DENSE HYDROGELS

Abstract

There is provided a method for preparing a dense hydrogel comprising an at least partially gelled hydrogel, placing the at least partially gelled hydrogel in fluid communication with an end of a capillary, and driving the at least partially gelled hydrogel into the capillary to form a dense hydrogel. There is also provided a system for preparing the dense hydrogel comprising a capillary having a bore; and a driver in communication with an end of the capillary for driving an at least partially gelled hydrogel into the bore of the capillary to form a dense hydrogel.

Claims

1-96. (canceled)

97. A system for preparing a dense hydrogel, the system comprising: a capillary having a first open end, a second open end and a bore defined therebetween; a driver in communication with the second open end of the capillary, the driver arranged to selectively exert: a negative pressure to drive a hydrogel into the capillary to form a dense hydrogel in the capillary, and a positive pressure to drive the dense hydrogel out of the capillary.

98. The system of claim 97, wherein the driver is a manual or an automatic pump.

99. The system of claim 97, further comprising the hydrogel, the hydrogel being a biocompatible material.

100. The system of claim 99, wherein the hydrogel is selected from collagen, hyaluronan, chitosan, fibrin, gelatin, alginate, agarose, polyacrylamide, poly(ethylene glycol), poly(vinyl alcohol), polyacrylic acid, hydroxyl ethyl methacrylate, polyanhydrides, poly(propylene fumarate), and mixtures of the same.

101. The system of claim 99, wherein the hydrogel is collagen type I.

102. The system of claim 99, wherein the first open end of the capillary can be brought into contact with the hydrogel.

103. The system of claim 99, wherein the hydrogel includes at least one bioactive agent.

104. The system of claim 102, wherein the at least one bioactive agent is selected from cells, genes, drug molecules, therapeutic agents, particles, osteogenic agents, osteoconductive agents, osteoinductive agents, anti-inflammatory agents and growth factors.

105. The system of claim 97, wherein the first open end of the capillary has an internal diameter sufficient to eject a dense hydrogel which has a size and shape suitable for injection into a subject.

106. The system of claim 97, wherein the capillary has an internal diameter of about 0.1 to about 10 mm or about 0.1 to about 5 mm.

107. The system of claim 97, wherein the system is arranged to allow water removal from the hydrogel.

108. The system of claim 97, further comprising a support for housing the hydrogel, the hydrogel having an upper face when in the support, the first open end of the capillary contactable with the upper face of the hydrogel in the support, wherein the upper face of the hydrogel in the support has a greater surface area than a surface area of the capillary first open end.

109. The system of claim 97, further comprising a support for housing the hydrogel and a temperature control device to alter the temperature of the hydrogel in the support.

110. The system of claim 97, wherein the driver is arranged to apply a pressure of up to about 2 ATM.

111. A system for preparing a dense hydrogel, the system comprising: a capillary with a first open end, a second open end and a bore defined therebetween; a driver in communication with the second open end of the capillary, the driver arranged to exert a pressure differential to drive a hydrogel into the capillary to form a dense hydrogel in the capillary, the hydrogel comprising a solid component and a liquid component, wherein the system is arranged to allow removal of at least a portion of the liquid component to form the dense hydrogel in the capillary.

112. A kit for preparing a dense hydrogel, the kit comprising the system of claim 1, and the hydrogel in a support.

113. The kit of claim 112, further comprising capillaries having different internal diameters.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Further aspects and advantages of the present invention will become better understood with reference to the description in association with the following in which:

[0098] FIG. 1 is a schematic representation of a method or a system of the present disclosure for producing a dense hydrogel.

[0099] FIG. 2a illustrates certain embodiments of the method and system of FIG. 1 in which negative pressure is used.

[0100] FIG. 2b illustrates certain embodiments of the method and system of FIG. 1 in which positive pressure is used.

[0101] FIG. 3 illustrates certain embodiments of the method and system of FIG. 2a for producing dense hydrogels.

[0102] FIG. 4 illustrates a dense collagen hydrogel made according to the embodiments of FIG. 3.

[0103] FIG. 5 illustrates further embodiments of the method and system of FIG. 2a for producing dense hydrogels.

[0104] FIG. 6 illustrates certain embodiments of the system of FIG. 2b for producing dense hydrogels.

[0105] FIG. 7 is a three-dimensional view of an alternative embodiment of the system of FIG. 6.

[0106] FIG. 8 is an enlarged view of a capillary portion of the system of FIG. 7.

[0107] FIG. 9a are SEM micrographs (left column) and corresponding fast Fourier-transform (FFT) images (right column) showing increasing magnifications of the nanofibrillar structure of dense collagen gels according to certain embodiments of the present disclosure (Example 1).

[0108] FIG. 9b is a polarized FTIR spectrum of the dense collagen gels of FIG. 9a illustrating a change in the absorbance of the Amide I and II according to the polarization of the infra-red light.

[0109] FIG. 10a is a scanning electron micrograph of a dense collagen gel hybridized with anionic fibroin derived polypeptides (Cs) in simulated body fluid, according to certain embodiments of the present disclosure (Example 2).

[0110] FIG. 10b is a FTIR spectrum illustrating the phases of mineral formed within the collagen gel of FIG. 10a.

[0111] FIG. 11 illustrates the early response of NIH/3T3 fibroblasts to dense collagen gel formation process according to certain embodiments of the present disclosure (Example 3) through confocal laser scanning microscopy (CLSM) obtained with (a,b) Calcein AM-Ethidium Bromide and (c,d) F-actin staining of NIH/3T3 at day 1 (left column) and day 7 (right column).

[0112] FIG. 12a illustrates neural transdifferentiation of mouse Mesenchymal stem cells (m-MSCs) cultured in dense collagen gels (“I-DC”) according to certain embodiments of the present disclosure and exposed to neural transdifferentiation media (Example 4) viewed by: top row: a) confocal laser scanning microscopy (CLSM) with i Calcein-AM green positive staining, ii Ethidium Bromide red binding cells, and iii F-actin fibers staining in red), and bottom row: scanning electron micrographs of the I-DC gel at different magnifications.

[0113] FIG. 12b shows fast Fourier transform-based power density spectra of the m-MSC cells within the I-DC gels (dashed line) and a control dense collagen with non-aligned fibrils and m-MSC cells (“DC”) (solid line) of FIG. 12a at day 21 of culture, as an indication of m-MSC cell elongation and alignment.

[0114] FIG. 13 illustrates the gene expression of the m-MSCs in the I-DC gels of FIG. 12a compared to control DC gels.

[0115] FIG. 14a illustrates osteoblastic differentiation of MSCs cultured within dense aligned-fibrillar collagen gels in osteogenic media according to certain embodiments of the present disclosure (“I-DC”) (bottom row) compared to a control comprising m-MSCs cultured within dense collagen gels with no fibrillar alignment (“DC”) (top row), as investigated at day 21 of culture by (i) Von Kossa stained histological sections (scale bar=500 μm), (ii) CLSM (Calcein-AM green positive staining and Ethidium Bromide red binding cells), and (iii) SEM (Example 5).

[0116] FIG. 14b is an ATR-FTIR spectrum of the I-DC and DC gels of FIG. 14a at days 14 and 21 of culture.

[0117] FIG. 14c is an x-ray diffraction spectrum of the anisotropic I-DC collagen gels of FIG. 14a displaying an accelerated formation of apatite (more pronounced peak around 31° C.) at days 14 and 21 in culture, when compared to isotropic DC gels used as control.

[0118] FIG. 14d shows changes in ALP, Runx2 and OPN (left side) and in MMP1, MMP13 and TIMP1 (right side) gene expression within the I-DC gels of FIG. 14a at days 1, 14 and 21 relative to the DC gel control of FIG. 14a at day 1.

[0119] FIG. 15 is a graph illustrating the variation of the density of the resultant dense hydrogel by varying the capillary diameter and hydrogel precursor solution concentration (Example 6).

DETAILED DESCRIPTION OF THE INVENTION

[0120] This invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or of being carried out in various ways. Also, the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. The use of “including”, “comprising”, or “having”, “containing”, “involving” and variations thereof herein, is meant to encompass the items listed thereafter as well as, optionally, additional items. In the following description, the same numerical references refer to similar elements.

[0121] The examples below describe embodiments of the present invention concerning dense collagen hydrogels using collagen solutions as a hydrogel precursor. However, the invention is not limited to collagen-based systems and hydrogels other than collagen are included within the present scope, for example, gelatin, alginates, hyaluranon, chitosan, fibrin, agarose, polyacrylamide, PEG (polyethylene glycol), PAA (polyacrylic acid), HEMA (hydroxy ethyl methacrylate) and the like.

[0122] FIG. 1 illustrates a first aspect of the present disclosure directed to a method for making a dense hydrogel 100 comprising providing an at least partially gelled hydrogel 102; placing the at least partially gelled hydrogel in fluid communication with a first end 104a of a capillary 104; and driving the at least partially gelled hydrogel into the capillary 104 to form the dense hydrogel 100. In other words, the at least partially gelled hydrogel is passed through the first end 104a of the capillary. The capillary 104 has a bore 105 into which the at least partially gelled hydrogel 102 is driven. The first end 104a of the capillary may be directly or indirectly in communication with the at least partially gelled hydrogel.

[0123] FIG. 1 also illustrates a second aspect of the present disclosure directed to a system 112 for making a dense hydrogel 100 comprising the capillary 104 having the bore 105 for receiving the at least partially gelled hydrogel 102 and a driver 106 (FIGS. 2a and 2b) for driving the at least partially gelled hydrogel 102 into the capillary 104.

[0124] The at least partially gelled hydrogel 102 can be driven into or through the capillary 104 by the driver 106 exerting a pressure differential between the capillary 104 and the at least partially gelled hydrogel 102. This pressure differential can be increased by applying a negative or a positive pressure on the at least partially gelled hydrogel 102 or the dense hydrogel 100. In FIG. 2a, the large arrow represents the negative pressure applied through the capillary 104 on the dense hydrogel 100. In FIG. 2b, the large arrow represents the positive pressure applied to the uncompacted hydrogel 102. Atmospheric pressure may also be present acting on the uncompacted hydrogel exposed to atmospheric pressure (especially in embodiments of FIG. 2a) but is not shown in the figures. Combinations of the same or different drivers 106 are possible for applying both negative and positive pressure.

[0125] In one embodiment of the method and the system, which is illustrated in FIG. 3, the capillary 104 is a needle and the driver 106 is a syringe with a piston. The needle is removably attachable to the syringe. The syringe can exert a pressure differential across the capillary by actuation of the piston with the syringe cylinder. The needle can have any suitable internal bore diameter. In this embodiment, the internal bore diameter is 0.1 to about 1.5 mm, about 0.9 or about 1.2 mm (16 Gauge). In other embodiments, the internal bore diameter is about 0.1 to about 10 mm. The syringe can have any volume, for example 50 ml. In this embodiment, the at least partially gelled hydrogel 102 is driven into the needle and optionally into the syringe by exerting negative pressure on the hydrogel 102 through the needle by pulling a piston of the syringe away from the needle. In this embodiment, positive pressure is exerted by atmospheric pressure on the at least partially gelled hydrogel 102.

[0126] In the embodiment of FIG. 3, in step i, a hydrogel precursor 108, which is neutralized collagen type I solution, is provided and then at least partially gelled. The hydrogel precursor 108 is prepared by neutralizing 3.2 ml of rat tail tendon type I collagen (2.11 mg/ml, in 0.6% acetic acid) with 0.8 ml of 10 times concentrated Dulbecco Modified Eagle Medium (10×DMEM) and 37 μm of 5M NaOH. It will be appreciated that other hydrogel precursors can be used and prepared in manners known in the art. The gelling of this hydrogel precursor 108 is then be initiated by incubating the hydrogel precursor 108 in a support means 110 such as a cast (e.g. a mould of 20×40×10 mm). Incubation comprises allowing the neutralized collagen solution 108 to at least partially gel (self-assemble) in the cast 110 at a temperature of about 37° C. for at least about 10 minutes. Using this method, an at least partially gelled hydrogel 102 having a collagen fibrillar density of about 0.2 wt % can be achieved. It will be appreciated that the method can be adapted to obtain lower or higher collagen fibrillar densities for example by adjusting the initial collagen concentration and the gelation conditions (e.g. temperature, time, pH). It will also be appreciated that gelling of the collagen solution can be initiated in other ways and for different periods of time than that specified. Also other dimensions and shapes of moulds are possible.

[0127] Once the gel is at least partially formed, in step ii, the needle 104 is placed in contact with the at least partially formed gel 102 and the at least partially gelled hydrogel 102 is driven into the bore of the needle by pulling the syringe piston away from the needle which applied negative pressure across the needle bore. In step iii, the at least partially gelled gel 102 continues to be driven into the needle bore by continuing to pull the syringe piston away from the needle to form a dense collagen gel 100 in the bore of the needle. The dense gel 100 may also be at least partially received into the syringe barrel.

[0128] Other drivers 106 for driving the collagen gel 102 into the capillary 104 are also possible, such as a pump, which may replace the syringe or be connected to the syringe piston for actuating the same. The process of driving the gel 102 through the capillary 104 results in a densification or compaction of the same. The total water content is lower, and the total solid phase content is higher in the dense gel 100 compared to the at least partially gelled hydrogel 102. In other words, the partially gelled hydrogel undergoes compaction whilst being driven into the capillary. It has also been found that the structure of the gel re-arranges (e.g. fibrils align) so that a dense collagen gel with aligned fibrils is obtained. In the embodiment illustrated in FIG. 3, the dense collagen gel formed using the method described above has a collagen fibrillar density of about 5.5-9.2 weight % (wt %). This collagen fibrillar density can be tailored by using different capillary internal diameters, different gelation conditions, different starting collagen concentrations, and compacting using different pressure differentials across the capillary. FIG. 3 vi illustrates how decreasing the capillary diameter in certain embodiments can increase the collagen fibrillar density in the resultant dense hydrogel.

[0129] The method of FIG. 3 optionally further comprises the step of removing liquid (such as water) from the at least partially gelled hydrogel 102 before, or at the same time as, driving it through the capillary 104 (step iv in FIG. 3). Accordingly, the system 112 illustrated in FIG. 3, includes a removal means 114 (e.g. absorbent paper such as filter paper or blotting paper) for removing liquid from the at least partially gelled hydrogel by contacting a surface of the at least partially gelled hydrogel with the absorbent paper 114 which removes water by capillary action. Negative pressure across the capillary 104 can be maintained to allow the gel to be lifted from the mould and the absorbent paper 114 to be placed on the opposite side of the gel to facilitate or accelerate fluid expulsion from the hydrated collagen gel. Removing the water can accelerate the gelling process and is an optional step. It may be necessary to release the pressure for some seconds (e.g. 1-30 seconds) in order to let the gel stabilize and then re-apply the pressure again. Alternatively, a valve can be provided for pressure equalization.

[0130] The method further comprises ejecting the dense hydrogel 100 from the capillary 104 (step v in FIG. 3). The dense hydrogel 100 can then be delivered directly to a site in a human or animal patient, or into a container for storage (not shown), using a delivery device. In the embodiment illustrated in FIG. 3, the delivery device is the same needle 104 used to form the dense hydrogel 100.

[0131] In FIG. 3, the dense collagen gel 100 is ejected from the needle 104 by applying a positive force on the dense collagen e.g. by pushing the syringe piston towards the needle. The piston can be moved manually (by hand) or automatically (by pump). The same syringe, or a different syringe containing an inert liquid medium (not shown) may be used. Of course, other ways of delivering the dense collagen from the needle are also possible, such as through the use of a pump.

[0132] Alternatively, the dense hydrogel may be passed into the syringe, and then a delivery device with a different diameter used to deliver the dense hydrogel.

[0133] The dense hydrogel may also be stored in a receiver such as the chamber/cylinder of the same or different syringe or the capillary bore until needed.

[0134] In the embodiment of FIG. 3, the resultant dense collagen 100 has a size and shape corresponding to the internal size and shape of the capillary. By means of the size and shape of capillary, the resultant dense hydrogel is sized and shape to be suitable for delivery to a treatment site by injection. As can be seen in FIG. 4, the dense hydrogel 100 obtained through the method and system of FIG. 3 has a cohesive form and has a shape and size suitable for being injected.

[0135] Certain other embodiments of the method include the addition of substances into the hydrogel precursor 108, for example bioactive agents such as cells (e.g. stem cells), genes, drug molecules, therapeutic agents, particles (e.g. silk fibroin derived polypeptide particles), osteogenic agents osteoconductive agents, osteoinductive agents, anti-inflammatory agents, growth factors, enzymes (e.g. alkaline phosphatase) or the like. These can be added to the partially gelled hydrogel, during or before gelation.

