1145. [0181] Sandler, M., Gemperli, B. M., Hanekom, C., and Kuhn, S. H. (1988). Serum α.sub.1-protease inhibitor in diabetes mellitus: reduced concentration and impaired activity. Diabetes Res Clin Pract 5, 249-255. [0182] Sandoval, C., Stojanova, A., DiFalco, M. R., and Congote, L. F. (2003). The fusion of IGF I with stromal cell-derived factor I or [alpha]1 proteinase inhibitor alters their mitogenic or chemotactic activities while keeping their ability to inhibit HIV-1-gp120 binding. Biochemical Pharmacology 65, 2055-2063. [0183] Schuler, G., Schuler-Thurner, B., and Steinman, R. M. (2003). The use of dendritic cells in cancer immunotherapy. Current Opinion in Immunology 15, 138-147. [0184] Sifers, R. N., Brashears-Macatee, S., Kidd, V. J., Muensch, H., and Woo, S. L. (1988). A frameshift mutation results in a truncated alpha 1-antitrypsin that is retained within the rough endoplasmic reticulum. Journal of Biological Chemistry 263, 7330:-7335. [0185] Sinico, R. A., Radice, A. N. T. O., kehata, M. A. S. A., iammerresi, G. A. I. A., orace, C. A. T. E., rrigo, G. I. R. O., ollini, B. R. U. N., i Vecchi, M. A. U. R., and Iacomini, J. (2005), Anti-C1q Autoantibodies in Lupus Nephritis: Prevalence and Clinical Significance. Ann NY Acad Sci 1050, 193-200. [0186] Song, G., Goudy, K., Campbell-Thompson, M., Wasserfall, C., Scott-Jorgensen, M., Wang, J., Tang, Q., Crawford, J. M., Ellis, T. M., Atkinson, M. A., and Flotte, T. R. (2004). Recombinant adeno-associated virus-mediated alpha-1. antitrypsin gene therapy prevents type I diabetes in NOD mice. Gene Ther 11, 181-186. [0187] Talmud, P. J., Martin, S., Steiner, G., Flavell, D. M., Whitehouse, D. B., Nagl, S., Jackson, R., Taskinen, M. R., Frick, M. H., Nieminen, M. S., Kesaniemi, Y. A., Pasternack, A., Humphries, S. E., Syvanne, M., and the Diabetes Atherosclerosis Intervention Study Investigators (2003). Progression of Atherosclerosis Is Associated With Variation in the {alpha}1-Antitrypsin Gene. Arterioscler Thromb Vasc Biol 23, 644-649. [0188] Tavor. S., Petit, I., Porozov, S., Goichberg, P., Avigdor, A., Sagiv, S., Nagler, A., Naparstek, E., and Lapidot, T. (2005). Motility, proliferation and egress to the cirenlation of human AML cells in transplanted NOD/SCID mice are elastase dependent. Blood 106, 2120-2127. [0189] Terashima, M., Murai, T., Kawamura, M., Nakanishi, S., Stoltz, T., Chen, L., Drohan, W., Rodriguez, R. L., and Katoh, S. (1999). Production of functional human α1-antitrypsin by plant cell culture. Appl Microbiol Biotechnol 52, 516-523. [0190] Virella, G., Wohltmann, H., Sagel, J., Lopes-Virella, M. F. L., Kilpatrick, M., Phillips, C. B., and Colwell, J. (1981). Soluble immune complexes in patients with Diabetes Mellitus: Detection and pathological significance. Diabetologia 21, 184-191. [0191] Weaver, A. M., Hussaini, I. M., Mazar, A., Henkin, J., and Gonias, S. L. (1997). Embryonic Fibroblasts That Are Genetically Deficient in Low Density Lipoprotein Receptor-related Protein Demonstrate Increased Activity of the Urokinase Receptor System and Accelerated Migration on Vitronectin. Journal of Biological Chemistry 272, 14372-14379. [0192] Wei, X., Decker, J. M., Wang, S., Hui, H., Kappes, J. C., Wu, X., Salazar-Gonzalez, J. F., Salazar, M. G., Kilby, J. M., Saag, M. S., Komarova, N. L., Nowak, M. A., Hahn, B. H., Kwong, P. D., and Shaw, G. M. (2003). Antibody neutralization and escape by HIV-1. Nature 422, 307-312. [0193] Winkler, I. G., Hendy, J., Coughlin, P., Horvath, A., and Levesque, J. P. (2005). Serine protease inhibitors serpinal and serpina3 are down-regulated in bone marrow during hematopoietic progenitor mobilization. The Journal of Experimental Medicine 201, 1077-1088. [0194] Wolf, K., Muller, R., Borgmann, S., Brocker, E. B., and Friedl, P. (2003). Amoeboid shape change and contact guidance: T-lymphocyte crawling through fibrilar collagen is independent of matrix remodeling by MMPs and. other proteases. Blood 102, 3262-3269. [0195] Wright, S. D. and Meyer, B. C. (1986). Phorbol esters cause sequential activation and deactivation of complement receptors on polymorphonuclear leukocytes. J. Immunol. 136, 1759-1764.
[0196] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will be apparent to those skilled in the art from the foregoing description and the accompanying figures.
[0197] Patents, patent applications, publications, product descriptions, and protocols are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes.