IMPROVED PEPTIDE EXPRESSION AND APO-H SPECIFIC SUBJECT ANTIBODY DETECTION
20200291093 ยท 2020-09-17
Inventors
Cpc classification
C12N2740/16043
CHEMISTRY; METALLURGY
G01N2800/226
PHYSICS
G01N33/564
PHYSICS
C12N15/64
CHEMISTRY; METALLURGY
International classification
G01N33/543
PHYSICS
C12N15/64
CHEMISTRY; METALLURGY
Abstract
Provided herein are compositions, systems, kits, and methods for expressing a peptide of interest, such as Apolipoprotein H (ApoH), also known as 2-glycoprotein I (2GPI), at increased levels using a non-ApoH signal peptide (e.g., a signal peptide that permits increased protein export from cells). Also provided herein are compositions, systems, kits, and methods for employing such recombinant ApoH with a non-ApoH signal peptide to detect subject Apolipoprotein H antibodies in a sample from a subject (e.g., to diagnose antiphospholipid syndrome in a subject).
Claims
1. A composition comprising: a non-natural peptide, or nucleic acid sequence encoding said non-natural peptide, wherein said non-natural peptide comprises: a) a signal peptide portion comprising, or consisting of, a hydrophobic region comprising at least seven consecutive hydrophobic amino acids, and b) a peptide of interest portion.
2. The composition of claim 1, wherein said peptide of interest portion comprises a protein selected from: a therapeutic protein, an antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, an ScFv or fragment thereof, an Fc-fusion protein or fragment thereof, a growth factor or a fragment thereof, a cytokine or a fragment thereof, an extracellular domain of a cell surface receptor or a fragment thereof, an enzyme, a zymogen, an enzyme inhibitor, a coagulation factor, or protein with enzymatic activity.
3. The composition of claim 1, wherein said peptide of interest portion comprises at least a portion of human Apolipoprotein H.
4. The composition of claim 3, wherein said peptide of interest portion is able to specifically bind to anti-Apolipoprotein H antibodies (anti-2-glycoprotein-I antibodies).
5. The composition of claim 4, wherein said peptide of interest portion comprises, or consists of, at least a portion of Domain I of human Apolipoprotein H (ApoH).
6. The composition of claim 1, wherein said signal peptide comprises, or consists of, i) said hydrophobic region, ii) a charged region that is N-terminal of said hydrophobic region, and iii) a neutral region that is C-terminal of said hydrophobic region.
7. The composition of claim 6, wherein said charged region comprises at least two charged amino acids, and/or wherein said neutral region comprises at least two neutral amino acids.
8. The composition of claim 1, wherein said signal peptide comprises, or consists of, one of the following amino acid sequences: TABLE-US-00003 a) METDTLLLWVLLLWVPGST; (SEQIDNO:32) b) METDTLLLWVLLLWVPGS; (SEQIDNO:33) c) METDTLLLWVLLLWVPG; (SEQIDNO:34) d) METDTLLLWVLLLWVP; (SEQIDNO:35) and e) METDTLLLWVLLLW. (SEQIDNO:36)
9. The composition of claim 4, wherein Apolipoprotein H antibodies are from a patient with antiphospholipid syndrome.
10. The composition of claim 1, wherein said peptide of interest portion comprises at least a portion of Domain I of human ApoH, and wherein said at least a portion of Domain I of human ApoH comprises peptide sequence RGGMR (SEQ ID NO:30).
11. The composition of claim 1, wherein said peptide of interest portion comprises at least a portion of Domain I of human ApoH, and wherein said at least a portion of Domain I of human ApoH comprises peptide selected from SEQ ID NOS:3, 4, 5, and 22.
12. The composition of claim 1, wherein said peptide of interest portion comprises at least a portion of Domain V of human ApoH, and wherein said at least a portion of Domain V of human ApoH comprises peptide selected from SEQ ID NOS:23, 24, 25, and 29.
13. The composition of claim 1, wherein said peptide of interest portion comprises at least a portion of Domain I of human ApoH, and wherein said at least a portion of Domain I of human ApoH comprises the entire Domain I of human ApoH (SEQ ID NO:3) or SEQ ID NO:3 with one, two, or three conservative amino acid changes.
14. The composition of claim 1, wherein said peptide of interest portion comprises, or consists of: i) the human apolipoprotein H protein shown in SEQ ID NO:2 or 2) the protein shown in SEQ ID NO:2 with one, two, or three conservative amino acid changes.
15. The composition of claim 1, wherein said hydrophobic region comprises between eight and fifteen consecutive hydrophobic amino acids.
16. The composition of claim 1, wherein said at least seven hydrophobic amino acids are each independently selected from the group consisting of: alanine, valine, leucine, isoleucine, proline, phenylalanine, trypophane, cysteine and methionine.
17. The composition of claim 1, wherein said at least seven hydrophobic amino acids are each independently selected from the group consisting of: leucine, valine, proline, and trypophane.
18. The composition of claim 1, wherein said hydrophobic region comprises at least seven consecutive amino acids from LLLWVLLLVWP (SEQ ID NO:31).
19. The composition of claim 15, wherein said hydrophobic region does not contain any non-hydrophobic amino acids.
20. The composition of claim 15, wherein said hydrophobic region contains only hydrophobic amino acids.
21. The composition of claim 6, wherein said signal peptide portion comprises a methionine N-terminal of said charged region.
22. The composition of claim 6, wherein charged region is two to four amino acids in length.
23. The composition of claim 6, wherein said charged region comprises or consists of three or four charged amino acids.
24. The composition of claim 6, wherein said charged regions further comprises at least one neural-polar amino acid.
25. The composition of claim 6, wherein said at least two charged amino acids are aspartic acid and glutamic acid.
26. The composition of claim 6, wherein said at least two charged amino acids are independently selected from: lysine, arginine, histidine, aspartic acid and glutamic acid.
27. The composition of claim 6, wherein said neutral region comprises or consists of three neutral amino acids.
28. The composition of claim 1, wherein said at least two neutral amino acids comprises two or three neutral-polar amino acids.
