METHOD OF TREATMENT
20200289559 ยท 2020-09-17
Inventors
- Maria A. Degli-Esposti (Nedlands, AU)
- Geoffrey R. Hill (Hawthorne, AU)
- Christopher E. Andoniou (Woodbridge, AU)
- Peter Fleming (Samson, AU)
Cpc classification
A61K2039/55
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
International classification
Abstract
This invention relates generally to the inhibition of cytomegalovirus (CMV) reactivation in immunosuppressed subjects, including subjects receiving hematopoietic or solid organ transplants. The present invention is particularly relevant for the treatment of CMV reactivation or infection in subjects with graft-versus-hosts disease (GVHD) or under immunosuppressive therapy.
Claims
1. A method for inhibiting cytomegalovirus (CMV) reactivation in a transplant recipient with a CMV-seropositive serological status, the method comprising obtaining serum and/or plasma from the transplant recipient prior to transplantation and administering an effective amount of the serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after transplantation, wherein the serum or plasma comprises one or more anti-CMV antibodies.
2. The method of claim 1, wherein the transplant is a solid organ transplant.
3. The method of claim 1, wherein the transplant is a bone-marrow transplant or a hematopoietic stem cell transplant.
4. The method of any one of claims 1 to 3, wherein the component is an isolated or enriched antibody fraction.
5. The method of any one of claims 1 to 4, wherein the component is isolated anti-CMV antibodies.
6. The method of claim 5, wherein the isolated anti-CMV antibodies are IgG.sup.CMV antibodies.
7. The method of any one of claims 1 to 6, wherein the serum or plasma, or a component thereof, comprises anti-CMV antibodies with specificity to two or more CMV antigens.
8. The method of any one of claims 1 to 7, wherein the transplant recipient has graft-versus-host disease (GVHD).
9. The method of any one of claims 1 to 8, wherein the anti-CMV antibodies are specific for CMV strains present in the transplant recipient.
10. The method of any one of claims 1 to 9 wherein CMV serological status is determined by detecting CMV protein or nucleic acid in a blood sample.
11. The method of claim 10, wherein CMV serological status is determined by PCR.
12. The method of claim 10, wherein CMV serological status is determined by detecting anti-CMV antibodies.
13. The method of any one of claims 1 to 12, wherein the transplant donor is CMV-seropositive.
14. The method of claim 13, further comprising obtaining serum and/or plasma from the CMV-seropositive transplant donor and administering an effective amount of the donor serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with, or after, transplantation, wherein the donor serum or plasma comprises one or more anti-CMV antibodies.
15. The method of claim 14, wherein the anti-CMV antibodies are specific for CMV strains present in the CMV-seropositive transplant donor.
16. A method for inhibiting CMV reactivation in a subject with a CMV-seropositive serological status following the administration of an immunosuppressive agent, the method comprising obtaining serum and/or plasma from the subject prior to administration of the immunosuppressive agent and administering an effective amount of the serum and/or plasma, or a component thereof, to the subject concomitant with, or after, administration of the immunosuppressive agent, wherein the serum or plasma comprises one or more anti-CMV antibodies.
17. The method of claim 16, wherein the component is an isolated or enriched antibody fraction.
18. The method of claim 17, wherein the component is isolated anti-CMV antibodies.
19. The method of claim 18, wherein the isolated anti-CMV antibodies are IgG.sup.CMV antibodies.
20. The method of any one of claims 16 to 19, wherein the serum or plasma, or a component thereof, comprises anti-CMV antibodies with specificity to two or more CMV antigens.
21. The method of any one of claims 16 to 20, wherein the anti-CMV antibodies are specific for CMV strains present in the CMV-seropositive subject.
22. The method of any one of claims 16 to 21, wherein the subject is a transplant recipient.
23. The method of claim 22, wherein the subject has GVHD.
24. The method of claim 22 or 23, wherein the transplant donor is CMV-seropositive.
25. The method of claim 24, further comprising obtaining serum and/or plasma from the transplant donor and administering an effective amount of the donor serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after, transplantation, wherein the donor serum or plasma comprises one or more anti-CMV antibodies.
26. The method of claim 25, wherein the anti-CMV antibodies are specific for CMV strains present in the CMV-seropositive transplant donor.
27. The method of any one of claims 16 to 26, wherein the subject has an immune or autoimmune disorder.
28. The method of claim 27, wherein the immune or autoimmune disorder is selected from the group consisting of type I diabetes, rheumatoid arthritis, systemic lupus erythematosus (SLE), multiple sclerosis, myasthenia gravis, Sjogren's syndrome or acquired immunodeficiency syndrome (AIDS).
29. The method of any one of claims 16 to 28, wherein the subject has immune-related adverse events (irAEs) following treatment with a checkpoint inhibitor.
30. The method of any one of claims 16 to 29, wherein CMV serological status is determined by detecting CMV protein or nucleic acid in a blood sample.
31. The method of claim 30, wherein CMV serological status is determined by PCR.
32. The method of claim 30, wherein CMV serological status is determined by detecting anti-CMV antibodies.
33. A method for preventing CMV infection in a transplant recipient, wherein the transplant donor has a CMV-seropositive serological status, the method comprising obtaining serum and/or plasma from the transplant donor prior to transplantation and administering an effective amount of the serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after transplantation, wherein the serum or plasma comprises one or more anti-CMV antibodies.
34. The method of claim 33, wherein the anti-CMV antibodies are specific for CMV strains present in the CMV-seropositive transplant donor.
35. The method of claim 33 or 34, wherein the transplant recipient has a CMV-seronegative serological status.
36. A method for inhibiting CMV viral spread a transplant recipient with a CMV-seropositive serological status, the method comprising obtaining serum and/or plasma from the transplant recipient prior to transplantation and administering an effective amount of the serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after, transplantation, wherein the serum or plasma comprises one or more anti-CMV antibodies.
37. The method of claim 36, wherein the transplant is a solid organ transplant.
38. The method of claim 37, wherein the transplant is a bone-marrow transplant or a hematopoietic stem cell transplant.
39. The method of any one of claims 36 to 38, wherein the component is an isolated or enriched antibody fraction.
40. The method of any one of claims 36 to 39, wherein the component is isolated anti-CMV antibodies.
41. The method of claim 40, wherein the isolated anti-CMV antibodies are IgG.sup.CMV antibodies.
42. The method of any one of claims 36 to 41, wherein the serum or plasma, or a component thereof, comprises anti-CMV antibodies with specificity to two or more CMV antigens.
43. The method of any one of claims 36 to 42, wherein the transplant recipient has GVHD.
44. The method of any one of claims 36 to 43, wherein the anti-CMV antibodies are specific for CMV strains present in the CMV-seropositive transplant recipient.
45. The method of any one of claims 36 to 44, wherein CMV serological status is determined by detecting CMV protein or nucleic acid in a blood sample.
46. The method of claim 45, wherein CMV serological status is determined by PCR.
47. The method of claim 45, wherein CMV serological status is determined by detecting CMV antibodies.
48. The method of any one of claims 36 to 47, wherein the transplant donor is CMV-seropositive.
49. The method of claim 48, further comprising obtaining serum and/or plasma from the CMV-seropositive transplant donor and administering an effective amount of the donor serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with, or after, transplantation, wherein the donor serum or plasma comprises one or more anti-CMV antibodies.
