ENZYME COMPOSITE INCLUDING HEME POLYMERASE AND HEME LIGASE, AND METHOD FOR PRODUCING HEMOZOIN USING SAME

20200291379 ยท 2020-09-17

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to an enzym complex in which a heme polymerase and a heme ligase are linked to each other via the dockerin module of cellulas, and to a method for producing a hemozoin using the same. The enzyme complex according to the present invention can polymerize heme with higher efficiency than conventional enzymes, and thus can more efficiently produce hemozoin, a conductive biopolymer.

Claims

1. An enzyme complex comprising a heme polymerase, a heme ligase, and a scaffold protein, wherein the heme polymerase comprises a first dockerin module of a first cellulase, and the heme ligase comprise a second dockerin module of a second cellulase, wherein the scaffold protein comprises a cohesin module, and wherein the heme polymerase and the heme ligase are linked via a protein-protein interaction between the cohesin module, the first dockerin module, and the second dockerin module.

2. The enzyme complex of claim 1, wherein the dockerin module is derived from endo-beta-1,4-glucanase-B.

3. The enzyme complex of claim 1, wherein the heme polymerase is encoded by a nucleotide sequence set forth in SEQ ID NO. 3.

4. The enzyme complex of claim 1, wherein the heme ligase is encoded by a nucleotide sequence set forth in SEQ ID NO. 28.

5. A method for producing the enzyme complex of claim 1, comprising the steps of: (a) preparing a heme polymerase having a first dockerin module of a first celluase bound thereto; (b) preparing a heme ligase having a second dockerin module of a second cellulase bound thereto; (c) preparing a scaffold protein comprising a cohesin module; and (d) mixing the heme polymerase and the heme ligase with the scaffold protein to such that the heme polymerase and the heme ligase are linked via a protein-protein interaction between the cohesin module, the first dockerin module, and the second dockerin module.

6. A method for producing hemozoin comprising polymerizing a heme using the enzyme complex of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0012] FIG. 1 is a schematic view of the recombinant vectors pET22(+) HRPII Exon2 (A) and pET22b(+) HDP Exon (B) inserted with HRPII Exon2 and HDP Exon, respectively, in accordance with the present invention.

[0013] FIG. 2 shows schematic views of the recombinant vectors pKEN HRPII-Doc (A) inserted with heme polymerase Exon2 gene HRPII-Doc fused with the dockerin domain gene of cellulase, the recombinant vectors pKEN HDP-Doc (B) inserted with the heme ligase exon 1-exon 2-exon 3 gene HDP-Doc fused with the dockerin domain gene of cellulase, and the recombinant vector pET22b-mCbpA (C) inserted with the mini scaffold protein gene mCbpA having a cohesin domain that binds to the dockerin domain to form an enzyme complex, in accordance with the present invention.

[0014] FIG. 3 shows the results of SDS-PAGE analysis after His-tag purification of proteins performed to analyze the expression of proteins in E. coli strain inserted with the recombinant vectors pET22(+) HRPII Exon2 and pET22b(+) HDP Exon, in accordance with the present invention.

[0015] FIG. 4 shows the results of Western blot analysis performed to analyze the expression of proteins in an E. coli strain inserted with the recombinant vectors pKEN HRPII-Doc and pKEN HDP-Doc in accordance with the present invention.

[0016] FIG. 5 shows the results of SDS-PAGE analysis performed to confirm the formation of an enzyme complex according to the present invention. Purification with cellulose indicated the formation of the enzyme complex, and His-tag purification indicated the presence of proteins corresponding to the respective subunits.

[0017] FIG. 6 shows the results of analyzing the heme polymerization activity of a complex obtained by assembling Plasmodium sp. strain-derived heme polymerase HRPII-Doc and chimeric heme ligase HDP-Doc proteins with each other, each of which has bound thereto the dockerin module of endo-beta-1,4-glucanase-B gene. The analysis was performed using heme as a substrate and the heme polymerase complex showed increased activity.

BEST MODE FOR CARRYING OUT THE INVENTION

[0018] Previous studies on hemozoin have been mostly focused on diagnosis which is performed using the magnetic properties of materials. However, in the present invention, a magnetic hemozoin polymer was produced using enzymes derived from E. coli, and it was confirmed that this magnetic hemozoin polymer has the potential to be developed into bioplastic.

[0019] In the present invention, in order to develop an enzymatic conversion technology of producing a large amount of hemozoin applicable to conductive bioplastic and to improve the efficiency of conventional heme polymerase, a complex of two different enzymes having the ability to polymerize heme was prepared, thereby increasing the efficiency with which hemozoin is produced by polymerization of heme.

[0020] Therefore, in one aspect, the present invention is directed to an enzyme complex in which heme polymerase and heme ligase are linked via interaction between a scaffold protein and a dockerin module of cellulase.

[0021] In one example of the present invention, the heme polymerase and heme ligase derived from a Plasmodium sp. strain were introduced into an E. coli expression vector and expressed, and it was confirmed that the heme-converting enzymes were expressed at high levels from the recombinant strain and easily operated.

[0022] In one example of the present invention, a fragment obtained by fusing the dockerin domain gene of cellulase to each of the exon 2 portion of Plasmodium sp. strain-derived heme polymerase (histidine rich protein 2) gene and heme ligase exon 1-exon 2-exon 3 fusion gene was introduced into an E. coli expression vector and expressed. As a result, it was confirmed that a heme polymerase fusion protein having the dockerin module linked thereto and a heme ligase fusion protein having the dockerin module linked thereto were produced.

[0023] The heme polymerase fusion protein and the heme ligase fusion protein were linked to each other via the dockerin module with a scaffold protein, thereby producing an enzyme complex.

[0024] In the present invention, the dockerin module may be derived from endo-beta-1,4-glucanase-B.

[0025] In the present invention, the heme polymerase may be encoded by a nucleotide sequence represented by SEQ ID NO. 3, and the heme ligase is encoded by a nucleotide sequence represented by SEQ ID NO. 28.

[0026] In the present invention, in order to improve the efficiency of conventional heme polymerase, an enzyme complex was prepared in which heme polymerase and heme ligase are linked via interaction between a scaffold protein and a dockerin module of cellulase, thereby increasing the efficiency with which hemozoin is produced by polymerization of heme.

[0027] Therefore, in another aspect, the present invention is directed to a method for producing the above-described enzyme complex, comprising the steps of: (a) preparing a heme polymerase having a dockerin module bound thereto; (b) preparing a heme ligase having a dockerin module bound thereto; and (c) mixing the heme polymerase and the heme ligase to produce the enzyme complex.

[0028] In the present invention, hemozoin was produced from heme using the prepared enzyme complex in which heme polymerase and heme ligase are linked via interaction between a scaffold protein and a dockerin module of cellulase, thereby increasing the efficiency with which hemozoin is produced by polymerization of heme.

[0029] Therefore, in still another aspect, the present invention is directed to a method for producing hemozoin, comprising polymerizing heme using an enzyme complex capable of producing hemozoin.

[0030] In one example of the present invention, 100 M heme dissolved in a N,N-dimethylformamide solvent was used as a substrate and the enzyme complex was reacted using 500 mM sodium acetate (pH 5.2) as a reaction buffer at 37 C. for 12 hours. Then, the amount of hemozoin produced by polymerization of heme was measured at a wavelength of 400 nm using an absorbance analyzer. As a result, it was confirmed that the heme polymerization activity was higher when heme polymerase and heme ligase were used in combination than when the polymerase was used alone, and that the polymerization activity was 1.4-fold more increased when the heme polymerase complex was used compared to that heme polymerase and heme ligase were used in combination.

[0031] The heme-converting enzyme complex developed according to the present invention can effectively act on the biological conversion of heme to hemozoin, and thus can produce a hemozoin polymer in an economical, cost-effective and efficient manner. This complex is expected to be an invention which is useful for processes. Accordingly, hemozoin converted from heme may be useful as conductive bioplastic, and thus is expected to be a very useful invention for various industrial processes. As used herein, the term vector refers to an expression vector capable of expressing a target protein in suitable host cells and to a genetic construct that includes essential regulatory elements to which a gene insert is operably linked in such a manner as to be expressed. In general, a plasmid vector is an extrachromosomal cyclic double-stranded DNA and performs various functions in cells. It acts as an inhibitor that kills similar strains or species by producing antibiotic-resistant substances and bacteriocin, and performs biological functions, such as pigment production, compound decomposition and nitrogen fixing. It has a restriction enzyme site so that an exogenous DNA fragment having a length of up to about 10 kb can be inserted therein.

[0032] In order to overcome the possibility of inserting only a relatively small DNA fragment, which is a serious disadvantage of a plasmid vector and bacteriophage, cosmid which is an engineered hybrid of a plasmid and phase DNA may be used to clone a larger DNA fragment.

[0033] The vector has a cos site which is packaged into a phage particle, and also has a plasmid replication origin that replicates in a bacterial host, and a gene capable of selecting a plasmid. It is packaged into a protein envelope in a test tube, like a bacteriophage vector. However, after an E. coli host cell is infected with the packaged DNA, the DNA replicates as a plasmid rather than bacteriophage DNA, and is not lysed. It is 2.5 kb in size, and after it is packaged into a host cell by infection, the cos site has a size of 37 kb to 52 kb. After separation, it contains foreign DNA as an insert. In generally, one having a size of 35 kb to 45 kb may be cloned as a cosmid vector.

[0034] In addition, phage, a common type of bacteriophage vector, is derived from a 50-kb double-strand wild-type genome that has single-strand complementary ends of 12 nucleotides that can form base pairs, which are called cohesive termini or cos. Host cells are lysed in a lytic pathway after replication of a new virus and release of a progeny virus. This type of DNA may have 3 kb added to the total size of 52 kb, and may also contain only 5% of the genome. A vector providing a space for foreign DNA is free of nonessential DNA fragments.

[0035] A vector related to the present invention includes plasmid vectors (e.g., pSC101, ColEl, pBR322, pUC8/9, pHC79, and pUC19), cosmid vectors, bacteriophage vectors (e.g., gt4B,-Charon, z1 and M13), and viral vectors.

[0036] The viral vector includes a vector derived from retrovirus, for example, human immunodeficiency virus (HIV), murine leukemia virus (MLV), leukemia virus (e.g., avian sarcoma and leukosis virus, ASLV), spleen necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus 8(MMTV), adenovirus, adeno-associated virus (AAV), and herpes simplex virus, but is not limited thereto.

[0037] As used herein, the term operably linked means that a nucleic acid expression control sequence is functionally linked to a nucleic acid sequence encoding the protein of interest so as to execute general functions. Operable linkage with the recombinant vector can be performed using a gene recombination technique well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes generally known in the art.

[0038] As used herein, the term regulatory element means an untranslated nucleic acid sequence that assists in, enhances, or otherwise affects the transcription, translation or expression of a nucleic acid sequence that encodes a protein. The expression vector of the present invention essentially includes a genetic circuit of the present invention as a regulatory element, and may include an expression regulatory element that can affect the expression of a protein, such as, for example, an initiation codon, a termination codon, a polyadenylation signal, an enhancer, or a signal sequence for membrane targeting or secretion.

[0039] A polyadenylation signal increases the stability of transcripts or facilitates cytosolic entry. An enhancer sequence is a nucleic acid sequence which is located at various sites in a promoter and increases transcriptional activity compared to the transcriptional activity of the promoter when the enhancer sequence is absent. Signal sequences include, but are not limited to, a PhoA signal sequence, an OmpA signal sequence, etc., when the host is an Escherichia sp. strain; an amylase signal sequence, a subtilisin signal sequence, etc., when the host is a Bacillus sp. strain; and a mating factor (MF) signal sequence, a SUC2 signal sequence, etc., when the host is yeast.

[0040] In addition, when being a replicable expression vector, the vector may include a replication origin, a specific nucleic acid sequence that initiates replication.

[0041] The vector according to the present invention may comprise a selection marker. The selection marker is used to select cells transformed with the vector. Here, markers giving selectable phenotypes, such as drug tolerance, auxotrophy, tolerance to cytotoxic agents, or expression of surface proteins, may be used as the selection marker. Since only the cells expressing the selection marker survive in an environment treated with a selective agent, it is possible to select the transformed cells. Representative examples of the selection marker include ura4, leul, his3, etc., which are auxotrophic markers, but the types of markers that may be used in the present invention are not limited by the above examples.