29. The composition of claim 8, wherein said at least two neutral amino acid comprises at least one neutral-nonpolar amino acid and at least one neutral-polar amino acid.
30. The composition of claim 29, wherein at least one neutral-nonpolar amino acid is glycine.
31. The composition of claim 29, wherein at least one neutral-polar amino acid is selected from serine and threonine.
32. The composition of claim 1, wherein said non-natural peptide further comprises c) a cleavage site, wherein said cleavage site is located between said signal peptide portion and said peptide of interest portion.
33. A method of expressing a non-natural peptide comprising: culturing a cell containing an expression vector encoding a non-natural peptide such said non-natural peptide is expressed in, and exported from, said cell, wherein said non-natural peptide is as recited in any of claims 1-32.
34. The method of claim 33, wherein said signal peptide comprises, or consists of, i) said hydrophobic region, ii) a charged region that is N-terminal of said hydrophobic region, and iii) a neutral region that is C-terminal of said hydrophobic region.
35. The method of claim 34, wherein said charged region comprises at least two charged amino acids.
36. The method of claim 34, wherein said neutral region comprises at least two neutral amino acids.
37. The method of claim 33, further comprising: purifying said non-natural peptide that has been exported from said cell to generate a purified preparation.
38. The method of claim 33, wherein said non-natural peptide is exported from said cell at a level that is at least two times greater than when said expression vector encoding human Apolipoprotein H with natural signal peptide (SEQ ID NO:1) is employed instead of said non-natural peptide under identical conditions.
39. The method of claim 33, wherein said non-natural peptide is exported from said cell at a level that is at least four times greater than when said expression vector encoding human Apolipoprotein H with natural signal peptide (SEQ ID NO:1) is employed instead of said non-natural peptide under identical conditions.
40. The method of claim 33, wherein said peptide of interest portion comprises at least a portion of human Apolipoprotein H and is able to specifically bind to anti-Apolipoprotein H antibodies from a patient with antiphospholipid syndrome.
41. A method of detecting the presence or absence of anti-Apolipoprotein H antibodies (anti-2-glycoprotein-I antibodies) in a sample comprising: a) contacting a sample with a non-natural peptide, wherein said non-natural peptide specifically binds anti-Apolipoprotein H antibodies, if present, to form a complex, wherein said non-natural peptide comprises: i) a signal peptide portion comprising, or consisting of, a hydrophobic region comprising at least seven consecutive hydrophobic amino acids; and ii) a peptide of interest portion comprising, or consisting of, at least a portion of Domain I of human Apolipoprotein H (ApoH) and which is able to specifically bind to anti-Apolipoprotein H antibodies (anti-2-glycoprotein-I antibodies), and b) detecting the presence or absence of said complex in said sample.
42. The method of claim 41, wherein said signal peptide comprises, or consists of, A) said hydrophobic region, B) a charged region that is N-terminal of said hydrophobic region, and C) a neutral region that is C-terminal of said hydrophobic region.
43. The method of claim 42, wherein said charged region comprises at least two charged amino acids.
44. The method of claim 42, wherein said neutral region comprises at least two neutral amino acids.
45. The method of claim 41, wherein said detecting the presence or absence of said complex detects the presence of said complex, thereby indicating the presence of said anti-Apolipoprotein H antibodies in said sample.
46. The method of claim 41, wherein said detecting the presence or absence of said complex detects the absence of said complex, thereby indicating the absence of said anti-Apolipoprotein H antibodies in said sample.
47. The method of claim 41, wherein said non-natural peptide comprises a label.
48. The method of claim 47, further comprising contacting said sample with a solid support comprising moieties that bind said label.
49. The method of claim 48, further comprising incubating said sample under conditions such that: i) said non-natural peptide specifically binds said anti-Apolipoprotein H antibody to form a complex, and ii) said complex binds to said solid support via said label binding at least one of said moieties.
50. The method of claim 49, further comprising washing said solid support.
51. The method of claim 50, further comprising adding to said sample a detectably labeled secondary antibody capable of binding said Apolipoprotein H antibody in said complex.
52. The method of claim 44, wherein said sample is selected from the group consisting of: a blood sample, a serum sample, a plasma sample, and a urine sample.
53. The method of claim 44, wherein said peptide of interest portion is able to specifically bind to anti-Apolipoprotein H antibodies from a patient with antiphospholipid syndrome.
54. A method of detecting antiphospholipid syndrome in a subject comprising: a) contacting a sample from a subject suspected of containing a subject antibody to Apolipoprotein H (2GPI) with a non-natural peptide, wherein said non-natural peptide specifically binds said subject antibody to form a complex, wherein said non-natural peptide comprises: i) a signal peptide portion comprising, or consisting of, a hydrophobic region comprising at least seven consecutive hydrophobic amino acids; and ii) a peptide of interest portion comprising, or consisting of, at least a portion of Domain I of human Apolipoprotein H (ApoH), wherein said peptide of interest portion is able to specifically bind to anti-Apolipoprotein H antibodies (anti-(32-glycoprotein-I antibodies) from a patient with antiphospholipid syndrome, and b) detecting the presence of said complex, thereby detecting the presence antiphospholipid syndrome in said subject.
55. The method of claim 54, wherein said signal peptide comprises, or consists of: A) said hydrophobic region, B) a charged region that is N-terminal of said hydrophobic region, and C) a neutral region that is C-terminal of said hydrophobic region.
56. The method of claim 55, wherein said charged region comprises at least two charged amino acids.
57. The method of claim 55, wherein said neutral region comprises at least two neutral amino acids.
58. A kit or system comprising: a) composition comprising: a non-natural peptide, or nucleic acid sequence encoding said non-natural peptide, wherein said non-natural peptide comprises: i) a signal peptide portion comprising, or consisting of, a hydrophobic region comprising at least seven consecutive hydrophobic amino acids; and ii) a peptide of interest portion; and b) at least one of the following: i) cells, ii) a solid support, and iii) a detectable label.
59. The kit or system of claim 58, wherein said peptide of interest portion comprises a protein selected from: a therapeutic protein, an antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, an ScFv or fragment thereof, an Fc-fusion protein or fragment thereof, a growth factor or a fragment thereof, a cytokine or a fragment thereof, an extracellular domain of a cell surface receptor or a fragment thereof, an enzyme, a zymogen, an enzyme inhibitor, a coagulation factor, or protein with enzymatic activity.