50. The method of claim 49, wherein the anti-CMV antibodies are specific for CMV strains present in the CMV-seropositive transplant donor.
51. A method for inhibiting viral spread in a transplant recipient with a CMV-seronegative serological status, wherein the transplant donor has a CMV-seropositive serological status, the method comprising obtaining serum and/or plasma from the transplant donor and administering an effective amount of the serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after, transplantation, wherein the serum or plasma comprises one or more anti-CMV antibodies.
52. The method of claim 51, wherein the anti-CMV antibodies are specific for CMV strains present in the CMV-seropositive transplant donor.
53. Use of serum or plasma, or a component thereof, from a CMV-seropositive transplant recipient in the manufacture of a medicament for the inhibition of CMV reactivation in the transplant recipient.
54. Use of serum or plasma, or a component thereof, from a CMV-seropositive transplant donor in the manufacture of a medicament for the inhibition of CMV reactivation or prevention of CMV infection in a transplant recipient.
55. Use of serum or plasma, or a component thereof, from a CMV-seropositive transplant recipient in the manufacture of a medicament for the inhibition of CMV viral spread in the transplant recipient.
56. Use of serum or plasma, or a component thereof, from a CMV-seropositive transplant donor in the manufacture of a medicament for the inhibition of CMV viral spread in a transplant recipient.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Embodiments of the disclosure are described herein, by way of non-limiting example only, with reference to the accompanying drawings.
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
DETAILED DESCRIPTION OF THE INVENTION
[0021] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. All patents, patent applications, published applications and publications, databases, websites and other published materials referred to throughout the entire disclosure, unless noted otherwise, are incorporated by reference in their entirety. In the event that there is a plurality of definitions for terms, those in this section prevail. Where reference is made to a URL or other such identifier or address, it is understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference to the identifier evidences the availability and public dissemination of such information.
[0022] The articles a, an and the include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to an agent includes a single agent, as well as two or more agents; reference to a treatment includes a single treatment, as well as two or more treatments; and so forth.
[0023] Throughout this specification, unless the context requires otherwise, the word comprise, or variations such as comprises or comprising, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.
[0024] As used herein, the term agent includes a compound that induces a desired pharmacological and/or physiological effect. The term also encompasses pharmaceutically acceptable and pharmacologically active ingredients of those compounds specifically mentioned herein including but not limited to salts, esters, amides, prodrugs, active metabolites, analogs and the like. When the above term is used, it will be understood by persons skilled in the art that this includes the active agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs, etc. The term agent is not to be construed narrowly but extends to small molecules, proteinaceous molecules such as peptides, polypeptides and proteins as well as compositions comprising them and genetic molecules such as RNA, DNA and mimetics and chemical analogs thereof as well as cellular agents. The term agent also includes a cell which is capable of producing and secreting the agents referred to herein, as well as a polynucleotide comprising a nucleotide sequence that encode such agents. Thus, the term agent extends to nucleic acid constructs including vectors such as viral or non-viral vectors, expression vectors and plasmids for expression in and secretion in a range of cells.
[0025] The term subject as used herein refers to mammals and includes humans, primates, livestock animals (e.g. sheep, pigs, cattle, horses, donkeys), laboratory test animals (e.g. mice, rabbits, rats, guinea pigs), companion animals (e.g. dogs, cats) and captive wild animals (e.g. foxes, kangaroos, deer). Typically, the mammal is human, laboratory test animal or companion animal. More typically, the mammal is a human.
[0026] As used herein the term effective amount includes within its meaning a non-toxic but sufficient amount of serum and/or plasma, or a component thereof, which is effective for inhibiting CMV reactivation or for treating or preventing CMV infection. The exact amount required will vary from subject to subject depending on factors such as the subject being treated, the age and general health and wellbeing of the subject and the mode of administration and so forth. Thus, it is not possible to specify an exact effective amount. However, for any given case, an appropriate effective amount may be determined by one of ordinary skill in the art using only routine experimentation.
[0027] As used herein the terms treating, treatment, and the like refer to any and all methods which remedy, prevent, hinder, retard, ameliorate, reduce, delay or reverse the progression of CMV infection or one or more undesirable symptoms thereof in any way. Thus the terms treating and the like are to be considered in their broadest context. For example, treatment does not necessarily imply that a patient is treated until total recovery. CMV infection is typically characterized by multiple symptoms, and thus the treatment need not necessarily remedy, prevent, hinder, retard, ameliorate, reduce, delay or reverse all of said symptoms. Methods of the present disclosure may involve treating the CMV infection in terms of reducing or ameliorating the occurrence of a highly undesirable event or symptom associated with the CMV infection or an outcome of the progression of the infection, but may not of itself prevent the initial occurrence of the event, symptom or outcome. Accordingly, treatment includes amelioration of the symptoms of CMV infection or preventing or otherwise reducing the risk of developing symptoms of CMV infection.
[0028] In the context of the present disclosure, the terms inhibiting and variations thereof such as inhibition and inhibits do not necessarily imply the complete inhibition of the specified event, activity or function. Rather, the inhibition may be to an extent, and/or for a time, sufficient to produce the desired effect. Inhibition may be prevention, retardation, reduction or otherwise hindrance of the event, activity or function. Such inhibition may be in magnitude and/or be temporal in nature. In particular contexts, the terms inhibit and prevent, and variations thereof may be used interchangeably.
Inhibition of CMV Reactivation
[0029] The present disclosure describes the inhibition of CMV reactivation in CMV-seropositive transplant recipients, which is predicated on the finding that antibodies produced by the humoral immune response are sufficient to inhibit or prevent CMV reactivation. Accordingly, provided herein are methods for inhibiting CMV reactivation in a CMV-seropositive transplant recipient by administering serum and/or plasma from the transplant recipient, wherein the serum or plasma comprises one or more anti-CMV antibodies that are specific for the CMV strains present in the transplant recipient. The disclosure also provides methods for inhibiting or preventing CMV reactivation in CMV-seropositive donor organs, tissues or cells by administering serum and/or plasma from the transplant donor to the transplant recipient, wherein the serum or plasma comprises one or more anti-CMV antibodies that are specific for the CMV strains present in the donor organs, tissues or cells.
[0030] Accordingly, provided herein are methods for inhibiting CMV reactivation in a CMV-seropositive transplant recipient, the method comprising obtaining serum and/or plasma from the transplant recipient prior to transplantation and administering an effective amount of the serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after, transplantation, wherein the serum or plasma comprises one or more anti-CMV antibodies.
[0031] The term CMV reactivation as used herein refers to the reactivation of a latent CMV infection. CMV reactivation can result from a number of different stimuli, including immunosuppression and inflammation. For example, CMV reactivation can occur following transplantation.
[0032] The term CMV serological status as used herein refers to the presence or absence of CMV protein or nucleic acid in a blood sample. The term CMV-seropositive is used to refer to a transplant recipient, transplant donor, or other subject with antibodies to CMV or CMV protein or nucleic acid present in their blood, which is indicative of a latent CMV infection. The term CMV-seronegative is used to refer to a transplant recipient, transplant donor, or other subject without antibodies to CMV or CMV protein or nucleic acid present in their blood, which is indicative of the absence of a latent CMV infection.
[0033] The skilled person will appreciate that the determination of CMV serological status in accordance with the present disclosure may be performed using a variety of techniques known in the art. In exemplary embodiments, CMV serological status may be determined by detecting antibodies to CMV or CMV protein or nucleic acid in a blood sample. In an embodiment, polymerase chain reaction (PCR)-based methods can be used to detect CMV nucleic acids. In another embodiment, CMV serological status may be determined by detecting anti-CMV antibodies. Suitable methods for the detection of anti-CMV antibodies include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), western blotting and immunohistochemistry.
[0034] In an exemplary embodiment, the methods described herein comprise the determination of the CMV serological status of the transplant recipient, transplant donor or other subject. Alternatively, the CMV serological status may be known. Determination of CMV serological status is routinely made in, for example, young adults, pregnant women or immune-compromised subjects with flu-like symptoms.
[0035] The terms transplant or graft mean refers to an organ, tissue or cell that has been transplanted from one subject to a different subject, or transplanted within the same subject (e.g., to a different area within the subject). Organs such as liver, kidney, heart or lung, or other body parts, such as bone or skeletal matrix such as bone marrow, tissue, such as skin, cornea, intestines, endocrine glands, or stem cells or various types, or hematopoietic cells including hematopoietic stem and progenitor cells, are all examples of transplants. The graft or transplant can be an allograft, autograft, isograft, or xenograft. The term allograft refers to a graft between two genetically non-identical members of a species. The term autograft refers to a graft from one area to another on a single individual. The term isograft or syngraft refers to a graft between two genetically identical individuals. The term xenograft refers to a graft between members of different species.
[0036] In exemplary embodiments, the transplant may be a solid organ transplant, a bone-marrow transplant or a hematopoietic stem cell transplant.
[0037] In particular embodiments of the present disclosure, the serum and/or plasma of CMV-seropositive transplant recipients are administered before, concomitant with or after transplantation to inhibit CMV reactivation.
[0038] The skilled person will appreciate that serum is a heterogeneous mixture of components, including but not limited to electrolytes, antibodies, antigens, hormones and any exogenous substances (e.g., drugs and microorganisms). In an exemplary embodiment, an effective amount of serum is administered to a transplant recipient before, concomitant with, or after transplantation.
[0039] Similarly, the skilled person would also appreciate that plasma is a heterogeneous mixture of components including but not limited to proteins (e.g., serum albumins, globulins and fibrinogen), glucose, clotting factors, electrolytes, hormones, carbon dioxide and oxygen. Plasma differs from serums in that it contains fibrinogen and clotting factors. In an exemplary embodiment, an effective amount of plasma is administered to a transplant recipient before, concomitant with, or after transplantation.
[0040] In an exemplary embodiment, an effective amount of a component of serum or plasma is administered to a transplant recipient before, concomitant with, or after transplantation. Suitable components include an isolated or enriched antibody fraction and isolated anti-CMV antibodies.
[0041] The term antibody as used herein broadly refers to any immunoglobulin (Ig) molecule comprised of four polypeptide chains, two heavy (H) chains and two light (L) chains, or any functional fragment, mutant, variant, or derivation thereof, which retains the essential epitope features of an Ig molecule. Such mutant, variant, or derivative antibody formats are known in the art.
[0042] In a full size antibody, each heavy chain comprises a heavy chain variable region (HCVR or VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain comprises a light chain variable region (LCVR or VL) and a light chain constant region, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass.
[0043] The skilled person will appreciate that isolation or enrichment of the antibody fraction of serum or plasma will increase the ratio of antibodies present relative to other serum or plasma components. This is not limited to a particular antibody species. Thus, the isolated or enriched antibody fraction will comprise antibodies with specificity to a broad range of different viral antigens, including for example, antigens from other viruses such as adenovirus, Epstein-Barr virus and BK virus. In an exemplary embodiment, the component is isolated anti-CMV antibodies. The skilled person will appreciate that isolated anti-CMV antibodies will exhibit specificity to a diverse range of CMV species and antigens and may be of any type, class or subclass. In an exemplary embodiment, the isolated anti-CMV antibodies are IgG.sup.CMV antibodies.
[0044] The term cytomegalovirus or CMV is not intended to be limited to a particular CMV strain or species. The extent of strain diversity in single CMV-seropositive individuals has been previously shown (e.g., Novak et al., (2008), Journal of Clinical Microbiology, 46(3): 882-886; Binder et al., (1999), Journal of Virological Methods, 78153-78162; Coaquette et al., (2004), Clinical Infection and Disease, 39155-39161; and Rasmussen et al., (1997), Journal of Infection and Disease, 175179-175184). Accordingly, the skilled person would appreciate that CMV-seropositive transplant recipients, transplant donors or other subjects contemplated by the present disclosure may be infected with multiple strains of CMV.
[0045] In particular embodiments of the present disclosure, the serum or plasma, or a component thereof comprises anti-CMV antibodies with specificity to two or more CMV antigens. The use of multiple antigens is a preferred method for the inhibition of CMV reactivation as a single antigen directed antibody is unlikely to provide broad protection for the diverse range of CMV strains that are present in CMV-seropositive transplant recipients, transplant donors or other subjects contemplated by the present disclosure.
[0046] The present disclosure also provides a method for inhibiting CMV reactivation in CMV-seropositive subjects in other contexts of immunosuppression. For example, provided herein is a method for inhibiting CMV reactivation in a CMV-seropositive subject following the administration of an immunosuppressive agent, the method comprising obtaining serum and/or plasma from the subject prior to administration of the immunosuppressive agent and administering an effective amount of the serum and/or plasma, or a component thereof, to the subject before, concomitant with or after administration of the immunosuppressive agent, wherein the serum or plasma comprises one or more anti-CMV antibodies.
[0047] Exemplary immunosuppressive agents that may be employed in accordance with the present disclosure include, but are not limited to corticosteroids (e.g., prednisone, prednisolone, fludarabine, budesonide and alemtuzumab), calcineurin inhibitors (e.g., cyclosporine and tacrolimus), mTOR inhibitors (e.g., sirolimus, everolimus and rapamycin) and IMDH inhibitors (e.g., azathioprine, leflunomide and mycophenolate).
[0048] In an exemplary embodiment, the subject is a transplant recipient. Immunosuppression in transplant recipients is multifactorial and immunosuppression may result from the recipient's primary disease, or from the preparatory regimen. Alternatively, immunosuppression in transplant recipients can also arise from GVHD or from the treatment of GVHD. Accordingly, in an exemplary embodiment, the subject has GVHD.
[0049] The administration of immunosuppressive agents is also common in the treatment of immune or autoimmune disorders. The term immune or autoimmune disorder includes, but is not limited to type I diabetes, rheumatoid arthritis, systemic lupus erythematosus (SLE), multiple sclerosis, myasthenia gravis, Sjogren's syndrome or acquired immunodeficiency syndrome (AIDS).
[0050] In an exemplary embodiment, the subject has immune-related adverse events (irARs) following treatment with a checkpoint inhibitor. It has been shown that CMV reactivation occurs in patients with checkpoint-inhibitor induced irARs, such as immune-related diarrhoea and colitis (Franklin et al., (2017), European Journal of Cancer, 86: 248-256). The term checkpoint inhibitor as used herein refers to any agent that inhibits immune checkpoints. Examples of checkpoint inhibitors include, but are not limited to, anti-CTLA-4 antibodies (e.g., ipilimumab), anti-PD-1 antibodies (e.g., nivolumab and pembrolizumab) and combinations thereof.
