CONJUGATE OF FINASTERIDE WITH PEPTIDE

20200289526 ยท 2020-09-17

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a composition for preventing hair loss and, more specifically, to a compound having a structure in which finasteride and a peptide are linked through a covalent bond and a pharmaceutical composition or a cosmetic composition for preventing hair loss or promoting hair growth comprising the same. The compound of the present invention having a structure in which finasteride and a peptide are linked through a covalent bond is excellent in physiological activities such as hair loss improvement, hair growth promotion, cell growth promotion, etc., is excellent in stability in water and skin permeation, and thus can be effectively used as a composition for preventing hair loss and promoting hair growth.

    Claims

    1. A compound having a structure conjugating finasteride and peptide with a covalent bond.

    2. The compound of claim 1, wherein the peptide is composed of 2 to 30 amino acids.

    3. The compound of claim 2, wherein the peptide is composed of 8 to 15 amino acids.

    4. The compound of claim 1, wherein the peptide is a water soluble peptide.

    5. The compound of claim 4, wherein the water soluble peptide has at least 70% of an amino acid having a hydrophilic side chain.

    6. The compound of claim 5, wherein the amino acid having a hydrophilic side chain is selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro).

    7. The compound of claim 5, wherein the amino acid having a hydrophilic side chain is an amino acid with an electric charge selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) and glutamic acid (Glu).

    8. The compound of claim 4, wherein the water soluble peptide has at least three amino acids with an electric charge selected from the group consisting of arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) and glutamic acid (Glu).

    9. The compound of claim 4, wherein the water soluble peptide has five or less amino acids having a hydrophobic side chain.

    10. The compound of claim 9, wherein the water soluble peptide has three or less amino acids having a hydrophobic side chain.

    11. The compound of claim 9, wherein the amino acid having a hydrophobic side chain is selected from the group consisting of alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophane (Trp).

    12. The compound of claim 1, wherein the peptide is selected from the group consisting of a Nokkin peptide composed of an amino acid sequence of SEQ ID No. 1, a Keramin2 peptide composed of an amino acid sequence of SEQ ID No. 2, and a WINT peptide composed of an amino acid sequence of SEQ ID No. 3.

    13. A pharmaceutical composition for preventing hair loss or promoting hair growth comprising the compound of claim 1.

    14. A cosmetic composition for preventing hair loss or promoting hair growth comprising the compound of claim 1.

    15. The cosmetic composition of claim 14, which has a formulation selected from the group consisting of skin lotion, milk lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hear cream, lair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aerosol, pomade, solgel, emulsion, oil, wax and aerosol.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0020] FIG. 1 is a photograph showing the solubility of the compound of the present invention and finasteride in water.

    [0021] FIGS. 2a and 2b are graphs showing the effect of the compound of the present invention and finasteride on 5 reductase activity. FIGS. 2a and 2b respectively show the relative concentration of DHT and testosterone after treatment with the compound of the present invention and finasteride.

    [0022] FIG. 3a is an immunostaining photograph showing the shape and number of keratinocytes after treatment with the compound of the present invention and finasteride, and FIG. 3b is a graph showing the relative number of keratinocytes according to the concentration of the compound treated.

    [0023] FIG. 4a is an immunostaining photograph showing the shape and number of human hair dermal papilla cells (HHDPC) after treatment with the compound of the present invention and finasteride, and FIG. 4b is a graph showing the relative number of keratinocytes according to the concentration of the compound treated.

    [0024] FIG. 5a is a Western blot photograph showing the translocation of beta-catenin into nucleus in HHDPC cells after treatment with the compound of the present invention and finasteride, and FIG. 5b is a graph converting this into relative numerical values with respect to the negative control.

    [0025] FIG. 6a is a Western blot photograph showing the expression of phospho-Smad1/5/8 in HHDPC cells after treatment with the compound of the present invention and finasteride, and FIG. 6b is a graph converting this into relative numerical values with respect to BMP2.

    [0026] FIG. 7a is an electrophoretic photograph showing the expression of DKK-1 mRNA in HHDPC cells after treatment with the compound of the present invention and finasteride, and FIG. 7b is a graph converting this into relative numerical values with respect to the negative control.

    [0027] FIGS. 8a and 8b are photographs confirming the effect of the compound of the present invention on hair growth through animal tests. FIG. 8a compares the growth rate of mice hair applied with finasteride and the compound of the present invention, and FIG. 8b confirms the number of hair follicle by H&E staining of the hair of the back skin of mice applied with finasteride and the compound of the present invention with H&E.

    [0028] FIGS. 9a and 9b are graphs showing the skin permeability test result of the compound of the present invention.

    BEST MODE FOR CARRYING OUT THE INVENTION

    [0029] In order to achieve the technical task, the present invention provides a compound having a structure conjugating finasteride and peptide with a covalent bond.

    [0030] The finasteride is N-(1,1-dimethylethyl)-3-oxo-(5,17)-4-azaandrost-1-ene-17-carboxamide, and has a formula represented by the following formula 1.