60. The kit or system of claim 58, wherein said peptide of interest portion comprises at least a portion of human Apolipoprotein H.
61. The kit or system of claim 60, wherein said peptide of interest portion is able to specifically bind to anti-Apolipoprotein H antibodies (anti-2-glycoprotein-I antibodies).
62. The kit or system of claim 61, wherein said peptide of interest portion comprises, or consists of, at least a portion of Domain I of human Apolipoprotein H (ApoH).
63. The kit or system of claim 58, wherein said signal peptide comprises, or consists of: A) said hydrophobic region, B) a charged region that is N-terminal of said hydrophobic region, and C) a neutral region that is C-terminal of said hydrophobic region.
64. The kit or system of claim 63, wherein said charged region comprises at least two charged amino acids.
65. The kit or system of claim 63, wherein said neutral region comprises at least two neutral amino acids.
66. The kit or system of claim 58, wherein said peptide of interest portion is able to specifically bind to anti-Apolipoprotein H antibodies from a human patient with antiphospholipid syndrome.
67. A composition comprising: a) a signal peptide comprising or consisting of, a hydrophobic region comprising at least seven consecutive hydrophobic amino acids; and b) a peptide of interest portion, wherein said signal peptide is not attached to said peptide of interest portion.
68. The composition of claim 67, wherein said signal peptide comprises, or consists of: A) said hydrophobic region, B) a charged region that is N-terminal of said hydrophobic region, and C) a neutral region that is C-terminal of said hydrophobic region.
69. The composition of claim 68, wherein said charged region comprises at least two charged amino acids.
70. The composition of claim 68, wherein said neutral region comprises at least two neutral amino acids.
71. The composition of claim 67, wherein said peptide of interest portion is able to specifically bind to anti-Apolipoprotein H antibodies from a human patient with antiphospholipid syndrome.
72. A composition comprising a non-natural peptide, wherein said non-natural peptide comprises a signal peptide, and wherein said signal peptide comprises, or consists of, one of the following amino acid sequences: TABLE-US-00004 a) METDTLLLWVLLLWVPGST; (SEQIDNO:32) b) METDTLLLWVLLLWVPGS; (SEQIDNO:33) c) METDTLLLWVLLLWVPG; (SEQIDNO:34) d) METDTLLLWVLLLWVP; (SEQIDNO:35) and e) METDTLLLWVLLLW. (SEQIDNO:36)
73. The composition of claim 72, wherein said non-natural peptide further comprises a peptide of interest that is linked to said signal peptide.
74. The composition of claim 73, wherein said peptide of interest comprises at least a portion of human Apolipoprotein H.
Description
DESCRIPTION OF THE FIGURES
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION
[0042] Provided herein are compositions, systems, kits, and methods for expressing a peptide of interest, such as Apolipoprotein H (ApoH), also known as 2-glycoprotein I (2GPI), at increased levels using a non-ApoH signal peptide (e.g., a signal peptide that permits increased protein export from cells). Also provided herein are compositions, systems, kits, and methods for employing such recombinant ApoH with a non-ApoH signal peptide to detect subject Apolipoprotein H antibodies in a sample from a subject (e.g., to diagnose antiphospholipid syndrome in a subject).
[0043] Each of peptides shown in SEQ ID NOS:2-5, 7, 22-29, and 32-36 may be constructed with longer, shorter, or mutated versions thereof. For example, one could change one, two, three amino acids in these sequences. For example, one could make conservative changes to such amino acid sequences. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Exemplary conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine In certain embodiments, provided herein are peptides that have substantial identity (e.g., at least 95% identity) to the amino acid sequences shown in SEQ ID Nos:2-5, 7, 22-29, and 32-36. In certain embodiments, the following hydrophobic amino acids may be substituted for each other: glycine (Gly), alanine (Ala), valine (Val), leucine (Leu), isoleucine (Ile), proline (Pro), phenylalanine (Phe), methionine (Met), and tryptophan (Trp). In some embodiments, the following charged amino acids may be substituted for each other: Aspartic acid (Asp), Glutamic acid (Glu), Lysine (Lys), Arginine (Arg), and Histidine (His). In particular embodiments, the following positive-polar amino acids may be substituted for each other: Lysine (Lys), Arginine (Arg), and Histidine (His). In other embodiments, the following neutral-polar amino acids may be substituted for each other: Tyrosine (Tyr), Serine (Thr), Threonine (Thr), Asparagine (Asn), Glutamine (Gln), and Cysteine (Cys). In some embodiments, the following neutral-nonpolar amino acids may be substituted for each other: alanine (Ala), glycine (Gly), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), proline (Pro), and valine (Val).
[0044] Current anti-2GPI assays use plasma-derived 2GPI as the target for measuring anti-2GPI antibodies. This approach has many shortcomings, including: 1) the use of human plasma to obtain the protein, 2) the use of harsh conditions (perchloric acid precipitation, etc.) to isolate 2GPI, which results in protein oxidation and loss of conformation, 3) the time and expense required to obtain plasma, isolate and characterize the protein, and 4) potential impurities in a preparation of protein obtained from plasma. In contrast, the methods and compositions described herein have produced r2GPI with yields of >20 mg/liter, with only a gentle, heparin-sepharose purification step to isolate the protein from media (see Examples below). Overall, we estimate the cost of obtaining the recombinant protein to be approximately of that required to obtain the protein from plasma.
[0045] In addition, several studies have demonstrated that anti-2GPI antibodies reactive with domain 1 of 2GPI are more pathogenic that those against other parts of the proteins. Identification of such antibodies in patients will improve the ability to identify patients at highest risk of primary or recurrent thrombosis, as well as pregnancy loss. While a clinical assay (Innova) currently exists that measures antibodies to domain 1, this assay does not use intact 2GPI as a target.