Inhibition of Viral Spread
[0051] The present disclosure describes the inhibition of CMV viral spread in CMV-seropositive transplant recipients by administering serum and/or plasma from the transplant recipient, wherein the serum or plasma comprises one or more anti-CMV antibodies. The disclosure also provides methods for inhibiting or preventing CMV viral spread in CMV-seropositive donor organs, tissues or cells by administering serum and/or plasma from the transplant donor to the transplant recipient, wherein the serum or plasma comprises one or more anti-CMV antibodies.
[0052] The term viral spread as used herein refers to the cell-to-cell transmission and cell-free transmission of virus within a host. Accordingly, skilled persons would appreciate that viral spread may occur within a host (i.e., transplant recipient) following reactivation of a latent CMV infection, or from donor organs, tissue or cells derived from a CMV-seropositive donor that is transmitted to other cells in a CMV-seropositive or CMV-seronegative transplant recipient following transplantation.
Treatment or Prophylaxis
[0053] The findings described herein offer novel opportunities for the treatment or prevention of CMV infection following transplantation, where the transplant recipient and/or transplant donor are CMV-seropositive.
[0054] Accordingly, embodiments of the present disclosure provide methods for treating or preventing CMV infection in a CMV-seropositive transplant recipient, the method comprising obtaining serum and/or plasma from the transplant recipient prior to transplantation and administering an effective amount of the serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after transplantation, wherein the serum or plasma comprises one or more anti-CMV antibodies.
[0055] In another embodiment, the present disclosure provides methods for preventing CMV infection in a transplant recipient with a CMV-seronegative serological status, wherein the transplant donor has a CMV-seropositive serological status, the method comprising obtaining serum and/or plasma from the transplant donor prior to transplantation and administering an effective amount of the serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after transplantation, wherein the serum or plasma comprises one or more anti-CMV antibodies.
[0056] The skilled person will appreciate that the transplant donor may be CMV-seropositive. The CMV-seropositive transplant donor will have unique range of anti-CMV antibodies that that may be distinct from the transplant recipient or the transplant recipient may be CMV-seronegative. Thus, the method for inhibiting CMV reactivation in accordance with the present disclosure may or may not require the administration of serum and/or plasma from the transplant donor to treat or prevent a CMV infection arising from the transplanted cells or tissue.
[0057] In exemplary embodiments, the method for treating or preventing CMV infection in a CMV-seropositive transplant recipient described hereinbefore further comprises obtaining serum and/or plasma from the CMV-seropositive transplant donor and administering an effective amount of the donor serum and/or plasma, to the transplant recipient before, concomitant with or after transplantation.
[0058] Also provided herein is a method for treating or preventing CMV infection in a transplant recipient, wherein the transplant donor is CMV-seropositive, the method comprising obtaining serum and/or plasma from the transplant donor and administering an effective amount of the serum and/or plasma, or a component thereof, to the transplant recipient before, concomitant with or after transplantation, wherein the serum or plasma comprises one or more anti-CMV antibodies.
Administration
[0059] The serum or plasma, or a component thereof, according to the present disclosure may be administered to the transplant recipient before, concomitant with or after transplantation. One skilled in the art would be able to determine the time of administration to treat, prevent or prime the transplant recipient for transplantation. Furthermore, the one skilled in the art would be able, by routine experimentation, to determine an effective, non-toxic amount to be employed, taking into consideration the time of administration; the route of administration; the rate of sequestration; the duration of the treatment; other agents used in combination or coincidental with the treatment, together with other related factors well known in medicine.
[0060] Those skilled in the art will appreciate that the methods of the present disclosure may also be employed in combination with other therapies and treatments. For example, CMV-seropositive serum and/or plasma, or a component thereof, may be administered in combination with an adoptive cell transfer treatment (e.g., adoptive transfer of CMV-specific T cells or transplant donor-derived B cells), intravenous CMV immunoglobulin (e.g., CytoGam) or additional antiviral agents (e.g., ganciclovir, valganciclovir, foscarnet, cidofovif and formivirsen). For combination therapies, each component of the combination may be administered at the same time, or sequentially in any order, or at different times, so as to provide the desired effect. When administered separately, it may be preferred for the components to be administered by the same route of administration, although it is not necessary for this to be so. Alternatively, the components may be formulated together in a single dosage unit as a combination product.
[0061] Typically, antiviral agents and immunosuppressive agents are provided in the form of pharmaceutical compositions with one or more pharmaceutically acceptable carriers. The compositions can also comprise additional ingredients such as diluents, stabilizers, excipients, and adjuvants.
[0062] Depending on factors including the route of administration, the carriers, diluents and adjuvants can include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or non-ionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG). Compositions may be administered in any suitable dosage form and by any suitable route. For example, administration may be systemic, regional or local and may be, for example, oral, nasal, oromucosal, topical, intracerebral, intrathecal, intracranial, epidural, intravenous, intramuscular, or subcutaneous. Compositions can be administrated as a single dose or multiple doses, and at varying intervals.
[0063] All publications mentioned in this specification are herein incorporated by reference. The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
[0064] It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the present disclosure without departing from the spirit or scope of the disclosure as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
[0065] The present disclosure will now be further described in greater detail by reference to the following specific examples, which should not be construed as in any way limiting the scope of the disclosure.
EXAMPLES
Materials and Methods
Mice
[0066] Non-infected female mice aged between 8-12 weeks were used as donors in the transplant protocols and for primary infection of MCMV (to establish latency). Seropositive (latently-infected) and age-matched seronegative (non-infected) female mice were 19-25 weeks of age. BALB/c weaners were used at 3 weeks of age.
[0067] Strains utilised in experiments are listed in Table 1. Mice were housed in micro-isolator cages under a 12:12-h light-dark cycle and were provided with a standard mouse diet and autoclaved acidified water (pH 2.5). All animal experimentation was performed according to the guidelines and with the approval of the Animal Ethics Committees of QIMR Berghofer Medical Research Institute and the University of Western Australia.
TABLE-US-00001 TABLE 1 Mouse strains Strain Abbreviation Source C57BL/6 B6 Animal Resources Centre (Perth, WA, Australia) B6.Ptprc.sup.a PTP Animal Resources Centre (Perth, WA, Australia) B6D2F1 B6D2F1 Animal Resources Centre (Perth, WA, Australia) C3H.SW C3H.SW Jackson Laboratories (Bar Harbor, Main, USA) B6.IFNAR1.sup./ B6.IFNAR KO Jackson Laboratories (Bar Harbor, Main, USA) B6.IFN gamma .sup./ B6.IFN KO Jackson Laboratories (Bar Harbor, Main, USA) BALB/c.IFN gamma .sup./ BALB. IFN KO Jackson Laboratories (Bar Harbor, Main, USA) B6.PtpxC57BL/6j PTPxC57 Bred-in-house at QIMR Berghofer facility (Brisbane, QLD, Australia) BALB/c BALB/c Animal Resources Centre (Perth, WA, Australia) BALB.B6-CT6 CT6 Bred in-house at Animal Services Facility of the University of Western Australia (Perth, WA, Australia) B6. Mt .sup./ Mt KO Bred-in-house at QIMR Berghofer facility (Brisbane, QLD, Australia) B6.TCR/ Bred-in-house at QIMR Berghofer facility (Brisbane, QLD, Australia) B6.FcIII/ Bred-in-house at QIMR Berghofer facility (Brisbane, QLD, Australia)
General Reagents
Media and Solutions
RPMI Media
[0068] RPMI-1640 (Roswell Park Memorial Institute1640) (Gibco)+2% heat inactivated fetal bovine serum (FBS) (Life Technologies), 1% penicillin/streptomycin (Sigma-Aldrich) and 2 mM L-glutamine (Life Technologies). The solution was filter sterilized (0.22 m) and stored at 4 C.