[0136] An alternative embodiment of the method and system of FIGS. 3 and 4 is illustrated in FIG. 5. In this embodiment, the driver 106 is a pump which exerts negative pressure on the at least partially gelled hydrogel 102 or the hydrogel 100 in order to drive the at least partially formed hydrogel 102 into the capillary 104 to form the dense hydrogel 100. The dense hydrogel 100 is then delivered from the capillary bore by exerting a positive pressure on the dense gel 100 using the same or a different driver for controlled ejection of the dense hydrogel 100.

[0137] Specifically, in the system 112 of FIG. 5, the capillary 104 is a needle connectable to a first valve 120 (e.g. a three-way Luer lock valve) which in turn is connectable to a second valve 122. The second valve is then connectable to the driver 106. By means of the first and second valves 120, 122, a pathway 123 between the pump 106 and the second valve 122 can be opened and closed. The driver 106 is a pump which can preferably exert both negative and positive pressure. In this embodiment, the pump is an O-ring syringe piston with a locking mechanism 124 comprising threads 126 and a wing lock 128 (e.g. as described in U.S. Pat. No. 5,860,955, U.S. Pat. No. 5,713,342, U.S. Pat. No. 6,796,959 or U.S. Pat. No. 6,938,319). This type of pump is currently used for balloon catheterization and stent delivery procedures. The pump 106 can generate a negative or positive pressure (e.g. up to 30 ATM) in a controllable manner by engaging the threads 126 in order to maintain the selected pressure. Any other type of pump can also be used. Interchangeable needles of differing gauge sizes can be used with embodiments of the system 112 as the capillary 104. The smaller the diameter of the capillary 104, the higher the density of the dense hydrogel which can be achieved.

[0138] In use, a user selects an appropriate negative pressure to be applied from the pump 106 on the at least partially gelled hydrogel 102 which is in communication with the free end of the needle. The appropriate negative pressure can be maintained by engaging the locking mechanism 124. As the at least partially gelled hydrogel 102 is drawn into the needle bore, the dense hydrogel is formed is the needle bore. Water can be removed from the at least partially gelled hydrogel 102 using the absorbent paper 114 applied to the at least partially gelled hydrogel outside of the needle.

[0139] In order to prevent movement of the dense hydrogel 100 in the needle once the densification process is almost complete, the first valve 120 is opened and the second valve 122 is closed. This closes the pathway 123 to the pump 106 while providing an open path through the first valve 120 in order to equalize the pressure within, and surrounding the capillary 104.

[0140] Optionally, for controlled ejection of the densified gel 100, the pathway 123 between the dense hydrogel and the pump may be flooded with a less-compressible fluid than air, such as liquid. A syringe 130 containing a liquid (e.g. water, phosphate buffered saline, cell culture medium, saline etc) is connected to the second valve 122 whilst a pathway towards the needle 104 is closed and the pathway 123 is open. The liquid from the syringe 130 can then replace the air. Once the pathway 123 is full of liquid, the pathway towards the syringe 130 is closed, and the pathway to the needle 104 is opened. Positive pressure can then be applied by the pump 106 to eject the dense gel 100.

[0141] Depending on the size of the dense hydrogel, and diameter (i.e. gauge) of the needle, the required ejection pressure will vary. In one example, a 1 mL gel with a 10G (2.692 mm internal diameter) needle requires between 1-1.5 ATM, while a 16G (1.194 mm internal diameter) needle can require up to 2 ATM.

[0142] Referring now to FIG. 6, an embodiment of the method and system of FIG. 2b is shown, in which positive pressure is applied directly to the uncompacted at least partially gelled hydrogel 102 by a driver 106. The driver in this embodiment, is a chamber 140 for receiving the at least partially gelled hydrogel 102 or the hydrogel precursor, the chamber 140 having a pressurizable environment 141. The environment 141 can be any substance which can be pressurized. The system 112 further comprises an inlet 142 through which the environment 141 can be pressurized such as by forcing in gas or liquid to provide a positive pressure on the partially gelled hydrogel 102. In certain embodiments, the partially gelled hydrogel 102 is separated from the environment by a flexible membrane 144. In certain embodiments, the membrane 144 is a semi-permeable membrane which allows the flow of fluid from the at least partially gelled hydrogel to the environment. The membrane 144 can be an osmotic membrane (e.g. dialysis tubing). This membrane 144 is attachable to the chamber via an attachment 146, such as a threaded male and female attachment, that can clamp the membrane 144 in the correct position for attachment to the capillary 104. The environment 141 can include a hypertonic medium (not shown) surrounding the membrane 144 and the least partially gelled hydrogel 102 contained therein. The hypertonic medium acts as the removal means 114 for removing liquid from the partially gelled hydrogel.

[0143] To increase the rate of insertion of the at least partially gelled hydrogel 102 into the capillary 104, the pressure difference between the internal and external environment of the capillary can be controlled. In this embodiment, negative pressure across the capillary can be generated by the driver 106 which can be a syringe apparatus (syringe piston 106a actuating in a syringe chamber 106b) or a vacuum pump (not shown). The capillary 104 extends through a top wall of the chamber 140. An attachment/seal 145 may be provided to attach and/or seal the capillary to the chamber 140. The attachment 145 may be a locking screw.

[0144] The positive pressure within the chamber 140 can be generated by the influx of any substance, such as gas through the inlet 142. In certain embodiments, gas is pumped into the chamber 140 which in turn applies pressure on the fluid (e.g. hypertonic media) contained within the chamber 140, which in turn applies pressure on the at least partially gelled hydrogel 102 to force it into the capillary 104. The difference in pressure between the external and internal environments of the capillary may permit large samples of the at least partially hydrated hydrogel to be compacted to a greater extent than the embodiments shown in FIGS. 3 and 5. By means of the chamber 140 and membrane 144, a sterile environment can be achieved without the loss of material including additives in the partially gelled hydrogel (such as therapeutic agents, cells, particles, etc.). Furthermore, removal of the water from the at least partially gelled hydrogel 102 through osmosis as it is pressed into the capillary 104 can also shorten the time to make the dense hydrogel.