[0042] In the present invention, host cell means a cell which parasitizes other microorganisms or genes and supply nutrients, and which is transformed with a vector that has various genetic or molecular effects in the host cell. In the competence state of receiving foreign DNA, foreign DNA such as a vector may be inserted into the host cell. When a vector is successfully introduced into the host cell, the genetic character of the vector is provided to the host cell.

[0043] Preferably, the host microorganisms of the present invention may be Gram-negative bacteria, which include a Salmonella sp. strain, an Acinebacter sp. strain, an Escherichia sp. strain, a Pseudomonas sp. strain, a Klebsiella sp, strain, etc. For example, the Gram-negative bacteria include Salmonella typhimurium, Acinebacter calcoaceticus, E. coli, Pseudomonas aeruginosa, Klebsiella aerogenes, Acinebacter baumannii, Klebsiella pneumonia, etc., but host cells that can be transformed with the vector of the present invention are not limited thereto.

[0044] As a method of introducing a vector into the host cell, a transformation method can be used. As used herein, the term transformation refers to a process of introducing DNA into a host cell and making the DNA replicable therein as a chromosomal factor or by completion of chromosomal integration, which is a phenomenon of artificially causing a genetic change by introducing exogenous DNA into a cell. The method of transformation used in the present invention may be any transformation method, and it may be easily performed according to the conventional method used in the art. Examples of the commonly used transformation method may include a CaCl.sub.2 precipitation method, the Hanahan method with improved efficiency using dimethyl sulfoxide (DMSO) as a reducing agent in the CaCl.sub.2 precipitation method, electroporation, a CaPO.sub.4 precipitation method, a protoplast fusion method, a stirring method using silicon carbide fiber, an agrobacteria-mediated transformation method, a transformation method using polyethylene glycol (PEG), dextran sulfate-, lipofectamine-, and dry/suppression-mediated transformations, etc. The method for transforming the plasmid according to the present invention is not limited to these methods, but any method for transformation commonly used in the art may be used without limitation.

[0045] The recombinant vector comprising and the desired gene according to the present invention may be produced using restriction enzymes and polymerase chain reaction (PCR) from a vector which is conventionally used in the art as described above. In addition, the produced vector may be introduced into a host cell by a common transformation technique. In the present invention, the vector was introduced into E. coli BL21, and the expression levels of proteins were measured.

[0046] In addition, the host cell transformed by the above method may be cultured through a culture method commonly used in the art, if necessary, and the culture medium and period that can be used in the present invention may be selected arbitrarily by a person of ordinary skill in the art, if necessary.

[0047] In the present invention, preferably, an E. coli strain transformed was cultured in LB (Luria Bertani) medium for 12 hours, and then further cultured for 2 hours to induce production of proteins from recombinant genes. Various media that can be commonly used in the art can be applied to the medium.

EXAMPLES

[0048] Hereinafter, the present invention will be described in further detail with reference to examples. It will be obvious to a person having ordinary skill in the art that these examples are for illustrative purposes only and are not to be construed to limit the scope of the present invention.

Example 1

Amplification of Heme Polymerase and Heme Ligase Genes

[0049] To clone enzymes for polymerizing hemozoin, with reference to the nucleotide sequence of the exon 2 portion of a heme polymerase (histidine rich protein 2) gene from the genomic DNA of a Plasmodium sp. strain (Plasmodium falciparum Welch, ATCC PRA-405D), primers were designed and synthesized such that the restriction enzyme EcoRI recognition sequence was inserted at the 5 end of the forward primer and the restriction enzyme Hindlll recognition sequence was inserted at the 5 end of the reverse primer(SEQ ID NOS: 1 and 2). Using the synthesized primers, PCR was performed. As a result, a PCR band containing the exon 2 portion (SEQ ID NO. 3) of the 853-bp heme polymerase gene could be observed.