Serum-Free RPMI Media (No FBS)
[0069] RPMI-1640 (Roswell Park Memorial Institute1640) (Gibco)+1% penicillin/streptomycin (Sigma-Aldrich) and 2 mM L-glutamine (Life Technologies). The solution was filter sterilized (0.22 m) and stored at 4 C.
IMDM Complete
[0070] IMDM (Life Technologies), 10% FBS, 1% penicillin/streptomycin (Sigma-Aldrich), 2 mM L-glutamine (Hyclone Thermo Scientific), 1% non-essential amino acids (Life Technologies), 1 mM sodium pyruvate (Sigma-Aldrich) and 0.05 mM 2-mercaptoethanol (Sigma-Aldrich). The solution was filter sterilized (0.22 m) and stored at 4 C.
PBS
[0071] 145 mM NaCl (Univar, AR), 10 mM Na.sub.2HPO.sub.4 (Univar, AR) and 3 mM KH.sub.2PO.sub.4 (Univar, AR).
FACS Buffer
[0072] PBS, 2% FBS (Life Technologies), 5 mM EDTA (Chem-Supply)
Gey's Buffer
[0073] 7 g/L NH.sub.4Cl (Sigma-Aldrich), 0.37 g/L KCl (Sigma-Aldrich), 0.3 g/L Na.sub.2HPO.sub.4.12H.sub.2O (Sigma-Aldrich), 0.024 g/L KH.sub.2PO.sub.4 (Sigma-Aldrich), 1 g/L glucose (Sigma-Aldrich), 0.01 g/L phenol red (Sigma-Aldrich), 0.021 g/L MgCl.sub.2.6H.sub.2O (Sigma-Aldrich), 0.07 g/L MgSO.sub.4.7H.sub.2O (Sigma-Aldrich), 0.017 g/L CaCl.sub.2 (Sigma-Aldrich) and 1.125 g/L NaHCO.sub.3 (Sigma-Aldrich).
Mouse Cytomegalovirus Latency Model
[0074] Mice were inoculated intraperitoneally (i.p.) with 110.sup.4 plaque-forming units (PFU) of salivary gland-propagated MCMV-K181Perth or MCMV-K181Perth-LacZ as indicated. BALB/c and DBA2 mice received 510.sup.3 PFU due to asplenia with higher doses. All mice were housed for at least 3 months prior to transplant, to allow latent infection to develop. Latently infected mice were then used as recipients for BMT.
Bone Marrow Transplantation
Bone Marrow Harvest and Processing
[0075] The hind legs were removed and the bones scraped clean of tissue. Bone marrow (BM) was flushed, using RPMI media from femurs, tibiae and pelvises with a 26-gauge needle and syringe, with the resulting cell suspension filtered through a 70 m cell strainer (Miltenyi, Australia), washed with RPMI media and an aliquot counted on an AcT Diff Coulter Counter (Beckman Coulter, Australia).
[0076] T cell depleted (TCD) bone marrow was obtained by incubating BM with an antibody master mix, produced in-house, containing anti-CD4 (RL172.4), anti-CD8 (TIB 211) and CD90.2 (HO-13-4) at 30 ml antibody master mix per 35010.sup.6 BM cells, for 30 minutes on ice. Cells were washed twice with RPMI media (without FBS) and then incubated with 1.3 ml rabbit complement (Cedarlane Laboratories, Burlington, ON, Canada) per 10010.sup.6 cells for 40 minutes at 37 C. Cells were subsequently washed twice with RPMI media (without FBS) and then resuspended in RPMI media. An aliquot was removed for counting and purity analysis by FACS (BD LSR Fortessa) to ensure less than 1% viable CD3.sup.+ T cells remained.
T Cell Isolation and Selection
[0077] Splenocytes were isolated by mashing spleens in RPMI media and the cell suspension filtered through a 70 m cell strainer. Red blood cells (RBCs) were lysed using 1 mL of Gey's buffer per spleen, for 1 minute. Lysis was ceased by washing twice with RPMI media and centrifugation at 450 g for 5 minutes. Cells were resuspended in RPMI media and an aliquot removed for counting using an AcT Diff Coulter Counter (Beckman Coulter, Australia).
[0078] For whole CD3.sup.+ T cell selection, cells were incubated with antibody master mix containing in-house produced monoclonal antibody (mAb) supernatants against CD19, B220, GR1, Ter119 and CD11b, each at 10 g per 10010.sup.6 cells each, for 20 minutes on ice. Cells were washed with FACS buffer and incubated with pre-washed Biomag goat anti-rat IgG beads (Qiagen, VIC, Australia) at 20 L beads per 110.sup.6 cells, for 20 minutes on ice with occasional mixing. The cell suspension was placed on a magnetic stand for 3-5 minutes, until clear. The clear supernatant was collected and an aliquot removed for counting and to determine purity by FACS to ensure >80% CD3.sup.+ selection. For selection of purified CD4.sup.+ or CD8.sup.+ T cells from splenocytes, cells were positively selected using the MACS system (Miltenyi Biotec, Bergisch Gladbach, Germany). Purified CD4.sup.+ T cells (>80% CD4.sup.+CD3.sup.+, 0.8% CD8.sup.+CD3.sup.+) or CD8.sup.+ T cells (>80% CD8.sup.+CD3.sup.+, <1.2% CD4.sup.+CD3.sup.+), cells were selected according to the manufacturer's protocol.
Transplantation
[0079] Latently infected recipient mice received total body irradiation (TBI) prior to transplantation (day 1), split into 2 doses separated by 3 hours (Table 2) from a Gammacell caesium source gamma irradiator.
[0080] TCD BM cells alone (to mimic non-GVHD conditions) or BM+T cells (to induce GVHD) were resuspended in Leibovitz's L-15 Medium (Sigma Aldrich) and injected intravenously into the tail vein of mice with a 27 G insulin syringe (BD Biosciences, Australia) (Table 2). Mice were monitored daily and scored weekly for signs of GVHD according to clinical parameters: weight loss, posture (hunching), mobility, fur texture and skin integrity (Table 3; Cooke et al., (1996), Blood, 88: 3230-3239). Each parameter was graded with a maximum of 2, and once the animal reached a cumulative score of 6, was sacrificed and counted as death due to GVHD.