[0046] The expression systems described herein allows for production of multiple forms of r2GPI including small versions of the protein such as isolated domain 1 (or other domains), domain deletion mutants or polypeptides containing scrambled domains or even pieces of other proteins substituted for specific 2GPI domains. Since each of the 5 domains of 2GPI is a sushi domain, a module present in many different proteins, one can swap in a related but non-homologous domain for any domain within 2GPI thought to be important to its function. Some examples of proteins that contain sushi domains include selectins, complement regulatory proteins, tissue factor pathway inhibitor, IL2-receptor, and many others. Specific substitutions would focus on domain 1, which contains the 2GPI epitope, domain 5, which is thought to mediate 2GPI binding to cells, and potentially other domains as well.
[0047] The use of a recombinant proteins containing at least part of domain 1 of human ApoH as a decoy for anti-2GPI antibodies in patients with APS could be used for treatment. While not limited to any particular mechanism, it is believed that anti-2GPI antibodies induce vascular activation by binding to cell-bound 2GPI domain 1 that is anchored to cells via binding through domain 5. Thus, free domain 1 (or fragments thereof) may bind anti-2GPI antibodies, preventing them from binding cell bound 2GPI. Likewise, recombinant 2GPI domain 5 may inhibit the binding of 2GPI to cells.
[0048] The 2GPI peptides produced by the methods described herein may be used in any type of suitable immunoassay. The present description is not limited by the type of immunoassay employed to detect patient antibodies in a sample. A number of exemplary formats are as follows. In an indirect assay, 2GPI peptide or protein is coated on solid phase (e.g., beads) and then contacted with a sample (e.g. 18 minutes), followed by a wash step. Then, in a second step, patient antibodies to 2GPI are detected by contacting the immune complex with labeled second antibody to detect human IgG (or IgM) bound to the solid phase (e.g. for 4 minutes). Another assay is a two-step direct (sandwich) assay. In this assay, 2GPI peptide or protein is coated on solid phase (e.g., beads) and contacted with sample (e.g. for about 18 minutes) and then washed. In a second step, antibodies to 2GPI are detected with a labeled 2GPI peptide/protein that binds to human IgG (or IgM) bound to the solid phase containing the 2GPI protein (e.g. for 4 minutes). A one-step direct (sandwich) assay could also be employed. In such an assay, 2GPI peptide or protein is coated on solid phase and contacted with sample (e.g., for about 18 minutes) and with labeled 2GPI peptide/protein at the same time or about the same time (e.g., for 18 minutes). Another type of assay is a solution phase capture. In such an assay, the sample is contacted with both protein tagged 2GPI peptide or protein (e.g., biotin tag, FLAG-tag, HA-tag, etc.) and labeled 2GPI peptide or protein in the presence of a solid phase coated with an affinity molecule (e.g., streptavidin or protein tag antibody). If the patient antibodies are present in the sample, the tagged peptide or protein and labeled 2GPI peptides or proteins can bind to patient antibodies in a complex that can be captured by the associated protein tag to a solid phase support. In all of these assay formats, the solid phase is further processed to elicit a signal from labeled 2GPI associated with patient antibodies and with the solid phase. Since the literature suggests that there exist lupus anticoagulants, detected using functional clotting assays that depend on either 2GPI or prothrombin for their activity, and that the 2GPI-dependent lupus anticoagulants are most important in predicting APS clinical events, the recombinant proteins described herein could also be used for more predictive clotting assays.
[0049] Notably, the 2GPI proteins are labeled with a detectable label or labeled with a specific partner that allows capture or detection. For example, the labels may be a detectable label, such as a fluorophore, radioactive moiety, enzyme, biotin/avidin label, chromophore, chemiluminescent label, or the like. Still further the invention contemplates the preparation of 2GPI diagnostic kits comprising the immunodiagnostic reagents described herein and instructions for the use of the immunodiagnostic reagents in immunoassays for determining the presence of 2GPI antibodies.
[0050] The immunoassays may be packaged into a kit. Any secondary antibodies, which are provided in the kit, such as anti-IgG antibodies and anti-IgM antibodies, can also incorporate a detectable label, such as a fluorophore, radioactive moiety, enzyme, biotin/avidin label, chromophore, chemiluminescent label, or the like, or the kit can include reagents for labeling the antibodies or reagents for detecting the antibodies (e.g., detection antibodies) and/or for labeling the analytes or reagents for detecting the analyte. The antibodies, calibrators and/or controls can be provided in separate containers or pre-dispensed into an appropriate assay format, for example, into microtiter plates. In certain immunoassays, there are two containers provided.
Optionally, the kit includes quality control components (for example, sensitivity panels, calibrators, and positive controls). Preparation of quality control reagents is well-known in the art and is described on insert sheets for a variety of immunodiagnostic products. Sensitivity panel members optionally are used to establish assay performance characteristics, and further optionally are useful indicators of the integrity of the immunoassay kit reagents, and the standardization of assays.
[0051] The kit can also optionally include other reagents required to conduct a diagnostic assay or facilitate quality control evaluations, such as buffers, salts, enzymes, enzyme co-factors, substrates, detection reagents, and the like. Other components, such as buffers and solutions for the isolation and/or treatment of a test sample (e.g., pretreatment reagents), also can be included in the kit. The kit can additionally include one or more other controls. One or more of the components of the kit can be lyophilized, in which case the kit can further comprise reagents suitable for the reconstitution of the lyophilized components. The various components of the kit optionally are provided in suitable containers as necessary, e.g., a microtiter plate. The kit can further include containers for holding or storing a sample (e.g., a container or cartridge for a sample). Where appropriate, the kit optionally also can contain reaction vessels, mixing vessels, and other components that facilitate the preparation of reagents or the test sample. The kit can also include one or more instrument for assisting with obtaining a test sample, such as a syringe, pipette, forceps, measured spoon, or the like.
[0052] In some embodiments, the detectable label is at least one acridinium compound. In such embodiments, the kit can comprise at least one acridinium-9carboxamide, at least one acridinium-9-carboxylate aryl ester, or any combination thereof. If the detectable label is at least one acridinium compound, the kit also can comprise a source of hydrogen peroxide, such as a buffer, solution, and/or at least one basic solution. It should be understood that in the immunodiagnostic reagent the antigens for antibody detection may be detectably labeled, and any antibodies provided in kit for use along with such reagents also may be detectably labeled. If desired, the kit can contain a solid support phase, such as a magnetic particle, bead, test tube, microtiter plate, cuvette, membrane, scaffolding molecule, film, filter paper, disc or chip.