[0050] Primer nucleotide sequences are as follows:

TABLE-US-00001 SEQIDNO.1: GCGCgaattcgAATAATTCCGCATTTAATAATAACTTGT SEQIDNO.2: GCGCaagcttATGGCGTAGGCAATGTGT

[0051] In addition, with reference to the nucleotide sequence of a heme ligase gene from the genomic DNA of a Plasmodium sp. strain (Plasmodium falciparum Welch, ATCC PRA-405D), primers were designed so as to remove the intron portion and secure the exons only. For the exon 1 portion of the heme ligase, primers were synthesized such that the restriction enzyme EcoRI was inserted at the 5 end of the forward primer and the N-terminal 10-bp sequence of the exon 2 portion of the heme ligase was inserted at the 5 end of the reverse primer (SEQ ID NOS: 4 and 5).

[0052] In addition, for the exon 2 portion of the heme ligase, primers were synthesized such that the C-terminal 10-bp sequence of the exon 1 portion of the heme ligase was inserted at the 5 end of the forward primer, and N-terminal 10-bp sequence of the exon 3 portion of the heme ligase sequence was inserted at the 5 end of the reverse primer(SEQ ID NOS: 6 and 7). Last, for the exon 3 portion of the heme ligase, primers were synthesized such that the C-terminal 10-bp sequence of the exon 2 portion of the heme ligase was inserted at the 5 end of the forward primer, and the restriction enzyme HindIII recognition sequence was inserted at the 5 end of the reverse primer (SEQ ID NOS: 8 and 9). Next, using the synthesized primers, PCR was performed.

[0053] As a result, PCR bands containing 216-bp, 204-bp and 195-bp heme ligase exon 1 (SEQ ID NO. 10), exon 2 (SEQ ID NO. 11) and exon 3 (SEQ ID NO. 12) genes were observed.

[0054] Primer nucleotide sequences are as follows:

TABLE-US-00002 SEQIDNO.4: GCGCgaattcgATGAAAAATAGATTTTATTATAATTTGATAATTAAA A SEQIDNO.5: agctgccaacTGTAGGATGATTTAACAGATTAGAA SEQIDNO.6: tcatcctacaGTTGGCAGCTCGTTAATAC SEQIDNO.7: acattaaccaCGGTTGGTAAGATGAACCA SEQIDNO.8: ttaccaaccgTGGTTAATGTACAATGAAAAAAGG SEQIDNO.9: GCGCaagcttAAAAATGATGGGCTTATCTACTATA

Example 2

Cloning of Exon 2 Portion of Heme Polymerase (Histidine Rich Protein 2) Gene and Ligation and Cloning of Exon 1, Exon 2 and Exon 3 Genes of Heme Ligase

[0055] The amplification products of the exon 2 portion of the heme polymerase gene and the heme ligase exon 1, exon 2 and exon 3 genes, obtained in Example 1, were electrophoresed on 0.8% agarose gel, and the DNA fragments on the agarose gel were recovered using a gel extraction kit (GeneAll).

[0056] Then, in order to ligate the heme ligase exon 1, exon 2 and exon 3 genes, overlap PCR was performed using the recovered DNA fragments. From the three recovered DNA fragments, primers were designed and synthesized such that the restriction enzyme EcoRI was inserted at the 5 end of the forward primer and the restriction enzyme HindIII recognition sequence was inserted at the 5 end of the reverse primer (SEQ ID NO. 12 and 13). PCR reaction was performed, and as a result, a PCR band containing a 615-bp heme ligase exon gene of the heme ligase exon 1-exon 2-exon 3 fusion gene could be observed.

[0057] Primer sequences are as follows:

TABLE-US-00003 SEQIDNO.13: GCGCgaattcgATGAAAAATAGATTTTATTATAATTTGATAATTAAA A SEQIDNO.14: GCGCaagcttAAAAATGATGGGCTTATCTACTATA

[0058] Thereafter, each of the exon 2 portion of the heme polymerase gene HrpII and the exon gene of the heme ligase gene Hdp was cleaved, and then ligated into the E. coli expression vector pET22b(+) which was then transformed into E. coli BL21 using EcoRI and HindIII. Next, the ligated recombinant plasmid DNAs were separated from the transformants. The recombinant vectors were named pET22b(+) HRPII Exon2 and pET22b(+) HDP Exon and are shown in FIG. 1.