    ##STR00001##

    [0031] In the present invention, the term peptide means a linear molecule formed via peptide bond of the amino acid residues. The peptide may be prepared by biological or chemical synthesis methods generally known in the art, in particular by solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)).

    [0032] The peptide is to increase the water solubility of finasteride. In this aspect, preferably, the peptide is a water soluble peptide, but is not limited thereto. According to an embodiment of the present invention, the peptide may be composed of 2 to 30 amino acids, preferably 5 to 20 amino acids, more preferably 8 to 15 amino acids, and more preferably 10 to 12 amino acids. According to a preferable embodiment of the present invention, the peptide has at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, and most preferably 100% of the amino acid having a hydrophilic side chain, and thus it is preferable to be high. On the other hand, the peptide has 50% or less, preferably 40% or less, more preferably 30% or less, more preferably 20% or less, more preferably 10% or less, and most preferably 0% of the amino acid having a hydrophobic side chain, and thus it is preferable to be low. In the present invention, amino acid having a hydrophilic side chain refers to arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro), and amino acid having a hydrophobic side chain refers to alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophane (Trp), but is not limited thereto. In addition to the amino acids present in the natural world, variants thereof may be used without limitation. According to an embodiment of the present invention, the amino acid having a hydrophilic side chain is preferably an amino acid with an electric charge, such as arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp) or glutamic acid (Glu), but is not limited thereto. According to an embodiment of the present invention, the water soluble peptide may comprise at least 3 amino acids with an electric charge, preferably at least 5 amino acids with an electric charge, and more preferably at least 7 amino acids with an electric charge, but is not limited thereto.

    [0033] According to a preferable embodiment of the present invention, the peptide comprises five or less, preferably four or less, more preferably three or less, more preferably two or less, more preferably one or less, and most preferably no amino acid having a hydrophobic side chain. According to an embodiment of the present invention, the peptide may be a Nokkin peptide composed of an amino acid sequence of SEQ ID No. 1, a Keramin2 peptide composed of an amino acid sequence of SEQ ID No. 2, or a WINT peptide composed of an amino acid sequence of SEQ ID No. 3, but is not limited thereto.

    [0034] According to an embodiment of the present invention, the compound of the present invention has the function of promoting growth of keratinocytes and HHDPC cells. According to an embodiment of the present invention, the compound of the present invention has the function of activating the WNT signaling pathway. According to an embodiment of the present invention, the compound of the present invention translocates beta-catenin into the nucleus.

    [0035] The compound of the present invention has excellent stability by itself, but its stability may be further improved by modifying any amino acid composing the peptide conjugated to the compound. According to an embodiment of the present invention, the N-terminal of the peptide may be conjugated with a protecting group selected from the group consisting of an acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG), to further improve the stability. According to an embodiment of the present invention, the peptide may be conjugated with a protecting group selected from the group consisting of an acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG), to further improve the stability.

    [0036] The modification of amino acid as mentioned above greatly improves the stability of the compound of the present invention. In the present invention, the term stability is used to encompass not only in vivo stability, but also in vitro stability such as storage stability (e.g., storage stability at room temperature). Also, the protecting group mentioned in the above protects the compound of the present invention from in vivo and in vitro attack of the proteolytic enzyme.

    [0037] Also, the present invention provides a composition for treating or improving hair loss comprising the compound as an active ingredient. According to an embodiment of the present invention, the present invention provides a composition for improving skin condition comprising the peptide as an active ingredient. In the present invention, the composition may be in the form of a pharmaceutical composition or a health food, but is not limited thereto.

    [0038] Since the composition of the present invention comprises the compound of the present invention as an active ingredient, common descriptions between them are omitted in order to avoid undue redundancy leading to the complexity of the specification.

    [0039] According to an embodiment of the present invention, treating or improving hair loss by the compound of the present invention is promoting hair growth or growing hair. According to a preferable embodiment of the present invention, the compound of the present invention has the ability to promote the growth of keratinocytes and HHDPC cells, and promote the beta-catenin signaling pathway, which is a representative signaling pathway of WNT protein. Through animal tests carried out based on the results, it can be found that the compound of the present invention remarkably promotes hair growth. Thus, the composition of the present invention is very effective in improving hair growth and skin condition.

    [0040] Also, according to an embodiment of the present invention, improving skin condition by the compound of the present invention includes improving wrinkles, improving skin elasticity, preventing skin aging, improving skin moisturization, removing scars or regenerating skin.

    [0041] Since the composition of the present invention comprises the compound of the present invention as an active ingredient, common descriptions between them are omitted in order to avoid undue redundancy leading to the complexity of the specification.

    [0042] According to a preferable embodiment of the present invention, the composition of the present invention is a pharmaceutical composition comprising (a) a pharmaceutically effective amount of the compound of the present invention; and (b) a pharmaceutically acceptable carrier.

    [0043] In the present specification, the term pharmaceutically effective amount means an amount sufficient to achieve the efficacy or activity of the compound of the present invention.

    [0044] The pharmaceutically acceptable carrier of the pharmaceutical composition of the present invention which is generally used for preparation may include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but is not limited thereto. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include a lubricant, wetting agent, sweetener, flavoring agent, emulsifier, suspending agent, preservative, etc. Suitable pharmaceutically acceptable carriers and preparations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

    [0045] The pharmaceutical composition of the present invention may be prepared in a unit dosage or multiple dosage form using a pharmaceutically acceptable carrier and/or excipient according to a method that may be easily carried out by a person having ordinary skill in the art. In this case, the formulation may be in the form of a solution in oily or aqueous medium, suspension or emulsion, or may be in the form of an extract, powder, granule, tablet, capsule or gel (e.g., hydrogel), and may further include a dispersant or a stabilizer.

    [0046] The pharmaceutical composition according to the present invention may be administered orally or parenterally in clinical administration and may be used in general forms of pharmaceutical preparations. That is, the pharmaceutical composition of the present invention may be administered in various oral and parenteral dosage forms during actual clinical administration. When being formulated, a diluent or excipient such as a filler, thickening agent, binder, wetting agent, disintergrant, surfactant, etc. generally used may be used. Solid preparations for oral administration include tablets, pills, powder, granules, capsules, etc., and such solid preparations are prepared by mixing at least one excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. with an herbal extract or herbal fermented product. Also, in addition to simple excipients, lubricants such as magnesium stearate or talc may be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrup, etc., and may include various excipients such as wetting agents, flavoring agents, aromatics, preservatives, etc., in addition to water and liquid paraffin, which are frequently used simple diluents. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. As non-aqueous solvents or suspensions, propylene glycol, polyethylene glycol, plant oils such as olive oil, injectable esters such as ethyl oleate, etc. may be used. As the base of suppositories, witepsol, Macrogol, Tween 61, cacao butter, laurin fat, glycerol, gelatin, etc. may be used.

    [0047] The unit dosage form may contain, for example, 1, 2, 3 or 4 individual doses or , or of an individual dose. An individual dose contains the amount of active drug which is administered in one application and this usually corresponds to a whole, , or of a daily dose.

    [0048] The pharmaceutical composition of the present invention may be prepared in a unit dosage or multiple dosage form using a pharmaceutically acceptable carrier and/or excipient according to a method that may be easily carried out by a person having ordinary skill in the art. In this case, the formulation may be in the form of a solution in oily or aqueous medium, suspension or emulsion, or may be in the form of an extract, powder, granule, tablet, capsule or gel (e.g., hydrogel), and may further include a dispersant or a stabilizer.

    [0049] According to a preferable embodiment of the present invention, the composition of the present invention is a cosmetic composition comprising (a) a cosmetically effective amount of the compound of the present invention; and (b) a cosmetically acceptable carrier.

    [0050] In the present specification, the term cosmetically effective amount means an amount sufficient to achieve the efficacy of improving skin of the composition of the present invention.

    [0051] The cosmetic composition of the present invention may be prepared in any formulation generally prepared in the art. For example, it may be formulated into a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation and spray, etc., but is not limited thereto. More specifically, it may be prepared in various forms such as skin lotion, milk lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hear cream, hair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aerosol, pomade, solution such as gel, etc., solgel, emulsion, oil, wax, aerosol, etc., but is not limited thereto.

    [0052] When the formulation of the present invention is paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicon, bentonite, silica, talc or zinc oxide, etc. may be used as a carrier ingredient.

    [0053] When the formulation of the present invention is powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier ingredient, and especially, the spray formulation may further include a propellant such as chloro flouro hydrocarbon, propane/butane or dimethyl ether, but it is not limited thereto.

    [0054] When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier may be used as a carrier ingredient. For example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid ester may be used, but it is not limited thereto.

    [0055] When the formulation of the present invention is a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspension such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. may be used as a carrier ingredient, but it is not limited thereto.

    [0056] When the formulation of the present invention is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkyl amido betaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester, etc. may be used as a carrier ingredient, but it is not limited thereto.

    [0057] When the formulation of the present invention is hair shampoo, base ingredients for composing shampoo such as a thickening agent, surfactant, viscosity control agent, moisturizer, pH control agent, preservative, essential oil, etc. are mixed with the compound of the present invention. As a thickening agent, CDE may be used. As a surfactant, an anionic surfactant such as LES and an amphoteric surfactant such as coco betaine may be used. As a viscosity control agent, polyquater may be used. As a moisturizer, glycerin may be used. As a pH control agent, citric acid and sodium hydroxide may be used. As a preservative, grapefruit extract may be used. In addition thereto, essential oil such as cedarwood, peppermint, rosemary, etc., and silk amino acid, pentaol, vitamin E, etc. may be added. According to an embodiment of the present invention, with respect to 100 parts by weight of the compound of the present invention, 5 to 10 parts by weight of CDE, 30 to 40 parts by weight of LES, 10 to 20 parts by weight of coco betaine, 0.1 to 0.2 parts by weight of polyquater, 5 to 10 parts by weight of glycerin, 0.1 to 1.01 parts by weight of grapefruit extract, 0.5 to 1 parts by weight of silk amino acid, 0.5 to 1 parts by weight of pintail, 0.5 to 2 parts by weight of vitamin E, and 0.01 to 0.1 parts by weight of any one of cedarwood, peppermint, rosemary as essential oil, may be mixed, but it is not limited thereto.

    [0058] The ingredients included in the cosmetic composition of the present invention include ingredients commonly used in cosmetic compositions, in addition to the compound of the present invention and the carrier ingredients as active ingredients. For example, it may further include a conventional adjuvant such as a stabilizer, solubilizer, vitamin, pigment and fragrance, but is not limited thereto.

    [0059] Hereinafter, the present invention will be explained in detail with reference to the examples.

    [0060] However, the following examples are provided only to illustrate the present invention, and the scope of the present invention is not limited thereby.

    Example 1. Synthesis of the Compound of the Present Invention

    [0061] <1-1> Synthesis of Peptide

    [0062] <1-1-1> Synthesis of the Peptide of SEQ ID No. 3

    [0063] 700 mg of chlorotrityl chloride resin (CTL resin; Nova biochem [0064] Cat No. 01-64-0021) was put in a reactor and stirred for 3 minutes after adding 10 ml of methylene chloride (MC). After removing the solution, 10 ml of dimethylformamide (DMF) was added. Then, after stirring for 3 minutes, the solvent was removed again. After adding 10 ml of dichloromethane (DCM) to the reactor, 200 mmole of Fmoc-Cys(trt)-OH (Bachem, Swiss) and 400 mmole of diisopropylethylamine (DIEA) were added and dissolved well by stirring. After reacting for 1 hour with stirring, the mixture was washed and dissolved with methanol and DIEA (2:1) in DCM. After reacting for 10 minutes, the mixture was washed with excess DCM/DMF (1:1). After removing the solution, followed by addition of 10 ml of DMF and stirring for 3 minutes, the solvent was removed again. After adding 10 ml of a deprotecting solution (20% piperidine/DMF) to the reactor, the mixture was stirred for 10 minutes at room temperature and then the solution was removed. After adding again the same amount of the deprotecting solution and performing reaction for 10 minutes, the solution was removed and Cys(trt)-CTL resin was prepared by washing twice with DMF, once with MC, and once with DMF, for 3 minutes, respectively.

    [0064] After adding 10 ml of DMF to another reactor, 200 mmole of Fmoc-His(trt)-OH (Bachem, Swiss) and 200 mmole of Bop were added and dissolved well by stirring. After adding 400 mmole of DIEA to the reactor in two fractions, the mixture was stirred for at least 5 minutes until all the solid was dissolved. The resulting amino acid mixture solution was added to the reactor containing the deprotected resin and reacted for 1 hour at room temperature with stirring. After removing the reaction solution, followed by stirring with DMF solution 3 times, 5 minutes, respectively, the solution was removed. A small amount of the reacted resin was taken and subjected to Kaiser test (Nihydrine Test) to determine the extent of reaction. His(trt)-Cys(trt)-CTL resin was prepared in the same way as described above by deprotecting 2 times with the deprotecting solution. After sufficiently washing with DMF and MC and carrying out Kaiser test once again, amino acid attachment was carried out as follows in the same way as described above.

    [0065] According to the selected amino acid sequence, chain reaction was carried out in the order of Fmoc-Cys(trt), Fmoc-Arg, Fmoc-Gln(trt), Fmoc-Val, Fmoc-Arg, Fmoc-Thr, Fmoc-Gln(trt) and Fmoc-Arg(pbf). After reacting the Fmoc-protecting group with the deprotecting solution twice for 10 minutes, respectively, the solution was removed by washing well. After performing acetylation for an hour by adding acetic anhydride, DIEA and HoBt, the prepared peptidyl resin was washed 3 times, each with DMF, MC and methanol, dried by slowly flowing nitrogen gas, completely dried in the presence of P2O5 under reduced pressure, reacted with 30 ml of a leaving solution (containing trifluoroacetic acid 95%, distilled water 2.5% and thioanisole 2.5%) for 2 hours at room temperature upon intermittent agitation. The resin was filtered and washed with a small amount of TFA solution, after which the filtrate was combined with the mother liquor. After distillation under reduced pressure to reduce the total volume to about half, precipitation was induced by adding 50 ml of cold ether and the formed precipitates were collected by centrifugation, followed by washing twice with cold ether. After removing the mother liquor, the resultant was dried sufficiently under nitrogen atmosphere to obtain 0.65 g of unpurified NH2-Arg-Gln-Thr-Arg-Val-Gln-Arg-Cys-His-Cys-OH peptide (SEQ ID No. 3) (yield: 92.6%). The molecular weight was measured as 1287.1 (theoretical value: 1286.5) using a molecular weight analyzer.

    [0066] <1-1-2> Synthesis of the Peptide of SEQ ID No. 1 and SEQ ID No. 2

    [0067] The peptide of SEQ ID No. 1 (Glu-Leu-Ile-Glu-His-Gly-Gly-Gly-Arg-Pro-Ala-Asp: ELIEHGGGRPAD) and the peptide of SEQ ID No. 2 (Ac-Tyr-Lys-Ser-Lys-Lys-Gly-Gly-Trp-Thr-His: Ac-YKSKKGGWTH) were synthesized using the same method as in Example <1-1-1>.

    TABLE-US-00001 TABLE1 measuredvalue SEQ (molecularweightanalyzer) ID aminoacid measured theoretical No. sequence value value 1 ELIEHGGGRPAD 1250.9 1250.35 2 Ac-YKSKKGGWTH 1233.8 1233.4 3 RQTRVERCHC 1287.1 1286.5

    [0068] <1-2> Synthesis of the Compound of the Present Invention

    [0069] 1 mmol of peptidyl resin and 10 ml of 1-methyl-2-pyrrolidone (NMP) are put in a peptide reactor and reacted for 30 minutes after adding 270 mg (2.0 equiv.) of 1-hydroxybenzotriazole (HOBt) and 759 mg (2.0 equiv.) of N,N,N,N-tetramethyl-O-(1H-benzotriazole-1-yl) uronium hexafluorophosphate, O-(benzotriazole-1-yl)-N,N,N,N-tetramethyl uronium hexafluorophosphate. After adding 388 mg (3 equiv.) of N,N-diisopropylethylamine (DIEA) and 624 mg (2.0 equiv.) of finasteride analogue, the mixture was reacted for 24 to 72 hours at room temperature to obtain a peptidyl resin reacted by filtering. After reacting the obtained resin for 2 hours at room temperature using a cleavage solution, the resin and protecting group were removed. After recrystallizing using 10 ml (10 mmol) of diethyl ether, hybrid peptide was obtained. The reaction schemes of the compound having a structure conjugating finasteride and peptide with a covalent bond are described in detail in the following.

    ##STR00002##

    ##STR00003##

    ##STR00004##

    ##STR00005##

    Experimental Example 1. Solubility Test of the Compound of the Present Invention

    [0070] Finasteride-CG-Nokkin compound (compound 1), finasteride-CG-Keramin2 compound (compound 2), finasteride-CG-WINT compound (compound 3) prepared in Example <1-2>, and finasteride are respectively dissolved in distilled water each in a concentration of 10 mg/ml.

    [0071] As a result, it was confirmed that finasteride itself was hardly dissolved in water, whereas compounds 1 to 3 of the present invention were all completely dissolved in water (FIG. 1)

    Experimental Example 2. Analysis on the Effect of the Compound of the Present Invention on 5a Reductase Activity

    [0072] In order to confirm the effect of the compound of the present invention on 5a reductase activity, first, liver cell extracts known to have a large amount of 5a reductase were collected through a protein extraction method. After reacting testosterone with finasteride or compounds 1 to 3 of the present invention, liver cell extracts were put in the corresponding solution and reacted for 1 hour at 37 C. The reactant of putting the liver cell extracts in testosterone and reacting it for 1 hour at 37 C. is the control. After the reaction is completed, the amount of testosterone and DHT were confirmed through HPLC. The HPLC analysis was carried out under the following conditions. [0073] C18 column [0074] UV 240 nm [0075] flow rate: 1 ml/minute [0076] mobile phase: A: 0.1% Formic acid in water [0077] B: 0.1% Formic acid in acetonitrile [0078] gradient: 0 min B 5%30 min B 80%

    [0079] As a result, when compared with the control, the concentration of testosterone was increased when treated with finasteride and the compounds of the present invention, and the concentration of DHT was decreased in proportion thereto. Also, when compared with the case treated with finasteride, it was confirmed that the increase of testosterone concentration and decrease of DHT concentration were more remarkable when treated with the compound of the present invention (see FIGS. 2a and 2b).

    Experimental Example 3. Effect of the Compound of the Present Invention on the Growth of Keratinocytes

    [0080] In order to analyze the similar effects and inhibitory effects of growth factors with respect to the compound synthesized in Example <1-2>, sulfohodomine B (SRB) calorimetric assay was carried out using HaCaT keratinocytes (Korean Cell Line Bank) according to the method of Rizzino et al. (Rizzino, et al. Cancer Res. 48:4266(1988)).

    [0081] HaCaT keratinocytes were cultured under 5% CO.sub.2 for 24 hours at 37 C. in Dulbecco's modified Eagle's medium (DMEM, Gibco, U.S.A.) containing 10% fetal bovine serum (FBS; Sigma) after inoculating each well of a 96-well plate with 3,000 cells. The cultured cell lines were treated with 1% trypsin solution to detach the cultured cell lines from the bottom of the culture flask and centrifuged to collect cell pellets. They were resuspended in FBS-free DMEM culture medium and cultured under 5% CO.sub.2 for 24 hours at 37 C. After 24 hours later, the medium was changed with the same serum-free culture medium, and the cells were cultured for 72 hours under the same conditions as described above with a blank sample dissolved in 10% DMSO in sterilized condition as reference, compounds of formulae 1 to 3 of the present invention (50 M), finasteride (50 M), and EGF (100 nM) used as a positive reference. After removing the supernatant and fixing the cells using ethanol, the cells were washed three times with phosphate buffer saline (PBS). After removing the washing solution, and treating with calorimetric SRB solution, followed by sufficient washing with 1% acetic acid, the cells were observed under a microscope to evaluate cell viability. In addition, absorbance was measured at ultraviolet rays of 560 nm to analyze cell proliferation.

    [0082] After treating the keratinocytes with the compound of the present invention and observing the morphological change in cells 72 hours later, it was confirmed that the compound of the present invention changed the growth and morphological shape of keratinocytes (FIG. 3a). Also, it was confirmed that the growth of keratinocytes was greatly increased when treated with the compound of the present invention as compared with the case treated with finasteride (FIG. 3b).

    Experimental Example 4. Effect of the Compound of the Present Invention on the Growth of HHDPC Cells

    [0083] The effect of the compounds of the present invention on the growth of HHDPC cells (ATCC/U.S.A.) was confirmed in the same manner as in Experimental Example 3. In this case, MNX (10 uM) and IGF-1 (1 uM) were used as positive control.

    [0084] As a result, it was confirmed that the compound of the present invention changed the growth and morphological shape of HHDPC cells (FIG. 4a). Also, it was confirmed that the growth of HHDPC cells was greatly increased when treated with the compound of the present invention as compared with the case treated with finasteride (FIG. 4b).

    Experimental Example 5. Analysis on the Effect of the Compound of the Present Invention on Translocation of Beta-Catenin into the Nucleus

    [0085] 5 hours after treating HHDPC cells cultured for 48 hours with the compounds of the present invention synthesized in Example <1-2>, the effect of the compound of the present invention on the translocation of beta-catenin, which is a signal substance essential for promoting hair growth, into the nucleus by the representative signaling pathway of WNT protein was measured. The expression of beta-catenin was observed through Western blot using an antibody against beta-catenin (SantaCruz, U.S.A.), and it was confirmed whether beta-catenin was translocated into the nucleus by immunohistochemistry using the same antibody. In particular, HHDPC cells were cultured in a CO.sub.2 incubator for 24 hours at 37 C. after inoculating each well of a 6-well plate with 100,000 cells. The medium was changed into a serum-free DMEM medium, and then after treating the cells with finasteride, finasteride-WINT compound, WINT respectively in concentrations of 5 and 50 M, the cells were cultured for 24 hours. After extracting the nuclear and cytoplasmic protein using a protein extraction kit, Western blot was carried out under the following conditions. [0086] preparation of 12% SDS-PAGE [0087] loading with 15 g of protein to SDS-PAGE [0088] transfer to PVDF membrane [0089] blocking with 5% dried skim milk solution for 1 hour at room temperature [0090] reaction of 1st antibody (anti-beta-catenin antibody, anti-HDAC, anti-alpha tubulin antibody) at room temperature for 2 hours in a concentration of 1/3000 [0091] washing three times with PBST for 10 minutes [0092] reaction of 2nd antibody at room temperature for 1 hour in a concentration of 1/5000 [0093] washing three times with PBST for 15 minutes [0094] detection

    [0095] As a result, it was confirmed that when treated with the compound of the present invention, the expression of beta-catenin increased. Also, it was confirmed that beta-catenin is translocated from the cytoplasm to the nucleus by the compound of the present invention even when measuring whether beta-catenin is translocated into nucleus using immunehistochemistry in HHDPC cells, and that the compound of the present invention still exists in the cytoplasm and has activity (FIGS. 5a and 5b).

    Experimental Example 6. Analysis on the Effect of the Compound of the Present Invention on Inhibition of BMP Signal Translocation