[0053] The present disclosure provides immunoassays and combination immunoassays method for determining the presence, amount or concentration of anti-2GPI antibodies in a test sample. Any suitable assay known in the art can be used in such methods. Examples of such assays include, but are not limited to, immunoassay, such as sandwich immunoassay (e.g., monoclonal-polyclonal sandwich immunoassays, including radioisotope detection (radioimmunoassay (RIA)) and enzyme detection (enzyme immunoassay (EIA) or enzyme-linked immunosorbent assay (ELISA)(e.g., Quantikine ELISA assays, R&D Systems, Minneapolis, Minn.)), competitive inhibition immunoassay (e.g., forward and reverse), fluorescence polarization immunoassay (FPIA), enzyme multiplied immunoassay technique (EMIT), bioluminescence resonance energy transfer (BRET), and homogeneous chemiluminescent assay, etc.
[0054] Any suitable detectable label as is known in the art can be used as anyone or more of the detectable labels. For example, the detectable label can be a radioactive label (such as 3H, 125I, 35S, 14C, 32p, and 33p), an enzymatic label (such as horseradish peroxidase, alkaline peroxidase, glucose 6-phosphate dehydrogenase, and the like), a chemiluminescent label (such as acridinium esters, thioesters, orsulfonamides; luminol, isoluminol, phenanthridinium esters, and the like), a fluorescentlabel (such as fluorescein (e.g., 5-fluorescein, 6-carboxyfluorescein, 36-carboxyfluorescein, 5(6)-carboxyfluorescein, 6-hexachloro-fluorescein, 6-tetrachlorofluorescein, fluorescein isothiocyanate, and the like)), rhodamine, phycobiliproteins, R-phycoerythrin, quantum dots (e.g., zinc sulfide-capped cadmiumselenide), a thermometric label, or an immuno-polymerase chain reaction label. An introduction to labels, labeling procedures and detection of labels is found in Polak andVan Noorden, Introduction to Immunocytochemistry, 2nd ed., Springer Verlag, N.Y.(1997), and in Haugland, Handbook of Fluorescent Probes and Research Chemicals(1996), which is a combined handbook and catalogue published by Molecular Probes, Inc., Eugene, Oreg. A fluorescent label can be used in FPIA (see, e.g., U.S. Pat. Nos. 5,593,896, 5,573,904, 5,496,925, 5,359,093, and 5,352,803, which are hereby incorporated by reference in their entireties). An acridinium compound can be used as a detectable label in a homogeneous chemiluminescent assay (see, e.g., Adamczyk et al., Bioorg. Med. Chem. Lett. 16: 1324-1328 (2006); Adamczyk et al., Bioorg. Med. Chem. Lett. 4: 2313-2317 (2004); Adamczyk et al., Biorg. Med. Chem. Lett. 14: 39173921(2004); and Adamczyk et al., Org. Lett. 5: 3779-3782 (2003)).
EXAMPLES
Example 1
[0055] 2-glycoprotein I (2GPI), also known as Apolipoprotein H (ApoH), is the primary antigen for antiphospholipid antibodies (Ab), and Ab to 2GPI are associated with thrombosis and recurrent fetal loss. 2GPI is comprised of 5 sushi domains. Complex disulfide bonding renders 2GPI a challenging protein to produce recombinantly in high yield and most studies have utilized domain-deletion mutants produced on a lab scale for structure-function analyses. 2GPI also has a complex tertiary structure, and is reported to circulate in a circular form that may open to expose the antigenic site for 2GPI Ab under specific conditions. This Examples describes new methods to produce recombinant 2GPI in which replacement of the leader (signal) peptide allows large scale expression using a lentiviral system with one-step purification on heparin-sepharose. The ability of this protein to bind anti-2GPI Ab was compared with that of plasma-derived (wild type, WT) 2GPI.
Methods
[0056] 2GPI cDNA was cloned into pLenti CMV DEST. The 2GPI containing vector was used to transduce HEK293 cells with selection using puromycin. 2GPI was purified from conditioned medium using HiTrap Heparin HP. Plasma 2GPI was purified using a protocol employing perchloric acid precipitation followed by heparinsepharose and Mono-S chromatography.
[0057] To measure anti-2GPI Ab, we analyzed plasma from 32 patients referred to the Cleveland Clinic Special Coagulation Laboratory for anti-2GPI testing using the Inova Quanta-Lite ELISA. Normal plasma samples (n=15) were also analyzed at 1:100 dilution to determine cutoffs for anti-2GPI positivity. Briefly, 96-well plates were coated overnight at 4 C. with 2 ug/ml WT or recombinant 2GPI. After blocking 2GPI-coated plates with BSA, 50 ul of patient plasma at 1:10 and 1:100 dilutions were added to individual wells in quadruplicate. A standard curve for IgG binding to each plate was created using affinity-purified rabbit anti-2GPI IgG at concentrations of 15, 31.25, 62.5, 125, and 250 ng/ml. After incubation for 30 minutes at room temperature, plates were washed three times and 100 ul of a 1:5000 dilution of goat anti-human IgG was added. After 30 minutes, wells were again washed prior to adding 100 ul/well of a-phenylenediamine dihydrochloride. Plates were read at 490 nm after 15 minutes following addition of 25 ul/well H.sub.2SO.sub.4. Results from different plates were standardized by extrapolating the amount of bound Ab from the standard curve prepared on each plate.
[0058] To compare performance of recombinant 2GPI against WT 2GPI in ELISA we first evaluated correlation using recombinant and WT 2GPI by Spearman's test. The two sets of ELISAs were also compared using the Wilcoxon matched pairs test. ELISA readings were considered positive if they were >90th percentile on a curve established using 15 normal plasmas. Sensitivity and specificity of the assays was determined with respect to the results of the clinical assay.