[0145] FIGS. 7 and 8 illustrate in more detail an embodiment of the system of FIG. 6.

[0146] In any of the above described embodiments of the system or method of the present disclosure, a stepped approach may be taken to obtain a dense hydrogel with small diameters, in which the at least partially gelled hydrogel is first compacted in a larger internal diameter capillary, followed by further compaction in a capillary or capillaries with a smaller internal diameter. This approach can avoid or minimize clumping or loss of gel functionality. In this case, the capillaries may be separate or joined.

[0147] According to another aspect of the present disclosure (illustrated in FIGS. 6 and 7), there is provided a device for preparing a dense hydrogel, the device comprising the chamber 140 for receiving the at least partially gelled hydrogel 102 or a hydrogel precursor; the connector (attachment) 145 for connecting to a capillary 104 into which the at least partially gelled hydrogel 102 can be driven to form a dense hydrogel 100; the inlet 142 connectable to a pump for applying positive pressure in the chamber 140.

[0148] From a further aspect, there is provided a device for preparing a dense hydrogel, the device comprising: a membrane 144 for receiving an at least partially gelled hydrogel 102 or a hydrogel precursor, wherein the membrane 144 has flexible walls, and the connector 145 for connecting to the capillary 104 into which the at least partially gelled hydrogel 102 can be forced to form a dense hydrogel 100; the chamber 140 for receiving the membrane 144 and for applying pressure to the flexible walls, in use, to force the at least partially gelled hydrogel 102 into the capillary 104. The chamber 140 further comprises the inlet 142 for pressurizing the environment 141. The flexible walls of the membrane 144 comprise an osmotic membrane, and the chamber 140 comprises a hypertonic medium in contact with the osmotic membrane for removing water from the at least partially gelled hydrogel by osmosis. The device further comprises a pump for exerting pressure across the capillary.

[0149] The device, system or method of FIG. 6 or 7 can further comprise a heat and/or humidity controller for controlling the heat and/or humidity inside the chamber 140. This can regulate the gelling process The device further comprises the capillary 104, the capillary 104 having a smaller diameter than a diameter of the chamber or the vessel.

[0150] According to another aspect of the present disclosure, there is provided a kit for forming a dense hydrogel, the kit comprising a capillary 104 having a bore 105, and a driver 106 attachable to an end of the capillary for driving an at least partially gelled hydrogel into the bore 105 of the capillary to form a dense hydrogel. The kit further comprises any of the system 112 or device features described above and illustrated in the figures. In certain embodiments, the kit comprises a hydrogel precursor or an at least partially gelled hydrogel. The hydrogel precursor can be a collagen hydrogel precursor, such as type I collagen solution. The capillary is a needle with a bore. The driver can be a pump (e.g. as illustrated in FIG. 5), a syringe (e.g. as illustrated in FIGS. 3 and 4), or a positive pressure driver (e.g. the pressurized chamber 140 of FIGS. 6 and 7). The kit can further include instructions for use.

[0151] According to another aspect of the present disclosure, there is provided dense gels having aligned fibrils. The dense hydrogel may have a substantially aligned solid phase, and the density of the solid phase may be from about 2 to about 60 wt %. In certain embodiments, the hydrogel is dense collagen with a density of from about 2 to about 60%, about 5 to about 50%, about 5 to about 45%, about 10 to about 40%, about 15 to about 35%, about 20 to about 30%, about 5 to about 60%, about 10 to about 60%, about 15 to about 60%, about 20 to about 60%, about 25 to about 60%, about 30 to about 60%, about 35 to about 60%, about 40 to about 60%, about 45 to about 60%, or about 50 to about 60%. The solid phase of the hydrogel is fibrillar and the alignment of the fibers is >0.038 unit when measured using the method reported by Ayres et al. [Ayres et al., Biomaterials. 2006, 27(32): 5524-5534; and Ayres et al., J. Biomater. Sci. Polymer Edn, Vol. 19, No. 5, pp. 603-621 (2008)]. The dense collagen is suitable for injection into a treatment site of a patient and has an internal diameter corresponding to or less than a diameter of a needle or a catheter. In this embodiment, the collagen further includes cells or particles. The cells are aligned with the aligned fibrils. In other embodiments, the particles are fibroin-derived polypeptides, such as polypeptides isolated and extracted from silk fibroin such as a soluble fraction Cs, a precipitated fraction Cp, or a combination of the Cs and Cp fractions.

EXAMPLES

[0152] The examples below are given so as to illustrate the practice of various embodiments of the present disclosure. They are not intended to limit or define the entire scope of this disclosure.

Example 1—Morphological Analysis of Dense Aligned-Fibrillar Collagen Gels

[0153] Dense collagen hydrogels were made according to certain embodiments of the present disclosure substantially as illustrated in, and described in relation to, FIG. 3. The collagen fibre alignment in the resultant dense hydrogels was investigated using Scanning Electron Microscopy and polarized attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy.

[0154] For SEM, the dense gels were fixed with a 4% glutaraldehyde 0.1M sodium cacodylate solution overnight at 4° C. The samples were then washed with deionised distilled water and dried at 4° C. through a graded series of ethanol solutions. In order to maintain collagen triple helical structure, samples were subsequently dried with a Ladd critical point dryer. Samples were then sputter coated with Au/Pd. The SEM analysis was performed with a S-4700 Field Emission-STEM at 2 kV and 10 μA. For ATR-FTIR, a FTIR microscope was coupled with a polarizer. The incident infra-red light was rotated 90° on a spot size of 100 μm.sup.2 and an average (n=64) spectrum of the sample was acquired at 0° and 90° using a resolution of 4 cm.sup.−1.