Serum Transfer
[0081] Protection of BALB/c weaners from MCMV infection was tested by i.p. injection of serum. Serum was collected from (i) non-GVHD and GVHD mice at day 14 and day 28 post-transplant or (ii) mice latently infected with either K181 or the N1 MCMV isolate. Weaners were injected with relevant MCMV isolates 24 hr after serum transfer and viral replication quantified 4 days p.i. BMT recipients were injected with serum from latently infected (seropositive) or uninfected (seronegative) BALB/c mice, twice weekly post-transplant commencing at day 14. Mice received a total volume of 1000 l of serum (5200 l). Serum was collected from BALB/c mice infected with 510.sup.3 PFU of MCMV-K181, or the N1 MCMV strain, at least 60 days p.i. A pooled sera preparation was generated by combining an equal volume of serum isolated from mice individually infected with one of eight MCMV isolates: K181, N1, G4, G5, K4, K6, GIF or M16A (Voigt, et al. (2003), Proceedings of the National Academy of Sciences USA, 100: 13483-13488). All sera were UV-inactivated prior to injection to ensure viable MCMV was not transferred. Titration of serum on permissive cell monolayers confirmed the absence of viable virus. BMT recipients were injected with K181, N1 or pooled sera, twice weekly post-transplant commencing at day +14. Mice received a total volume of 800 l of serum (4200 l).
MCMV Latently Infected Bone Marrow Chimeras
[0082] Recipient mice were irradiated (1000 cGy) and transplanted with 1010.sup.6 BM cells.
[0083] The following combination of donor/recipients was transplanted:
PTPB6; IFN KOPTP; PTPIFN KO; and IFN KOIFN KO
[0084] (PTPCD45.1.sup.+; B6CD45.2.sup.+; and IFN KOCD45.2.sup.+)
[0085] Mice were allowed to reconstitute for 2 months prior to MCMV infection of 110.sup.4 PFU of K181-MCMV-Perth and allowed to enter latency for 3 months prior to secondary transplantation.
TABLE-US-00002 TABLE 2 Characteristics of the mouse stem cell transplant systems Transplant Irradiation BM system Haplotype dose [cGy] cells T cells BALB/c .fwdarw. B6 H-2.sup.d .fwdarw. H-2.sup.b 1000 10 10.sup.6 2 10.sup.6 CD4.sup.+ 2 10.sup.6 CD8.sup.+ B6 .fwdarw. BALB/c H-2.sup.b .fwdarw. H-2.sup.d 900 5 10.sup.6 0.2 10.sup.6 CD3.sup.+ BALB/c .fwdarw. H-2.sup.d .fwdarw. H-2.sup.d 900 5 10.sup.6 2 10.sup.6 CD3.sup.+ DBA2 B6 .fwdarw. B6D2F1 H-2.sup.b .fwdarw. H-2.sup.b/d 1100 5 10.sup.6 3 10.sup.6 CD3.sup.+ C3H.SW .fwdarw. B6 H-2.sup.b .fwdarw. H-2.sup.b 1000 10 10.sup.6 2 10.sup.6 CD8.sup.+
TABLE-US-00003 TABLE 3 Scoring matrix utilised to determine development of GVHD Criteria Score 0 Score 0.5 Score 1 Score 1.5 Score 2 Skin Normal Minor Scaling of Areas of Obvious integrity scaling of paws/tail hair loss areas of paws OR tail with skin denuded OR ears only thickening skin Posture Normal Very minor Clear Hunching Severe hunching at hunching also noted hunching rest only noted only with impairs at rest movement movement Fur Normal Minor Mild to Moderately Severe texture ruffling moderate severe ruffling, (partial and ruffling ruffling poor over ventral (ruffling (complete grooming surface only) over ruffling (complete ventral ventral over surface) surface and ventral partial over and dorsal dorsal surface) surface) Activity Normal Minor Mild to Moderate Stationary decrease moderately to severely unless only decreased decreased stimulated Weight <10% 10-24% 25% loss
Depletion In-Vivo after BMT
[0086] For in-vivo depletion experiments, mice were injected intravenously with the appropriate concentration of depleting antibody in 250-350 L saline solution (Table 4).
TABLE-US-00004 TABLE 4 Depleting antibodies used for in-vivo cell depletions Antibody target Clone Dose schedule* Supplier CD4 GK1.5 500 g/dose/mouse at day 1 In-house 250 g/dose/mouse weekly thereafter CD8 53-5.8 150 g/dose/mouse at day 1 and In-house weekly thereafter NK1.1 PK136 500 g/dose/mouse at day 1 In-house 250 g/dose/mouse twice weekly thereafter *Day 0 = day of transplant
Leukaemia Challenge
[0087] Primary leukaemia cells were generated using the expression of the human oncogene MLL-AF9 to model human AML and myeloid blast-crisis leukaemia, as previously described (Bruedigam et al., (2014), Cell Stem Cell, 15: 775-790). Cells were cryopreserved at disease onset, for subsequent transplantation.
[0088] Lethally-irradiated recipients were transplanted with 1010.sup.6 TCD BM cells and 310.sup.6 CD3.sup.+ purified T cells. The non-GVHD group received TCD BM only. Leukaemia cells (B6. MLL-AF9-GFP.sup.+) were thawed on the day of injection and included in grafts at 110.sup.6 cells per mouse. Peripheral blood was collected at 2 weeks and weekly thereafter by retro-orbital bleed into Vacuette K.sub.2EDTA tubes (Greiner Bio-one) to prevent coagulation. Blood samples were counted and RBCs lysed. Survival and GVHD clinical scores were assessed weekly. Leukaemia burden in the blood was determined by enumeration of green fluorescent protein positive (GFP.sup.+) cells by FACS.
[0089] For a death to be attributed to leukaemia, tumour burden in peripheral blood at either terminal or last routine bleed had to meet the following criteria to avoid overstatement of leukemic deaths when both GVHD and leukaemia were present: any limb paralysis, greater than 4% GFP.sup.+ cells in peripheral blood (with any total white cell count), or present in the peripheral blood at any level but with a total white cell count 1010.sup.6 per mL blood.
Histological Analysis
Hematoxylin and Eosin Staining
[0090] Organs were excised and fixed in 10% formalin. Cut sections were stained with hematoxylin and eosin and analysed with a light microscope (Olympus) and images collected with a digital camera (Olympus) at the magnifications indicated.
Lac Z Staining of CMV K181-LacZ Infected Cells
[0091] Organs were excised and fixed in 2% PFA at 4 C. for 1-2 hours then transferred to 10% sucrose solution overnight at 4 C. Organs were slow-rate frozen in optimal cutting temperature (OCT) compound using a dry-ice/propanol cooling bath. Sections were cut and stained as per LacZ staining protocol (Palladino et al., (1995), Journal of Virology, 69: 2075-2081).
Flow Cytometry
Surface Staining
[0092] FcRII/FcRIII receptors were blocked with a CD32/CD16 antibody mix (generated in-house from 2.4G2 hybridoma line) to reduce non-specific antibody binding. 50 L of 2.4G2 supernatant stock solution (5 mg/mL) was added to the cells for 10 minutes at room temperature (RT). Cells were washed in FACS buffer and surface stained. The antibodies utilized in experiments are listed in Table 5 and were used at a 1/200 dilution of the stock concentration in 100 L final volume of FACS buffer and incubated for 20 minutes at RT.