Results
[0059] Recombinant 2GPI was produced in high yield (10-20 mg/L) and purified to homogeneity with a single heparin chromatography step. The purified protein migrated as a single band of 50 kD on SDS-PAGE with a characteristic increase in M.sub.r upon reduction. Anti-2GPI IgG ELISA using WT and recombinant 2GPI demonstrated excellent correlation at both 1:10(Spearman's rho 0.70, P<0.001) and 1:100 dilution (Spearman rho 0.727, p<0.001) (
[0060] This Example demonstrates that recombinant 2GPI can be produced in high yield by this method and purified with a single heparin chromatography step. It is recognized by anti-2GPI Ab at least as well as WT 2GPI.
Example 2
[0061] This Example describes a method of recombinant 2GPI (r2GPI) production that yields approximately 20 mg/liter of protein at low cost. This recombinant protein may be purified by a single heparin affinity-chromatography step, avoiding the harsh conditions needed to purify 2GPI from plasma. Initial works indicates that we can also produce r2GPI in which important antigenic sites recognized by pathogenic antibodies have been changed by site-directed mutagenesis. The use of r2GPI allows superior standardization and reproducibility compared to plasma 2GPI since the properties of the latter may be affected by purification methods, altered glycosylation among plasma donors, and other variables.
[0062] We have developed a new strategy for production of r2GPI in human cells. This product could largely replace plasma-derived 2GPI in clinical ELISAs. Moreover, there is also an undeveloped market for the sale of 2GPI, which is used for research purposes, as well as development of additional clinical assays such as measurement of 2GPI-dependent lupus anticoagulants. The technology is ready for immediate use.
[0063] 2GPI was produced in mammalian cells and purified using single step heparin-superose chromatography. Yield of 10-20 mg/liter are routinely obtained, though purification conditions could be further optimized.
[0064] To determine whether r2GPI is recognized by anti-2GPI antibodies, we immunized rabbits with purified, human plasma 2GPI and affinity purified IgG on the same material. We then compared the ability of these purified rabbit antihuman anti-2GPI antibodies to bind natural and r2GPI in a linear, concentration-dependent manner. As shown in
[0065] Finally, we tested the binding of IgG from 5 serum samples from patients with anti-2GPI antibodies and 5 normal, healthy controls without such antibodies to ELISA plates coated with natural or recombinant 2GPI. In all cases, samples were tested at 1:5, 1:10 and 1:100 dilutions using standard procedures. Binding activity of IgG from the samples was converted to ng/ml of anti-2GPI using the rabbit anti-2GPI-derived standard curve after correction for sample dilution. The results of these studies are shown in Table 1.
TABLE-US-00001 TABLE 1 ELISA of normal and patient sera for antibodies to plasma or 2GPI Serum dilution 1:5 1:10 1:100 Anti-2GPI level APS-1 394 709 3069 (ng/ml) [Plasma 328 675 5439 2GPI/recombinant 2GPI coating] APS-2 3 1 ND 126 295 484 APS-3 210 ND
147 154 APS-8 9 81 97 69 82 ND APS-18 156 229 191 237 440 1852 N-27 21 28 163 37 ND N-28 ND ND N-29 ND ND N-30 ND 101 N-31 41 7 ND 30 ND
indicates data missing or illegible when filed
Review of this table demonstrates that greater amounts of 2GPI were detected in wells coated with recombinant 2GPI in 4 of 5 patient (APS) sera tested. The largest differences were observed at serum dilutions of 1:100, which are used in many commercially available ELISAs. Moreover, the background binding of IgG from normal controls (N) was generally equal or lower to recombinant 2GPI than to plasma 2GPI.
[0066] Taken together, these findings suggest that recombinant 2GPI is recognized at least as well, if not better, than anti-2GPI antibodies. Moreover, this reagent offers consistency, reproducibility, and overall better options for standardization compared to plasma 2GPI. With the possibility of cost savings due to a much simpler production and purification scheme, we believe that recombinant 2GPI provides a new option for clinical anti-2GPI antibody assays.
Example 3
APOH Expression, Characterization and Use as a Diagnostic and Investigative Tool in Patients with Antiphospholipid Antibody Syndrome
[0067] This Example describes further characterization of ApoH expression systems (e.g., as described in the Examples above).
I. Cloning and Expression of APOH cDNA
[0068] A. APOH cDNA Containing a Native Signal Peptide is Expressed but not Secreted
[0069] Previous attempts to express APOH in bacterial and insect cell systems were unsuccessful. Therefore, the native APOH cDNA (containing the native signal peptide; see
[0070] B. Modification of the APOH Signal Peptide Leads to Efficient Secretion
[0071] A known consensus sequence for a secretory signal peptide is characterized by the presence of three discrete regions within the peptide sequence (see, SAFC/Sigma Aldrich, Mascarenhas et al., Signal Peptide Optimization: Effect On Recombinant Monoclonal IgG Productivity, Product Quality And Antigen-Binding Affinity; 2009, herein incorporated by reference in its entirety). These include an N-terminal charged region of approximately 4 amino acids, a middle region containing 10-12 hydrophobic amino acids, and a C-terminal region of 3-4 polar amino acids with a net negative charge (see,
[0072] C. Cloning of APOH cDNA into Lentiviral Vectors
[0073] Human Apolipoprotein H (APOH) ORF clone in a pCMV6-Entry vector with a Myc-DDK-tag was purchased from OriGene Technologies (Rockvile, Md.; Catalogue # RC205017). Full length cDNA was amplified using forward primer: 5CACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAG GTTCCACTGGTCGGACCTGTCCCAAGCCAG3 (SEQ ID NO:15) and reverse primer: 5TTAGCATGGCTTTACATCGGATGCATCAGTTTTCCAAAAAGCCAGAGAACTGTG TTCCTTGAAGCATTTG3 (SEQ ID NO:16) with no tag and a native stop codon. The sequence of the forward primer includes the sequence encoding the mutant signal peptide (ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCC ACT; SEQ ID NO:17) that replaced the native APOH signal peptide. In two constructs, we also performed site-directed mutagenesis to replace specific amino acids thought to be of importance in recognition of 2-glycoprotein I by pathogenic antiphospholipid antibodies (
[0074] Amplified cDNA was sub-cloned into the pENTR Directional TOPO cloning vector (Invitrogen, Catalogue # K2400-20, Carlsbad, Calif., USA). Upon confirmation of the correct DNA sequence, plasmid clone pENTR-spmAPOH-WT (
[0075] D. Lentivirus Production
[0076] Lentivirus was produced using the Lentiviral Gateway Expression kit (Life Technologies, Carlsbad, Calif., USA). Twelve million GP2-293 (HEK) cells were seeded in 15 cm.sup.2 plates with growth medium using 10% calf serum without antibiotics and grown overnight. Growth media was removed and replaced with Opti-MEM with reduced serum, and cells were cotransfected with 9 g each of pLP1, pLP2, pVSVG, and pDEST-APOH-WT/SEGVG/AAGMA plasmid DNA using 150 l of Lipofectamine 2000 (Thermo Fisher Scientific, Catalogue #11668019, Waltham, Mass., USA). Three days later, the supernatant was collected, centrifuged to remove cell debris and concentrated using a Lenti-X concentrator (Clontech Laboratories, Catalogue #631231, Mountain View, Calif., USA) according to the manufacturer's recommendations. The lentivirus pellet was resuspended in PBS and stored at 80 C. until further use.