[0155] It can be seen in FIG. 9a that the dense collagen hydrogel has substantially aligned collagen fibrils. Driving the non-densified partially-gelled collagen gel into a capillary forces the collagen fibrils to re-arrange and to align with one another along the long axis of the capillary. The collagen fibrillar density of the dense hydrogels was found to be from about 2 to about 60 wt %. The left column of FIG. 9a shows the collagen fibrils at increasing magnifications. The right column shows the Fast Fourier Transform (FFT) of the images. When analyzed according to the method reported by Ayres et al. (see above), a degree of anisotropy of 0.053±0.012 was reached. The vertical light gray lines are an indication of the alignment. Polarized ATR-FTIR spectra of injectable collagen gels taken by rotating the collimator by 90° (FIG. 9b) showed how the collagen is not denatured by the whole process (Amide I peak at 1661 cm-1). In addition, the reduction of the Amide I absorbance and the corresponding increase of the Amide II absorbance with a 90° shift in the polarization of the IR light corroborated the morphological analysis, as it is an indication of the alignment of the collagen fibrils.

Example 2—Incorporation of Anionic Fibroin Derived Polypeptides into the Dense Aligned-Fibrillar Collagen Gel

[0156] Dense collagen hydrogels incorporating anionic fibroin derived polypeptides were made according to certain embodiments of the present disclosure substantially as illustrated in, and described in relation to, FIG. 3. This illustrates that the presently disclosed system 112 and method can be used to incorporate any macromolecules or inorganic materials, such as particles, fibrils, hollow fibrils, having a size between about 5 nm to about 300 μm, into the dense hydrogel.

[0157] In this example, collagen precursors were hybridized with 10 dry wt % anionic fibroin derived polypeptides (Cs) at the point of fibrillogenesis (fibril formation). This was then passed into a 0.9 mm capillary needle according to certain embodiments of the present disclosure to form a dense collagen-Cs hybrid gel. The dense collagen-Cs hybrid gels were then injected into sterile simulated body fluid (SBF) at 37° C. for up to 7 days to investigate the bioactivity of the hybrid material, in comparison to the previously published data of the inventors (Marelli et al. Biomaterials. 2012; 33:102-8, the contents of which are incorporated herein by reference).

[0158] It was found that the method of densifying the hydrogel did not affect the mineralization of the dense collagen gels in SBF as at day 7 carbonated-hydroxyapatite was extensively formed within the aligned collagenous matrix. As seen in FIG. 10a, the collagenous matrix maintained its nanofibrillar aligned structure throughout the process and resulted in homogenous mineralization. The inset image in FIG. 10a is a higher magnification micrograph in which the collagen nanofibrils and carbonated-hydroxyapatite crystals are visible. The exposure of this dense collagen gel to SBF resulted in the rapid mineralization of the aligned collagenous matrix. As can be seen in the FTIR spectra of FIG. 10b, v.sub.3 and v.sub.1 PO.sub.4.sup.3− absorbances at 1012 cm.sup.−1 and 961 cm.sup.−1 together with the v.sub.2 CO.sub.3.sup.2− absorbance at 871 cm.sup.−1 indicated the formation of carbonated hydroxyapatite within the anisotropic collagen matrix.

Example 3—Viability of Cells Seeded within the Dense Aligned-Fibrillar Collagen Gels

[0159] Cells were incorporated in the at least partially gelled hydrogel before being passed into the capillary, according to certain embodiments of the present invention, and were found to remain viable through the densification and fibrillar alignment process.

[0160] NIH/3T3 cells were homogenously seeded in dense collagen gels by incorporating them in the collagen solution at the point of gel self-assembly. The method and system of FIG. 3 was applied. NIH/3T3 cells seeded in the dense collagen gels were cultured up to day 7 in basal culture medium. Viability and morphological analysis of NIH/3T3 cells seeded in injectable dense collagen gels are presented in FIG. 11. The top and bottom rows show, respectively, confocal laser scanning microscopy (CLSM) images obtained with (a,b) Calcein AM-Ethidium Bromide and (c,d) F-actin staining of NIH/3T3 at days 1 (left column) and 7 (right column). At day 1, the NIH/3T3 cells seeded in dense collagen were alive and aligned along the nanofibrils. At day 7, viability and alignment of the NIH/3T3 cells were maintained.

Example 4—Neuronal Transdifferentiation of Mouse Mesenchymal Stem Cells Seeded within Dense Aligned-Fibrillar Collagen Gels

[0161] Mouse mesenchymal stem cells (m-MSCs) were incorporated in the at least partially gelled hydrogel (at the point of self-assembly) before being passed into a 0.9 mm diameter capillary to form a dense aligned-fibrillar collagen gel according to certain embodiments of the present invention (FIG. 3) (“I-DC”). The transdifferentiation of the m-MSCs in the dense gels toward a neuronal phenotype was then investigated (Table 1) by culturing the MSCs in the dense collagen gels and exposing them to neural transdifferentiation media, and comparing them to a control.

[0162] Culturing comprised placing the I-DC gels in complete media (alpha-minimal essential media, 10% HyClone Foetal Bovine Serum, 2 mM L-glutamine, 100 U/mL Penecillin-Streptomycincontaining differentiation (diff) supplements conducive towards nervous (N-) lineage. For N-diff, 1 mM Beta-mercaptoethanol was supplemented to the culture media for the first day, and 35 ng/mL of all-trans-retinoic acid supplemented the media for the second day. In subsequent days, only 5 μM forskolin, 10 ng/mL basic fibroblast growth factor, platelet derived growth factor (AA) 10 ng/mL, and 10 ng/mL insulin-like growth factor-1 were supplemented to the media (which was changed every other day).