    [0096] 5 hours after treating HHDPC cells cultured for 48 hours with the compounds of the present invention synthesized in Example <1-2>, the effect of the compound of the present invention on the activity of phospho-Smad1/5/8, which is a signal substance essential for inhibiting hair loss, by the representative signaling pathway of BMP protein was measured. The expression of phospho-Smad1/5/8 was confirmed through Western blot using an antibody against phospho-Smad1/5/8. In particular, HHDPC cells were cultured in a CO.sub.2 incubator for 24 hours at 37 C. after inoculating each well of a 6-well plate with 100,000 cells. The medium was changed into a serum-free DMEM medium, and then after treating the cells with finasteride and finasteride-Nokkin compound, respectively in concentrations of 0.5, 5 and 50 M, the cells were cultured for 24 hours. After extracting the nuclear and cytoplasmic protein using a protein extraction kit, Western blot was carried out under the following conditions. [0097] preparation of 12% SDS-PAGE [0098] loading with 15 g of protein to SDS-PAGE [0099] transfer to PVDF membrane [0100] blocking with 5% dried skim milk solution for 1 hour at room temperature [0101] reaction of 1st antibody (anti-phospho-Smad1/5/8 antibody, anti-HDAC, anti-alpha tubulin antibody) at room temperature for 2 hours in a concentration of 1/3000 [0102] washing three times with PBST for 10 minutes [0103] reaction of 2nd antibody at room temperature for 1 hour in a concentration of 1/5000 [0104] washing three times with PBST for 15 minutes [0105] detection

    [0106] As a result, it was confirmed that when treated with the compound of the present invention, the expression of phospho-Smad1/5/8 in the nucleus decreased (FIGS. 6a and 6b).

    Experimental Example 7. Analysis on the Effect of the Compound of the Present Invention on the Expression of DKK-1

    [0107] The effect of the compound of the present invention on mRNA expression of DKK-1, which is a representative hair loss protein expressed by DHT was confirmed. In particular, HHDPC cells were cultured in a CO.sub.2 incubator for 24 hours at 37 C. after inoculating each well of a 6-well plate with 100,000 cells. After reacting testosterone with finasteride or the finasteride-Nokkin compound of compounds 1 to 3 of the present invention, finasteride-Keramin2 compound and finasteride-WINT compound, liver cell extracts were put in the corresponding solution and reacted for 1 hour at 37 C. The reactant of putting the liver cell extracts in testosterone and reacting it for 1 hour at 37 C. was used as a positive control. The medium was changed into a serum-free DMEM medium, and then after treating the cells with finasteride and finasteride-Nokkin compound, finasteride-Keramine2 compound and finasteride-WINT compound, respectively in a concentration 50 M, the cells were cultured for 24 hours. After extracting the RNA of the cells using an RNA extraction kit, RT-PCR was carried out using the following primers.

    TABLE-US-00002 1.DKK-1 forwardprimer: (SEQIDNo.4) (5')TGATGAGTACTGCGCTAGTC(3') reverseprimer: (SEQIDNo.5) (5')CTCCTATGCTTGGTACACAC(3') 2.GAPDH forwardprimer: (SEQIDNo.6) (5')GGAGCCAAAAGGGTCATCAT(3') reverseprimer: (SEQIDNo.7) (5')GTGATGGCATGGACTGTGGT(3')

    [0108] As a result, it was confirmed that the compound of the present invention further inhibited the expression of increased DKK-1 in the positive control more than the case treated with finasteride, and in particular, it could inhibit the expression of DKK-1 to a level even lower than the negative control, which was not treated with anything (FIGS. 7a and 7b).

    Experimental Example 8. Hair Growth Test

    [0109] The effect of the compound of the present invention on hair growth was confirmed through animal tests. In particular, the hair on the back of a 7-week old male C57BL/6 mouse was removed using hair removal cream. After preparing PBS, finasteride and the finasteride-WINT compound of the present invention in concentrations of 100 g/ml, they were evenly applied on the back skin of mice once every day, and the color of the back skin of mice was observed by taking photographs from the point the color started to turn black.

    [0110] Then, the mice were killed, and the hair on the back skin was observed through H&E staining. To this end, after collecting the back skin of mice and fixing it in 4% paraformaldehyde (PFA), paraffin embedding was carried out. After cutting the back skin of the embedded mice in a thickness of 4 the number of hair follicles was confirmed through H&E staining.

    [0111] As a result, it was confirmed that mice applied with the finasteride-WINT compound of the present invention clearly presented a faster rate of hair growth of the mice as compared with the mice applied with PBS or finasteride (FIG. 8a), and that the number of hair follicles increased remarkably as compared with the control and group administered with finasteride (FIG. 8b).

    Experimental Example 9. Skin Permeability Test

    [0112] Since finasteride is a drug controlling steroid type hormones, when it is orally administered, there may be side effects such as causing systemic toxicity by spreading through blood. Thus, if it penetrates the skin even when applied on the skin, there is a possibility for it to penetrate into the entire body and cause toxicity, and if it does not penetrate the skin, since it is left in the scalp and does not spread into the entire body, the side effects of finasteride may be inhibited. In this regard, after applying finasteride and the finasteride-WINT compound of the present invention on three dimensional artificial skin, the present inventors confirmed whether it penetrates into the skin.