[0077] E. Generation of Stable Cell Lines
[0078] HEK-293F cells were transduced with APOH lentiviral vectors in the presence of 5 g/ml polybrene according to standard procedures. Briefly, 24 after treating cells with lentivirus, media was replaced with DMEM media containing 10% FBS and penicillin and streptomycin. After reaching confluence, cells were split 1:5 and grown in DMEM containing 10% FBS and selected against 2 g/ml puromycin for 4 to 5 passages. Puromycin resistant cells expressing recombinant apoH were isolated as stable cell lines.
[0079] F. Recombinant Protein Expression and Purification
[0080] Stable cells lines were grown and expanded in DMEM containing 5% FBS and 2 g/ml puromycin. Cells were transferred to EX-CELL 293 serum free media (Sigma, St. Louis, Mo.; catalogue #14571C) and grown as suspension culture in Optimum Growth 1.6 L Flasks (Fisher Scientific; Waltham, Mass.; Catalogue # NC0768461) at a density of 1.4cells/ml on an orbital shaker rotating at 150 rpm, for 4 to 5 days. Cells were harvested by centrifugation at 5000 rpm for 10 min and secreted 2GPI present in cell culture supernatant was collected and filtered through a 0.2 M filter. Filtered supernatant was concentrated using Centricon Plus-70 filter units and the medium was exchanged for buffer A (0.1 M Tris-HCl pH 7.8; 30 mM NaCl). Fifty milliliters of concentrated, buffer-exchanged cell culture supernatant was loaded onto a 5 ml heparin Hi-Trap column using a GE FPLC system, and protein eluted using a 10-50% NaCl gradient. Fractions within the peak containing 2GPI were run on 10% SDS-PAGE and stained using coomassie brilliant blue. Fractions containing pure 2GPI were pooled.
II. Isolation of Anti-2GPI Antibodies
[0081] A. Affinity Purification of Patient-Derived Anti-2GPI Antibodies
[0082] Serum from patients with antiphospholipid antibody syndrome (APS) was dialyzed overnight against 20 mM potassium phosphate buffer, pH 7.0, and incubated with Affigel-immobilized 2GPI in a 10 ml column with affinity column with end-over-end rotation overnight at 4 C. The column was washed with 100 ml 20 mM potassium phosphate buffer, pH 7.0. Bound anti-2GPI antibodies were eluted in 1 ml fractions using 0.1 M citrate buffer pH 3.4 and collected in Eppendorf tubes containing neutralization buffer (1 M Tris-HCl, pH 9.0).
[0083] B. Fractionation of Anti-2GPI-IgG from Total Anti-2GPI Antibodies
[0084] Fractions containing anti-2GPI antibodies (IgG, IgA, IgM) were pooled and diluted with 20 mM potassium phosphate buffer pH 7.0 and passed through a Protein-G column. The column was washed with 20 volumes of 20 mM potassium phosphate buffer pH 7.0 and eluted in 1 ml fractions with 0.1 M Glycine, pH 2.4, into eppendorf tubes containing neutralization buffer (1 M Tris-Cl, pH 9.0).
[0085] C. Anti-2GPI-ELISA
[0086] High binding ELISA plates were coated with 5 g/ml 2GPI for 1 hour at 37 C. and non-specific binding blocked using 0.2% BSA for 1 hour at 37 C. 2GPI for these studies was either plasma-derived or recombinant (r2GPI); the recombinant 2GPI was from the spmAPOH-WT or spmAPOH-SEGVG vectors. After wells were coated with 2GPI, they were washed once with wash buffer (PBST, 0.05% tween-20). Anti-2GPI antibodies (1 g/ul) were diluted 1:50; 1:500; 1:1000; 1:5000 and 1:10,000 and 50 ul of diluted antibody was added to microplate wells and incubated at 37 C. for 30 minutes, followed by 3 washes with wash buffer. HRP-conjugated goat-anti-human/rabbit IgG was then added to wells and incubated at 37 C. for 30 minutes followed by 3 additional washes with wash buffer. Secondary antibody binding was detected by incubating wells with OPD solution (0.4 mg/ml in 50 mM phosphate citrate buffer) at room temperature for 10 mM, and the reaction stopped using 1N H2SO4 followed by detection at 490 nm.