[0093] To detect MCMV-specific T cells we used the following PE-conjugated tetramers, all purchased from ImmunoID Tetramers: H-2Ld-YPHFMPTNL MCMVIE1, H-2Kb-SSPPMFRV MCMV-m38, H-2DbHGIRNASFI MCMV-m45. Tetramers were used at a 1/200 dilution of the stock concentration in a 100 L final volume FACS buffer and incubated for 30 minutes, on ice.
[0094] The fluorescence-labelled preparations were washed with FACS buffer and analysed on a LSR Fortessa II (BD Biosciences) using FACSDiva software (Version 8.0.1). Offline analysis was performed using FlowJo (Version 10, Treestar).
IE1 Peptide Stimulation and Intracellular Staining
[0095] Splenocytes were incubated with 1 g/mL Brefeldin A (BioLegend, CA, USA) and 200 ng/mL H-2Ld MCMV-IE1-YPHFMPTNL peptide (Genscript, Piscataway, N.J., USA) in IMDM media for 4 hours at 37 C. Cells were washed and processed for surface staining as described above, followed by intracellular cytokine staining as per the manufacturer's protocol (BD Cytofix/Cytoperm Kit; BD Bioscience). Labelled cells were analysed by FACS (BD LSR Fortessa).
TABLE-US-00005 TABLE 5 Antibodies used for flow cytometry Antibody target Clone Conjugate Supplier CD3 145-2C11 PE, APC BioLegend CD4 RM4-5 PB, PECy7 BD Biosciences APC BioLegend CD8 53-6.7 APC, APC.Cy7 BioLegend FITC Generated in-house PerCP Cy5.5 BD Biosciences CD19 6D5 APC.Cy7 BioLegend CD44 IM7 FITC BioLegend CD45.1 A20 PE, APC-Cy7 BioLegend CD45.2 104 AF700, APC BioLegend CD62L MEL14 AF700 BioLegend CD90.2 23-2.1 BV605 BioLegend CD127 A7R34 BV421 BioLegend CD138 281-2 BV421 BioLegend IFN XMG1.2 BV421 BioLegend IgD 11-26c 2a FITC BioLegend IgG1, RTK2071 BV421 BioLegend IgG2a R19-15 Biotin BD Biosciences IgM RMM-1 APC BioLegend KLRG1 2F1 APC-Cy 7 BioLegend NK1.1 PK136 PE BioLegend NKp46 29A1.4 PECy-7 BioLegend TCR H57-597 PerCP/Cy5.5 BioLegend TCR GL3 BV421 BioLegend
Quantification of CMV
[0096] Viral DNA Extraction and qPCR
[0097] Viremia from plasma was determined by qRT-PCR for the viral gB gene. Briefly, blood was collected from mice by retro-orbital bleed into a MiniCollect K.sub.2.EDTA collection tube (Greiner Bio-one, Austria). DNA was extracted using the Qiagen DNeasy Blood and tissue kit (Qiagen, VIC, Australia) as recommended by manufacturer. qRT-PCR was performed from 4 L DNA with Sso Advanced Universal SYBR green mix (Biorad) and forward (5 ttggctgtcgtctagctgttt 3) and reverse (5 taaggcgtggactagcgataa 3) primers. Serial dilutions of a synthesized MCMV gB sequence (ttggctgtcgtctagctgttttaacgcgcggagtatcaatagagcatcttgctcggtgtaggtcctctccaagccc tttttatcgctgtccacgcctta) were used for the standard curve (range 10.sup.6-40 genome copies/L reaction mix). 40 copies/L reaction mix is the limit of detection established for the assay.
Plaque Forming Units Assay
[0098] The mice were sacrificed and organs were collected and snap-frozen in dry ice and stored at 80 C. for later use. To perform plaque assays, organs were thawed and processed as described (Lawson et al., (1988), Journal of General Virology, 69: 1987-1998). Briefly, tissues were thawed and homogenized in cold MEM 2% Neonatal Calf serum (NCS, Gibco), and centrifuged to remove insoluble debris. The resulting homogenates were serially diluted and absorbed onto a monolayer of M210B4 cells for 1 h at 37 C. The supernatant was removed and MEM 2% NCS containing 0.01% carboxy-methylcellulose (CMC; Sigma-Aldrich) was overlayed onto the cell monolayer and cells incubated at 37 C., 5% CO.sub.2 for 4 days. A solution of 0.5% methylene blue in 10% formaldehyde was added to the cells for 1 day to fix and stain the monolayer. The number of plaques per well were counted using a dissecting microscope and plaque forming units (PFU) per organ calculated.
Complement-Dependent Neutralization Assay
[0099] A neutralization assay, based on plaque reduction, was performed as described by Lawson et al. (supra). In brief, serum samples were heated at 56 C. for 30 minutes to inactivate serum complement. Serial dilutions of serum were diluted in MEM in the presence of 5% rabbit serum, as a source of complement, and incubated with 100 PFU K181 MCMV for 1 hour at 37 C. in 5% CO.sub.2. Following incubation, the virus-antibody mixture was added to a monolayer of M210B4 cells and incubated for a further 60 minutes at 37 C. in 5% CO.sub.2. After incubation, the virus-antibody mixture was removed and the cells overlaid with MEM 2% NCS containing 0.01% carboxy-methylcellulose (CMC; Sigma-Aldrich); the trays were then incubated at 37 C., 5% CO.sub.2 for 4 days, then fixed and stained with 0.5% methylene blue in 10% formaldehyde for 1 day prior to plaques being counted. Neutralization titres were recorded as the dilution of serum that gave a 50% reduction in plaque numbers relative to controls incubated in the absence of serum. Four replicates were performed for each dilution of the serum.
CMV Enzyme-Linked Immunosorbent Assay (ELISA)
[0100] Enzyme-linked immunosorbent assay (ELISA) was performed as previously described (Lawson et al., supra). MCMV antigen was diluted to the optimum concentration with carbonate/bicarbonate buffer pH 9.5 and incubated at 4 C. for 24 h in 96-well plates. Plates were washed three times with MOBS containing 0.05% Tween 20 and 0.1% bovine serum albumin (Amersham Biosciences). Serum was diluted 1/20 in MOBS containing 0.05% Tween 20 and 1% BSA followed by 122-fold serial dilutions. Nave mouse serum (NMS) was used as a negative control. Sera was added to the plates and incubated for 2 hours at RT in the dark. The plate was then washed 3 times with MOBS containing 0.05% Tween 1% BSA. Anti-MCMV antibodies were detected by adding anti-mouse IgG or IgM-peroxidase conjugate diluted in MOBS containing 0.05% Tween 20 1% BSA. Plates were washed 6 times prior to adding Tetramethylbenzidine substrate (Elisa Systems, QLD, Australia) and left in the dark for 5-20 minutes at RT and terminated by the addition of 1 M sulphuric acid. The absorbance was read at 450 nm using a spectrophotometer (Beckman-Coulter AD-200). The A450 value for each dilution of serum was plotted (y axis) against the log.sub.2 of its dilution factor (x axis). A straight line was fitted to the plot using Prism 6 software, and the serum titre defined as the last dilution preceding the intercept on the x axis.