[0059] Also, the E. coli transformants were named BL21/HRPII Exon2 and BL21/HDP Exon.

Example 3

Amplification of Heme Polymerase Exon 2 Gene and Heme Ligase Exon 1-Exon 2-Exon 3 Fusion Gene for Fusion to Dockerin Domain of Cellulase

[0060] For formation of a heme polymerase complex, fusion of the dockerin domain gene of cellulase to the exon 2 gene of the heme polymerase obtained in Example 1 and the heme ligase exon 1-exon 2-exon 3 fusion gene was performed.

[0061] For the fusion of the dockerin domain gene of cellulase to the exon 2 gene of heme polymerase, with reference to the nucleotide sequence of the heme polymerase exon 2 gene obtained in Example 1, primers were synthesized such that the restriction enzyme XbaI was be inserted at the 5 end of the forward primer and the N-terminal 10-bp sequence of the dockerin domain of endo-beta-1,4-glucanase-B gene was inserted at the 5 end of the reverse primer (SEQ ID NO. 15 and 16).

[0062] Next, using the synthesized primers, PCR was performed. As a result, a 875-bp PCR band containing the heme polymerase exon 2 gene derived from the Plasmodium sp. strain could be observed.

[0063] In addition, in order to clone the dockerin domain gene of cellulase for formation of a heme polymerase complex of the heme polymerase exon 2 gene, with reference to the nucleotide sequence of the dockerin domain of the endo-beta-1,4-glucanase-B gene from the genomic DNA of Clostridium cellulovorans, primers were designed and synthesized such that the C-terminal 10-bp sequence of the heme polymerase exon 2 gene derived from the Plasmodium sp. strain was inserted at the 5 end of the forward primer, and the restriction enzyme PstI recognition sequence was inserted at the 5 end of the reverse primer (SEQ ID NO. 17 and 18). Next, using the synthesized primers, PCR was performed.

[0064] As a result, a 222-bp PCR band containing a dockerin domain gene of the endo-beta-1,4-glucanase-B gene could be observed.

[0065] Primer nucleotide sequences are as follows:

TABLE-US-00004 SEQIDNO.15: GCGCtctagatttaagaaggagatatacatATG AATAATTCCGCATTTA SEQIDNO.16: cagcggatccATGGCGTAGGCAATGTGT SEQIDNO.17: cctacgccatGGATCCGCTGGCTCC SEQIDNO.18: ATATctgcagtcagtggtggtggtggtggtg TAAAAGCATTTTTTTAAG

[0066] For fusion of the dockerin domain gene of cellulase to the heme ligase exon 1-exon 2-exon 3 gene, with reference to the nucleotide sequence of the exon 1-exon 2-exon 3 gene obtained by ligation of heme ligase exon 1, exon 2, and exon 3 genes in Example 1, primers were synthesized such that the restriction enzyme XbaI was inserted at the 5 end of the forward primer, and the N-terminal 10-bp sequence of the dockerin domain of the endo-beta-1,4-glucanase-B gene was inserted at the 5 end of the reverse primer (SEQ ID NO. 19 and 20).

[0067] Next, using the synthesized primers, PCR was performed. As a result, a 641-bp PCR band containing the heme ligase exon 1-exon 2-exon 3 gene derived from the Plasmodium sp. strain could be observed.

[0068] In addition, with reference to the nucleotide sequence(SEQ ID NO. 23) of the dockerin domain of the endo-beta-1,4-glucanase-B gene from the genomic DNA of Clostridium cellulovorans, primers were designed and synthesized such that the C-terminal 10-bp sequence of the heme ligase exon 1-exon 2-exon 3 fusion gene derived from the Plasmodium sp. strain was inserted at the 5 end of the forward primer, and the restriction enzyme PstI recognition sequence was inserted at the 5 end of the reverse primer (SEQ ID NO. 21 and 22).

[0069] Using the synthesized primers, PCR was performed. As a result, a 222-bp PCR band containing a dockerin domain gene of the endo-beta-1,4-glucanase-B gene could be observed.