III. Binding of Anti-2GPI Antibodies to Plasma and Recombinant WT 2GPI
[0087] A. Comparison of Binding to Plasma-Derived and Recombinant 2GPI
[0088] The binding of patient derived anti-2GPI antibodies to plasma derived 2GPI and recombinant WT 2GPI was initially characterized using the 2GPI-ELISA described above. Equivalent binding of antibodies to the recombinant and plasma-derived protein was observed (
[0089] B. Recognition of r2GPI-WT by Plasma from Patients Undergoing Testing for Anti-2GPI Antibodies
[0090] To assess the interaction of anti-2GPI antibodies in plasma with plasma-purified and recombinant 2GPI, we analyzed plasma from 32 patients referred to the Cleveland Clinic Special Coagulation Laboratory for anti-2GPI testing using the Inova Quanta-Lite ELISA. Normal plasma samples (n=15) were also analyzed at 1:100 dilution to determine cutoffs for anti-2GPI positivity. Briefly, 96-well plates were coated overnight at 4 C. with 2 ug/ml plasma-purified or recombinant 2GPI. After blocking 2GPI-coated plates with BSA, 50 ul of patient plasma at 1:10 and 1:100 dilutions were added to individual wells in quadruplicate. Results from different plates were standardized by extrapolating the amount of bound Ab from a standard curve prepared on each plate.
[0091] To compare performance of recombinant 2GPI versus plasma-purified 2GPI in the ELISA we first evaluated the correlation using Spearman's test. The results of the two ELISAs were also compared using the Wilcoxon matched pairs test. ELISA readings were considered positive if they were >90.sup.th percentile on a curve established using 15 normal plasma samples. Sensitivity and specificity of the assays was determined with respect to the results of the clinical assay.
[0092] The anti-2GPI IgG ELISA using plasma purified and recombinant 2GPI demonstrated excellent correlation at both 1:10 (Spearman's rho 0.70, P<0.001) and 1:100 dilution (Spearman rho 0.727, p<0.001) (
[0093] C. Binding of Antibodies to Recombinant 2GPI-WT and 12GPI-SEGVG
[0094] The binding of affinity-purified anti-2GPI antibodies to recombinant 2GPI-WT and r2GPI-SEGVG was characterized using the 2GPI-ELISA described above. These studies demonstrated significantly greater binding of anti-2GPI antibodies to r2GPI-WT protein compared to r2GPI-SEGVG (
[0095] To exclude the possibility that these results might reflect major conformational changes in the mutant protein, we performed identical studies using polyclonal rabbit anti-2GPI antibodies raised against human 2GPI that are not expected to be domain 1 specific. Though minor differences in binding of the rabbit antibody to r2GPI-WT and r2GPI-SEGVG were observed at very high antibody dilutions, we generally observed very little differences in binding of these antibodies to the two proteins (
[0096] D. Biosensor Analysis
[0097] To obtain a more detailed understanding of the interactions between patient-derived antibodies and recombinant 2GPI, we used biosensor analysis. Briefly, 2GPI was linked to carboxymethylated dextran coated CMS sensor chips using amine coupling in the presence of 1.0 M acetate buffer, pH 5.0. Four flow channels were coated with plasma derived-2GPI, r2GPI-WT and r2GPI-SEGVG, respectively, with the additional channel used as control for comparison. 2GPI-coated channels were coupled to the chip in sufficient mass to cause a change of 1500 to 2000 Resonance Units (RU). Anti-2GPI antibodies at concentrations ranging from 1-15,000 nM, were flowed through channels at the rate of 30 l/minute for 3 min in the presence of running buffer (20 mmol/L HEPES, pH 7.4, supplemented with 300 mmol/L NaCl, 0.2% Tween-20 and 0.1% human serum albumin) After equilibrium binding was achieved, we assessed dissociation over a 10 minute interval. After dissociation, the sensor chip was regenerated using 10 ul of 50 mM Glycine-NaOH buffer containing 0.5% Triton X-100, pH 12.0, followed by 10 ul of 10 mM Glycine, pH 1.7. The BIAevelaution program (Biacore 3.0.1) was used to calculate association and dissociation rates to determine kinetic parameters of binding.
[0098] As with ELISAs, to determine that the SEGVG mutation did not cause a global change in 2GP conformation, we measured the binding of a polyclonal rabbit-anti-2GPI antibody to r2GPI-WT and r2GPI-SEGVG using this approach. Unlike patient derived anti-2GPI antibodies, the polyclonal rabbit antibody recognized all forms of 2GPI with similar affinity although the Rmax was slightly decreased for the SEGVG mutant (
TABLE-US-00002 TABLE 2 Binding of anti-2GPI antibodies to plasma, and recombinant wild-type and SEGVG mutant 2GPI Plasma 2GPI r2GPI-WT r2GPI-SEGVG Sample KD (M) Rmax KD (M) Rmax KD (M) Rmax Rabbit-anti-2GPI (IgG) 7.03 10.sup.8 2970 7.8 10.sup.8 4360 5.06 10.sup.9 2120 APS-21-anti-2GPI (IgG) 1.18 10.sup.8 509 2.08 10.sup.8 768 4.94 10.sup.6 56.3 Human IgG isotype control ND No binding ND No binding ND No binding
[0099] Taken together, this data demonstrates the following: 1) recombinant 2GPI is recognized as well as plasma 2GPI by affinity-purified human anti-2GPI IgG, 2) the 2GPI mutant SEGVG is recognized with approximately 100-fold less affinity by human APS anti-2GPI IgG, 3) plasma-derived and recombinant WT and mutant 2GPI are recognized equally well by a rabbit polyclonal anti-2GPI antibody, suggesting that the conformation of the mutant is similar to that of the wild-type protein and that all domains are appropriately presented for binding. These conclusions demonstrate, for example, that the recombinant 2GPI provides a suitable substrate for diagnostic assays to distinguish domain 1-dependent vs non-domain 1-dependent binding of human APS IgG to 2GPI, and thus to identify the most pathogenic APS IgG antibodies. Moreover, this recombinant 2GPI can be expressed in high quantities, is easily purified, and provides a potentially-important tool for research studies focused on the role of anti-2GPI antibodies in APS.
[0100] E. Binding of Monoclonal Anti-2GPI Antibodies to Plasma, r2GPI-WT and r2GPI-SEGVG
[0101] Several human monoclonal antibodies to 2GPI have been developed. Whether these are representative of anti-2GPI antibodies from APS patients is unknown. Nevertheless, they provide additional information concerning the utility of r2GPI. The specificity of these antibodies has not been thoroughly studied. Binding of two such antibodies, B-1 and IS-6, is depicted in
[0102] All publications and patents mentioned in the specification and/or listed below are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope described herein.