[0163] The control was m-MSCs seeded dense collagen gels without fibrillar alignment (“DC”). The control gels were made by neutralizing 3.2 ml of rat tail tendons type I collagen (2.11 mg/ml, in 0.6% acetic acid) with 0.8 ml of 10 times concentrated Dulbecco Modified Eagle Medium (10×DMEM) and 37 μm of 5M NaOH. The solution (4 ml) was then cast in a rectangular mould (18×43 mm.sup.2) and incubated at 37° C. for about 25 minutes. m-MSCs were incorporated at the point of self-assembly. The gel was then gently removed from the mould and compressed to form rectangular sheets using 1 kPa for 5 minutes in combination with blotting. The sheets were rolled along the long axis and halved to give cylindrical shaped dense collagen specimens incorporating MSCs of 1.0±0.1 mm diameter. mRNA expression of each gene was first normalized by a stable housekeeping gene (m-mEef2) and then related to the normalized expression level of the same gene in MSCs seeded in dense collagen gels (I-DC) at day 1. The up-regulation of all the neural genes used as marker for neuronal phenotype indicated an accelerated transdifferentiation of MSCs cells towards the neuronal phenotype already at day 1 of culture. The markers were then upregulated for the culture time points considered.

[0164] The dense collagen gels according to embodiments of the present disclosure (I-DC) supported the culture and the transdifferentiation of the m-MSCs toward a neuronal phenotype. The cells remained viable at all time points (FIG. 12a, see top row (a: i and ii), with an elongated cytoskeleton along the fibril direction (FIG. 12a, see top row a: iii) and displayed a typical dome-shaped nucleus typical of the neuronal phenotype (FIG. 12ai, see bottom row b) when analyzed through confocal laser scanning microscopy (CLSM) and SEM. The m-MSCs cultured in dense collagen gels for 14 days showed preferential alignment along the aligned collagen fibrils. In the control gels, the cells appeared to be more rounded in nature (less-oriented). These results showed that T-DC provided a better environment to sustain the transdifferentiation of m-MSCs toward a neuronal phenotype, when compared to the DC control.

[0165] FIG. 12b is a fast Fourier transform-based power spectra density of the m-MSCs distribution within the T-DC gels (dashed line) and the DC control gel (solid line) at day 21 of culture. The power spectra density were obtained from the CLSM microscopy images according to Millet et al., Integr. Biol., 2011, 3, 1167-1178. This provides a qualitative evaluation of cell elongation and alignment. The tight radial distribution and the highly increased gray value of m-MSCs around 90° and 270° cultured in I-DC gels when compared to the DC counterpart is an indication of their elongated structure and of their high degree of alignment within the aligned hydrogel of the present dislcosure.

[0166] In addition, q-PCR analysis of the m-MSCs gene expression evidenced an over-expression of neuronal-like genes in I-DC collagen, when compared to the control DC (FIG. 13), indicating that the I-DC gels were better able to support the neuronal transdifferentiation of the m-MSCs cells. The anisotropic matrix of the dense collagen gels of the present disclosure appears to make it a more stimulating environment for neuronal cells when compared to the control. Together these results suggested that the dense collagen gels of the present disclosure may be suitable constructs for nerve regeneration, as well as other applications in which aligned cells or other agents are preferred. These constructs may be injectable.

TABLE-US-00001 TABLE 1 Primers (in 5′ .fwdarw. 3′ Orientation) used to investigate the transdifferentiation of MSCs toward a neuronal phenotype in I-DC and DC gels Eef2 (+)GCTGCACAGTGCCCACCCAT (−)CACAGCCTGCCAGTCCAGC NES (+)CCAGCTGGCTGTGGAAGCCC (−)TGTGCCAGTTGCTGCCCACC INA (+)AGACGCGGTTTAGCACCGGC (−)GGACAGCCCGGCAGAGGAGA Sen10a (+)GGAGAGCCCTCGGGTCCCTG (−)GTTTTGCGCACCTGCCAGCC Tubb3a (+)TACACGGGCGAGGGCATGGA (−)TCACTTGGGCCCCTGGGCTT

Example 5—Osteoblastic Differentiation of Mouse Mesenchymal Stem Cells Seeded within Dense Aligned-Fibrillar Collagen Gels

[0167] Mouse mesenchymal stem cells (m-MSCs) were seeded in collagen gels at the point of self-assembly and dense gels were then produced according to embodiments of the present disclosure using a 0.9 mm diameter capillary to form the dense hydrogel. The differentiation of m-MSCs in the dense gels toward an osteoblastic phenotype was then investigated and compared to MSCs seeded and cultured in control gels (the control gels were made as described above in Example 4). Osteoblastic differentiation supplements were used comprising 50 μg/mL ascorbic acid, 50 mM beta-glycerophosphate, and 1 μM dexamethasone, with replenishment every 3 days.

[0168] The dense collagen gels of the present invention (I-DC) supported the culture of m-MSCs and accelerated their differentiation toward an osteoblastic phenotype, when compared to conventional DC gels (no fibrillar alignment). For all the time points considered, the m-MSCs remained viable (FIG. 14a bottom row (i, ii), and were found to mineralize the aligned collagen matrix (FIG. 14a bottom row (iii)), when analyzed through Von Kossa staining of histological sections, CLSM and SEM. The I-DC gels showed a greater extent of mineralization which is a sign of scaffold-induced accelerated osteoblastic differentiation. The mineral phase was seen within the outer region of the dense collagen gel. The CLSM staining (Calcein-AM green positive staining and Ethidium Bromide red binding cells) showed cells aligned along the collagen nanofibril direction for I-DC. For the control DC gels, a random cell distribution was seen.