[0070] Primer nucleotide sequences are as follows:

TABLE-US-00005 SEQIDNO.19: GCGCtctagatttaagaaggagatatacat ATGAAAAATAGATTTTATT SEQIDNO.20: cagcggatccAAAAATGATGGGCTTATCTACTATAT SEQIDNO.21: catcatttttGGATCCGCTGGCTCCG SEQIDNO.22: ATATctgcagtcagtggtggtggtggtggtg TAAAAGCATTTTTTTAAG Dockerindomainsequence(SEQIDNO.23): gatgttaacaaagatggaaaggtaaatgctatcgattatgcagtgcttaa atcaattcttttaggtacaaatactaacgttgatttatcagtatcagaca tgaataaggatggtaaagtaaatgctttggatttagctgttcttaaaaaa atgctttta

Example 4

Ligation and Cloning of Dockerin Domain Gene of Cellulase, Heme Polymerase Exon 2 Gene, and Heme Ligase Exon 1-Exon 2-Exon 3 Gene

[0071] The amplification products of the heme polymerase exon 2 gene, the heme ligase exon 1-exon 2-exon 3 gene, and the dockerin domain gene of cellulase obtained in Example 3, were electrophoresed on 0.8% agarose gel, and the DNA fragments on the agarose gel were recovered using a gel extraction kit (GeneAll).

[0072] Then, using the recovered DNA fragments, overlap PCR reaction was performed to ligate the dockerin domain gene of cellulase with the heme polymerase exon 2 gene and the heme ligase exon 1-exon 2-exon 3 gene, respectively. From the two recovered DNA fragments, primers were designed and synthesized such that the restriction enzyme Xbal was inserted at the 5 end of the forward primer and the restriction enzyme PstI recognition sequence was inserted at the 5 end of the reverse primer (SEQ ID NO. 24 and 25).

[0073] PCR reaction was performed, and as a result, a 1097-bp PCR band containing the heme polymerase exon 2 gene linked to the dockerin domain of cellulase and a 863-bp PCR band containing the heme ligase exon 1-exon 2-exon 3 gene linked to the dockerin domain of cellulase(SEQ ID NO. 28) were obtained.

[0074] Primer nucleotide sequences are as follows:

TABLE-US-00006 SEQIDNO.24: GCGCtctagatttaagaaggagatatacatATG AATAATTCCGCATTTA SEQIDNO.25: ATATctgcagtcagtggtggtggtggtggtg TAAAAGCATTTTTTTAAG SEQIDNO.26: GCGCtctagatttaagaaggagatatacat ATGAAAAATAGATTTTATT SEQIDNO.27: ATATctgcagtcagtggtggtggtggtggtg TAAAAGCATTTTTTTAAG

[0075] Thereafter, each of the chimeric heme polymerase gene HRPII-Doc and the chimeric heme ligase gene HDP-Doc was cleaved, and then ligated into the E. coli expression vector pKEN which was then transformed into E. coli BL21 using Xba I and PstI. Next, the ligated recombinant plasmid DNAs was separated from the transformants. The recombinant vectors were named pKEN-HRPII-Doc and pKEN-HDP-Doc and are shown in

[0076] FIG. 2. Also, the E. coli transformants were named BL21/HRPII-Doc and BL21/HDP-Doc.

[0077] In addition, in order to clone a mini-cellulose-binding protein A having a cellulose binding module (CBM) and two cohesin modules among cellulose-binding protein A which is a primary scaffolding subunit derived from Clostridium cellulovorans, with reference to the nucleotide sequence (GenBank: M73817.1), primers were synthesized such that the restriction enzyme BamHI recognition sequence (ggatcc) was inserted at the 5 end of the forward primer (SEQ ID NO. 29) and the restriction enzyme XhoI recognition sequence (ctcgag) was inserted at the 5 end of the reverse primer (SEQ ID NO. 30). As a result, a 1659-bp PCR band containing a mCbpA gene (SEQ ID NO. 31), a portion of the cellulose-binding protein-A gene derived from Clostridium cellulovorans, could be observed.