    [0113] To this end, finasteride and the finasteride-WINT compound of the present invention are respectively mixed in a mixed solvent of ethanol 10%, propylene glycol 40% and purified water 50%. Franz expansion cell test was carried out using three dimensional artificial skin. Finasteride and finasteride-WINT compound solution were applied on the three dimensional artificial skin 1 ml, respectively, and left for 24 hours. After sampling the receptor chamber solution, finasteride and finasteride-WINT compound permeating the skin were detected using HPLC. The finasteride detection condition of HPLC is C18 column, UV 210 nm, flow speed 1.6 ml/min, acetonitrile:water=45:55, and the detection R.T. was 9 to 10 minutes. In order to detect the finasteride-WINT compound of the present invention, multiple reaction monitoring (MRM) assay, which is a method for detecting the corresponding molecular weight was carried out using LC-MS/MS (3200 Qtrap) equipment.

    [0114] As a result, it was confirmed that the drug treated only with finasteride permeates the skin and thus was detected, and that the drug treated with the finasteride-WINT compound of the present invention was not detected with a substance permeating the skin and was left in the skin (FIGS. 9a and 9b).

    [0115] Summing up the experimental results of Experimental Examples 1 to 9, it can be found that the compound of the present invention exerts the functions of promoting hair growth and inhibiting hair loss very excellently and exerts the function of anti-aging.

    Formulation Example 1: Softening Lotion

    [0116] The softening lotion comprising the compound of the present invention prepared in Example <1-2> and consisting of the following composition was prepared according to a general method for preparing lotion.

    TABLE-US-00003 TABLE 2 Ingredients Content (weight %) compound of the present invention 2.5 1,3-butylene glycol 6 glycerin 4 PEG 1500 1 sodium hyaluronate 1 polysorbate 20 0.5 ethanol 8 preservative, pigment q.s. benzopenone-9 0.05 fragrance trace purified water balance Total 100

    Formulation Example 2. Nourishing Cream

    [0117] The nourishing cream comprising the compound of the present invention prepared in Example <1-2> and consisting of the following composition was prepared according to a general method for preparing nourishing cream.

    TABLE-US-00004 TABLE 3 Ingredients Content (weight %) compound of the present invention 2.5 meadow foam oil 3 cetearyl alcohol 1.5 stearic acid 1.5 glyceryl stearate 1.5 liquid paraffin 10 beewax 2 polysorbate 60 0.6 sorbitan sesquioleate 2.5 squalane 3 1,3-butylene glycol 3 gylcerin 5 triethanolamine 0.5 tocopheryl acetate 0.5 preservative, pigment q.s. fragrance q.s. purified water balance Total 100

    Formulation Example 3. Milk Lotion

    [0118] The milk lotion comprising the compound of the present invention prepared in Example <1-2> and consisting of the following composition was prepared according to a general method for preparing lotion.

    TABLE-US-00005 TABLE 4 Ingredients Content (weight %) compound of the present invention 2.5 1,3-butylene glycol 4 gylcerin 4 cetearyl alcohol 0.8 glyceryl stearate 1 triethanolamine 0.13 tocopheryl acetate 0.3 liquid paraffin 5 squalane 3 macadamia nut oil 2 polysorbate 60 1.5 sorbitan sesquioleate 0.5 carboxyvinylpolymer 1 preservative, pigment q.s. fragrance q.s. purified water balance Total 100

    Formulation Example 4. Essence

    [0119] The essence comprising the compound of the present invention prepared in Example <1-2> and consisting of the following composition was prepared according to a general method for preparing essence.

    TABLE-US-00006 TABLE 5 Ingredients Content (weight %) compound of the present invention 2.5 glycerin 10 1,3-butylene glycol 5 PEG 1500 2 allantoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 hydroxyethyl cellulose 0.1 sodium hyaluronate 8 carboxyvinylpolymer 0.2 triethanolamine 0.18 octyldodeceth-16 0.4 ethanol 6 fragrance, preservative, pigment q.s. purified water balance Total 100

    Formulation Example 5. Hair Serum

    [0120] The hair serum comprising the compound of the present invention prepared in Example <1-2> and consisting of the following composition was prepared according to a general method for preparing hair serum.

    TABLE-US-00007 TABLE 6 Ingredients Content (weight %) compound of the present invention 1 gylcerin 10 1,3-butylene glycol 5 PEG 1500 2 allantoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 hydroxyethyl cellulose 0.1 sodium hyaluronate 8 carboxyvinylpolymer 0.2 triethanolamine 0.18 octyldodeceth-16 0.4 ethanol 6 fragrance, preservative, pigment q.s. purified water balance Total 100

    Formulation Example 6. Hair Toner

    [0121] The hair toner comprising the compound of the present invention prepared in Example <1-2> and consisting of the following composition was prepared according to a general method for preparing hair toner.

    TABLE-US-00008 TABLE 7 Ingredients Content (weight %) compound of the present invention 1 gylcerin 2 1,3-butylene glycol 2 PEG 1500 2 allantoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 sodium hyaluronate 8 carboxyvinylpolymer 0.2 triethanolamine 0.18 ethanol 10 fragrance, preservative, pigment q.s. purified water balance Total 100