[0169] SEM allowed an investigation of the mineralization of the collagenous matrix. For the I-DC, a mineralized collagen matrix was observed within aligned fibrils (FIG. 14 a, bottom row (iii)). For the DC gels, a sporadic presence of mineral phase nucleated on collagen was observed (FIG. 14 a, top row (iii)).

[0170] Table 2 summarizes the extent of mineralization seen in the I-DC and DC samples. In particular, Von Kossa stained histological sections taken at day 21 (FIG. 14 i) revealed an extensive mineralization of I-DC gels (48±19% of positively stained scaffold surface), when compared to DC gels (7±4% of positively stained scaffold surface).

TABLE-US-00002 TABLE 2 Mineralization score of I-DC and DC gels. The score is based on % of area of histological sections of I-DC and DC gels that was mineralized as viewed by Von Kossa staining. Day of culture of m-MSCs in I-DC or DC gels Day 14 Day 21 DC + + I-DC ++ +++ +: 0-17% of area was mineralized. ++: 18-34% of area was mineralized; +++: 35-51% of the area was mineralized.

[0171] In addition, ATR-FTTR and XRD analyses were used to evaluate the MSC-mediated mineralization of the DC and I-DC gels. In FIG. 14b, MSC-seeded DC and I-DC gels showed an increase in the absorbance of v.sub.3 PO.sub.4.sup.3− at 1018 cm.sup.−1 and of v.sub.2 CO.sub.3.sup.2− at 872 cm.sup.−1, suggesting the formation of carbonated hydroxyapatite. FTIR spectra of I-DC gels showed a higher absorbance of the v.sub.3 PO.sub.4.sup.3− vibration at days 14 and 21 when compared to the DC ones, indicating an accelerated mineralization of the injectable dense collagen gels.

[0172] XRD diffractographs of MSCs-seeded DC and I-DC at day 14 and 21 (FIG. 14c) showed more crystalline structures in the I-DC gels, due to the preferential alignment of the collagenous nanofibrils within the gel structure. At day 14, the formation of an apatitic phase (broad peak around 31°) was visible in I-DC but not in DC gels, indicating an accelerated mineralization of the injectable dense collagen gels when compared to the DC counterpart.

[0173] FIG. 14d shows changes in ALP, Runx2 and OPN (left side) and in MMP1, MMP13 and TIMP1 (right side) gene expression within T-DC at days 1, 14 and 21 relative to DC at day 1 to evaluate the osteoblastic differentiation of MSCs. At each time point, RNA expression of each gene was first normalized by the housekeeping gene (GAPDH) and then related to the normalized expression level of the target gene in I-DC. Two-way ANOVA test (coupled with Tukey's test, p<0.05) was used to evaluate the effects of material and culture time on MSCs gene expression. Both material and culture time significantly affected (p<0.05) the expression of ALP, Runx2 and OPN genes. ALP, Runx2 and OPN genes were upregulated in MSCs cultured in I-DC gels when compared to the DC counterpart both at days 14 and 21 (p<0.05), indicating an accelerated osteoblastic differentiation of MSCs in I-DC gels. At day 21, the down-regulation of ALP and Runx2, early markers for the osteoblastic differentiation of MSCs and the up-regulation of OPN, a marker for mature osteoblastic differentiation, indicated that I-DC were able to sustain the osteoblastic differentiation of MSCs toward a more mature cell type.

[0174] Both material and culture time significantly affected (p<0.05) the expression of MMP1, MMP13 and TIMP1 genes. MMP1 and MMP13 were downregulated in MSCs cultured in 1-DC gels when compared to the DC control both at days 14 and 21 (p<0.05). TIMP1 was upregulated in MSCs cultured in I-DC gels when compared to the DC control both at days 14 and 21 (p<0.05). The downregulation of genes for the synthesis of metalloproteases (MMPs), together with the upregulation of genes for encoding MMPs inhibitor suggested a significant reduction in the MSCs-mediated remodeling of the aligned dense collagenous matrices.

[0175] Together these results suggest that the dense gels of the present disclosure may be suitable as constructs for bone regeneration. Also, due at least in part to the dimensions of the dense aligned-fibrillar hydrogel obtained, these resultant hydrogels may be injectable. In addition, the anisotropic matrix of the dense gels of the present disclosure accelerated the cell-mediated mineralization of the gels.

Example 6—Controlling the Density of the Resultant Dense Hydrogel by Varying Capillary Diameter, Hydrogel Precursor Solution Concentration and Applied Pressure Differential

[0176] Using the system and method described in FIG. 5, the final collagen fibre density (CFD) of various initial concentrations of collagen gel precursors and needle diameters were investigated. As shown in FIG. 15, it was found that decreasing the capillary diameter increased the resultant hydrogel CFD, where Gauge 10=2.69 mm, Gauge 14=1.60 mm, and Gauge 16=1.19 mm. Increasing the collagen precursor solution concentration also increased the resultant hydrogel CFD. The system and method embodiments of FIG. 5 generally applied a higher pressure differential than the embodiments of FIG. 3. Higher resultant CFD values were observed in the embodiments of FIG. 5. Increasing the pressure differential even further (as is the case for the embodiments illustrated in FIGS. 6-8), or the initial starting concentration, would further increase the resultant CFD.

[0177] While several embodiments of the invention have been described herein, it will be understood that the present invention is capable of further modifications, and this application is intended to cover any variations, uses, or adaptations of the invention, following in general the principles of the invention and including such departures from the present disclosure as to come within knowledge or customary practice in the art to which the invention pertains, and as may be applied to the essential features hereinbefore set forth and falling within the scope of the invention as defined in the appended claims.