TABLE-US-00007 SEQIDNO.29: ggatccgcagcgacatcatcaa SEQIDNO.30: GCGCctcgaggctataggatctccaatatttat

[0078] Next, the mini-cellulose-binding protein-A mCbpA gene was cleaved, and then ligated into the E. coli expression vector pET22b(+) using BamHI and Xhol, after which the vector was transformed into E. coli BL21. Then, the ligated recombinant plasmid DNA was separated from the transformant. The recombinant vector was named pET22b-mCbpA and is shown in

[0079] FIG. 2. In addition, the E. coli transformant was named

[0080] BL21/mCbpA.

[0081] Example 5: Expression of Heme Polymerase and Heme Ligase Proteins in E. coli Transformant

[0082] In order to examine the expression of enzyme proteins in the transformants obtained in Example 2 and 4, His-tag purification and SDS-PAGE were performed.

[0083] The E. coli transformant was treated with IPTG to induce the expression of heme polymerase and heme ligase proteins, and then shake-cultured at 16 C. for 12 hours and centrifuged to collect the cells. Then, the cells were disrupted using ultrasonic waves and centrifuged, and the supernatant was concentrated (Millipore, amicon 10kDa cut off) to obtain the corresponding proteins which were then loaded onto SDS-PAGE.

[0084] Next, Western blot analysis was performed using a His-tag attached to the C-terminal end of each protein.

[0085] As a result, it could be seen that the protein bands appeared at the same positions as the expected protein sizes. The results are shown in FIGS. 3 and 4, respectively.

[0086] In order to confirm scaffold protein/enzyme complex formation caused by a combination of heme polymerase and heme ligase, a purification experiment based on the carbohydrate binding module (CBM) of the scaffold protein was performed using cellulose as resin.

[0087] Expression of protein in the BL21/mCbpA recombinant strain was induced under the condition that the mCbpA protein was secreted into culture medium. The strain was inoculated into LB medium and cultured at 37 C. for 24 hours and cultured in IPTG-containing LB liquid medium for 5 hours more, and the supernatant was concentrated (Millipore, amicon 10kDa cut off) to obtain mCbpA, a mini-cellulose-binding protein A. For protein purification based on the interaction between a cellulose binding module (CBM) and cellulose, a reaction was performed in the presence of cellulose (Sigmacell Type 50, SIGMA) at room temperature for 1 hour. After the reaction, the reaction solution was rinsed three times with 0.02 M Tris buffer (pH 8.0) containing 1 M sodium chloride, and then eluted with 0.05 M Tris buffer (pH 12.5). The enzyme protein was electrophoresed by SDS-PAGE on 10% poly-acrylamide gel.

[0088] Only when heme polymerase and heme ligase bind to the scaffold protein to form an enzyme complex, purification with cellulose was possible. To confirm this fact, SDS-PAGE analysis was performed, and it was confirmed that proteins corresponding to the respective subunits purified with the His-tag were present. The results are shown in FIG. 5.

Example 6

Combination of Heme Polymerase and Heme Ligase and Analysis of Activity

[0089] In order to confirm the polymerization activity of a combination of heme polymerase and heme ligase, the analysis of heme polymerization activity was performed using heme as a substrate for when heme polymerase and heme ligase were each used alone; when heme polymerase and heme ligase were used in combination; and a complex of heme polymerase and heme ligase was used.

[0090] In the method of analyzing the activity, 100 M heme dissolved in a N,N-dimethylformamide solvent was used as a substrate and each enzyme(s) were subjected to a polymerization reaction using 500 mM sodium acetate (pH 5.2) as a reaction buffer at 37 C. for 12 hours. Then, the amount of hemozoin polymer produced was measured using an absorbance analyzer at a wavelength of 400 nm.

[0091] As a result of the method performed as described above, it was confirmed that the activity was higher when the polymerization was performed using the combination of heme polymerase and heme ligase than when the polymerase was used alone, and that the activity was 1.4-fold more increased when the heme polymerase complex was used than the activity when the combination was used. The results are shown in FIG. 6.

INDUSTRIAL APPLICABILITY

[0092] The enzyme complex according to the present invention can polymerize heme with higher efficiency than conventional enzymes, and thus can more efficiently produce hemozoin, a conductive biopolymer. Therefore, the inventive enzyme complex is expected to be used with advantages in environmental and economic terms.

[0093] Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.