Spread Inhibition Assay
[0101] Spread inhibition was measured using a method based on that described by Cui et al. (2013, Journal of Virological Methods, 192: 44-50). Briefly, M210B4 cell monolayers in black-wall clear-bottom 96-well plates were infected with 25 PFU of MCMV-K181Perth-GFP (Wikstrom et al. (2015), Blood, 126: 1503-1514). After 6 hours the inoculum was replaced with 200 l of culture medium containing twofold serial dilutions of serum, and cultured for 5 days. Relative fluorescent units (RFU) were measured using a CLARIOstar plate reader (BMG-Labtech), and monolayers were imaged using an epifluorescence Olympus IX70 microscope with a 2 lens and an Olympus DP70 camera (Olympus). The 50% inhibitory concentration (IC.sub.50) values were determined by fitting four-parameter curves to plots of the RFU versus Log.sub.2 serum dilution using InStat Prism software.
Statistical Analysis
[0102] Survival curves were plotted using Kaplan-Meier estimates and compared by log-rank analysis. The curves for leukaemia death were analysed using cumulative incidence analysis of competing risks by R_2.10.1 software. Viremia and PFU data are presented as geometric meangeometric standard error of the mean (SEM) and other data are represented by meanSEM. An unpaired 2-tailed Mann-Whitney U test was used to evaluate differences unless stated otherwise *p<0.05, **p<0.01, ***p<0.001.
Example 1: CMV Reactivation is Dependent on GVHD
[0103] In a newly established model of latent MCMV infection, the present inventors investigated the role of BMT and GVHD on MCMV reactivation. Latently infected B6 (H-2.sup.b) recipient mice (
[0104] These findings are broadly consistent across different transplant models. In the B6.fwdarw.BALB/c MHC-disparate model, significant viremia was observed at week 5 post-transplant in the GVHD group but not the non-GVHD group (
Example 2: CMV Reactivation Occurs in Multiple Organs
[0105] The pathogenesis of acute CMV infection is greatly influenced by its broad range of target cells and reactivation is commonly associated with multi-organ disease (Schmidt et al., (1991) The New England Journal of Medicine, 324). In order to investigate the cell types involved in CMV reactivation and subsequent amplification by lytic replication, B6D2F1 mice were latently infected with MCMV-K181Perth-LacZ. This virus co-expresses the LacZ reporter gene with McK2 (m131-129), but replicates as MCMV-K181Perth. Latently infected B6D2F1 mice were lethally irradiated and transplanted with BM and T cells from haploidentical donor B6 mice. Viremia and viral replication in the organs were determined weekly and lungs, liver, spleen, salivary glands and gut were collected and stained for -galactosidase (LacZ) activity. Positive stain is indicative of actively replicating virus.
[0106] MCMV reactivation was not detected in B6D2F1 recipients for the first 2 weeks post-transplant in plasma (
Example 3: T and NK Cell Lymphopenia Alone are Insufficient to Induce MCMV Reactivation
[0107] To investigate the underlying mechanism of MCMV reactivation in GVHD, and protection in non-GVHD mice, latently infected B6 (H-2.sup.b) recipient mice were transplanted with TCD BM alone or BM+T cells from BALB/c (H-2.sup.d, CD45.1.sup.+) donors. At day 14 post-transplant host m38-specific antiviral T cells were quantified using tetramers. Host m38-specific T cells were detected in the non-GVHD group, while these cells were absent in GVHD mice (
[0108] To test this hypothesis further, the present inventors performed BMT in a B6.fwdarw.B6D2F1 system with sustained CD4.sup.+, CD8.sup.+ and NK1.1.sup.+ immunodepletion. An additional group received TCR KO grafts together with immunodepletion to exclude any protective effect from T cells. MCMV viremia was quantified 3 weeks post-transplant and weekly thereafter. Interestingly, MCMV was undetectable in the plasma of all mice for at least 6 weeks post-transplant (
Example 4: Humoral Immunity Protects from MCMV Reactivation in the Absence of T and NK Cells
[0109] The lack of MCMV reactivation observed in non-GVHD mice despite sustained T-cell and NK cell depletion suggests that humoral immunity may be sufficient to protect from viral reactivation in the absence of GVHD. To determine the role of antibodies, the present inventors used Mt KO mice, which lack mature B cells and therefore cannot produce antibodies. These mice were latently infected and transplanted with CT6 (NK1.1.sup.+ BALB/c) TCD BM alone followed by continuous treatment with CD4.sup.+, CD8.sup.+ and NK1.1.sup.+ depleting antibodies to eliminate CD4 and CD8 T cells and NK cells. By day 14, mice exhibited severe hunching, ruffling and reduced activity, and were sacrificed at day 16. MCMV reactivation was detected in all Mt KO recipients with high-level viremia (
[0110] These data suggest that in the absence of T and NK cells, antibody-mediated immunity is sufficient to protect from MCMV reactivation. To confirm that antibody-mediated immunity is essential and sufficient to prevent MCMV reactivation and determine whether the additional absence of T-cells and NK cells is important, the present inventors transplanted latently infected Mt KO recipients with BM only, with or without post-transplant immunodepletion. MCMV reactivation occurred only in the immunodepleted group but, no reactivation was observed in the non-immunodepleted group either in plasma or target organs (
Example 5: Deficient Humoral Immunity Contributes to MCMV Reactivation in GVHD
[0111] Considering the protective role of the humoral immunity, the present inventors next investigated the role of GVHD on serum antibody levels. Serum from latently infected DBA2 and B62F1 mice neutralized MCMV in vitro, and contained high levels of MCMV-specific IgG pre-transplant (
[0112] The capacity of immune serum to neutralize cell-free virus and inhibit viral spread was also evaluated. The neutralizing capacity of antibodies present in the serum of mice at day 28 post-transplant was not significantly different between GVHD and non-GVHD groups (
TABLE-US-00006 TABLE 6 Quantification of Viral Spread Inhibition IC.sub.50 Spread Inhibition Days post-BMT Group (Log.sub.2).sup.a 14 Non-GVHD 6.265 1.349 14 GVHD 6.132 1.754 28 Non-GVHD 6.721 0.386 28 GVHD No inhibition.sup.b .sup.aData are expressed as reciprocal Log.sub.2 dilution of serum required to inhibit viral spread by 50%. .sup.bNo inhibition of viral spread detected at the lowest tested dilution (1/20).
Example 6: Recipient Plasma Cells Persist Post-Transplant and Produce IgG.SUP.MCMV .Antibodies
[0113] GHVD, and its associated immunosuppressive therapy, results in long-term immune deficiency and impaired infection-specific immunity. In a B6.fwdarw.B6D2F1 BMT system, mature splenic B cells were significantly reduced in recipients with GVHD (
Example 7: Serum Antibodies Protect from MCMV Reactivation Post-Transplant
[0114] Latently infected B6D2F1 (H-2.sup.b/d) mice were transplanted with BM and T cells from haploidentical B6 (H-2.sup.b) donors and administered serum from either a latent seropositive or a nave (seronegative) donor. GHVD clinical scores were similar post-transplant between groups (
[0115] Previous attempts to ameliorate CMV disease in transplant recipients with immunoglobulins, purified from either normal donors (IVIG) or donors with high titres of CMV antibodies (CMV-IG) have provided ambiguous results. These data suggest the potential requirement for virus-strain specific neutralization/inhibition. This was tested by examining whether immune serum from mice infected with MCMV-K181 afforded protection to infection with unrelated strains. As little as 5 l of K181 immune serum provided complete protection against infection with the same viral isolate (